Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-000211


Query

>20030531C-000211 (20030531C-000211) 20030531C-000211
GGAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAGCCA
CTTTTGTCGT GCCCTTGAGA ATTAGCCACA ATGATTCCTC CGGTGCTCAT
CTTTTTCCTG AGTTTTCTCT GCCATGCTGC TATCGCAGGG CGAACCTGTC
CCAAGCCGGA AGAGTTACCG TTTGCCGTAG TTGTGCCGTT GAAATCATCC
TATGCGCCAG GGGAGGAGAT AGTGTATACC TGCCAGCCGG GGTACGTGTC
CCGGGGAGGG ATCCGGCGGT TTATCTGCCC GCTCACAGGA CTTTGGCCCA
TCAACACTCT GAAATGTCTA CCCAGAGTAT GTCCTTTTGC TGGAATCTTA
GAAAACGGAG CTGTACGCTA TACAACTTTT GAGTATCCCA ACACGATCAG
TTTCACTTGC AACCGGGGTT TTTCTCTGAA AGGAGCTAAT TCGGCTAAAT
GTACCGAGGA AGGAAAATGG AGTCCAGACC TTCCTGTCTG TACCCCTATA
ACCTGCCCTC CACCACCCAC ACCCAAGTTT GCAAAACTTA GTGTTTATAA
GCCATTGGCT GGGAACAACT CTCTCTATGG AGGCAAGGCA GTCTTTGAAT
GCTTGCCACA GCACGCAATG TTTGGAAATG GTACAATTAC TTGCACAGAA
CATGGAAATT GGACTGAATT ACCAGAATGT AAGGAAGTAA AATGCCCATT
CCCATCAAGA CCAGAAAACG GATTTGTGAA CTATCCTGCA AAGCAAGTTC
TTTATTACCA GGATAAAGCC ACATATGGTT GCCATGACAC TTACACCTTG
GATGGACCAG AAGAAGTTGA ATGTAACAAA TTTGGAAACT GGTCTGCACA
GCCCAGCTGT AAAGCATCTT GTAAATTATC TGTGAAAAGA GCTACTGTGA
TATATGAAGG AGAGAGAGTC AATATCCAAG ATAAATTTAA AGAATGGAAT
GCTGCATGGC CCAAAAAATT TCTTTCTTCT GCAAGAATAA GGAAAAAAAA
GTGC

Search to ncbiHGDS database

Query= 20030531C-000211 (20030531C-000211) 20030531C-000211
         (1004 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22063103|ref|NT_010704.10|Hs17_10861 Homo sapiens chromosome...   137  1e-29
Alignment   gi|22066463|ref|NT_035469.1|Hs17_35631 Homo sapiens chromosome ...    42  0.58
Alignment   gi|22064910|ref|NT_024871.7|Hs17_25027 Homo sapiens chromosome ...    42  0.58
Alignment   gi|22054887|ref|NT_008705.12|Hs10_8862 Homo sapiens chromosome ...    42  0.58
Alignment   gi|22058882|ref|NT_025312.8|HsX_25468 Homo sapiens chromosome X...    40  2.3
Alignment   gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8...    40  2.3
Alignment   gi|22046496|ref|NT_023666.12|Hs8_23822 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6...    40  2.3
Alignment   gi|22066041|ref|NT_035425.1|Hs17_35587 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22070136|ref|NT_035363.1|Hs16_35525 Homo sapiens chromosome ...    40  2.3
Alignment   gi|17433681|ref|NT_011903.8|HsY_12060 Homo sapiens chromosome Y...    38  9.1
Alignment   gi|22045785|ref|NT_023974.12|Hs9_24130 Homo sapiens chromosome ...    38  9.1
Alignment   gi|22050151|ref|NT_008201.11|Hs8_8358 Homo sapiens chromosome 8...    38  9.1
Alignment   gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7...    38  9.1
Alignment   gi|22063448|ref|NT_007819.10|Hs7_7976 Homo sapiens chromosome 7...    38  9.1
Alignment   gi|22058426|ref|NT_007422.10|Hs6_7579 Homo sapiens chromosome 6...    38  9.1
Alignment   gi|22057693|ref|NT_007158.10|Hs6_7315 Homo sapiens chromosome 6...    38  9.1
Alignment   gi|22053317|ref|NT_019424.10|Hs6_19580 Homo sapiens chromosome ...    38  9.1
Alignment   gi|22041122|ref|NT_016354.12|Hs4_16510 Homo sapiens chromosome ...    38  9.1
Alignment   gi|22043975|ref|NT_005571.12|Hs3_5728 Homo sapiens chromosome 3...    38  9.1


