Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-000079


Query

>20030531C-000079 (20030531C-000079) 20030531C-000079
CTGCTCCCCT AAAGGCAGCT TTGACTGCGT GGGGGTATTT CCAGCTTTGT
GGCTTTCACT TCCACTTCTC CCAGGTGGGC GGAGTGGCCT CCTGTGGACG
AATCAGATTG CTCCTCCGCC CCAACTTCAG GAGGCGAGCC CGGGGCTTGG
GGTCCCAGAC GTGCCGCCGC CGCCGCCACA GCAGCATCCG CAGCAGCAGC
AGCAGCAGGA CGACTAGGAA AGACCCCAGG CCAGAACCAT GGAGGACCAG
CGCGACCTCA TCTCCAACCA TGAGCAGCTG CCCATGCTGG GCCAGCGCCC
CGGGGCCCCC GAGAGCAAGT GCAGCCGTGG AGCTCTGTAC ACAGGCTTTT
CTGTCCTGGT GGCTCTGCTC CTGGCTGGCC AGGCCACCAC CGCCTACTTC
CTGTACCAGC AGCAGGGCCG GCTGGACAAG CTGACGGTCA CCTCTCAGAA
CTTGCAGCTG GAGAGCCTGC GGATGAAGCT TCCCAAGCCC TCCAAGCCTT
TGAGCAAGAT GCGGGTTTCC GCCCCCATGC TGATGCAGGC CCTGCCCATG
GAAGGCCCGG AGCCTATGCG CAACGCCACC AAGTACGGCA ACATGACCCA
GGACCACGTG ATGCACCTGC TCCTGAAGTC TGACCCCCTG GGAGTGTACC
CGAAGCTGAA GGGGAGCCTC CCAGAAAACC TGAAGCACCT CAAGAACACC
ATGGACGGTG TGAACTGGAA GCTCTTTGAG AACTGGCTGC GTCAGTGGCT
CTTGTTTGAA ATGAGCAAGA ACTCGCTGGA GGAGACACCC TTTGAGGTTC
CGCCAAAAGA CCCACTGGAG ACGGAGGACC TGTCGTCCGG GCTGGGCGTG
ACCAAGCAGG ATCTCGGCCA AGTCATCCTG TAAGAGCAGC AGACGCCAGC
CCCCAGCCCT GCGTGGCCAC AGCTTGCCTG CCCCCCACCC TCCCTGCCGC
CCCCACCTGC ACCTCATCCC ATGGGCCTCT GGCACCTGGC TCGCCGTCCT
CCCTGGACAC CTCACGTCTC TTCAGAAGGC CAAGGATGAA CGACACAGGG
AGGCCCTGCT GCCCACAGCT CCATCCGCTA GCAGGGACAC AGGGCCCCCG
GGGACAGCCC GTGAGCGGGG CTGGTGCCAC TCCTGACACC TTGAGCTCCA
CATGGCG

Search to ncbiHGDS database

Query= 20030531C-000079 (20030531C-000079) 20030531C-000079
         (1157 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22052760|ref|NT_006859.10|Hs5_7016 Homo sapiens chromosome 5...   252  4e-64
Alignment   gi|22067932|ref|NT_010505.10|Hs16_10662 Homo sapiens chromosome...    44  0.17
Alignment   gi|22053857|ref|NT_009799.10|Hs13_9956 Homo sapiens chromosome ...    44  0.17
Alignment   gi|22046238|ref|NT_034885.1|Hs7_35047 Homo sapiens chromosome 7...    42  0.67
Alignment   gi|22066268|ref|NT_035428.1|Hs17_35590 Homo sapiens chromosome ...    42  0.67
Alignment   gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome ...    42  0.67
Alignment   gi|22050462|ref|NT_008218.10|Hs8_8375 Homo sapiens chromosome 8...    40  2.7
Alignment   gi|22040966|ref|NT_022393.11|Hs3_22549 Homo sapiens chromosome ...    40  2.7
Alignment   gi|22045752|ref|NT_005417.9|Hs2_5574 Homo sapiens chromosome 2 ...    40  2.7
Alignment   gi|22056598|ref|NT_024654.12|Hs15_24810 Homo sapiens chromosome...    40  2.7
Alignment   gi|22065966|ref|NT_009151.12|Hs11_9308 Homo sapiens chromosome ...    40  2.7
Alignment   gi|22064341|ref|NT_033927.2|Hs11_34082 Homo sapiens chromosome ...    40  2.7


