Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-000510


Query

>20030531C-000510 (20030531C-000510) 20030531C-000510
AGCTTTTTTG CGAGAGCCGC TGGATCAGCC GGACGTCCCC AGGCCCTGGC
CATGCGGCTC CTGCTACTTC TGGCCCCACT GGGCTGGCTG CTTCTGACCG
AAACGAAGGG TGACGCCAAA CCGGAGGACA ACCTCTTGGT GCTCACGGTG
GCCACGAAGG AGACCGAGGG GTTCCGACGC TTCAAGCGCT CAGCCCAGTT
CTTCAACTAC AAGATCCAGG CGCTGGGGCT GGGGGAGGAC TGGAATGAGA
AGGAGGCATC GTCGGGTGGA GGGCTGAAGG TTCGGCTGCT GAAGAAAGCC
CTGGAAAAGC ATGCAGACGA GAACCTGGTC ATTCTCTTCA CAGACAGCTA
TGACGTGGTG TTTGCCTCCG GGCCCCGAGA GCTGCTGAAG AAGTTCCGGC
AGGCCAAGAG CCAGGTGGTC TTCTCAGCAG AGGAGCTCAT CTACCCGGAC
CGCAGGCTGG AGGCCAAGTA CCCGGCCGTC TCCGACGGCA AGAGGTTCCT
GGGCTCTGGA GGCTTCATTG GTTATGCCCC CAACCTCAGC AAACTGGTGG
CTGAGTGGGA GGGTCAGGAC AGCGACAGCG ACCAACTCTT TTATACCAAG
ATATTCTTGG ACCCGGAGAA GAGGGAGCGG ATCAATATCA CCTTGGACCA
CCGCTGCCGT ATCTTCCAGA ATCTGGATGG AGCCTTGGAT GAGGTTGTGC
TCAAGTTCGA GATGGGCCAA GTGAGAGCGA GGAACCTGGC CTACGACACC
CTCCCGGTCC TGATTCACGG CAATGGGCCC ACCAAGCTGC AGCTGAACTA
CCTGGGCAAC TACATCCCGC GCTTCTGGAC CTTCGAGACG GGGTGCTCCG
TGTGTGATGA GGGCCTGCGC AGCCTCAAGG GCATTGGGGA TGAAGCTCTG
CCCACAGTCC TGGTCGGCCT GTTCATCGAA CAGCCCACGC CGTTCCTGTC
CCTGTTCTTC CAGCGGCTCC TGCGCCTCCA ATACCCCCGG AACGGATGCG
GCTTTTCCTT CACACCATGA GCAGCACCAC AGGCTCTAG

Search to ncbiHGDS database

Query= 20030531C-000510 (20030531C-000510) 20030531C-000510
         (1039 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22041533|ref|NT_022041.10|Hs1_22197 Homo sapiens chromosome ...   216  2e-53
Alignment   gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7...    44  0.15
Alignment   gi|22042174|ref|NT_025667.6|Hs3_25823 Homo sapiens chromosome 3...    42  0.60
Alignment   gi|22069349|ref|NT_024788.9|Hs16_24944 Homo sapiens chromosome ...    42  0.60
Alignment   gi|22058588|ref|NT_025291.9|HsX_25447 Homo sapiens chromosome X...    40  2.4
Alignment   gi|22043278|ref|NT_005034.10|Hs2_5191 Homo sapiens chromosome 2...    40  2.4
Alignment   gi|22065434|ref|NT_030843.3|Hs17_31099 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22057791|ref|NT_033278.2|Hs15_33454 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22057608|ref|NT_033275.2|Hs15_33451 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22056420|ref|NT_011669.10|HsX_11826 Homo sapiens chromosome ...    38  9.4
Alignment   gi|22046362|ref|NT_033215.2|Hs9_33391 Homo sapiens chromosome 9...    38  9.4
Alignment   gi|22045985|ref|NT_027081.8|Hs9_27241 Homo sapiens chromosome 9...    38  9.4
Alignment   gi|22045832|ref|NT_024000.12|Hs9_24156 Homo sapiens chromosome ...    38  9.4
Alignment   gi|22046387|ref|NT_023663.12|Hs8_23819 Homo sapiens chromosome ...    38  9.4
Alignment   gi|22046238|ref|NT_034885.1|Hs7_35047 Homo sapiens chromosome 7...    38  9.4
Alignment   gi|22050850|ref|NT_006519.10|Hs5_6676 Homo sapiens chromosome 5...    38  9.4
Alignment   gi|22048376|ref|NT_029975.3|Hs5_30230 Homo sapiens chromosome 5...    38  9.4
Alignment   gi|22042720|ref|NT_034706.1|Hs4_34868 Homo sapiens chromosome 4...    38  9.4
Alignment   gi|22041089|ref|NT_022416.11|Hs3_22572 Homo sapiens chromosome ...    38  9.4
Alignment   gi|22043178|ref|NT_034489.1|Hs2_34651 Homo sapiens chromosome 2...    38  9.4