>gi|22063103|ref|NT_010704.10|Hs17_10861 Homo sapiens chromosome 17
               reference genomic contig
          Length = 3152890

 Score =  137 bits (69), Expect = 1e-29
 Identities = 150/177 (84%)
 Strand = Plus / Plus


Query: 503     ctgccctccaccacccacacccaagtttgcaaaacttagtgtttataagccattggctgg 562
               ||||||||||||| ||| ||| | |||||||| |||| |||||||||||||||  |||||
Sbjct: 1817251 ctgccctccaccatccatacctacgtttgcaacacttcgtgtttataagccatcagctgg 1817310


Query: 563     gaacaactctctctatggaggcaaggcagtctttgaatgcttgccacagcacgcaatgtt 622
                ||||| || |||||| | | ||  ||||| |||||||| |||||||| || || |||||
Sbjct: 1817311 aaacaattccctctatcgggacacagcagtttttgaatgtttgccacaacatgcgatgtt 1817370


Query: 623     tggaaatggtacaattacttgcacagaacatggaaattggactgaattaccagaatg 679
               |||||||| ||||||||| |||||   |||||||||||||||| |||||||||||||
Sbjct: 1817371 tggaaatgatacaattacctgcacgacacatggaaattggactaaattaccagaatg 1817427


 Score =  131 bits (66), Expect = 8e-28
 Identities = 78/82 (95%)
 Strand = Plus / Plus


Query: 322     ccagagtatgtccttttgctggaatcttagaaaacggagctgtacgctatacaacttttg 381
               |||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||
Sbjct: 1811862 ccagagtatgtccttttgctggaatcttagaaaatggagccgtacgctatacgacttttg 1811921


Query: 382     agtatcccaacacgatcagttt 403
               | ||||||||||||||||||||
Sbjct: 1811922 aatatcccaacacgatcagttt 1811943


 Score =  127 bits (64), Expect = 1e-26
 Identities = 139/164 (84%)
 Strand = Plus / Plus


Query: 684     gaagtaaaatgcccattcccatcaagaccagaaaacggatttgtgaactatcctgcaaag 743
               |||||||||||||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 1821018 gaagtaaaatgcccattcccatcaagaccagacaatggatttgtgaactatcctgcaaaa 1821077


Query: 744     caagttctttattaccaggataaagccacatatggttgccatgacacttacaccttggat 803
               | |   ||||||||| ||||||||||||||| ||| ||||||||    ||  |  |||||
Sbjct: 1821078 ccaacactttattacaaggataaagccacatttggctgccatgatggatattctctggat 1821137


Query: 804     ggaccagaagaagttgaatgtaacaaatttggaaactggtctgc 847
               || || |||||| | ||||||| |||| | ||||||||||||||
Sbjct: 1821138 ggcccggaagaaatagaatgtaccaaactgggaaactggtctgc 1821181


 Score =  105 bits (53), Expect = 5e-20
 Identities = 143/173 (82%)
 Strand = Plus / Plus


Query: 145     cctgtcccaagccggaagagttaccgtttgccgtagttgtgccgttgaaatcatcctatg 204
               ||||||||||||| || || ||||| ||| ||  ||| || ||||| ||| ||| |||||
Sbjct: 1809790 cctgtcccaagccagatgatttaccattttccacagtggtcccgttaaaaacattctatg 1809849


Query: 205     cgccaggggaggagatagtgtatacctgccagccggggtacgtgtcccggggagggatcc 264
                |||||| || |||||   |||| ||||| ||||||| || |||||||| ||||||||
Sbjct: 1809850 agccaggagaagagattacgtattcctgcaagccgggctatgtgtcccgaggagggatga 1809909


Query: 265     ggcggtttatctgcccgctcacaggactttggcccatcaacactctgaaatgt 317
               |   |||||||||||| ||||||||||| ||||||||||||||||||||||||
Sbjct: 1809910 gaaagtttatctgccctctcacaggactgtggcccatcaacactctgaaatgt 1809962


 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 109/130 (83%), Gaps = 2/130 (1%)
 Strand = Plus / Plus