>gi|22052760|ref|NT_006859.10|Hs5_7016 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 5276488

 Score =  252 bits (127), Expect = 4e-64
 Identities = 163/175 (93%)
 Strand = Plus / Minus


Query: 314     agcaagtgcagccgtggagctctgtacacaggcttttctgtcctggtggctctgctcctg 373
               |||||||||||||| ||||| |||||||||||||||||  |||||||| ||||||||||
Sbjct: 2848438 agcaagtgcagccgcggagccctgtacacaggcttttccatcctggtgactctgctcctc 2848379


Query: 374     gctggccaggccaccaccgcctacttcctgtaccagcagcagggccggctggacaagctg 433
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2848378 gctggccaggccaccaccgcctacttcctgtaccagcagcagggccggctggacaaactg 2848319


Query: 434     acggtcacctctcagaacttgcagctggagagcctgcggatgaagcttcccaagc 488
               || |||||||| |||||| |||||||||||| |||||| ||||||||||||||||
Sbjct: 2848318 acagtcacctcccagaacctgcagctggagaacctgcgcatgaagcttcccaagc 2848264


 Score =  105 bits (53), Expect = 5e-20
 Identities = 111/129 (86%), Gaps = 1/129 (0%)
 Strand = Plus / Minus


Query: 32      ggggtatttccagc-tttgtggctttcacttccacttctcccaggtgggcggagtggcct 90
               |||||||||||||| ||||| |||||||||||||| ||| ||| ||||||||||||||||
Sbjct: 2853989 ggggtatttccagcctttgtagctttcacttccacatctaccaagtgggcggagtggcct 2853930


Query: 91      cctgtggacgaatcagattgctcctccgccccaacttcaggaggcgagcccggggcttgg 150
                |||||||||||||||||| |||  | || || |||| | |||||||||| |||| |  |
Sbjct: 2853929 tctgtggacgaatcagattcctctccagcaccgactttaagaggcgagccggggggtcag 2853870


Query: 151     ggtcccaga 159
               |||||||||
Sbjct: 2853869 ggtcccaga 2853861


 Score = 99.6 bits (50), Expect = 3e-18
 Identities = 71/78 (91%)
 Strand = Plus / Minus


Query: 238     catggaggaccagcgcgacctcatctccaaccatgagcagctgcccatgctgggccagcg 297
               |||||| |||||||||||||| ||||||||| ||||||| |||||||||||||||| |||
Sbjct: 2853814 catggatgaccagcgcgaccttatctccaacaatgagcaactgcccatgctgggccggcg 2853755


Query: 298     ccccggggcccccgagag 315
               ||| |||||||| |||||
Sbjct: 2853754 ccctggggccccggagag 2853737


 Score = 65.9 bits (33), Expect = 5e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus


Query: 575     gccaccaagtacggcaacatgacccaggaccacgtgatgcacctgctcc 623
               ||||||||||| |||||||||||  ||||||| ||||||||||||||||
Sbjct: 2847421 gccaccaagtatggcaacatgacagaggaccatgtgatgcacctgctcc 2847373


 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 64/76 (84%)
 Strand = Plus / Minus


Query: 630     ctgaccccctgggagtgtacccgaagctgaaggggagcctcccagaaaacctgaagcacc 689
               |||||||||||   |||||||||   |||||||||||| |||| || |||||||  ||||
Sbjct: 2846288 ctgaccccctgaaggtgtacccgccactgaaggggagcttcccggagaacctgagacacc 2846229


Query: 690     tcaagaacaccatgga 705
               | ||||||||||||||
Sbjct: 2846228 ttaagaacaccatgga 2846213


 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus


Query: 823     ggaggacctgtcgtccgggctgggcgtgaccaagcaggatctcggcc 869
               |||||||| ||| || |||||||| ||||||||||||||||| ||||
Sbjct: 2843724 ggaggacccgtcttctgggctgggtgtgaccaagcaggatctgggcc 2843678


 Score = 48.1 bits (24), Expect = 0.011
 Identities = 51/60 (85%)
 Strand = Plus / Minus


