Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-003018


Query

>20030531C-003018 (20030531C-003018) 20030531C-003018
AGACACGCCT GCAGACATTC CCTGGGAAAG GGCAAGCAGC AGCCAGGTGT
GAATGAGGCA GGATGAACTG GACAGGTCTG TACACCTTGC TCAGTGGCGT
GAACCGGCAT TCTACTGCCA TTGGCCGAGT ATGGCTCTCA GTCATCTTCA
TCTTCAGAAT CATGGTGCTG GTGGTGGCTG CAGAGAGTGT GTGGGGTGAT
GAGAAATCTT CCTTCATCTG CAACACCCTC CAGCCTGGCT GCAACAGCGT
CTGCTACGAC CACTTTTTCC CCATCTCCCA TGTGCGTCTG TGGTCTCTGC
AGCTCATCTT GGTTTCCACC CCAGCTCTTC TCGTGGCCAT GCACGTGGCT
CACCAGCAGC ACATAGAAAA GAAAATGCTG CGACTTGAGG GCCATGCCGA
CCCCCTCCAC CTGGAGGAGG TGAAGAGGCA CAAGGTCCAC ATCTCAGGGA
CGCTGTGGTG GACCTACGTC ATCAGCGTGG TCTTCCGGCT GCTGTTCGAG
GCCGCCTTCA TGTACGTCTT TTATCTGCTC TACCCTGGCT ATGCCATGGT
GCGGTTGGTG AAGTGTGAGG CCTACCCCTG CCCCAACACA GTGGACTGCT
TTGTGTCCCG CCCCACCGAG AAGACCGTCT TCACCGTCTT CATGCTGGCC
GCCTCCGGCA TCTGCATCAT CCTCAATGTG GCCGAGGTGG TGTACCTCAT
CTTCCGGGCC TGCGCCCGCC GAGCCCAGCG CCGCTCCAAT CCGCCCTCCC
GCAAGGGCTC GGGGGGCTTC GGCCACCGCC TCTCACCTGA ATACAAGCAG
AACGAGATCA ACAAGCTGCT GAGCGAGCAG GACGGCTCCC TGAAAGACAT
ACTGCGCCGC AGCCCCGGTA CCGGGGCTGG GCTGGCGGAA AAGAGCGACC
GCTGCTCAGC CTGCTGATGC CACAGACCAG GCAACCTCCC ATCCTGCCCC
TCCACCCTGG CCCCGGGGCT GCCCCTCCTT CTCCCCTGCC GGCTGGCTGA
GCAGGCCTCT GCCTGCGAGG GATTTGCTCC ATCAAAACCC TCCTTCCCTT
CTTCTAGG

Search to ncbiHGDS database

Query= 20030531C-003018 (20030531C-003018) 20030531C-003018
         (1058 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22058381|ref|NT_019696.9|HsX_19852 Homo sapiens chromosome X...  1388  0.0
Alignment   gi|22053857|ref|NT_009799.10|Hs13_9956 Homo sapiens chromosome ...    90  3e-15
Alignment   gi|22045328|ref|NT_004511.12|Hs1_4668 Homo sapiens chromosome 1...    60  3e-06
Alignment   gi|22065129|ref|NT_024901.10|Hs17_25057 Homo sapiens chromosome...    50  0.003
Alignment   gi|22043791|ref|NT_034400.1|Hs1_34562 Homo sapiens chromosome 1...    48  0.010
Alignment   gi|17484369|ref|NT_011362.7|Hs20_11519 Homo sapiens chromosome ...    44  0.15
Alignment   gi|22063928|ref|NT_033903.2|Hs11_34058 Homo sapiens chromosome ...    44  0.15
Alignment   gi|22056350|ref|NT_033944.2|Hs6_34099 Homo sapiens chromosome 6...    42  0.61
Alignment   gi|16168698|ref|NT_011520.8|Hs22_11677 Homo sapiens chromosome ...    42  0.61
Alignment   gi|22058050|ref|NT_035325.1|Hs15_35487 Homo sapiens chromosome ...    42  0.61
Alignment   gi|22065966|ref|NT_009151.12|Hs11_9308 Homo sapiens chromosome ...    42  0.61
Alignment   gi|22061139|ref|NT_007627.9|Hs6_7784 Homo sapiens chromosome 6 ...    40  2.4
Alignment   gi|22054609|ref|NT_025741.9|Hs6_25897 Homo sapiens chromosome 6...    40  2.4
Alignment   gi|22052573|ref|NT_006802.10|Hs5_6959 Homo sapiens chromosome 5...    40  2.4
Alignment   gi|22067415|ref|NT_011515.8|Hs21_11672 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22041195|ref|NT_022135.10|Hs2_22291 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22060079|ref|NT_024997.8|Hs18_25153 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22069010|ref|NT_010604.10|Hs16_10761 Homo sapiens chromosome...    40  2.4
Alignment   gi|22048717|ref|NT_025892.9|Hs14_26048 Homo sapiens chromosome ...    40  2.4
Alignment   gi|22060932|ref|NT_009681.12|Hs12_9838 Homo sapiens chromosome ...    40  2.4


