Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-000169


Query

>20030531C-000169 (20030531C-000169) 20030531C-000169
GGCTCATTCG CGCGTTAGAA GGCTCAGGCC GTTGTGCTGT GCTGTCTTCC
CGCCTGCGCC AGGGACCTGC CCAACTCAGT GGTGACCATG GCATCAGACG
AGGGCAAACT TTTCGTTGGA GGGCTGAGCT TTGACACCAA TGAGCAGTCG
CTGGAGCAGG TCTTCTCAAA ATATGGGCAG ATCTCAGAAG TGGTAGTAGT
GAAGGACAGG GAGACCCAGC GATCGAGGGG CTTTGGGTTT GTCACCTTTG
AGAACATTGA TGACGCCAAG GACGCTATGA TGGCCATGAA CGGGAAGTCT
GTGGATGGGC GGCAGATCCG GGTTGACCAG GCCGGCAAGT CATCTGATAA
CCGATCCCGT GGGTACCGAG GTGGCTCCTC GGGGGGCCGG GGCTTCTTCC
GTGGGGGCCG AGGCCGGGGC CGTGGGTTCT CCAGAGGAGG AGGGGATCGA
GGCTATGGTG GTAGCCGGTT CGAGTCCAGG AGTGGGGGCT ATGGCGGCTC
CAGGGACTAC TACAGCAGCC GGAGTCAGGG TGGCGGCTAT GGTGACCGGA
GCTCAGGCGG GTCCTACAGA GACAGCTACG ACAGTTACGC TACACACAAC
GAGTAAAAAT CCTGCTCAAG ATCGTCCTTC CAATGGCTGT ATATTTAAAG
ATTTTGGGAG CTCCGCTGAA TCGTTAATGT GTAGTGAATC CACCTCCTTG
TACCCACTTT TGTAGTCTTA TCAGTTCCTA TCTTGTCAAA CACAGCCTGA
CTGCTTCTGA CCCCAGATGG CCTCATTATT ACACTTTTCT TTTTAAAGAA
GTGCCATCTG TTTTTGAGGA TTTTGAACAT GTTTTGCAAA GCACTTCAGG
TTTTACTTTT TATCGTGAGC CATGAGCTTT TTAAAAAAAT CATTGAGGGT
TGCGAGAGTT TGAGTTTGGG GTTGTGTTGC CTTTTTTCTC TTTTTCGTGG
GGGTCGGCCC C

Search to ncbiHGDS database

Query= 20030531C-000169 (20030531C-000169) 20030531C-000169
         (961 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22053087|ref|NT_011268.6|Hs19_11425 Homo sapiens chromosome ...   196  2e-47
Alignment   gi|22057725|ref|NT_033254.2|Hs12_33430 Homo sapiens chromosome ...    46  0.036
Alignment   gi|22041985|ref|NT_029223.8|Hs1_29382 Homo sapiens chromosome 1...    46  0.036
Alignment   gi|22044506|ref|NT_006344.12|Hs4_6501 Homo sapiens chromosome 4...    44  0.14
Alignment   gi|22044752|ref|NT_005775.12|Hs3_5932 Homo sapiens chromosome 3...    44  0.14
Alignment   gi|22045461|ref|NT_005375.10|Hs2_5532 Homo sapiens chromosome 2...    44  0.14
Alignment   gi|22047592|ref|NT_023133.8|Hs5_23289 Homo sapiens chromosome 5...    42  0.55
Alignment   gi|22044229|ref|NT_006316.12|Hs4_6473 Homo sapiens chromosome 4...    42  0.55
Alignment   gi|22042666|ref|NT_034703.1|Hs4_34865 Homo sapiens chromosome 4...    42  0.55
Alignment   gi|22055203|ref|NT_011588.10|HsX_11745 Homo sapiens chromosome ...    40  2.2
Alignment   gi|22047878|ref|NT_007972.12|Hs8_8129 Homo sapiens chromosome 8...    40  2.2
Alignment   gi|22046812|ref|NT_023717.9|Hs8_23873 Homo sapiens chromosome 8...    40  2.2
Alignment   gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7...    40  2.2
Alignment   gi|22046740|ref|NT_007758.8|Hs7_7915 Homo sapiens chromosome 7 ...    40  2.2
Alignment   gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6...    40  2.2
Alignment   gi|22057384|ref|NT_034880.1|Hs6_35042 Homo sapiens chromosome 6...    40  2.2
Alignment   gi|22052191|ref|NT_006713.10|Hs5_6870 Homo sapiens chromosome 5...    40  2.2
Alignment   gi|22047228|ref|NT_023098.6|Hs5_23254 Homo sapiens chromosome 5...    40  2.2
Alignment   gi|22043566|ref|NT_006216.11|Hs4_6373 Homo sapiens chromosome 4...    40  2.2
Alignment   gi|22043776|ref|NT_005543.11|Hs3_5700 Homo sapiens chromosome 3...    40  2.2


