Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-003125


Query

>20030531C-003125 (20030531C-003125) 20030531C-003125
GGCGTTTTCC AGCGTTGGGT TTGCGGAGAG ACACAGCCAC ACCAAGAAGG
ACGCTTGTCA GACCCTCAGA TGGGACAGAG GTGACTCGGC GCTCCCGGGA
GAGGTTGCAC GGCCGCTCCC CGTCCCGTCC CTGCGGGATC CAGAGTACAG
AAAAGTTTTT GTTTGCGTGT GCCACCCCCA GAGAGCTAAG ACGCTCGCAC
CCTGTGCATG CAAAACAGTC TTGGCTTCTG ACGTGCTGTG TGTAGCCGCT
GCTTGTGTGA ATCATCAGCC CTTTGCTTGG GCACAAGGTG AAGGATGTCC
CAGTGGTATG AGCTTCAGCA GCTTGACTCC AAATTCCTGG AGCAGGTTCA
TCAGCTCTAC GATGACAGTT TTCCCATGGA AATCAGACAA TATCTGGCAC
AGTGGCTAGA AAATCAGGAC TGGGAGCACG CTGCCAATGA TGTTTCGTTT
GCCACCATCC GTTTTCATGA CCTTCTGTCG CAGCTGGATG ATCAGTACAG
TCGATTTTCC TTGGAGAATA ATTTTTTGTT GCAGCATAAC ATTAGGAAAA
GCAAGCGTAA CCTTCAGGAT AATTTTCAAG AAGACCCAAT ACAGATGTCT
ATGATCATCT GTAACTGTCT GAAGGAGGAA AGAAAGATCT TGGAAAATGC
CCAGAGATTC AATCAGACTC AGTCAGGGAA TATTCAGAGC ACTGTGATGT
TAGACAAAGT TATGTGTATA GAGCATGAAA TCAAGACCCT AGAAGATCTA
CAAGATGAAT ATGACTTTAA ATGCAAAACC TTGCAGAATA GAGAACATGA
TACCAATGGT GTGGCAAAGA ACGATCAGAA ACAGGAACAG ATGTTACTCC
AAAAGATGTA TTTAATGCTT GACAACAAGA GAAAGGAAGT AGTTAACAAA
ATAATAGAGT TATTGAATGT CACCGAACTT ACCCAGAAAG CCCTGATTAA
TGATGAACTG GTGGAATGGA AGCGGAGACA GCAGAGTGCC TGTATCGGGG
GACCCCCCAA CGCTTGCCTC GATCAGCTGC AGAACTGGTT CACCATAGTT
GCAGAAAGTC TGCAGCAGGT TCGTCAGCAG CTTAAAAAGC TTGAGGAATT
GGAACAGAAA TACACCTATG AACATGACCC TATCACAAAA AACAAACAAG
CGTTGTGGGA CCGCACCTTC AGCCTCTTCC AGCAGCTCAT TCAGAGCTCA
TTTGTGGTGG AAAGACAGCC CTGCATGCCA ACTCATCCTC AGAGGCCATT
GGTCCTGAAG ACTGGAGTAC AATTTACTGT GAAGTTGAGA CTGTTGGTGA
AGTTGCAGGA GCTGAATTAT AATTTGAAAG TCAAAGTCTT ATTTGATAAA
GATGTGAGTG AAAGAAATAC AGTAAAAGGG TTTAGAAAGT TCAACATTTT
GGGCACTCAC ACGAAGGTGA TGAACATGGA GGAGTCCACC AATGGGAGTC
TGGCGGCAGA ATTCCGACAC CTGCAACTGA AAGAACAGAA AAATGCCGGC
GCCAGAACCA ACGAGGGTCC TCTCATCGTT ACTGAAGAGC TTCATTCCCT
TAGTTTTGAA ACCCAATTGT GCCAGCCTGG CTTGGTCATT GACCTTGAGA
CCACCTCTCT GCCCGTCGTG GTGATCTCCA ACGTCAGCCA GCTCCCGAGC
GGTTGGGCCT CCATCCTGTG GTACAACATG CTGGTGGCAG AACCCAGGAA
TCTGTCCTTC TTCCTGAACC CACCTTGTGC ACGATGGTCT CAGCTTTCAG
AGGTGCTGAG TTGGCAGTTT TCTTCTGTCA CCAAAAGAGG TCTCAATGTG
GACCAGCTGA ACATGCTGGG AGAGAAACTT CTTGGTCCCA CTGCTGGCCC
TGACGGTCTT ATTCCCTGGA CGAGGTTCTG TAAGGAAAAC ATAAATGACA
AAAATTTTCC TTTCTGGCTT TGGATTGAAA GTATCCTTGA ACTCATTAAG
AAACACCTGC TCTCTCTCTG GAATGATGGG TGTATTGTGG GCTTTATCAG
CAAGGAGCGA GAGCGGGCTC TGCTAAAGGA CCAGCAGCCG GGGACGTTCC
TGTTGCGGTT CAGTGAGAGC TGCCGGGAAG GGGCCATCAC GTTCACGTGG
GTGGAGCGGT CCCAGAACGG AGGCGAACCT TACTTCCATG CAGTTGAACC
TTACACGAAG AAAGAACTCT CTGCTGTTAC CTTCCCTGAC ATTATTCGCA
ATTATAAAGT CATGGCCGCT GAAAATATTC CAGAGAATCC CCTGAAATAT
CTGTATCCAA ATATTGATAA AGACCATGCT TTTGGAAAGT ACTACTCCAG
GCCAAAGGAA GCCCCAGAAC CTATGGAACT TGACGGCCCT AAAGGAACAG
GATACATCAA GACTGAATTG ATTTCTGTGT CTGAAGTTCA CCCTTCTCGA
CTTCAGACCA CAGACAACCT TCTTCCCATG TCTCCTGAGG AGTTTGACGA
GGTGTCTCGA ATGGTGGGCC CTGTAGAATT TGACATGATG AATGCAGTAT
AGAGCATGAA TTTTTCTCAT CTTCTCTGGC GACAGTTTCC CTTTCCACCT
GTGATTTCCT CCTGTGCTCT GTTCCTTCAC ATTCTGTGTT TCTAGGAAAA
TGAAAGAAAG GCCAGCAAAT TCGCTGCACC CTGTTGATAG CAAGTGGATT
TTTCCCTAAT TCAGAAACAT CTGTCACTCT GAAGGGCTTC ATGCATCTTT
ACTGAAGTAA AATTGAA

