Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-003267


Query

>20030531C-003267 (20030531C-003267) 20030531C-003267
CAATATGATT ATGACAGCAG CACCATCCGG AAGAGGATAT TTCAAGAGGC
GCTGGTTCAA ATCACACTTC CCACCATGCA GAAGGCGCTG GCGTCCATGT
GTAAACCAGA ACTTCAGAAA TACGAGCAGT TCATTTTTGC AGATCACACC
CATATGATCC ACGTTGAGAA TGTCTACGAG GAGATTTTAC ATCAGATCCT
CCTTGATGAA ACCCTGAAAG TGATAAAGGA AGCTGCTGTC CTGAAGAAAC
ACAACTTATT TGAAGACAAC ATGGCCCTGC CCAGCGAAAG CGTGTCCAGC
TTAACTGATC TAAAAACTCC TGCAGGGTCC AACCAGGCCA GCCCTGCCAG
GAGAGCCTCT GCCATTCTGC CAGGCGGTCC AGATAGTGAG ATCGTGAGTA
ATGAGGTATT CCAGGAGTCA GGGGAAAAGA AGGAGTCTGG GGTCTCCAGT
TCTTTGGCCA AAGGAGAAAG CCTTCCTTCC CCTGTGCCCA GCCCTCCCCC
AGGCGGGGAC GGGCAGCTCA TCATTTCAAG CATGGATGAC CCTGCTGTGA
ATCTTGTGGC TGCAGAGGAC ACAGCAGGAG ACCTGGGCAC ACACTCATCA
GAGCTGGAGT GTGAGGAGAC TCCTGAGGAC CAAGAACCCC CCCAGGAAAA
GCCCGAGCCC ACCTCTGCCT CAGGCTCCTT GAAGGAACTC AGAGACCTGT
TGACAGTGAC CATTGAAGTA CCAGCGGAGT CTGGCAAGCT CAAGATTGAA
GAAGATACAA ATGAGGAGAC CCTGGTTCCC CAGGAAATGG AAAAAGAAGA
GGAAACAACC CAAGTCTGCA CAGGGGCCCA TCAAGCAGCT GCCTCCAGTC
AGGACAACTG TGCAGAAAAC CAAGTGCATG AGAGAGAGAC CCATCCTCCT
GCTCCAGAGG CCGAGGCGGG GGAGGCAGAG TTGGGGGCCC TTCCAGAGGC
TCAGCCAGCC TGCGGGGAGC TCAGCGAGGG CACCCGCAGC CCAGGCCCCA
CAGAGGAGCA AGTAGAGGCC GGGGGGCCCC CCAAAGGGGA GCTTACAGAG
GGGGCTTCCG GACTGGATGC CCTTGGAGGA GAAGGGGCCG TGTGTGCTGT
CGAGGCTGAG GCTGTGCCCC AAGAAGGTTG CATGTTCAGT TCGGACCCCC
TCAGCCCCAG GGAGAGCCAG ATGTCTGTGG GAGAAGAATT GGTGGGAGGG
GAGTGCAGCA CAGCCCTGGA TGCTGCCAGC GTGGATGCAG GGGAGAGGGA
GGCTGCCCAT GTTCACCAGT GTCCGTGGGT GGTTGAGAAT GATCCAAACA
CCACCGAGAC CCTGGAGTCA CAGCCAGAGG GTCCCCCAGC ACAGCCCTGG
GAGGAGTGAA AGGGGCAGTT TGGCAAAAGC CTTTCTCTGA ACAAACTCAG
ACAAAAGAAT ATAGCTAAGG GTACACGTAG GGGTTGCATA CACGTGGTTA
CCAAAAGAAA AAGAAAAAAA AAAAAAAGTA TAAATACTTA ATTTGTAGAA
TGAAGCCAGA GGCAATGCAC ACAGGGCGTG CGCACTGAGG CAAACCTTTG
TGGAATTGAA CTGTTCCACC ATGAATTATT GCTTTAGCAT TTTAATAGGA
ATTACAAAGG TAATG

Search to ncbiHGDS database

Query= 20030531C-003267 (20030531C-003267) 20030531C-003267
         (1615 letters)

Database: Homo Sapiens Gene(masked sequence)
           1395 sequences; 2,826,392,627 total letters

Searching...................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gi|22045208|ref|NT_004487.12|Hs1_4644 Homo sapiens chromosome 1...   293  2e-76
Alignment   gi|20559789|ref|NT_011387.7|Hs20_11544 Homo sapiens chromosome ...    46  0.060
Alignment   gi|22050229|ref|NT_026437.8|Hs14_26604 Homo sapiens chromosome ...    46  0.060
Alignment   gi|22047485|ref|NT_023132.9|Hs5_23288 Homo sapiens chromosome 5...    44  0.24
Alignment   gi|22046448|ref|NT_004858.12|Hs1_5015 Homo sapiens chromosome 1...    44  0.24
Alignment   gi|22046740|ref|NT_007758.8|Hs7_7915 Homo sapiens chromosome 7 ...    42  0.94
Alignment   gi|17484914|ref|NT_011519.9|Hs22_11676 Homo sapiens chromosome ...    42  0.94
Alignment   gi|22069148|ref|NT_019609.8|Hs16_19765 Homo sapiens chromosome ...    42  0.94
Alignment   gi|22045511|ref|NT_004610.12|Hs1_4767 Homo sapiens chromosome 1...    42  0.94
Alignment   gi|22045482|ref|NT_004547.12|Hs1_4704 Homo sapiens chromosome 1...    42  0.94
Alignment   gi|22057101|ref|NT_011719.8|HsX_11876 Homo sapiens chromosome X...    40  3.7
Alignment   gi|22056869|ref|NT_011689.9|HsX_11846 Homo sapiens chromosome X...    40  3.7
Alignment   gi|22047115|ref|NT_008470.12|Hs9_8627 Homo sapiens chromosome 9...    40  3.7
Alignment   gi|22047017|ref|NT_008413.12|Hs9_8570 Homo sapiens chromosome 9...    40  3.7
Alignment   gi|22049640|ref|NT_008150.11|Hs8_8307 Homo sapiens chromosome 8...    40  3.7
Alignment   gi|22043401|ref|NT_006198.12|Hs4_6355 Homo sapiens chromosome 4...    40  3.7
Alignment   gi|22042092|ref|NT_022853.11|Hs4_23009 Homo sapiens chromosome ...    40  3.7
Alignment   gi|22044979|ref|NT_005795.12|Hs3_5952 Homo sapiens chromosome 3...    40  3.7
Alignment   gi|22044213|ref|NT_005588.12|Hs3_5745 Homo sapiens chromosome 3...    40  3.7
Alignment   gi|22043200|ref|NT_034560.1|Hs3_34722 Homo sapiens chromosome 3...    40  3.7