>gi|22058381|ref|NT_019696.9|HsX_19852 Homo sapiens chromosome X reference
               genomic contig
          Length = 3162719

 Score = 1388 bits (700), Expect = 0.0
 Identities = 933/1006 (92%), Gaps = 11/1006 (1%)
 Strand = Plus / Plus


Query: 44      caggtgtgaatgaggcaggatgaactggacaggtctgtacaccttgctcagtggcgtgaa 103
               |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2656840 caggtgtgaatgaggcaggatgaactggacaggtttgtacaccttgctcagtggcgtgaa 2656899


Query: 104     ccggcattctactgccattggccgagtatggctctcagtcatcttcatcttcagaatcat 163
               |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 2656900 ccggcattctactgccattggccgagtatggctctcggtcatcttcatcttcagaatcat 2656959


Query: 164     ggtgctggtggtggctgcagagagtgtgtggggtgatgagaaatcttccttcatctgcaa 223
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2656960 ggtgctggtggtggctgcagagagtgtgtggggtgatgagaaatcttccttcatctgcaa 2657019


Query: 224     caccctccagcctggctgcaacagcgtctgctacgaccactttttccccatctcccatgt 283
               ||| ||||||||||||||||||||||| ||||| ||||| || |||||||||||||||||
Sbjct: 2657020 cacactccagcctggctgcaacagcgtttgctatgaccaattcttccccatctcccatgt 2657079


Query: 284     gcgtctgtggtctctgcagctcatcttggtttccaccccagctcttctcgtggccatgca 343
               ||| |||||||| |||||||||||| | ||||||||||||||||| ||||||||||||||
Sbjct: 2657080 gcggctgtggtccctgcagctcatcctagtttccaccccagctctcctcgtggccatgca 2657139


Query: 344     cgtggctcaccagcagcacatagaaaagaaaatgctgcgacttgagggccatgccgaccc 403
               ||||||||||||||| |||||||| ||||||||||| || |||||||||||||  |||||
Sbjct: 2657140 cgtggctcaccagcaacacatagagaagaaaatgctacggcttgagggccatggggaccc 2657199


Query: 404     cctccacctggaggaggtgaagaggcacaaggtccacatctcagggacgctgtggtggac 463
               ||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 2657200 cctacacctggaggaggtgaagaggcacaaggtccacatctcagggacactgtggtggac 2657259


Query: 464     ctacgtcatcagcgtggtcttccggctgctgttcgaggccgccttcatgtacgtctttta 523
               ||| |||||||||||||| ||||||||| |||| ||||||| ||||||||| ||||||||
Sbjct: 2657260 ctatgtcatcagcgtggtgttccggctgttgtttgaggccgtcttcatgtatgtctttta 2657319


Query: 524     tctgctctaccctggctatgccatggtgcggttggtgaagtgtgaggcctacccctgccc 583
               ||||||||||||||||||||||||||||||| |||| ||||| || | ||||||||||||
Sbjct: 2657320 tctgctctaccctggctatgccatggtgcggctggtcaagtgcgacgtctacccctgccc 2657379


Query: 584     caacacagtggactgctttgtgtcccgccccaccgagaagaccgtcttcaccgtcttcat 643
               |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2657380 caacacagtggactgcttcgtgtcccgccccaccgagaaaaccgtcttcaccgtcttcat 2657439


Query: 644     gctggccgcctccggcatctgcatcatcctcaatgtggccgaggtggtgtacctcatctt 703
               ||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 2657440 gctagctgcctctggcatctgcatcatcctcaatgtggccgaggtggtgtacctcatcat 2657499


Query: 704     ccgggcctgcgcccgccgagcccagcgccgctccaatccgccctcccgcaagggctcggg 763
               ||||||||| ||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 2657500 ccgggcctgtgcccgccgagcccagcgccgctccaatccaccttcccgcaagggctc--- 2657556


Query: 764     gggcttcggccaccgcctctcacctgaatacaagcagaacgagatcaacaagctgctgag 823
               ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 2657557 gggcttcggccaccgcctctcacctgaatacaagcagaatgagatcaacaagctgctgag 2657616