Search to ncbiHGDS database

Query= 20030531C-003125 (20030531C-003125) 20030531C-003125
         (2717 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22041849|ref|NT_022197.10|Hs2_22353 Homo sapiens chromosome ...   272  1e-69
Alignment   gi|22064755|ref|NT_010840.8|Hs17_10997 Homo sapiens chromosome ...    52  0.002
Alignment   gi|22048149|ref|NT_007995.10|Hs8_8152 Homo sapiens chromosome 8...    44  0.40
Alignment   gi|22044820|ref|NT_005334.10|Hs2_5491 Homo sapiens chromosome 2...    44  0.40
Alignment   gi|22041066|ref|NT_021877.12|Hs1_22033 Homo sapiens chromosome ...    44  0.40
Alignment   gi|22057494|ref|NT_011757.10|HsX_11914 Homo sapiens chromosome ...    42  1.6
Alignment   gi|22067223|ref|NT_011512.6|Hs21_11669 Homo sapiens chromosome ...    42  1.6
Alignment   gi|22069517|ref|NT_024802.4|Hs16_24958 Homo sapiens chromosome ...    42  1.6
Alignment   gi|22069484|ref|NT_024797.10|Hs16_24953 Homo sapiens chromosome...    42  1.6
Alignment   gi|22054589|ref|NT_010194.12|Hs15_10351 Homo sapiens chromosome...    42  1.6
Alignment   gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome ...    42  1.6
Alignment   gi|22056793|ref|NT_024460.5|Hs12_24616 Homo sapiens chromosome ...    42  1.6
Alignment   gi|22045208|ref|NT_004487.12|Hs1_4644 Homo sapiens chromosome 1...    42  1.6
Alignment   gi|22058882|ref|NT_025312.8|HsX_25468 Homo sapiens chromosome X...    40  6.3
Alignment   gi|22056999|ref|NT_011692.10|HsX_11849 Homo sapiens chromosome ...    40  6.3
Alignment   gi|22056420|ref|NT_011669.10|HsX_11826 Homo sapiens chromosome ...    40  6.3
Alignment   gi|22045785|ref|NT_023974.12|Hs9_24130 Homo sapiens chromosome ...    40  6.3
Alignment   gi|22045301|ref|NT_019501.10|Hs9_19657 Homo sapiens chromosome ...    40  6.3
Alignment   gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8...    40  6.3
Alignment   gi|22047247|ref|NT_025796.10|Hs8_25952 Homo sapiens chromosome ...    40  6.3