>gi|22053087|ref|NT_011268.6|Hs19_11425 Homo sapiens chromosome 19
             reference genomic contig
          Length = 1739282

 Score =  196 bits (99), Expect = 2e-47
 Identities = 195/223 (87%), Gaps = 8/223 (3%)
 Strand = Plus / Plus


Query: 589   gctacacacaacgagtaaaaa----tcctgctcaagatcgtccttccaatggctgtatat 644
             |||||||||||||||||||||    ||||||||||||||||||||||||||||||| | |
Sbjct: 92819 gctacacacaacgagtaaaaacccttcctgctcaagatcgtccttccaatggctgtgtgt 92878


Query: 645   ttaaagattttgggagctccgctgaatcgttaatgtgtagtgaatccacctccttgta-- 702
             ||||||||| |||||||| ||||||| |||||||||||||| ||| ||||||||||||
Sbjct: 92879 ttaaagattgtgggagcttcgctgaa-cgttaatgtgtagtaaatgcacctccttgtatt 92937


Query: 703   cccacttttgtagtcttatcagttcctatcttgtcaaacacagcctgactgcttctgac- 761
             |||||||| |||||| | || ||||  |||||||||||| ||||||||| |||||||||
Sbjct: 92938 cccactttcgtagtcatttcggttctgatcttgtcaaacccagcctgaccgcttctgacg 92997


Query: 762   cccagatggcctcattattacacttttctttttaaagaagtgc 804
             ||  ||||||||| ||| || |||||||||||||| |||||||
Sbjct: 92998 ccgggatggcctcgttactagacttttctttttaaggaagtgc 93040


 Score =  170 bits (86), Expect = 9e-40
 Identities = 128/142 (90%)
 Strand = Plus / Plus


Query: 296   agtctgtggatgggcggcagatccgggttgaccaggccggcaagtcatctgataaccgat 355
             ||||||| ||||| ||||||||||| || |||||||| |||||||| || || |||||||
Sbjct: 91720 agtctgtagatggacggcagatccgagtagaccaggcaggcaagtcgtcagacaaccgat 91779


Query: 356   cccgtgggtaccgaggtggctcctcggggggccggggcttcttccgtgggggccgaggcc 415
             ||||||||||||| ||||||||  | |||||||||||||||||||||||||||||||| |
Sbjct: 91780 cccgtgggtaccgtggtggctctgccgggggccggggcttcttccgtgggggccgaggac 91839


Query: 416   ggggccgtgggttctccagagg 437
             |||||||||||||||| |||||
Sbjct: 91840 ggggccgtgggttctctagagg 91861


 Score =  145 bits (73), Expect = 5e-32
 Identities = 97/105 (92%)
 Strand = Plus / Plus


Query: 86    ccatggcatcagacgagggcaaacttttcgttggagggctgagctttgacaccaatgagc 145
             ||||||||||||| || ||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 91325 ccatggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagc 91384


Query: 146   agtcgctggagcaggtcttctcaaaatatgggcagatctcagaag 190
             ||||||||||||||||||||||||| || || |||||||| ||||
Sbjct: 91385 agtcgctggagcaggtcttctcaaagtacggacagatctctgaag 91429


 Score =  121 bits (61), Expect = 7e-25
 Identities = 97/109 (88%)
 Strand = Plus / Plus