>gi|22041533|ref|NT_022041.10|Hs1_22197 Homo sapiens chromosome 1
              reference genomic contig
          Length = 1071571

 Score =  216 bits (109), Expect = 2e-53
 Identities = 154/169 (91%)
 Strand = Plus / Plus


Query: 344    acagctatgacgtggtgtttgcctccgggccccgagagctgctgaagaagttccggcagg 403
              |||||||||||||| ||||||| || |||||||| ||||| |||||||||||||||||||
Sbjct: 135867 acagctatgacgtgctgtttgcatcggggccccgggagctcctgaagaagttccggcagg 135926


Query: 404    ccaagagccaggtggtcttctcagcagaggagctcatctacccggaccgcaggctggagg 463
              ||| |||||||||||||||||| || ||||||||||||||||| |||||||||||||||
Sbjct: 135927 ccaggagccaggtggtcttctctgctgaggagctcatctacccagaccgcaggctggaga 135986


Query: 464    ccaagtacccggccgtctccgacggcaagaggttcctgggctctggagg 512
              ||||||| ||||  || ||||| ||||||||||||||||||||||||||
Sbjct: 135987 ccaagtatccggtggtgtccgatggcaagaggttcctgggctctggagg 136035


 Score =  167 bits (84), Expect = 2e-38
 Identities = 108/116 (93%)
 Strand = Plus / Plus


Query: 510    aggcttcattggttatgcccccaacctcagcaaactggtggctgagtgggagggtcagga 569
              ||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 138135 aggcttcatcggttatgcccccaacctcagcaaactggtggccgagtgggagggccagga 138194


Query: 570    cagcgacagcgaccaactcttttataccaagatattcttggacccggagaagaggg 625
              |||||||||||| || || ||||| |||||||| ||||||||||||||||||||||
Sbjct: 138195 cagcgacagcgatcagctgttttacaccaagatcttcttggacccggagaagaggg 138250


 Score =  153 bits (77), Expect = 2e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus


Query: 888    ggatgaagctctgcccacagtcctggtcggcctgttcatcgaacagcccacgccgttcct 947
              |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||  |
Sbjct: 144029 ggatgaagctctgcccacggtcctggtcggcgtgttcatcgaacagcccacgccgtttgt 144088


Query: 948    gtccctgttcttccagcggctcctgcgcctccaataccccc 988
              ||||||||||||||||||||||||||| ||||| |||||||
Sbjct: 144089 gtccctgttcttccagcggctcctgcggctccactaccccc 144129


 Score =  145 bits (73), Expect = 6e-32
 Identities = 97/105 (92%)
 Strand = Plus / Plus


Query: 785    agctgcagctgaactacctgggcaactacatcccgcgcttctggaccttcgagacggggt 844
              |||||||| ||||||||||||||||||||||||||||||||||||||||||| || || |
Sbjct: 143354 agctgcagttgaactacctgggcaactacatcccgcgcttctggaccttcgaaacaggct 143413


Query: 845    gctccgtgtgtgatgagggcctgcgcagcctcaagggcattgggg 889
              || |||||||||| || ||| ||||||||||||||||||||||||
Sbjct: 143414 gcaccgtgtgtgacgaaggcttgcgcagcctcaagggcattgggg 143458


 Score =  131 bits (66), Expect = 8e-28
 Identities = 87/94 (92%)
 Strand = Plus / Plus


Query: 127    gacaacctcttggtgctcacggtggccacgaaggagaccgaggggttccgacgcttcaag 186
              |||||||| || || |||||||||||||| |||||||||||||| ||||| |||||||||
Sbjct: 133489 gacaaccttttagtcctcacggtggccactaaggagaccgagggattccgtcgcttcaag 133548


Query: 187    cgctcagcccagttcttcaactacaagatccagg 220
              |||||||| |||||||||||||||||||||||||
Sbjct: 133549 cgctcagctcagttcttcaactacaagatccagg 133582


 Score =  125 bits (63), Expect = 5e-26
 Identities = 90/99 (90%)
 Strand = Plus / Plus