>gi|22041849|ref|NT_022197.10|Hs2_22353 Homo sapiens chromosome 2 reference
               genomic contig
          Length = 1434841

 Score =  272 bits (137), Expect = 1e-69
 Identities = 206/225 (91%), Gaps = 3/225 (1%)
 Strand = Plus / Minus


Query: 2495    cagtatagagcatgaatttttctcatcttctctggcgacagtttccctttccacctgtga 2554
               ||||||||||||||||||||| |||||||||||||||||||||| ||||  || ||||||
Sbjct: 1074873 cagtatagagcatgaatttttttcatcttctctggcgacagttttccttctcatctgtga 1074814


Query: 2555    tttcctcctg-tgctctgttccttcacattctgtgtttctaggaaaatgaaagaaaggcc 2613
               || ||||||| | |||||||||||||||| ||||||||||||| ||||||||||||||||
Sbjct: 1074813 ttccctcctgctactctgttccttcacatcctgtgtttctagggaaatgaaagaaaggcc 1074754


Query: 2614    agcaaattcgctgcaccctgttgatagcaagtggatttttccctaattcagaaacatctg 2673
               ||||||||||||||| ||||||||||||||||| ||||||| |||| ||||||||||| |
Sbjct: 1074753 agcaaattcgctgcaacctgttgatagcaagtgaatttttctctaactcagaaacatcag 1074694


Query: 2674    tcactctgaagggcttcatgcatctttactgaag-taaaattgaa 2717
               | |||||||||||| ||||||||||| ||||||| ||||||||||
Sbjct: 1074693 ttactctgaagggcatcatgcatctt-actgaaggtaaaattgaa 1074650


 Score =  260 bits (131), Expect = 4e-66
 Identities = 173/187 (92%)
 Strand = Plus / Minus


Query: 2125    gaaccttacttccatgcagttgaaccttacacgaagaaagaactctctgctgttaccttc 2184
               |||||| |||||||||| |||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 1081189 gaacctgacttccatgcggttgaaccctacacgaagaaagaactttctgctgttactttc 1081130


Query: 2185    cctgacattattcgcaattataaagtcatggccgctgaaaatattccagagaatcccctg 2244
               |||||||| ||||||||||| ||||||||||| ||||| |||||||| ||||||||||||
Sbjct: 1081129 cctgacatcattcgcaattacaaagtcatggctgctgagaatattcctgagaatcccctg 1081070


Query: 2245    aaatatctgtatccaaatattgataaagaccatgcttttggaaagtactactccaggcca 2304
               || |||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||
Sbjct: 1081069 aagtatctgtatccaaatattgacaaagaccatgcctttggaaagtattactccaggcca 1081010


Query: 2305    aaggaag 2311
               |||||||
Sbjct: 1081009 aaggaag 1081003


 Score =  222 bits (112), Expect = 8e-55
 Identities = 148/160 (92%)
 Strand = Plus / Minus


Query: 1037    ggttcaccatagttgcagaaagtctgcagcaggttcgtcagcagcttaaaaagcttgagg 1096
               ||||||| |||||||| || ||||||||||| ||||| ||||||||||||||| | ||||
Sbjct: 1099383 ggttcactatagttgcggagagtctgcagcaagttcggcagcagcttaaaaagttggagg 1099324