Query: 863     agcatcttgtaaattatctgtgaaaagagctactgtgatatatgaaggagagagagtcaa 922
               ||||||||||||| || ||||||||| ||| |||||| | ||  ||||||||||||| ||
Sbjct: 1823334 agcatcttgtaaagtacctgtgaaaaaagccactgtggtgtaccaaggagagagagtaaa 1823393


Query: 923     tatccaagataaatttaaagaatggaatgctgcatggcccaaaaaatttctttcttctgc 982
                || || || |||||| |||||||||||||| |||||   | ||| ||||||||||||||
Sbjct: 1823394 gattcaggaaaaattt-aagaatggaatgctacatgg-tgataaagtttctttcttctgc 1823451


Query: 983     aagaataagg 992
               || |||||||
Sbjct: 1823452 aaaaataagg 1823461


 Score = 71.9 bits (36), Expect = 6e-10
 Identities = 57/64 (89%)
 Strand = Plus / Plus


Query: 76      ccacaatgattcctccggtgctcatctttttcctgagttttctctgccatgctgctatcg 135
               ||||||||||| |||| ||||||||||| |||  ||||||||||||||||| |||||| |
Sbjct: 1808602 ccacaatgatttctccagtgctcatcttgttctcgagttttctctgccatgttgctattg 1808661


Query: 136     cagg 139
               ||||
Sbjct: 1808662 cagg 1808665


 Score = 48.1 bits (24), Expect = 0.009
 Identities = 33/36 (91%)
 Strand = Plus / Plus


Query: 456     gaggaaggaaaatggagtccagaccttcctgtctgt 491
               ||||||||||||||||| || || ||||||||||||
Sbjct: 1814249 gaggaaggaaaatggagcccggagcttcctgtctgt 1814284



>gi|22066463|ref|NT_035469.1|Hs17_35631 Homo sapiens chromosome 17
              reference genomic contig
          Length = 188255

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 502    cctgccctccaccacccacac 522
              |||||||||||||||||||||
Sbjct: 178885 cctgccctccaccacccacac 178865



>gi|22064910|ref|NT_024871.7|Hs17_25027 Homo sapiens chromosome 17
              reference genomic contig
          Length = 524185

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 502    cctgccctccaccacccacac 522
              |||||||||||||||||||||
Sbjct: 450426 cctgccctccaccacccacac 450446



>gi|22054887|ref|NT_008705.12|Hs10_8862 Homo sapiens chromosome 10 reference
                genomic contig
          Length = 30291480

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 668      attaccagaatgtaaggaagt 688
                |||||||||||||||||||||
Sbjct: 20391870 attaccagaatgtaaggaagt 20391850


 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 567     aactctctctatggaggcaa 586
               ||||||||||||||||||||
Sbjct: 5636005 aactctctctatggaggcaa 5635986



>gi|22058882|ref|NT_025312.8|HsX_25468 Homo sapiens chromosome X reference
               genomic contig
          Length = 4358532

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 793     acaccttggatggaccagaagaag 816
               ||||||||||||| ||||||||||
Sbjct: 2990078 acaccttggatggcccagaagaag 2990055



>gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8 reference
                genomic contig
          Length = 13399573

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 895      ctgtgatatatgaaggagagagag 918
                |||||||| |||||||||||||||
Sbjct: 10871324 ctgtgatagatgaaggagagagag 10871301



>gi|22046496|ref|NT_023666.12|Hs8_23822 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 4131515

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 503     ctgccctccaccacccacac 522
               ||||||||||||||||||||
Sbjct: 1762794 ctgccctccaccacccacac 1762775


 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 503     ctgccctccaccacccacac 522
               ||||||||||||||||||||
Sbjct: 1797988 ctgccctccaccacccacac 1798007



>gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 48753116

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 938      taaagaatggaatgctgcatggcc 961
                ||||||||||||||||| ||||||
Sbjct: 36796178 taaagaatggaatgctggatggcc 36796201


 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 102      tttttcctgagttttctctg 121
                ||||||||||||||||||||
Sbjct: 10467213 tttttcctgagttttctctg 10467194


 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 969      tttctttcttctgcaagaa 987
                |||||||||||||||||||
Sbjct: 41739660 tttctttcttctgcaagaa 41739678



>gi|22066041|ref|NT_035425.1|Hs17_35587 Homo sapiens chromosome 17 reference
               genomic contig
          Length = 4896068