Query: 688    gatgaggttgtgctcaagttcgagatgggccaagtgagagcgaggaacctggcctacgac 747
              |||||||| ||||||||||| || |||||||| ||||||||||||||||||||||| |||
Sbjct: 142430 gatgaggtcgtgctcaagtttgaaatgggccatgtgagagcgaggaacctggcctatgac 142489


Query: 748    accctcccggtcctgattcacggcaatgggcccaccaag 786
              ||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 142490 accctcccggtcctgatccatggcaacgggccaaccaag 142528


 Score =  107 bits (54), Expect = 1e-20
 Identities = 66/70 (94%)
 Strand = Plus / Plus


Query: 624    ggagcggatcaatatcaccttggaccaccgctgccgtatcttccagaatctggatggagc 683
              ||||| ||||||||||||| |||||||||||||||||||||||||||| |||||||||||
Sbjct: 140343 ggagcagatcaatatcaccctggaccaccgctgccgtatcttccagaacctggatggagc 140402


Query: 684    cttggatgag 693
              ||||| ||||
Sbjct: 140403 cttgggtgag 140412


 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 117/139 (84%), Gaps = 6/139 (4%)
 Strand = Plus / Plus


Query: 215    tccaggcgctggggctgggggaggactggaat---gagaaggaggcatcgtcgggtggag 271
              |||||||||| || || |||||||||||||||   ||||||| | | ||| | |||||||
Sbjct: 135282 tccaggcgcttggcctaggggaggactggaatgtggagaaggggacgtcggcaggtggag 135341


Query: 272    ggctgaaggttcggctgctgaagaaagccctggaaaagcatgcagac---gagaacctgg 328
              ||| |||||| ||||||||||||||||| ||||| ||||| ||||||   ||| | ||||
Sbjct: 135342 ggcagaaggtccggctgctgaagaaagctctggagaagcacgcagacaaggaggatctgg 135401


Query: 329    tcattctcttcacagacag 347
              ||||||||||| |||||||
Sbjct: 135402 tcattctcttcgcagacag 135420


 Score = 79.8 bits (40), Expect = 3e-12
 Identities = 70/80 (87%)
 Strand = Plus / Plus


Query: 48     ggccatgcggctcctgctacttctggccccactgggctggctgcttctgaccgaaacgaa 107
              ||||||||||| |||||| || |||||||  |||||||||||||| ||| ||||| ||||
Sbjct: 120290 ggccatgcggcccctgctgctactggccctgctgggctggctgctgctggccgaagcgaa 120349


Query: 108    gggtgacgccaaaccggagg 127
              ||| |||||||| |||||||
Sbjct: 120350 gggcgacgccaagccggagg 120369



>gi|22050628|ref|NT_007933.10|Hs7_8090 Homo sapiens chromosome 7 reference
                genomic contig
          Length = 64386157

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 31/34 (91%)
 Strand = Plus / Minus


Query: 785      agctgcagctgaactacctgggcaactacatccc 818
                |||||||||| ||||||||||| |||||| ||||
Sbjct: 26038509 agctgcagctcaactacctgggaaactacgtccc 26038476


 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 378      agagctgctgaagaagttc 396
                |||||||||||||||||||
Sbjct: 26041860 agagctgctgaagaagttc 26041842


 Score = 38.2 bits (19), Expect = 9.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus


Query: 209      acaagatccaggcgctggggctggggg 235
                |||||| || |||||||||||||||||
Sbjct: 64302113 acaagagcctggcgctggggctggggg 64302139



>gi|22042174|ref|NT_025667.6|Hs3_25823 Homo sapiens chromosome 3 reference
               genomic contig
          Length = 2732005

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 546     ggtggctgagtgggagggtca 566
               |||||||||||||||||||||
Sbjct: 1709692 ggtggctgagtgggagggtca 1709672



>gi|22069349|ref|NT_024788.9|Hs16_24944 Homo sapiens chromosome 16
              reference genomic contig
          Length = 328394

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 893    aagctctgcccacagtcctgg 913
              |||||||||||||||||||||
Sbjct: 284299 aagctctgcccacagtcctgg 284279



>gi|22058588|ref|NT_025291.9|HsX_25447 Homo sapiens chromosome X reference
              genomic contig
          Length = 681758

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 943    ttcctgtccctgttcttcca 962
              ||||||||||||||||||||
Sbjct: 411533 ttcctgtccctgttcttcca 411514



>gi|22043278|ref|NT_005034.10|Hs2_5191 Homo sapiens chromosome 2 reference
               genomic contig
          Length = 3548565

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 332     ttctcttcacagacagctat 351
               ||||||||||||||||||||
Sbjct: 2516430 ttctcttcacagacagctat 2516411