Query: 824     cgagcaggacggctccctgaaagacatactgcgccgcagccccggtaccggggctgggct 883
                |||||||| |||||||||||||||||||||||||||||||| || ||||||||||||||
Sbjct: 2657617 tgagcaggatggctccctgaaagacatactgcgccgcagccctggcaccggggctgggct 2657676


Query: 884     ggcggaaaagagcgaccgctgctcagcctgctgatgccacagaccaggcaacctcccatc 943
               ||| |||||||||||||||||||| |||||||||||||||| ||||||||||||||||||
Sbjct: 2657677 ggctgaaaagagcgaccgctgctcggcctgctgatgccacataccaggcaacctcccatc 2657736


Query: 944     ctgcccctccaccctggccccggggctgcccctccttctcccctgccggctggctgagca 1003
               |  |||| | ||||| |||| |||   ||||||||||||||||||||||     ||  ||
Sbjct: 2657737 ccacccc-cgaccct-gccctgggcgagcccctccttctcccctgccgg-----tgcaca 2657789


Query: 1004    ggcctctgcctgcgagggatttgctccatcaaaaccctccttccct 1049
               |||||||||||||  |||| || ||| ||||||||| |||||||||
Sbjct: 2657790 ggcctctgcctgctgggga-ttactcgatcaaaaccttccttccct 2657834


 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 49/51 (96%), Gaps = 1/51 (1%)
 Strand = Plus / Plus


Query: 1       agacacgcctgcagacattccctgggaaagggcaagcagcagccaggtgtg 51
               |||||||||||||||||||| |||||||||||| |||||||||||||||||
Sbjct: 2648378 agacacgcctgcagacattctctgggaaagggc-agcagcagccaggtgtg 2648427



>gi|22053857|ref|NT_009799.10|Hs13_9956 Homo sapiens chromosome 13 reference
               genomic contig
          Length = 12392129

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 111/133 (83%)
 Strand = Plus / Minus


Query: 217     tctgcaacaccctccagcctggctgcaacagcgtctgctacgaccactttttccccatct 276
               ||||||||||||| ||||| |||||||| | ||| |||||||| ||||  ||||||||||
Sbjct: 1743565 tctgcaacaccctgcagccaggctgcaagaacgtgtgctacgatcactacttccccatct 1743506


Query: 277     cccatgtgcgtctgtggtctctgcagctcatcttggtttccaccccagctcttctcgtgg 336
               ||||  | || || ||| | |||||||| ||||| || ||||| ||||| || || ||||
Sbjct: 1743505 cccacatccggctatgggccctgcagctgatcttcgtgtccacgccagcgctcctagtgg 1743446


Query: 337     ccatgcacgtggc 349
               |||||||||||||
Sbjct: 1743445 ccatgcacgtggc 1743433


 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus


Query: 582     cccaacacagtggactgctttgtgtcccgccccaccgagaagaccgtcttcaccgtcttc 641
               |||||||| |||||||||||||||||||| ||||| |||||||| |||||||| || |||
Sbjct: 1743197 cccaacactgtggactgctttgtgtcccggcccacggagaagactgtcttcacagtgttc 1743138


Query: 642     atg 644
               |||
Sbjct: 1743137 atg 1743135


 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus


Query: 576     ccctgccccaacacagtggactgctttgtgtcccgccccaccgagaagaccgtcttcacc 635
               |||||||||||||| |||||||||||  | ||| | ||||| ||||||||| |||||| |
Sbjct: 1696874 ccctgccccaacacggtggactgcttcatctccaggcccacggagaagaccatcttcatc 1696815


Query: 636     gtcttcatgctggc 649
                |||||||||||||
Sbjct: 1696814 atcttcatgctggc 1696801


 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 80/98 (81%)
 Strand = Plus / Minus


Query: 252     tgctacgaccactttttccccatctcccatgtgcgtctgtggtctctgcagctcatcttg 311
               ||||| ||||||||||||||  | |||||  | || |||||| | || ||||| |||||
Sbjct: 1777429 tgctatgaccactttttcccggtgtcccacatccggctgtgggccctccagctgatcttc 1777370


Query: 312     gtttccaccccagctcttctcgtggccatgcacgtggc 349
               || ||||||||||| || || ||||||||||| |||||
Sbjct: 1777369 gtctccaccccagcgctgctggtggccatgcatgtggc 1777332


 Score = 42.1 bits (21), Expect = 0.61
 Identities = 42/49 (85%)
 Strand = Plus / Minus