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 417     ggtttttctctgaaaggagc 436
               ||||||||||||||||||||
Sbjct: 2865392 ggtttttctctgaaaggagc 2865373



>gi|22070136|ref|NT_035363.1|Hs16_35525 Homo sapiens chromosome 16 reference
               genomic contig
          Length = 1495931

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 100     tctttttcctgagttttctctgcc 123
               |||||||||| |||||||||||||
Sbjct: 1033945 tctttttcctcagttttctctgcc 1033968



>gi|17433681|ref|NT_011903.8|HsY_12060 Homo sapiens chromosome Y reference
               genomic contig
          Length = 4945747

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 619     tgtttggaaatggtacaattact 641
               |||||||||||| ||||||||||
Sbjct: 3198640 tgtttggaaatgctacaattact 3198662


 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 619     tgtttggaaatggtacaattact 641
               |||||||||||| ||||||||||
Sbjct: 1329781 tgtttggaaatgctacaattact 1329759


 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 619     tgtttggaaatggtacaattact 641
               |||||||||||| ||||||||||
Sbjct: 2871754 tgtttggaaatgctacaattact 2871732



>gi|22045785|ref|NT_023974.12|Hs9_24130 Homo sapiens chromosome 9 reference
                genomic contig
          Length = 20138537

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 104      tttcctgagttttctctgc 122
                |||||||||||||||||||
Sbjct: 16435967 tttcctgagttttctctgc 16435949



>gi|22050151|ref|NT_008201.11|Hs8_8358 Homo sapiens chromosome 8 reference
              genomic contig
          Length = 744215

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 501    acctgccctccaccaccca 519
              |||||||||||||||||||
Sbjct: 441482 acctgccctccaccaccca 441500



>gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7 reference
                genomic contig
          Length = 64386157

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 670      taccagaatgtaaggaagt 688
                |||||||||||||||||||
Sbjct: 58059566 taccagaatgtaaggaagt 58059548


 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 94       tgctcatctttttcctgagtttt 116
                ||||||| |||||||||||||||
Sbjct: 46994808 tgctcatttttttcctgagtttt 46994830



>gi|22063448|ref|NT_007819.10|Hs7_7976 Homo sapiens chromosome 7 reference
                genomic contig
          Length = 47428039

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 688      taaaatgcccattcccatc 706
                |||||||||||||||||||
Sbjct: 24480003 taaaatgcccattcccatc 24479985



>gi|22058426|ref|NT_007422.10|Hs6_7579 Homo sapiens chromosome 6 reference
               genomic contig
          Length = 6774867

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 113     ttttctctgccatgctgct 131
               |||||||||||||||||||
Sbjct: 5872907 ttttctctgccatgctgct 5872889



>gi|22057693|ref|NT_007158.10|Hs6_7315 Homo sapiens chromosome 6 reference
               genomic contig
          Length = 13091563

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 492     acccctataacctgccctc 510
               |||||||||||||||||||
Sbjct: 1453758 acccctataacctgccctc 1453776



>gi|22053317|ref|NT_019424.10|Hs6_19580 Homo sapiens chromosome 6
              reference genomic contig
          Length = 7107542

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 896    tgtgatatatgaaggagagagag 918
              ||||||||||| |||||||||||
Sbjct: 795287 tgtgatatatgcaggagagagag 795309


 Score = 38.2 bits (19), Expect = 9.1
 Identities = 25/27 (92%)
 Strand = Plus / Plus


Query: 807     ccagaagaagttgaatgtaacaaattt 833
               |||||||||||||||| |||| |||||
Sbjct: 3964089 ccagaagaagttgaatttaactaattt 3964115



>gi|22041122|ref|NT_016354.12|Hs4_16510 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 10944381

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 903     tatgaaggagagagagtcaatat 925
               ||||||||||| |||||||||||
Sbjct: 8911735 tatgaaggagaaagagtcaatat 8911713



>gi|22043975|ref|NT_005571.12|Hs3_5728 Homo sapiens chromosome 3 reference
              genomic contig
          Length = 2698654

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 542    tgtttataagccattggct 560
              |||||||||||||||||||
Sbjct: 477211 tgtttataagccattggct 477193


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1004
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 983
effective length of database: 2,826,363,332
effective search space: 2778315155356
effective search space used: 2778315155356
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)