Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-000541


Query

>20030531C-000541 (20030531C-000541) 20030531C-000541
AAAAGGGCAT GATGGGCGGG GGAGTTTTCC CGGCTCACTG TACCGCCTCT
CTGGCTGTCG AGTCGATAAT CCTAACGACG TTAAAGTCGT TTTTATTTCA
AGAAATCAAC AGAAAACAAG TCCCACCTCT AAAACTCAGC TGACGAGAAG
TGGGGTGTGC GGCGGCGAGT TCGAGAGCTA CGGGGCTTCA AACGCAGGAG
TGGGTTTTCT GGGTTTCTGG GTTCCTGGGT TCCCGGCGCA CCTCCTCCCG
GCACTCTACG CGCCTCGACC CACTACCTAG GCCCATGGGA ACTCAGAAGC
CTCGGATCCT GCCCTGGCTG ATATCTCAGC TGAACCAGGG GCAACTGGAG
GGCGTGGCCT GGCTGGATGA GGGCCACACG CGCTTCCGCA TCCCTTGGAA
GCACGGCTTG CGGCAGGATG CCCAGCAGGA GGACTTCGGC ATCTTCCAGG
CCTGGGCCGA GGCCAGTGGT GCCTACACTC CTGGGAAGGA TAAGCCCGAC
CTGCCCACCT GGAAGAGGAA TTTCCGGTCT GCCCTGAACC GGAAAGAAGC
ATTGCGTTTA GCAGAGGACC ACAGCAAGGA CCCCCACGAC CCACACAAGA
TCTATGAGTT TGTGACCTCA GGAGTTGGGG ACTTTCCTGA GCCAGACACC
TCTCTAGACC TCAGTGGCAG ATACAGTACC TCTGATACCC ACGAAGACAG
TCTGGATAAG TTACTAAGTG GCATGGACTT GGCCTCGGAT GCAGGGCCCC
CGAGCCTGAC CCTGGCCCTC GAGCAGCCCC CTCAGCTCTC CCTGAGCCCC
AGTGTAGACG CCCCCGCTTC TTGCCCCAAC CTGGGAGTCC GTGAAAACCC
ACTGAAGCAG CTGCTGGCGA ATGACGACGA GTGGGAGTTC CAGGTGACCG
TCTTCTACCG GGGCTGCCAA GTCTTCCAGC AGACTGTCTG CAGCCCGGGG
GGCCTGCGGC TGGTGGGATC CCAGGCCGAG GACGGGACGC TGGCCGGGC

Search to ncbiHGDS database

Query= 20030531C-000541 (20030531C-000541) 20030531C-000541
         (999 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22050993|ref|NT_011109.12|Hs19_11266 Homo sapiens chromosome...   184  6e-44
Alignment   gi|22069102|ref|NT_010635.9|Hs16_10792 Homo sapiens chromosome ...    46  0.037
Alignment   gi|22057317|ref|NT_029419.7|Hs12_29578 Homo sapiens chromosome ...    42  0.58
Alignment   gi|22055351|ref|NT_011598.6|HsX_11755 Homo sapiens chromosome X...    40  2.3
Alignment   gi|22063448|ref|NT_007819.10|Hs7_7976 Homo sapiens chromosome 7...    40  2.3
Alignment   gi|22042978|ref|NT_006111.12|Hs4_6268 Homo sapiens chromosome 4...    40  2.3
Alignment   gi|22042164|ref|NT_022865.10|Hs4_23021 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22070425|ref|NT_035372.1|Hs16_35534 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22060764|ref|NT_009654.11|Hs12_9811 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22066343|ref|NT_009237.12|Hs11_9394 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22061729|ref|NT_028309.7|Hs11_28468 Homo sapiens chromosome ...    40  2.3
Alignment   gi|22059389|ref|NT_025965.8|HsX_26121 Homo sapiens chromosome X...    38  9.0
Alignment   gi|22058506|ref|NT_025273.10|HsX_25429 Homo sapiens chromosome ...    38  9.0
Alignment   gi|22046160|ref|NT_029366.6|Hs9_29525 Homo sapiens chromosome 9...    38  9.0
Alignment   gi|22046838|ref|NT_023726.10|Hs8_23882 Homo sapiens chromosome ...    38  9.0
Alignment   gi|22058028|ref|NT_007299.10|Hs6_7456 Homo sapiens chromosome 6...    38  9.0
Alignment   gi|22057384|ref|NT_034880.1|Hs6_35042 Homo sapiens chromosome 6...    38  9.0
Alignment   gi|22056350|ref|NT_033944.2|Hs6_34099 Homo sapiens chromosome 6...    38  9.0
Alignment   gi|22048135|ref|NT_029289.6|Hs5_29448 Homo sapiens chromosome 5...    38  9.0
Alignment   gi|22047850|ref|NT_023195.10|Hs5_23351 Homo sapiens chromosome ...    38  9.0