Query: 189   agtggtagtagtgaaggacagggagacccagcgatcgaggggctttgggtttgtcacctt 248
             |||||| || ||||| ||||||||||||||| ||||  |||| |||||||||||||||||
Sbjct: 91531 agtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctt 91590


Query: 249   tgagaacattgatgacgccaaggacgctatgatggccatgaacgggaag 297
             |||||||||||| ||||| ||||| || |||||||||||||| ||||||
Sbjct: 91591 tgagaacattgacgacgctaaggatgccatgatggccatgaatgggaag 91639


 Score =  103 bits (52), Expect = 2e-19
 Identities = 76/84 (90%)
 Strand = Plus / Plus


Query: 435   aggaggaggggatcgaggctatggtggtagccggttcgagtccaggagtgggggctatgg 494
             |||||||||||| ||||||||||| || | ||||||||||||||||||||||||||| ||
Sbjct: 91942 aggaggaggggaccgaggctatggggggaaccggttcgagtccaggagtgggggctacgg 92001


Query: 495   cggctccagggactactacagcag 518
              |||||||| |||||||| |||||
Sbjct: 92002 aggctccagagactactatagcag 92025


 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus


Query: 515   gcagccggagtcagggtggcggctatggtgaccggagctcaggcgggtcctacagagaca 574
             |||||||||||||| |||| |||||  ||||||||||||| |||||||||||||||||||
Sbjct: 92370 gcagccggagtcagagtggtggctacagtgaccggagctcgggcgggtcctacagagaca 92429


Query: 575   gctacgacagttacg 589
             | || ||||||||||
Sbjct: 92430 gttatgacagttacg 92444


 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 74/83 (89%)
 Strand = Plus / Plus


Query: 3     ctcattcgcgcgttagaaggctcaggccgttgtgctgtgctgtcttcccgcctgcgccag 62
             |||| ||||||||||| |||||| || ||||||| || ||||||||||||| |||| |||
Sbjct: 89725 ctcactcgcgcgttaggaggctcgggtcgttgtggtgcgctgtcttcccgcttgcgtcag 89784


Query: 63    ggacctgcccaactcagtggtga 85
             |||||||||| ||||||||||||
Sbjct: 89785 ggacctgcccgactcagtggtga 89807



>gi|22057725|ref|NT_033254.2|Hs12_33430 Homo sapiens chromosome 12 reference
               genomic contig
          Length = 2120840

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 26/27 (96%)
 Strand = Plus / Minus


Query: 770     gcctcattattacacttttctttttaa 796
               ||||||||||||||||||| |||||||
Sbjct: 1052293 gcctcattattacacttttttttttaa 1052267



>gi|22041985|ref|NT_029223.8|Hs1_29382 Homo sapiens chromosome 1 reference
               genomic contig
          Length = 3283895

 Score = 46.1 bits (23), Expect = 0.036
 Identities = 23/23 (100%)
 Strand = Plus / Minus


Query: 117     tggagggctgagctttgacacca 139
               |||||||||||||||||||||||
Sbjct: 1633344 tggagggctgagctttgacacca 1633322


 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 227     ggggctttgggtttgtcac 245
               |||||||||||||||||||
Sbjct: 1633234 ggggctttgggtttgtcac 1633216



>gi|22044506|ref|NT_006344.12|Hs4_6501 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 7839908

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 776     ttattacacttttctttttaaa 797
               ||||||||||||||||||||||
Sbjct: 2119571 ttattacacttttctttttaaa 2119550



>gi|22044752|ref|NT_005775.12|Hs3_5932 Homo sapiens chromosome 3 reference
               genomic contig
          Length = 2690604

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 226     aggggctttgggtttgtcacct 247
               ||||||||||||||||||||||
Sbjct: 2405042 aggggctttgggtttgtcacct 2405021



>gi|22045461|ref|NT_005375.10|Hs2_5532 Homo sapiens chromosome 2 reference
               genomic contig
          Length = 11224855

 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 226     aggggctttgggtttgtcacct 247
               ||||||||||||||||||||||
Sbjct: 6571696 aggggctttgggtttgtcacct 6571675