Query: 492     ccaagcctttgagcaagatgcgggtttccgcccccatgctgatgcaggccctgcccatgg 551
               |||||||| |||||||||||||  |  || ||||  ||||||||||||| ||||||||||
Sbjct: 2848069 ccaagcctgtgagcaagatgcgcatggccaccccgctgctgatgcaggcgctgcccatgg 2848010


 Score = 42.1 bits (21), Expect = 0.67
 Identities = 39/45 (86%)
 Strand = Plus / Minus


Query: 723     tctttgagaactggctgcgtcagtggctcttgtttgaaatgagca 767
               ||||||||| |||| |||  || |||||| |||||||||||||||
Sbjct: 2845878 tctttgagagctggatgcaccattggctcctgtttgaaatgagca 2845834



>gi|22067932|ref|NT_010505.10|Hs16_10662 Homo sapiens chromosome 16
               reference genomic contig
          Length = 3364278

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 356     ctggtggctctgctcctggctg 377
               ||||||||||||||||||||||
Sbjct: 1571974 ctggtggctctgctcctggctg 1571995



>gi|22053857|ref|NT_009799.10|Hs13_9956 Homo sapiens chromosome 13 reference
               genomic contig
          Length = 12392129

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 603     accacgtgatgcacctgctcct 624
               ||||||||||||||||||||||
Sbjct: 4808018 accacgtgatgcacctgctcct 4808039



>gi|22046238|ref|NT_034885.1|Hs7_35047 Homo sapiens chromosome 7 reference
              genomic contig
          Length = 674951

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 603    accacgtgatgcacctgctcc 623
              |||||||||||||||||||||
Sbjct: 158709 accacgtgatgcacctgctcc 158689



>gi|22066268|ref|NT_035428.1|Hs17_35590 Homo sapiens chromosome 17
              reference genomic contig
          Length = 1778592

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 726    ttgagaactggctgcgtcagt 746
              |||||||||||||||||||||
Sbjct: 981014 ttgagaactggctgcgtcagt 980994



>gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome 12 reference
               genomic contig
          Length = 3995937

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 732     actggctgcgtcagtggctcttgtt 756
               |||||||||||||| ||||||||||
Sbjct: 1031964 actggctgcgtcagaggctcttgtt 1031988



>gi|22050462|ref|NT_008218.10|Hs8_8375 Homo sapiens chromosome 8 reference
              genomic contig
          Length = 2346729

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 217    ggaaagaccccaggccagaaccat 240
              |||||||| |||||||||||||||
Sbjct: 121934 ggaaagacaccaggccagaaccat 121911



>gi|22040966|ref|NT_022393.11|Hs3_22549 Homo sapiens chromosome 3
              reference genomic contig
          Length = 1886886

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 749    ctcttgtttgaaatgagcaagaac 772
              ||||||||||||||||||| ||||
Sbjct: 182169 ctcttgtttgaaatgagcatgaac 182146



>gi|22045752|ref|NT_005417.9|Hs2_5574 Homo sapiens chromosome 2 reference
              genomic contig
          Length = 1194534

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 603    accacgtgatgcacctgctc 622
              ||||||||||||||||||||
Sbjct: 554822 accacgtgatgcacctgctc 554803



>gi|22056598|ref|NT_024654.12|Hs15_24810 Homo sapiens chromosome 15
               reference genomic contig
          Length = 4216983

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 33      gggtatttccagctttgtggcttt 56
               |||||||||||||||| |||||||
Sbjct: 2634658 gggtatttccagctttttggcttt 2634635



>gi|22065966|ref|NT_009151.12|Hs11_9308 Homo sapiens chromosome 11 reference
               genomic contig
          Length = 12972822

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 719     aagctctttgagaactggct 738
               ||||||||||||||||||||
Sbjct: 4218130 aagctctttgagaactggct 4218111



>gi|22064341|ref|NT_033927.2|Hs11_34082 Homo sapiens chromosome 11 reference
                genomic contig
          Length = 18378018

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 346      cttttctgtcctggtggctctgct 369
                |||||||||||||||| |||||||
Sbjct: 17225579 cttttctgtcctggtgtctctgct 17225556


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1157
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 1136
effective length of database: 2,826,363,332
effective search space: 3210748745152
effective search space used: 3210748745152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)