Query: 1097    aattggaacagaaatacacctatgaacatgaccctatcacaaaaaacaaacaagcgttgt 1156
               |||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
Sbjct: 1099323 aattggaacagaaatacacctacgaacatgaccctatcacaaaaaacaaacaagtgttat 1099264


Query: 1157    gggaccgcaccttcagcctcttccagcagctcattcagag 1196
               |||||||||||||||| || ||||||||||||||||||||
Sbjct: 1099263 gggaccgcaccttcagtcttttccagcagctcattcagag 1099224


 Score =  220 bits (111), Expect = 3e-54
 Identities = 132/139 (94%)
 Strand = Plus / Minus


Query: 1698    gaatctgtccttcttcctgaacccaccttgtgcacgatggtctcagctttcagaggtgct 1757
               ||||||||||||||||||||  ||||| |||||||||||| ||||||||||||| |||||
Sbjct: 1086682 gaatctgtccttcttcctgactccaccatgtgcacgatgggctcagctttcagaagtgct 1086623


Query: 1758    gagttggcagttttcttctgtcaccaaaagaggtctcaatgtggaccagctgaacatgct 1817
               |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 1086622 gagttggcagttttcttctgtcaccaaaagaggtctcaatgtggaccagctgaacatgtt 1086563


Query: 1818    gggagagaaacttcttggt 1836
               ||||||||| |||||||||
Sbjct: 1086562 gggagagaagcttcttggt 1086544


 Score =  198 bits (100), Expect = 1e-47
 Identities = 142/156 (91%)
 Strand = Plus / Minus


Query: 884     aggaagtagttaacaaaataatagagttattgaatgtcaccgaacttacccagaaagccc 943
               ||||||||||| ||||||||||||||||  |||||||||| |||||||||||||| ||||
Sbjct: 1102172 aggaagtagttcacaaaataatagagttgctgaatgtcactgaacttacccagaatgccc 1102113


Query: 944     tgattaatgatgaactggtggaatggaagcggagacagcagagtgcctgtatcgggggac 1003
               |||||||||||||||| ||||| |||||||||||||||||||| |||||||| ||||| |
Sbjct: 1102112 tgattaatgatgaactagtggagtggaagcggagacagcagagcgcctgtattggggggc 1102053


Query: 1004    cccccaacgcttgcctcgatcagctgcagaactggt 1039
               | ||||| |||||| | |||||||||||||||||||
Sbjct: 1102052 cgcccaatgcttgcttggatcagctgcagaactggt 1102017


 Score =  194 bits (98), Expect = 2e-46
 Identities = 128/138 (92%)
 Strand = Plus / Minus


Query: 1988    tgggctttatcagcaaggagcgagagcgggctctgctaaaggaccagcagccggggacgt 2047
               ||||||| |||||||||||||||||||| || ||| | |||||||||||||||||||| |
Sbjct: 1083156 tgggcttcatcagcaaggagcgagagcgtgccctgttgaaggaccagcagccggggacct 1083097


Query: 2048    tcctgttgcggttcagtgagagctgccgggaaggggccatcacgttcacgtgggtggagc 2107
               ||||| |||||||||||||||||| |||||||||||||||||| ||||| ||||||||||
Sbjct: 1083096 tcctgctgcggttcagtgagagctcccgggaaggggccatcacattcacatgggtggagc 1083037


Query: 2108    ggtcccagaacggaggcg 2125
               ||||||||||||||||||
Sbjct: 1083036 ggtcccagaacggaggcg 1083019


 Score =  188 bits (95), Expect = 1e-44
 Identities = 134/147 (91%)
 Strand = Plus / Minus


Query: 422     gggagcacgctgccaatgatgtttcgtttgccaccatccgttttcatgaccttctgtcgc 481
               ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
Sbjct: 1113271 gggagcacgctgccaatgatgtttcatttgccaccatccgttttcatgacctcctgtcac 1113212


Query: 482     agctggatgatcagtacagtcgattttccttggagaataattttttgttgcagcataaca 541
               ||||||||||||| || ||||| ||||| ||||||||||| || ||| | ||||||||||
Sbjct: 1113211 agctggatgatcaatatagtcgcttttctttggagaataacttcttgctacagcataaca 1113152