 Score = 44.1 bits (22), Expect = 0.14
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcacct 247
               ||||||||||||||||||||||
Sbjct: 4639592 aggggctttgggtttgtcacct 4639613



>gi|22047592|ref|NT_023133.8|Hs5_23289 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 5756794

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 733     ttgtcaaacacagcctgactgcttc 757
               |||||||||||||||| ||||||||
Sbjct: 4523636 ttgtcaaacacagcctcactgcttc 4523660



>gi|22044229|ref|NT_006316.12|Hs4_6473 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 7656628

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcacc 246
               |||||||||||||||||||||
Sbjct: 3540264 aggggctttgggtttgtcacc 3540284



>gi|22042666|ref|NT_034703.1|Hs4_34865 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 3147178

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 162     cttctcaaaatatgggcagat 182
               |||||||||||||||||||||
Sbjct: 2259227 cttctcaaaatatgggcagat 2259247



>gi|22055203|ref|NT_011588.10|HsX_11745 Homo sapiens chromosome X reference
               genomic contig
          Length = 6021937

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 709     tttgtagtcttatcagttcctatc 732
               ||||||||||||| ||||||||||
Sbjct: 3968169 tttgtagtcttatgagttcctatc 3968146



>gi|22047878|ref|NT_007972.12|Hs8_8129 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 1547719

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 1213640 aggggctttgggtttgtcac 1213659



>gi|22046812|ref|NT_023717.9|Hs8_23873 Homo sapiens chromosome 8 reference
              genomic contig
          Length = 1118214

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 633    atggctgtatatttaaagat 652
              ||||||||||||||||||||
Sbjct: 263676 atggctgtatatttaaagat 263695



>gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7 reference
               genomic contig
          Length = 64386157

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 9847233 aggggctttgggtttgtcac 9847252


 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 3988448 aggggctttgggtttgtcac 3988467


 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 234      tgggtttgtcacctttgag 252
                |||||||||||||||||||
Sbjct: 49819380 tgggtttgtcacctttgag 49819398



>gi|22046740|ref|NT_007758.8|Hs7_7915 Homo sapiens chromosome 7 reference
               genomic contig
          Length = 12459970

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 153     ggagcaggtcttctcaaaat 172
               ||||||||||||||||||||
Sbjct: 7824077 ggagcaggtcttctcaaaat 7824096



>gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 48753116

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226      aggggctttgggtttgtcac 245
                ||||||||||||||||||||
Sbjct: 18349619 aggggctttgggtttgtcac 18349638



>gi|22057384|ref|NT_034880.1|Hs6_35042 Homo sapiens chromosome 6 reference
               genomic contig
          Length = 9104287

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 5550267 aggggctttgggtttgtcac 5550248


 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 928     tgccttttttctctttttc 946
               |||||||||||||||||||
Sbjct: 2483798 tgccttttttctctttttc 2483816



>gi|22052191|ref|NT_006713.10|Hs5_6870 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 13295383

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 9010653 aggggctttgggtttgtcac 9010634


 Score = 38.2 bits (19), Expect = 8.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 116     ttggagggctgagctttga 134
               |||||||||||||||||||
Sbjct: 9010764 ttggagggctgagctttga 9010746



>gi|22047228|ref|NT_023098.6|Hs5_23254 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 3107093

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 923     tgtgttgccttttttctctttttc 946
               ||||||||||||||| ||||||||
Sbjct: 1120120 tgtgttgccttttttttctttttc 1120097



>gi|22043566|ref|NT_006216.11|Hs4_6373 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 4005970

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226     aggggctttgggtttgtcac 245
               ||||||||||||||||||||
Sbjct: 2294904 aggggctttgggtttgtcac 2294923



>gi|22043776|ref|NT_005543.11|Hs3_5700 Homo sapiens chromosome 3 reference
              genomic contig
          Length = 2597048

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 226    aggggctttgggtttgtcac 245
              ||||||||||||||||||||
Sbjct: 343202 aggggctttgggtttgtcac 343221


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 961
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 940
effective length of database: 2,826,363,332
effective search space: 2656781532080
effective search space used: 2656781532080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)