Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-001710


Query

>20030531C-001710 (20030531C-001710) 20030531C-001710
AGCAGCCTCG GGGCGGGGTG GGCGGGTGCA CTCCGGCGCG GACGCCGGTG
AGGGGGCGTG TTCCCCGTGC CCGGCGGCTG CCCGCGGGAC CCCCGAGGGC
CCTCCCGGGC TCCCGGTGCG ACCATGGCGC GGAGCCTCCG GAACTGGCTG
GGCGGCTGCC TACTGGTGTC AGCATTAGGA ATGGTGGTGC CACCTCCTGA
AAACGTCAGA ATGAATTCAG TTAATTTCAA GAACATTCTC CAGTGGGACT
CACCTGCTTT TCCCCAGGGG GATCTGACCT TCACAGCTCA GTATCACAGT
TATAGGCAAT TCCAGGATCA GTGTGTGAGC ATCATCTTGA CGGAGTGTGA
TTTCTCAAGT CTTTCCAAGT ACGGTGACCA CATCTTAAGA GTCAGGGCTG
AATTTGCAGA CGAGCATTCA GACTGGATAA ACATCACCTT CTGTCCTGTG
GATGACACCA TTATTGGACC TCCTGGAATG CAAGTAGAGG CACTTGCGAA
TTCTTTACAT ATGCGTTTCT TAGCCCCCAA AATTGAGAAT GAACCTGAAA
CATGGACTGT GAGGAATATT TATAACTCAT GGGCTTATCA TGTGCAATAT
TGGAAGAATG GCTCCGATGA AAAGTTTGCA GTTACCGCCC AGTATGACTT
CGAGGTCCTT CGAAATCTGG AGTCATCCAC AACTTACTGT GTTCAAGTCC
GAGCGTTTCT TCCCGATCGG AACAAAACCG GGGAATGGAG TGATCCTGTC
TGTGGGCAGA CGACCAATGA CGAAACCACC CCCACCTGGA TCGTGGCCTG
TGTCCTGGCC GCCTCGGTGG TCGCCGCCTT CCTGCTGCTC CCTCGCTGCT
TCATCTTGCT

Search to ncbiHGDS database

Query= 20030531C-001710 (20030531C-001710) 20030531C-001710
         (860 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22067223|ref|NT_011512.6|Hs21_11669 Homo sapiens chromosome ...   194  6e-47
Alignment   gi|22050629|ref|NT_006431.10|Hs5_6588 Homo sapiens chromosome 5...    44  0.13
Alignment   gi|22044385|ref|NT_004350.12|Hs1_4507 Homo sapiens chromosome 1...    42  0.50
Alignment   gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6...    40  2.0
Alignment   gi|22052197|ref|NT_011196.10|Hs19_11353 Homo sapiens chromosome...    40  2.0
Alignment   gi|22046160|ref|NT_029366.6|Hs9_29525 Homo sapiens chromosome 9...    38  7.7
Alignment   gi|22048298|ref|NT_029973.5|Hs5_30228 Homo sapiens chromosome 5...    38  7.7
Alignment   gi|22042875|ref|NT_006081.12|Hs4_6238 Homo sapiens chromosome 4...    38  7.7
Alignment   gi|16168698|ref|NT_011520.8|Hs22_11677 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22042709|ref|NT_034481.1|Hs2_34643 Homo sapiens chromosome 2...    38  7.7
Alignment   gi|22069743|ref|NT_033288.2|Hs16_33464 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22069102|ref|NT_010635.9|Hs16_10792 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22068766|ref|NT_010552.10|Hs16_10709 Homo sapiens chromosome...    38  7.7
Alignment   gi|22062213|ref|NT_009781.12|Hs12_9938 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22063402|ref|NT_033899.2|Hs11_34054 Homo sapiens chromosome ...    38  7.7
Alignment   gi|22042225|ref|NT_029862.7|Hs1_30117 Homo sapiens chromosome 1...    38  7.7


>gi|22067223|ref|NT_011512.6|Hs21_11669 Homo sapiens chromosome 21 reference
                genomic contig
          Length = 28515771

 Score =  194 bits (98), Expect = 6e-47
 Identities = 116/122 (95%)
 Strand = Plus / Plus