>gi|22050993|ref|NT_011109.12|Hs19_11266 Homo sapiens chromosome 19
               reference genomic contig
          Length = 9762230

 Score =  184 bits (93), Expect = 6e-44
 Identities = 156/177 (88%)
 Strand = Plus / Minus


Query: 446     ccaggcctgggccgaggccagtggtgcctacactcctgggaaggataagcccgacctgcc 505
               |||||||||||||||||||| |||||| ||   ||| |||| ||||||||| ||||||||
Sbjct: 6307380 ccaggcctgggccgaggccactggtgcatatgttcccgggagggataagccagacctgcc 6307321


Query: 506     cacctggaagaggaatttccggtctgccctgaaccggaaagaagcattgcgtttagcaga 565
                |||||||||||||||||||| |||||||| ||||| |||||||  ||||||||||||||
Sbjct: 6307320 aacctggaagaggaatttccgctctgccctcaaccgcaaagaagggttgcgtttagcaga 6307261


Query: 566     ggaccacagcaaggacccccacgacccacacaagatctatgagtttgtgacctcagg 622
               |||||  ||||||||||| ||||||||||| || ||||| |||||||||| ||||||
Sbjct: 6307260 ggaccggagcaaggaccctcacgacccacataaaatctacgagtttgtgaactcagg 6307204


 Score =  174 bits (88), Expect = 6e-41
 Identities = 148/168 (88%)
 Strand = Plus / Minus


Query: 283     ccatgggaactcagaagcctcggatcctgccctggctgatatctcagctgaaccaggggc 342
               |||||||||| |  ||||| |||||||||||||||||| | || |||||| ||| |||||
Sbjct: 6308702 ccatgggaaccccaaagccacggatcctgccctggctggtgtcgcagctggacctggggc 6308643


Query: 343     aactggagggcgtggcctggctggatgagggccacacgcgcttccgcatcccttggaagc 402
               |||||||||||||||||||| || |  || ||| ||||||||||||||||||||||||||
Sbjct: 6308642 aactggagggcgtggcctgggtgaacaagagccgcacgcgcttccgcatcccttggaagc 6308583


Query: 403     acggcttgcggcaggatgcccagcaggaggacttcggcatcttccagg 450
               ||||| | ||||||||||| ||||||||||| ||||| ||||||||||
Sbjct: 6308582 acggcctacggcaggatgcacagcaggaggatttcggaatcttccagg 6308535


 Score =  105 bits (53), Expect = 5e-20
 Identities = 80/89 (89%)
 Strand = Plus / Minus


Query: 879     gagtgggagttccaggtgaccgtcttctaccggggctgccaagtcttccagcagactgtc 938
               |||||||||||| ||||||| | ||||||||||||| |||||||||||||||||||  ||
Sbjct: 6306191 gagtgggagttcgaggtgacagccttctaccggggccgccaagtcttccagcagaccatc 6306132


Query: 939     tgcagcccggggggcctgcggctggtggg 967
               | | |||||| ||||||||||||||||||
Sbjct: 6306131 tcctgcccggagggcctgcggctggtggg 6306103


 Score = 48.1 bits (24), Expect = 0.009
 Identities = 33/36 (91%)
 Strand = Plus / Minus


Query: 619     caggagttggggactttcctgagccagacacctctc 654
               ||||||||||||||||| |  |||||||||||||||
Sbjct: 6307123 caggagttggggacttttcccagccagacacctctc 6307088



>gi|22069102|ref|NT_010635.9|Hs16_10792 Homo sapiens chromosome 16
              reference genomic contig
          Length = 2263850

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 23/23 (100%)
 Strand = Plus / Plus


Query: 209    ctgggtttctgggttcctgggtt 231
              |||||||||||||||||||||||
Sbjct: 594267 ctgggtttctgggttcctgggtt 594289



>gi|22057317|ref|NT_029419.7|Hs12_29578 Homo sapiens chromosome 12
              reference genomic contig
          Length = 2668223

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 2      aaagggcatgatgggcgggggagtt 26
              |||| ||||||||||||||||||||
Sbjct: 273482 aaagtgcatgatgggcgggggagtt 273458



>gi|22055351|ref|NT_011598.6|HsX_11755 Homo sapiens chromosome X
             reference genomic contig
          Length = 131240

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 642   ccagacacctctctagacct 661
             ||||||||||||||||||||
Sbjct: 45303 ccagacacctctctagacct 45322



>gi|22063448|ref|NT_007819.10|Hs7_7976 Homo sapiens chromosome 7 reference
               genomic contig
          Length = 47428039