Query: 542     ttaggaaaagcaagcgtaaccttcagg 568
               | ||||||||||||||||| |||||||
Sbjct: 1113151 taaggaaaagcaagcgtaatcttcagg 1113125


 Score =  170 bits (86), Expect = 3e-39
 Identities = 101/106 (95%)
 Strand = Plus / Minus


Query: 1593    ccttgagaccacctctctgcccgtcgtggtgatctccaacgtcagccagctcccgagcgg 1652
               |||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1087910 cctttagacgacctctctgcccgttgtggtgatctccaacgtcagccagctcccgagcgg 1087851


Query: 1653    ttgggcctccatcctgtggtacaacatgctggtggcagaacccagg 1698
               ||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 1087850 ttgggcctccatcctttggtacaacatgctggtggcggaacccagg 1087805


 Score =  167 bits (84), Expect = 4e-38
 Identities = 120/132 (90%)
 Strand = Plus / Minus


Query: 292     aggatgtcccagtggtatgagcttcagcagcttgactccaaattcctggagcaggttcat 351
               |||||||| |||||||| || ||||||||||||||||| ||||||||||||||||||||
Sbjct: 1114169 aggatgtctcagtggtacgaacttcagcagcttgactcaaaattcctggagcaggttcac 1114110


Query: 352     cagctctacgatgacagttttcccatggaaatcagacaatatctggcacagtggctagaa 411
               ||||| || ||||||||||||||||||||||||||||| || |||||||||||| |||||
Sbjct: 1114109 cagctttatgatgacagttttcccatggaaatcagacagtacctggcacagtggttagaa 1114050


Query: 412     aatcaggactgg 423
               || || ||||||
Sbjct: 1114049 aagcaagactgg 1114038


 Score =  141 bits (71), Expect = 2e-30
 Identities = 92/99 (92%)
 Strand = Plus / Minus


Query: 1883    aggaaaacataaatgacaaaaattttcctttctggctttggattgaaagtatccttgaac 1942
               ||||||| |||||||| ||||||||||| |||||||||||||||||||| ||||| ||||
Sbjct: 1084031 aggaaaatataaatgataaaaattttcccttctggctttggattgaaagcatcctagaac 1083972


Query: 1943    tcattaagaaacacctgctctctctctggaatgatgggt 1981
               ||||||| |||||||||||| ||||||||||||||||||
Sbjct: 1083971 tcattaaaaaacacctgctccctctctggaatgatgggt 1083933


 Score =  139 bits (70), Expect = 9e-30
 Identities = 91/98 (92%)
 Strand = Plus / Minus


Query: 2388    tcacccttctcgacttcagaccacagacaaccttcttcccatgtctcctgaggagtttga 2447
               |||||||||| |||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 1079095 tcacccttctagacttcagaccacagacaacctgctccccatgtctcctgaggagtttga 1079036


Query: 2448    cgaggtgtctcgaatggtgggccctgtagaatttgaca 2485
               |||||||||||| || |||||| |||||||||| ||||
Sbjct: 1079035 cgaggtgtctcggatagtgggctctgtagaattcgaca 1078998


 Score =  139 bits (70), Expect = 9e-30
 Identities = 79/82 (96%)
 Strand = Plus / Minus


Query: 1514    agggtcctctcatcgttactgaagagcttcattcccttagttttgaaacccaattgtgcc 1573
               ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
Sbjct: 1088558 agggtcctctcatcgttactgaagagcttcactcccttagttttgaaacccaattgtgcc 1088499


Query: 1574    agcctggcttggtcattgacct 1595
               ||||||| ||||| ||||||||
Sbjct: 1088498 agcctggtttggtaattgacct 1088477


 Score =  121 bits (61), Expect = 2e-24
 Identities = 85/93 (91%)
 Strand = Plus / Minus


Query: 1381    tttagaaagttcaacattttgggcactcacacgaaggtgatgaacatggaggagtccacc 1440
               ||||| |||||||||||||||||||| ||||| || ||||||||||||||||||||||||
Sbjct: 1091109 tttaggaagttcaacattttgggcacgcacacaaaagtgatgaacatggaggagtccacc 1091050