Query: 212     cttcatctgcaacaccctccagcctggctgcaacagcgtctgctacgac 260
               ||||| |||||||||||  ||||| |||||| | | |||||||||||||
Sbjct: 1697274 cttcacctgcaacacccagcagccgggctgcgagaacgtctgctacgac 1697226



>gi|22045328|ref|NT_004511.12|Hs1_4668 Homo sapiens chromosome 1 reference
               genomic contig
          Length = 6811412

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 48/54 (88%)
 Strand = Plus / Plus


Query: 591     gtggactgctttgtgtcccgccccaccgagaagaccgtcttcaccgtcttcatg 644
               |||||||||||||| || |||||||| ||||||||| |||||| | ||||||||
Sbjct: 2564377 gtggactgctttgtctctcgccccacggagaagaccatcttcatcatcttcatg 2564430


 Score = 50.1 bits (25), Expect = 0.003
 Identities = 52/61 (85%)
 Strand = Plus / Plus


Query: 218     ctgcaacaccctccagcctggctgcaacagcgtctgctacgaccactttttccccatctc 277
               ||||||||||   ||||| ||||||| || ||||||||||||| |||  |||||||||||
Sbjct: 2554496 ctgcaacaccaagcagcccggctgcaccaacgtctgctacgacaactacttccccatctc 2554555


Query: 278     c 278
               |
Sbjct: 2554556 c 2554556


 Score = 42.1 bits (21), Expect = 0.61
 Identities = 30/33 (90%)
 Strand = Plus / Plus


Query: 171     gtggtggctgcagagagtgtgtggggtgatgag 203
               ||||||||||||||| | |||||||| ||||||
Sbjct: 2554449 gtggtggctgcagagcgcgtgtggggggatgag 2554481



>gi|22065129|ref|NT_024901.10|Hs17_25057 Homo sapiens chromosome 17
              reference genomic contig
          Length = 1405484

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 49/57 (85%)
 Strand = Plus / Minus


Query: 576    ccctgccccaacacagtggactgctttgtgtcccgccccaccgagaagaccgtcttc 632
              ||||||||  |||| || |||||||| |||  ||| |||||||||||||||||||||
Sbjct: 120359 ccctgcccgcacacggtcgactgcttcgtgagccggcccaccgagaagaccgtcttc 120303



>gi|22043791|ref|NT_034400.1|Hs1_34562 Homo sapiens chromosome 1 reference
              genomic contig
          Length = 946514

 Score = 48.1 bits (24), Expect = 0.010
 Identities = 60/72 (83%)
 Strand = Plus / Plus


Query: 189    gtgtggggtgatgagaaatcttccttcatctgcaacaccctccagcctggctgcaacagc 248
              |||||||| |||||| ||||   |||| | ||||||||||  |||||||||||| | | |
Sbjct: 920829 gtgtggggggatgagcaatccgacttcgtgtgcaacacccagcagcctggctgcgagaac 920888


Query: 249    gtctgctacgac 260
              ||||||||||||
Sbjct: 920889 gtctgctacgac 920900


 Score = 46.1 bits (23), Expect = 0.039
 Identities = 38/43 (88%)
 Strand = Plus / Plus


Query: 591    gtggactgctttgtgtcccgccccaccgagaagaccgtcttca 633
              ||||||||||| |||||||| ||||| ||||| ||| ||||||
Sbjct: 921273 gtggactgcttcgtgtcccggcccacggagaaaaccatcttca 921315


 Score = 44.1 bits (22), Expect = 0.15
 Identities = 43/50 (86%)
 Strand = Plus / Minus


Query: 231    cagcctggctgcaacagcgtctgctacgaccactttttccccatctccca 280
              |||||||||||| | |  ||||||||||||||   |||||||||||||||
Sbjct: 771792 cagcctggctgccagaatgtctgctacgaccaggctttccccatctccca 771743



>gi|17484369|ref|NT_011362.7|Hs20_11519 Homo sapiens chromosome 20 reference
               genomic contig
          Length = 24982240

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 21      cctgggaaagggcaagcagcag 42
               ||||||||||||||||||||||
Sbjct: 5657633 cctgggaaagggcaagcagcag 5657612



>gi|22063928|ref|NT_033903.2|Hs11_34058 Homo sapiens chromosome 11 reference
               genomic contig
          Length = 6368572

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 164     ggtgctggtggtggctgcagag 185
               ||||||||||||||||||||||
Sbjct: 5745270 ggtgctggtggtggctgcagag 5745291



>gi|22056350|ref|NT_033944.2|Hs6_34099 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 19894959

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 287      tctgtggtctctgcagctcat 307
                |||||||||||||||||||||
Sbjct: 11629865 tctgtggtctctgcagctcat 11629845