>gi|22065434|ref|NT_030843.3|Hs17_31099 Homo sapiens chromosome 17 reference
               genomic contig
          Length = 4353018

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus


Query: 943     ttcctgtccctgttcttccagcggctcc 970
               |||||| ||||||||||||| |||||||
Sbjct: 3044156 ttcctggccctgttcttccaacggctcc 3044129



>gi|22057791|ref|NT_033278.2|Hs15_33454 Homo sapiens chromosome 15
             reference genomic contig
          Length = 265687

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 848   ccgtgtgtgatgagggcctg 867
             ||||||||||||||||||||
Sbjct: 55981 ccgtgtgtgatgagggcctg 55962


 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 848    ccgtgtgtgatgagggcctg 867
              ||||||||||||||||||||
Sbjct: 146452 ccgtgtgtgatgagggcctg 146471



>gi|22057608|ref|NT_033275.2|Hs15_33451 Homo sapiens chromosome 15
              reference genomic contig
          Length = 872920

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 848    ccgtgtgtgatgagggcctg 867
              ||||||||||||||||||||
Sbjct: 671956 ccgtgtgtgatgagggcctg 671975


 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 848    ccgtgtgtgatgagggcctg 867
              ||||||||||||||||||||
Sbjct: 568411 ccgtgtgtgatgagggcctg 568430



>gi|22056420|ref|NT_011669.10|HsX_11826 Homo sapiens chromosome X reference
               genomic contig
          Length = 4827044

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 756     ggtcctgattcacggcaat 774
               |||||||||||||||||||
Sbjct: 1852114 ggtcctgattcacggcaat 1852096



>gi|22046362|ref|NT_033215.2|Hs9_33391 Homo sapiens chromosome 9 reference
              genomic contig
          Length = 364615

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 36     tccccaggccctggccatg 54
              |||||||||||||||||||
Sbjct: 299170 tccccaggccctggccatg 299152



>gi|22045985|ref|NT_027081.8|Hs9_27241 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 7631606

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 617     agaagagggagcggatcaatatc 639
               ||||||||||| |||||||||||
Sbjct: 6826247 agaagagggagaggatcaatatc 6826225



>gi|22045832|ref|NT_024000.12|Hs9_24156 Homo sapiens chromosome 9
             reference genomic contig
          Length = 501230

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 36    tccccaggccctggccatg 54
             |||||||||||||||||||
Sbjct: 81315 tccccaggccctggccatg 81297



>gi|22046387|ref|NT_023663.12|Hs8_23819 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 2255428

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 233     gggaggactggaatgagaa 251
               |||||||||||||||||||
Sbjct: 1198773 gggaggactggaatgagaa 1198755



>gi|22046238|ref|NT_034885.1|Hs7_35047 Homo sapiens chromosome 7 reference
              genomic contig
          Length = 674951

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 220    gcgctggggctgggggaggactg 242
              ||||||||| |||||||||||||
Sbjct: 641976 gcgctggggatgggggaggactg 641954



>gi|22050850|ref|NT_006519.10|Hs5_6676 Homo sapiens chromosome 5 reference
              genomic contig
          Length = 1881132

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 400    caggccaagagccaggtgg 418
              |||||||||||||||||||
Sbjct: 652363 caggccaagagccaggtgg 652381



>gi|22048376|ref|NT_029975.3|Hs5_30230 Homo sapiens chromosome 5 reference
              genomic contig
          Length = 1191729

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 379    gagctgctgaagaagttcc 397
              |||||||||||||||||||
Sbjct: 407865 gagctgctgaagaagttcc 407847



>gi|22042720|ref|NT_034706.1|Hs4_34868 Homo sapiens chromosome 4 reference
              genomic contig
          Length = 2370517

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 397    cggcaggccaagagccaggtggt 419
              |||||||||||||||||| ||||
Sbjct: 881303 cggcaggccaagagccagatggt 881325



>gi|22041089|ref|NT_022416.11|Hs3_22572 Homo sapiens chromosome 3
              reference genomic contig
          Length = 894363

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 709    gagatgggccaagtgagag 727
              |||||||||||||||||||
Sbjct: 304098 gagatgggccaagtgagag 304080



>gi|22043178|ref|NT_034489.1|Hs2_34651 Homo sapiens chromosome 2 reference
              genomic contig
          Length = 515744

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 944    tcctgtccctgttcttcca 962
              |||||||||||||||||||
Sbjct: 482871 tcctgtccctgttcttcca 482889


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1039
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 1018
effective length of database: 2,826,363,332
effective search space: 2877237871976
effective search space used: 2877237871976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)