Query: 1441    aatgggagtctggcggcagaattccgacacctg 1473
               ||||| ||||||||||| ||||| || ||||||
Sbjct: 1091049 aatggcagtctggcggctgaatttcggcacctg 1091017


 Score =  119 bits (60), Expect = 8e-24
 Identities = 75/80 (93%)
 Strand = Plus / Minus


Query: 714     gtgtatagagcatgaaatcaagaccctagaagatctacaagatgaatatgactttaaatg 773
               ||||||||||||||||||||||| ||| |||||| ||||||||||||||||||| |||||
Sbjct: 1103868 gtgtatagagcatgaaatcaagagcctggaagatttacaagatgaatatgacttcaaatg 1103809


Query: 774     caaaaccttgcagaatagag 793
               ||||||||||||||| ||||
Sbjct: 1103808 caaaaccttgcagaacagag 1103789


 Score =  117 bits (59), Expect = 3e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus


Query: 792     agaacatgataccaatggtgtggcaaagaacgatcagaaacaggaacagatgttactcca 851
               |||||| || |||||||||||||||||||  ||||||||||| |||||| |||||||| |
Sbjct: 1102473 agaacacgagaccaatggtgtggcaaagagtgatcagaaacaagaacagctgttactcaa 1102414


Query: 852     aaagatgtatttaatgcttgacaacaagagaaagg 886
                ||||||||||||||||||||||| ||||||||||
Sbjct: 1102413 gaagatgtatttaatgcttgacaataagagaaagg 1102379


 Score =  107 bits (54), Expect = 3e-20
 Identities = 60/62 (96%)
 Strand = Plus / Minus


Query: 1288    agactgttggtgaagttgcaggagctgaattataatttgaaagtcaaagtcttatttgat 1347
               |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1093839 agactgttggtgaaattgcaagagctgaattataatttgaaagtcaaagtcttatttgat 1093780


Query: 1348    aa 1349
               ||
Sbjct: 1093779 aa 1093778


 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus


Query: 1195    agctcatttgtggtggaaagacagccctgcatgccaactcatcctcagaggccattggtc 1254
               ||||| |||||||||||||||||||||||||||||||| || |||||||||||  |||||
Sbjct: 1095485 agctcgtttgtggtggaaagacagccctgcatgccaacgcaccctcagaggccgctggtc 1095426


Query: 1255    ctgaagactggagtacaatttactgtgaagttgag 1289
                ||||||| || || || || ||||||||||||||
Sbjct: 1095425 ttgaagacaggggtccagttcactgtgaagttgag 1095391


 Score = 99.6 bits (50), Expect = 8e-18
 Identities = 68/74 (91%)
 Strand = Plus / Minus


Query: 2314    ccagaacctatggaacttgacggccctaaaggaacaggatacatcaagactgaattgatt 2373
               ||||| || ||||||||||| |||||||||||||| ||||| ||||||||||| ||||||
Sbjct: 1080048 ccagagccaatggaacttgatggccctaaaggaactggatatatcaagactgagttgatt 1079989


Query: 2374    tctgtgtctgaagt 2387
               ||||||||||||||
Sbjct: 1079988 tctgtgtctgaagt 1079975


 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus


Query: 566     aggataattttcaagaagacccaatacagatgtctatgatcatctgtaactgtctgaagg 625
               ||||||||||||| ||||||||||| ||||||||||||||||| |  | |||||||||||
Sbjct: 1111826 aggataattttcaggaagacccaatccagatgtctatgatcatttacagctgtctgaagg 1111767


Query: 626     aggaaagaaagatcttggaaaatgcccagagattcaatcag 666
               | ||||| || ||  ||||||| ||||||||||| ||||||
Sbjct: 1111766 aagaaaggaaaattctggaaaacgcccagagatttaatcag 1111726


 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus


Query: 668     ctcagtcagggaatattcagagcactgtgatgttagacaaa 708
               ||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 1105325 ctcagtcggggaatattcagagcacagtgatgttagacaaa 1105285


 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus


Query: 1195    agctcatttgtggtggaaagacagccctgcatgccaactcatcctcagaggccattggt 1253
               |||||||||||||| ||  ||||||| || |||||||| || ||||||||||| |||||
Sbjct: 1165986 agctcatttgtggttgagcgacagccatgtatgccaacccaccctcagaggccgttggt 1165928