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 202     gggttttctgggtttctgggttcc 225
               |||||| |||||||||||||||||
Sbjct: 4376669 gggtttactgggtttctgggttcc 4376646


 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 614     gacctcaggagttggggac 632
               |||||||||||||||||||
Sbjct: 1973881 gacctcaggagttggggac 1973899



>gi|22042978|ref|NT_006111.12|Hs4_6268 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 1437204

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 824     ccccaacctgggagtccgtg 843
               ||||||||||||||||||||
Sbjct: 1322323 ccccaacctgggagtccgtg 1322304



>gi|22042164|ref|NT_022865.10|Hs4_23021 Homo sapiens chromosome 4
              reference genomic contig
          Length = 1105337

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 210    tgggtttctgggttcctgggttcc 233
              |||||| |||||||||||||||||
Sbjct: 103901 tgggttcctgggttcctgggttcc 103878



>gi|22070425|ref|NT_035372.1|Hs16_35534 Homo sapiens chromosome 16
              reference genomic contig
          Length = 503384

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 202    gggttttctgggtttctgggttcc 225
              |||||||||| |||||||||||||
Sbjct: 254600 gggttttctgagtttctgggttcc 254577



>gi|22060764|ref|NT_009654.11|Hs12_9811 Homo sapiens chromosome 12
              reference genomic contig
          Length = 1260689

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 209    ctgggtttctgggttcctgg 228
              ||||||||||||||||||||
Sbjct: 141488 ctgggtttctgggttcctgg 141469



>gi|22066343|ref|NT_009237.12|Hs11_9394 Homo sapiens chromosome 11 reference
               genomic contig
          Length = 10629579

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 779     ccctcagctctccctgagcc 798
               ||||||||||||||||||||
Sbjct: 4279923 ccctcagctctccctgagcc 4279942



>gi|22061729|ref|NT_028309.7|Hs11_28468 Homo sapiens chromosome 11 reference
               genomic contig
          Length = 2043862

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 848     cccactgaagcagctgctgg 867
               ||||||||||||||||||||
Sbjct: 1029378 cccactgaagcagctgctgg 1029397



>gi|22059389|ref|NT_025965.8|HsX_26121 Homo sapiens chromosome X reference
               genomic contig
          Length = 1602779

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 128     tctaaaactcagctgacgagaag 150
               ||||||||||||||||| |||||
Sbjct: 1178647 tctaaaactcagctgacaagaag 1178625



>gi|22058506|ref|NT_025273.10|HsX_25429 Homo sapiens chromosome X reference
               genomic contig
          Length = 4349943

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 98      tcaagaaatcaacagaaaa 116
               |||||||||||||||||||
Sbjct: 1491660 tcaagaaatcaacagaaaa 1491678



>gi|22046160|ref|NT_029366.6|Hs9_29525 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 6463790

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 211     gggtttctgggttcctgggttcc 233
               ||||| |||||||||||||||||
Sbjct: 4130057 gggttcctgggttcctgggttcc 4130035



>gi|22046838|ref|NT_023726.10|Hs8_23882 Homo sapiens chromosome 8
              reference genomic contig
          Length = 942137

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 315    tggctgatatctcagctga 333
              |||||||||||||||||||
Sbjct: 711730 tggctgatatctcagctga 711748



>gi|22058028|ref|NT_007299.10|Hs6_7456 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 12331746

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 309      ctgccctggctgatatctc 327
                |||||||||||||||||||
Sbjct: 11369624 ctgccctggctgatatctc 11369606



>gi|22057384|ref|NT_034880.1|Hs6_35042 Homo sapiens chromosome 6 reference
              genomic contig
          Length = 9104287

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 383    cttccgcatcccttggaagcacg 405
              |||||||||||| ||||||||||
Sbjct: 333299 cttccgcatcccctggaagcacg 333321



>gi|22056350|ref|NT_033944.2|Hs6_34099 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 19894959

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 440      catcttccaggcctgggcc 458
                |||||||||||||||||||
Sbjct: 14931883 catcttccaggcctgggcc 14931901



>gi|22048135|ref|NT_029289.6|Hs5_29448 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 3609826

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 605     tgagtttgtgacctcagga 623
               |||||||||||||||||||
Sbjct: 1066086 tgagtttgtgacctcagga 1066068



>gi|22047850|ref|NT_023195.10|Hs5_23351 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 4409808

 Score = 38.2 bits (19), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 106     tcaacagaaaacaagtcccacct 128
               |||||||||| ||||||||||||
Sbjct: 2017533 tcaacagaaagcaagtcccacct 2017511


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 999
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 978
effective length of database: 2,826,363,332
effective search space: 2764183338696
effective search space used: 2764183338696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)