Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-003029


Query

>20030531C-003029 (20030531C-003029) 20030531C-003029
TCCTTTTGTA AGAAGAGCTC AGAATCACAA GAGGGAAACT TGCCCCAAAG
ATGAGCCTCG CATGTACAAC CTTGGCCAGC TTCCTCCTGA TTTTCATTGT
TTCCAACAAA GGTACAGTCT CTCAAATTAC TGAGGTTGTC TGGGGCATCG
TGGATCAAGA CATCAACCTG GACATTCCTG AACTTTCAAA ACATGATAAC
GTAGATCATA TACGATGGCA GAAGAATGAA AACAAGATCG CAGAATTTAA
AAAAAACAAA GAAACTCACC CTGTGAAAGA CACATACATG ATGTTACCAA
ATGGAACTCT GAGAATTAAA GATCTGAAGA GAGATGATGA GGGTATCTAC
AAGGTAACTG TCTATGCTAC GGATGGAAAA CACATGCTGG AGAGAAAATT
TGATTTGCAG ATTCTAGATG GGGTCTCAAA ACCTGTAATC TCCTGGAGCT
GTGCCAACAA AACGGTGACC TGTGAGGTAG CAGAAGGAAG TGACCCTAAG
TTAAAACTGT ATGTAAATAA GTCCACTGCC AGAGAAGGTC GTCAGAAGGT
CATCCTGTGG AAGTGGAACA CCAAATGGAG CACATTATTC AAGTGTGTGG
CCAGTAACAA CGCCAGTGAG CAAATCAGCA TGGTGACCAT CAGTTGTACG
GGGCAAGGTC TGGATATCTA TCTCATCATC GGCATCTGCG GAGGAGGCAC
CGTATTCCTC ATCTTCATAG CACTACTCAT ATTCTACACC AGCAAGAGGA
AAAAGCAGAG CAGCAGGAGA AATGATGAGG AGCTGGAGAT AAGAGCGAAG
AGAGCGAGCC CCGAGGAAAG GGGCCGGAAG CCCCATCCAT TTCCAGGCTC
AACTCCTCAA AATCCGGTCA TTTCCCAAAC TCCTCCAATG CCTGGTCATC
GTTCTCAGGC ACCTACTCCT CGTCCCGGGC CTCCTGGCCC CCGTGTCCAG
CACCCACAGA AGAAGAGGCC TCCTCCTACC CCGGGCACAC AAGTTCACCA
GCAAAAAGGC CCTCCCCTCC CCAAGCCTCG AGTTCAAACA AAACCTACCC
ATGAGGCCAA AGAAAACTCA TAACTCTGTC TCCTGATGCG GTTGTCCCTT
CCCTCTAATT AAAAGAGGAC AGAAACTGTC CTTTCCTGTA AAAGGCACTG
TGGAGTTTCT CCACTCCAGG CGCGCATGCT AGCCGCTTCC ATCAAGCGTG
CTCTGCAGGG GGACCGGGAC AGCGCCCAAG CCCAGGAGCC ACAGCCCTGT
CTGTACCATC TAACTCAGCC CCGAGGCCTG ACATCTGGAG TCTCTGGCCT
CCTCCACCAC TGCAGGAAGG GAAAAACCGT CAAAGAGTAC GGATTAGGAT
GATGGGTGAC CGAGCACAAA ATCCTGGAGA TCTCTCAGCC TCTGTCTCAC
ACCATGTGCA GGCATCAGAT ATCAAGTGGA GGGTGTGGCC GTGTCTTGTT
GCAAGCAACC TGCCTGCTGG AGACATGCTT GTCATTTGCT CACCTTATGG
GGAGTAGAAG TGAAATAAAA GGCTTGACCT GACACCAGTG TTTACTCATT
GTGGAAAGGA GCCCAGCATC CAGCTACGGA ATC