 Score = 48.1 bits (24), Expect = 0.026
 Identities = 30/32 (93%)
 Strand = Plus / Minus


Query: 1350    agatgtgagtgaaagaaatacagtaaaagggt 1381
               |||||||| ||| |||||||||||||||||||
Sbjct: 1091231 agatgtgaatgagagaaatacagtaaaagggt 1091200


 Score = 48.1 bits (24), Expect = 0.026
 Identities = 33/36 (91%)
 Strand = Plus / Minus


Query: 1473    gcaactgaaagaacagaaaaatgccggcgccagaac 1508
               |||| ||||||||||||||||||| ||| |||||||
Sbjct: 1089824 gcaattgaaagaacagaaaaatgctggcaccagaac 1089789



>gi|22064755|ref|NT_010840.8|Hs17_10997 Homo sapiens chromosome 17
              reference genomic contig
          Length = 1378293

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus


Query: 1654   tgggcctccatcctgtggtacaacatgctg 1683
              ||||| ||||||||||||||||||||||||
Sbjct: 688044 tgggcgtccatcctgtggtacaacatgctg 688015


 Score = 46.1 bits (23), Expect = 0.10
 Identities = 29/31 (93%)
 Strand = Plus / Minus


Query: 1988   tgggctttatcagcaaggagcgagagcgggc 2018
              ||||||||||||| |||||||| ||||||||
Sbjct: 686172 tgggctttatcagtaaggagcgggagcgggc 686142



>gi|22048149|ref|NT_007995.10|Hs8_8152 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 4016801

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 34/38 (89%)
 Strand = Plus / Minus


Query: 2534    agtttccctttccacctgtgatttcctcctgtgctctg 2571
               ||||||| |||| || ||||||||||| ||||||||||
Sbjct: 2908458 agtttccttttctacatgtgatttcctgctgtgctctg 2908421


 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 1126    gaccctatcacaaaaaacaaacaa 1149
               ||||||||| ||||||||||||||
Sbjct: 3789602 gaccctatctcaaaaaacaaacaa 3789625



>gi|22044820|ref|NT_005334.10|Hs2_5491 Homo sapiens chromosome 2 reference
               genomic contig
          Length = 11260329

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Plus


Query: 1120    gaacatgaccctatcacaaaaaacaaacaa 1149
               ||||| ||||||||| ||||||||||||||
Sbjct: 6082925 gaacaagaccctatctcaaaaaacaaacaa 6082954



>gi|22041066|ref|NT_021877.12|Hs1_22033 Homo sapiens chromosome 1
              reference genomic contig
          Length = 4217311

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus


Query: 1886   aaaacataaatgacaaaaattt 1907
              ||||||||||||||||||||||
Sbjct: 281608 aaaacataaatgacaaaaattt 281587


 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 1126    gaccctatcacaaaaaacaaacaa 1149
               ||||||||| ||||||||||||||
Sbjct: 3258635 gaccctatctcaaaaaacaaacaa 3258612



>gi|22057494|ref|NT_011757.10|HsX_11914 Homo sapiens chromosome X reference
               genomic contig
          Length = 6712769

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 1321    aatttgaaagtcaaagtctta 1341
               |||||||||||||||||||||
Sbjct: 3605281 aatttgaaagtcaaagtctta 3605301



>gi|22067223|ref|NT_011512.6|Hs21_11669 Homo sapiens chromosome 21 reference
                genomic contig
          Length = 28515771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 519      taattttttgttgcagcataa 539
                |||||||||||||||||||||
Sbjct: 12618093 taattttttgttgcagcataa 12618113



>gi|22069517|ref|NT_024802.4|Hs16_24958 Homo sapiens chromosome 16
              reference genomic contig
          Length = 455656

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 1126   gaccctatcacaaaaaacaaacaag 1150
              ||||||||| |||||||||||||||
Sbjct: 234394 gaccctatctcaaaaaacaaacaag 234418



>gi|22069484|ref|NT_024797.10|Hs16_24953 Homo sapiens chromosome 16
               reference genomic contig
          Length = 4385914