 Score = 40.1 bits (20), Expect = 2.4
 Identities = 35/40 (87%)
 Strand = Plus / Plus


Query: 609      cgccccaccgagaagaccgtcttcaccgtcttcatgctgg 648
                |||||||| ||||| ||| |||||| | ||||||||||||
Sbjct: 18554505 cgccccacggagaaaaccatcttcatcatcttcatgctgg 18554544



>gi|16168698|ref|NT_011520.8|Hs22_11677 Homo sapiens chromosome 22 reference
                genomic contig
          Length = 23083944

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 163      tggtgctggtggtggctgcagagag 187
                ||||||||| |||||||||||||||
Sbjct: 10182319 tggtgctggaggtggctgcagagag 10182295


 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 217      tctgcaacaccctccagcc 235
                |||||||||||||||||||
Sbjct: 17909741 tctgcaacaccctccagcc 17909723


 Score = 38.2 bits (19), Expect = 9.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 972     cccctccttctcccctgcc 990
               |||||||||||||||||||
Sbjct: 6358700 cccctccttctcccctgcc 6358682



>gi|22058050|ref|NT_035325.1|Hs15_35487 Homo sapiens chromosome 15
              reference genomic contig
          Length = 2264849

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 162    atggtgctggtggtggctgca 182
              |||||||||||||||||||||
Sbjct: 389544 atggtgctggtggtggctgca 389564



>gi|22065966|ref|NT_009151.12|Hs11_9308 Homo sapiens chromosome 11 reference
               genomic contig
          Length = 12972822

 Score = 42.1 bits (21), Expect = 0.61
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 160     tcatggtgctggtggtggctgcaga 184
               ||||||||||||||||||| |||||
Sbjct: 3696194 tcatggtgctggtggtggcagcaga 3696218



>gi|22061139|ref|NT_007627.9|Hs6_7784 Homo sapiens chromosome 6
             reference genomic contig
          Length = 533682

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 932   caacctcccatcctgcccctccac 955
             ||||||||| ||||||||||||||
Sbjct: 24640 caacctcccctcctgcccctccac 24663



>gi|22054609|ref|NT_025741.9|Hs6_25897 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 25642888

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 1035     aaaccctccttcccttcttc 1054
                ||||||||||||||||||||
Sbjct: 19959064 aaaccctccttcccttcttc 19959083



>gi|22052573|ref|NT_006802.10|Hs5_6959 Homo sapiens chromosome 5 reference
              genomic contig
          Length = 679124

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 966    gggctgcccctccttctccc 985
              ||||||||||||||||||||
Sbjct: 390398 gggctgcccctccttctccc 390417



>gi|22067415|ref|NT_011515.8|Hs21_11672 Homo sapiens chromosome 21 reference
               genomic contig
          Length = 3429374

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 713     cgcccgccgagcccagcgcc 732
               ||||||||||||||||||||
Sbjct: 1605831 cgcccgccgagcccagcgcc 1605850



>gi|22041195|ref|NT_022135.10|Hs2_22291 Homo sapiens chromosome 2 reference
               genomic contig
          Length = 16160948

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 107     gcattctactgccattggcc 126
               ||||||||||||||||||||
Sbjct: 9119760 gcattctactgccattggcc 9119779



>gi|22060079|ref|NT_024997.8|Hs18_25153 Homo sapiens chromosome 18
              reference genomic contig
          Length = 453697

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 403    ccctccacctggaggaggtg 422
              ||||||||||||||||||||
Sbjct: 208576 ccctccacctggaggaggtg 208595



>gi|22069010|ref|NT_010604.10|Hs16_10761 Homo sapiens chromosome 16
               reference genomic contig
          Length = 5675707

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 307     tcttggtttccaccccagctcttc 330
               ||||| ||||||||||||||||||
Sbjct: 2119018 tcttgctttccaccccagctcttc 2118995



>gi|22048717|ref|NT_025892.9|Hs14_26048 Homo sapiens chromosome 14 reference
                genomic contig
          Length = 46538979

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 969      ctgcccctccttctcccctg 988
                ||||||||||||||||||||
Sbjct: 11259982 ctgcccctccttctcccctg 11259963



>gi|22060932|ref|NT_009681.12|Hs12_9838 Homo sapiens chromosome 12 reference
               genomic contig
          Length = 2739920

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 413     ggaggaggtgaagaggcaca 432
               ||||||||||||||||||||
Sbjct: 1558472 ggaggaggtgaagaggcaca 1558453


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1058
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 1037
effective length of database: 2,826,363,332
effective search space: 2930938775284
effective search space used: 2930938775284
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)