Query: 336      cttgacggagtgtgatttctcaagtctttccaagtacggtgaccacatcttaagagtcag 395
                ||||||||| |||||||||||||||||||||||||| |||||||||| ||| ||||||||
Sbjct: 20226332 cttgacggaatgtgatttctcaagtctttccaagtatggtgaccacaccttgagagtcag 20226391


Query: 396      ggctgaatttgcagacgagcattcagactggataaacatcaccttctgtcctgtggatga 455
                ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 20226392 ggctgaatttgcagatgagcattcagactgggtaaacatcaccttctgtcctgtggatga 20226451


Query: 456      ca 457
                ||
Sbjct: 20226452 ca 20226453


 Score =  159 bits (80), Expect = 3e-36
 Identities = 131/148 (88%)
 Strand = Plus / Plus


Query: 458      ccattattggacctcctggaatgcaagtagaggcacttgcgaattctttacatatgcgtt 517
                ||||||||||||| ||||||||||||||||| | ||||||  ||||||||||||||||||
Sbjct: 20229452 ccattattggaccccctggaatgcaagtagaagtacttgctgattctttacatatgcgtt 20229511


Query: 518      tcttagcccccaaaattgagaatgaacctgaaacatggactgtgaggaatatttataact 577
                |||||||||| |||||||||||||||   ||||| |||||| ||| |||| | |||||||
Sbjct: 20229512 tcttagcccctaaaattgagaatgaatacgaaacttggactatgaagaatgtgtataact 20229571


Query: 578      catgggcttatcatgtgcaatattggaa 605
                ||||| ||||| |||||||||| |||||
Sbjct: 20229572 catggacttataatgtgcaatactggaa 20229599


 Score =  125 bits (63), Expect = 4e-26
 Identities = 117/135 (86%)
 Strand = Plus / Plus


Query: 638      cccagtatgacttcgaggtccttcgaaatctggagtcatccacaacttactgtgttcaag 697
                ||||||||||||| ||||||||  |||| |||||| |||  |||||||| ||||||||||
Sbjct: 20232807 cccagtatgactttgaggtcctcagaaacctggagccatggacaacttattgtgttcaag 20232866


Query: 698      tccgagcgtttcttcccgatcggaacaaaaccggggaatggagtgatcctgtctgtgggc 757
                | |||| ||||||||| |||||||||||| | |||||||||||||| |||||||||| ||
Sbjct: 20232867 ttcgagggtttcttcctgatcggaacaaagctggggaatggagtgagcctgtctgtgagc 20232926


Query: 758      agacgaccaatgacg 772
                | || ||| ||||||
Sbjct: 20232927 aaacaacccatgacg 20232941


 Score =  121 bits (61), Expect = 7e-25
 Identities = 97/109 (88%)
 Strand = Plus / Plus


Query: 185      tggtgccacctcctgaaaacgtcagaatgaattcagttaatttcaagaacattctccagt 244
                |||| |||||||| ||||| |||||||||||||| |||||||||||||||||||| ||||
Sbjct: 20218103 tggtaccacctcccgaaaatgtcagaatgaattctgttaatttcaagaacattctacagt 20218162


Query: 245      gggactcacctgcttttccccagggggatctgaccttcacagctcagta 293
                |||| |||||||||||| || | ||| | ||||| ||||||||||||||
Sbjct: 20218163 gggagtcacctgcttttgccaaagggaacctgactttcacagctcagta 20218211



>gi|22050629|ref|NT_006431.10|Hs5_6588 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 19491418

 Score = 44.1 bits (22), Expect = 0.13
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 588     tcatgtgcaatattggaagaat 609
               ||||||||||||||||||||||
Sbjct: 6264997 tcatgtgcaatattggaagaat 6264976



>gi|22044385|ref|NT_004350.12|Hs1_4507 Homo sapiens chromosome 1 reference
              genomic contig
          Length = 2112206

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 75     cggctgcccgcgggacccccg 95
              |||||||||||||||||||||
Sbjct: 523855 cggctgcccgcgggacccccg 523875



>gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 48753116

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 41       gacgccggtgagggggcgtg 60
                ||||||||||||||||||||
Sbjct: 27756834 gacgccggtgagggggcgtg 27756815


 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 741     tgatcctgtctgtgggcaga 760
               ||||||||||||||||||||
Sbjct: 3179057 tgatcctgtctgtgggcaga 3179038