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 629     aaagaaagatcttggaaaatg 649
               |||||||||||||||||||||
Sbjct: 2772446 aaagaaagatcttggaaaatg 2772426


 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 1126    gaccctatcacaaaaaacaaacaa 1149
               ||||||||| ||||||||||||||
Sbjct: 2490692 gaccctatctcaaaaaacaaacaa 2490669



>gi|22054589|ref|NT_010194.12|Hs15_10351 Homo sapiens chromosome 15
               reference genomic contig
          Length = 17436912

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 1893    aaatgacaaaaattttccttt 1913
               |||||||||||||||||||||
Sbjct: 2944151 aaatgacaaaaattttccttt 2944171



>gi|22061968|ref|NT_009770.12|Hs12_9927 Homo sapiens chromosome 12 reference
               genomic contig
          Length = 3995937

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 314     ttcagcagcttgactccaaattcct 338
               |||||||||||||| ||||||||||
Sbjct: 1915202 ttcagcagcttgaccccaaattcct 1915178



>gi|22056793|ref|NT_024460.5|Hs12_24616 Homo sapiens chromosome 12
              reference genomic contig
          Length = 372230

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 1475   aactgaaagaacagaaaaatg 1495
              |||||||||||||||||||||
Sbjct: 129166 aactgaaagaacagaaaaatg 129186



>gi|22045208|ref|NT_004487.12|Hs1_4644 Homo sapiens chromosome 1 reference
               genomic contig
          Length = 13838177

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 2173    gctgttaccttccctgacattattc 2197
               ||||||| |||||||||||||||||
Sbjct: 9951300 gctgttatcttccctgacattattc 9951324



>gi|22058882|ref|NT_025312.8|HsX_25468 Homo sapiens chromosome X reference
               genomic contig
          Length = 4358532

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 1478    tgaaagaacagaaaaatgcc 1497
               ||||||||||||||||||||
Sbjct: 3843649 tgaaagaacagaaaaatgcc 3843630



>gi|22056999|ref|NT_011692.10|HsX_11849 Homo sapiens chromosome X reference
               genomic contig
          Length = 2260135

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 1126    gaccctatcacaaaaaacaaacaa 1149
               ||||||||| ||||||||||||||
Sbjct: 1750358 gaccctatctcaaaaaacaaacaa 1750335



>gi|22056420|ref|NT_011669.10|HsX_11826 Homo sapiens chromosome X reference
               genomic contig
          Length = 4827044

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 1890    cataaatgacaaaaattttc 1909
               ||||||||||||||||||||
Sbjct: 2584507 cataaatgacaaaaattttc 2584526



>gi|22045785|ref|NT_023974.12|Hs9_24130 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 20138537

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 1126    gaccctatcacaaaaaacaaacaa 1149
               ||||||||| ||||||||||||||
Sbjct: 2131414 gaccctatctcaaaaaacaaacaa 2131437



>gi|22045301|ref|NT_019501.10|Hs9_19657 Homo sapiens chromosome 9
              reference genomic contig
          Length = 1853458

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 1126   gaccctatcacaaaaaacaaacaa 1149
              ||||||||| ||||||||||||||
Sbjct: 152468 gaccctatctcaaaaaacaaacaa 152445



>gi|22048917|ref|NT_008046.10|Hs8_8203 Homo sapiens chromosome 8 reference
                genomic contig
          Length = 13399573

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 1126     gaccctatcacaaaaaacaaacaa 1149
                ||||||||| ||||||||||||||
Sbjct: 10625018 gaccctatctcaaaaaacaaacaa 10625041



>gi|22047247|ref|NT_025796.10|Hs8_25952 Homo sapiens chromosome 8
             reference genomic contig
          Length = 550614

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 2587  tgtttctaggaaaatgaaag 2606
             ||||||||||||||||||||
Sbjct: 78805 tgtttctaggaaaatgaaag 78786


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 2717
length of database: 2,826,392,627
effective HSP length: 22
effective length of query: 2695
effective length of database: 2,826,361,937
effective search space: 7617045420215
effective search space used: 7617045420215
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)