Search to ncbiHGDS database

Query= 20030531C-003029 (20030531C-003029) 20030531C-003029
         (1583 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22042607|ref|NT_031697.5|Hs1_31868 Homo sapiens chromosome 1...   145  9e-32
Alignment   gi|17484914|ref|NT_011519.9|Hs22_11676 Homo sapiens chromosome ...    46  0.059
Alignment   gi|22052191|ref|NT_006713.10|Hs5_6870 Homo sapiens chromosome 5...    44  0.23
Alignment   gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8...    42  0.92
Alignment   gi|22049118|ref|NT_034769.1|Hs5_34931 Homo sapiens chromosome 5...    42  0.92
Alignment   gi|22043501|ref|NT_006204.12|Hs4_6361 Homo sapiens chromosome 4...    42  0.92
Alignment   gi|22041803|ref|NT_022184.9|Hs2_22340 Homo sapiens chromosome 2...    42  0.92
Alignment   gi|22048717|ref|NT_025892.9|Hs14_26048 Homo sapiens chromosome ...    42  0.92
Alignment   gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6...    40  3.6
Alignment   gi|22047001|ref|NT_016755.10|Hs5_16911 Homo sapiens chromosome ...    40  3.6
Alignment   gi|22059267|ref|NT_010966.10|Hs18_11123 Homo sapiens chromosome...    40  3.6
Alignment   gi|22058665|ref|NT_010859.9|Hs18_11016 Homo sapiens chromosome ...    40  3.6
Alignment   gi|22064341|ref|NT_033927.2|Hs11_34082 Homo sapiens chromosome ...    40  3.6
Alignment   gi|22063402|ref|NT_033899.2|Hs11_34054 Homo sapiens chromosome ...    40  3.6
Alignment   gi|22055424|ref|NT_008818.12|Hs10_8975 Homo sapiens chromosome ...    40  3.6
Alignment   gi|22051066|ref|NT_024037.12|Hs10_24193 Homo sapiens chromosome...    40  3.6


>gi|22042607|ref|NT_031697.5|Hs1_31868 Homo sapiens chromosome 1 reference
              genomic contig
          Length = 646087

 Score =  145 bits (73), Expect = 9e-32
 Identities = 213/259 (82%), Gaps = 3/259 (1%)
 Strand = Plus / Plus


Query: 816    gaaaggggccggaagccccatccatttccaggctcaactcctcaaaatccggtcatttcc 875
              |||||||||||||||||||| | | ||||||  ||||| ||||| ||||| |  | ||||
Sbjct: 532167 gaaaggggccggaagccccaccaaattccagcttcaacccctcagaatccagcaacttcc 532226


Query: 876    caaa---ctcctccaatgcctggtcatcgttctcaggcacctactcctcgtcccgggcct 932
              |||    ||||||||   |||||||||||||| |||||||||| || |||||||  ||||
Sbjct: 532227 caacatcctcctccaccacctggtcatcgttcccaggcacctagtcatcgtcccccgcct 532286


Query: 933    cctggcccccgtgtccagcacccacagaagaagaggcctcctcctaccccgggcacacaa 992
              ||||| | |||||| |||||||  |   |||||||||||||| || |  |||||||||||
Sbjct: 532287 cctggacaccgtgttcagcaccagcctcagaagaggcctcctgctccgtcgggcacacaa 532346


Query: 993    gttcaccagcaaaaaggccctcccctccccaagcctcgagttcaaacaaaacctacccat 1052
              ||||||||||| |||||||| ||||||||||  |||||||||||  |||||||| |||||
Sbjct: 532347 gttcaccagcagaaaggcccgcccctccccagacctcgagttcagccaaaacctccccat 532406


Query: 1053   gaggccaaagaaaactcat 1071
              | |||   |||||||||||
Sbjct: 532407 ggggcagcagaaaactcat 532425


 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus


Query: 299    aaatggaactctgagaattaaagatctgaagagagatgatgagggtatctacaaggta 356
              |||||||||||||| ||||||  |||||||||  |||||| ||| |||||||||||||
Sbjct: 518495 aaatggaactctgaaaattaagcatctgaagaccgatgatcaggatatctacaaggta 518552


 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Plus


Query: 655    aaggtctggatatctatctcatcatcggcatctgcggaggaggca 699
              |||||||||| |||||||||||||| ||||| || ||||||||||
Sbjct: 528149 aaggtctggacatctatctcatcattggcatatgtggaggaggca 528193


 Score = 46.1 bits (23), Expect = 0.059
 Identities = 84/103 (81%), Gaps = 1/103 (0%)
 Strand = Plus / Plus


Query: 1      tccttttgtaagaagagctcagaatcacaagagggaaacttgccccaaagatgagcctcg 60
              |||||||| | |||||||||||||||| |||| ||||||   |||| ||||||||| |
Sbjct: 518106 tccttttgcatgaagagctcagaatcaaaaga-ggaaaccaacccctaagatgagctttc 518164


Query: 61     catgtacaaccttggccagcttcctcctgattttcattgtttc 103
              |||||| |    | ||||||||||| |||||||||| ||||||
Sbjct: 518165 catgtaaatttgtagccagcttccttctgattttcaatgtttc 518207



>gi|17484914|ref|NT_011519.9|Hs22_11676 Homo sapiens chromosome 22 reference
               genomic contig
          Length = 3457401

 Score = 46.1 bits (23), Expect = 0.059
 Identities = 23/23 (100%)
 Strand = Plus / Plus