>gi|22052197|ref|NT_011196.10|Hs19_11353 Homo sapiens chromosome 19
               reference genomic contig
          Length = 7901404

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 826     gccttcctgctgctccctcgctgc 849
               ||||||||||| ||||||||||||
Sbjct: 6155794 gccttcctgctcctccctcgctgc 6155817



>gi|22046160|ref|NT_029366.6|Hs9_29525 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 6463790

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 177     aggaatggtggtgccacct 195
               |||||||||||||||||||
Sbjct: 5691944 aggaatggtggtgccacct 5691926



>gi|22048298|ref|NT_029973.5|Hs5_30228 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 5165300

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 209     gaatgaattcagttaattt 227
               |||||||||||||||||||
Sbjct: 3135863 gaatgaattcagttaattt 3135881



>gi|22042875|ref|NT_006081.12|Hs4_6238 Homo sapiens chromosome 4 reference
              genomic contig
          Length = 1050957

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 616    gatgaaaagtttgcagtta 634
              |||||||||||||||||||
Sbjct: 810566 gatgaaaagtttgcagtta 810548


 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 772     gaaaccacccccacctgga 790
               |||||||||||||||||||
Sbjct: 1006376 gaaaccacccccacctgga 1006394



>gi|16168698|ref|NT_011520.8|Hs22_11677 Homo sapiens chromosome 22 reference
                genomic contig
          Length = 23083944

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 75       cggctgcccgcgggacccc 93
                |||||||||||||||||||
Sbjct: 18066779 cggctgcccgcgggacccc 18066797



>gi|22042709|ref|NT_034481.1|Hs2_34643 Homo sapiens chromosome 2 reference
              genomic contig
          Length = 562113

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 313    caggatcagtgtgtgagcatcat 335
              |||||||||||||||| ||||||
Sbjct: 326187 caggatcagtgtgtgaccatcat 326165



>gi|22069743|ref|NT_033288.2|Hs16_33464 Homo sapiens chromosome 16
              reference genomic contig
          Length = 1587798

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 679    acaacttactgtgttcaag 697
              |||||||||||||||||||
Sbjct: 938675 acaacttactgtgttcaag 938693



>gi|22069102|ref|NT_010635.9|Hs16_10792 Homo sapiens chromosome 16 reference
               genomic contig
          Length = 2263850

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 167     tgtcagcattaggaatggt 185
               |||||||||||||||||||
Sbjct: 2106435 tgtcagcattaggaatggt 2106417



>gi|22068766|ref|NT_010552.10|Hs16_10709 Homo sapiens chromosome 16
               reference genomic contig
          Length = 6839154

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 822     cgccgccttcctgctgctc 840
               |||||||||||||||||||
Sbjct: 2059535 cgccgccttcctgctgctc 2059553



>gi|22062213|ref|NT_009781.12|Hs12_9938 Homo sapiens chromosome 12
              reference genomic contig
          Length = 5576829

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 521    tagcccccaaaattgagaa 539
              |||||||||||||||||||
Sbjct: 190840 tagcccccaaaattgagaa 190822



>gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome 12 reference
               genomic contig
          Length = 3995937

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 826     gccttcctgctgctccctc 844
               |||||||||||||||||||
Sbjct: 3569990 gccttcctgctgctccctc 3569972



>gi|22063402|ref|NT_033899.2|Hs11_34054 Homo sapiens chromosome 11 reference
                genomic contig
          Length = 14510482

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 25/27 (92%)
 Strand = Plus / Minus


Query: 491      cacttgcgaattctttacatatgcgtt 517
                ||||||||||||| |||||||| ||||
Sbjct: 13978363 cacttgcgaattccttacatattcgtt 13978337



>gi|22042225|ref|NT_029862.7|Hs1_30117 Homo sapiens chromosome 1 reference
               genomic contig
          Length = 4719077

 Score = 38.2 bits (19), Expect = 7.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus


Query: 542     aacctgaaacatggactgtgagg 564
               |||||||||||||||||| ||||
Sbjct: 3309640 aacctgaaacatggactgagagg 3309618


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 860
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 839
effective length of database: 2,826,363,332
effective search space: 2371318835548
effective search space used: 2371318835548
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)