Query: 996     caccagcaaaaaggccctcccct 1018
               |||||||||||||||||||||||
Sbjct: 1569926 caccagcaaaaaggccctcccct 1569948



>gi|22052191|ref|NT_006713.10|Hs5_6870 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 13295383

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 25/26 (96%)
 Strand = Plus / Plus


Query: 927     gggcctcctggcccccgtgtccagca 952
               |||||||||||||| |||||||||||
Sbjct: 3304956 gggcctcctggcccacgtgtccagca 3304981



>gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 13399573

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 436     taatctcctggagctgtgcca 456
               |||||||||||||||||||||
Sbjct: 5645774 taatctcctggagctgtgcca 5645794



>gi|22049118|ref|NT_034769.1|Hs5_34931 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 2214536

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 994     ttcaccagcaaaaaggccctc 1014
               |||||||||||||||||||||
Sbjct: 2149061 ttcaccagcaaaaaggccctc 2149041



>gi|22043501|ref|NT_006204.12|Hs4_6361 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 8152527

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 1058    caaagaaaactcataactctg 1078
               |||||||||||||||||||||
Sbjct: 5490949 caaagaaaactcataactctg 5490929



>gi|22041803|ref|NT_022184.9|Hs2_22340 Homo sapiens chromosome 2 reference
              genomic contig
          Length = 13852153

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 918    cctcgtcccgggcctcctggccccc 942
              |||| ||||||||||||||||||||
Sbjct: 828780 cctcatcccgggcctcctggccccc 828756



>gi|22048717|ref|NT_025892.9|Hs14_26048 Homo sapiens chromosome 14 reference
                genomic contig
          Length = 46538979

 Score = 42.1 bits (21), Expect = 0.92
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 1502     gagtagaagtgaaataaaagg 1522
                |||||||||||||||||||||
Sbjct: 17773996 gagtagaagtgaaataaaagg 17774016



>gi|22061075|ref|NT_007592.10|Hs6_7749 Homo sapiens chromosome 6 reference
                genomic contig
          Length = 48753116

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 543      cagaaggtcatcctgtggaa 562
                ||||||||||||||||||||
Sbjct: 27887291 cagaaggtcatcctgtggaa 27887310



>gi|22047001|ref|NT_016755.10|Hs5_16911 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 4241890

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 612     gccagtgagcaaatcagcatggtg 635
               |||||||||| |||||||||||||
Sbjct: 2611547 gccagtgagccaatcagcatggtg 2611524



>gi|22059267|ref|NT_010966.10|Hs18_11123 Homo sapiens chromosome 18
               reference genomic contig
          Length = 3820621

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 1121    agaaactgtcctttcctgta 1140
               ||||||||||||||||||||
Sbjct: 3068027 agaaactgtcctttcctgta 3068046



>gi|22058665|ref|NT_010859.9|Hs18_11016 Homo sapiens chromosome 18 reference
               genomic contig
          Length = 6201965

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 995     tcaccagcaaaaaggccctc 1014
               ||||||||||||||||||||
Sbjct: 3393998 tcaccagcaaaaaggccctc 3393979


 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 995     tcaccagcaaaaaggccctc 1014
               ||||||||||||||||||||
Sbjct: 3244215 tcaccagcaaaaaggccctc 3244234



>gi|22064341|ref|NT_033927.2|Hs11_34082 Homo sapiens chromosome 11 reference
                genomic contig
          Length = 18378018

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 303      ggaactctgagaattaaaga 322
                ||||||||||||||||||||
Sbjct: 10995798 ggaactctgagaattaaaga 10995817



>gi|22063402|ref|NT_033899.2|Hs11_34054 Homo sapiens chromosome 11 reference
                genomic contig
          Length = 14510482

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 376      gaaaacacatgctggagaga 395
                ||||||||||||||||||||
Sbjct: 12137615 gaaaacacatgctggagaga 12137634



>gi|22055424|ref|NT_008818.12|Hs10_8975 Homo sapiens chromosome 10 reference
               genomic contig
          Length = 6065754

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 1224    gcccaagcccaggagccaca 1243
               ||||||||||||||||||||
Sbjct: 4741203 gcccaagcccaggagccaca 4741184



>gi|22051066|ref|NT_024037.12|Hs10_24193 Homo sapiens chromosome 10
               reference genomic contig
          Length = 3625701

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 1007    aggccctcccctccccaagc 1026
               ||||||||||||||||||||
Sbjct: 2104042 aggccctcccctccccaagc 2104061


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1583
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 1562
effective length of database: 2,826,363,332
effective search space: 4414779524584
effective search space used: 4414779524584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)