>gi|22045208|ref|NT_004487.12|Hs1_4644 Homo sapiens chromosome 1 reference
               genomic contig
          Length = 13838177

 Score =  293 bits (148), Expect = 2e-76
 Identities = 331/392 (84%)
 Strand = Plus / Minus


Query: 219     agtgataaaggaagctgctgtcctgaagaaacacaacttatttgaagacaacatggccct 278
               ||||||||||||||||||| || ||||||||||||||||||||||||| ||||||||| |
Sbjct: 9882922 agtgataaaggaagctgctatcttgaagaaacacaacttatttgaagataacatggcctt 9882863


Query: 279     gcccagcgaaagcgtgtccagcttaactgatctaaaaactcctgcagggtccaaccaggc 338
               |||||| ||||| |||||||||||||| ||||||||  | ||  ||||||| ||||||||
Sbjct: 9882862 gcccagtgaaagtgtgtccagcttaacagatctaaagccccccacagggtcaaaccaggc 9882803


Query: 339     cagccctgccaggagagcctctgccattctgccaggcggtccagatagtgagatcgtgag 398
               |||||||||||||||||| ||||||||||||||||| | ||  | |||||||| | | ||
Sbjct: 9882802 cagccctgccaggagagcttctgccattctgccaggagttctgggtagtgagaccctcag 9882743


Query: 399     taatgaggtattccaggagtcaggggaaaagaaggagtctggggtctccagttctttggc 458
               ||| || |||||||||||||||| |||| ||||| || ||| |||| | || || |||||
Sbjct: 9882742 taacgaagtattccaggagtcagaggaagagaagcagcctgaggtccctagctcgttggc 9882683


Query: 459     caaaggagaaagccttccttcccctgtgcccagccctcccccaggcggggacgggcagct 518
               |||||||||||||||| ||  ||||| ||| ||||| |||||||  |||   | |||| |
Sbjct: 9882682 caaaggagaaagcctttctctccctgggccaagcccacccccagatgggactgagcaggt 9882623


Query: 519     catcatttcaagcatggatgaccctgctgtgaatcttgtggctgcagaggacacagcagg 578
                || ||||||||  |||||||||| |  ||||||| ||||||  ||||||||||||||||
Sbjct: 9882622 gattatttcaagagtggatgaccccgtggtgaatcctgtggcaacagaggacacagcagg 9882563


Query: 579     agacctgggcacacactcatcagagctggagt 610
               |  || |||||||  |||||||||||||||||
Sbjct: 9882562 actcccgggcacatgctcatcagagctggagt 9882531


 Score =  153 bits (77), Expect = 4e-34
 Identities = 101/109 (92%)
 Strand = Plus / Minus


Query: 112     cttcagaaatacgagcagttcatttttgcagatcacacccatatgatccacgttgagaat 171
               ||||||||||||||||||||||| ||||||||||| ||| ||||||| |||||||| |||
Sbjct: 9885010 cttcagaaatacgagcagttcatctttgcagatcataccaatatgattcacgttgaaaat 9884951


Query: 172     gtctacgaggagattttacatcagatcctccttgatgaaaccctgaaag 220
               ||||| ||||||||||||||||||||||| ||||||||||| |||||||
Sbjct: 9884950 gtctatgaggagattttacatcagatcctgcttgatgaaactctgaaag 9884902


 Score =  137 bits (69), Expect = 2e-29
 Identities = 90/97 (92%)
 Strand = Plus / Minus


Query: 1       caatatgattatgacagcagcaccatccggaagaggatatttcaagaggcgctggttcaa 60
               ||||||||||||||||||||||||||||| |||| ||||||||||||||| || ||||||
Sbjct: 9890515 caatatgattatgacagcagcaccatccgaaagaagatatttcaagaggcactagttcaa 9890456


Query: 61      atcacacttcccaccatgcagaaggcgctggcgtcca 97
               ||||||||||||||  |||||||||| ||||||||||
Sbjct: 9890455 atcacacttcccactgtgcagaaggcactggcgtcca 9890419


 Score =  103 bits (52), Expect = 3e-19
 Identities = 107/124 (86%), Gaps = 1/124 (0%)
 Strand = Plus / Minus


Query: 1487    cttaatttgtagaatgaagccagaggcaatgcacacagggcgtgcgca-ctgaggcaaac 1545
               ||||||||| | ||| || ||||||| |||||| ||||||| || ||| |||||||||||
Sbjct: 9881694 cttaatttgaataataaaaccagaggaaatgcatacagggcatgagcaactgaggcaaac 9881635


Query: 1546    ctttgtggaattgaactgttccaccatgaattattgctttagcattttaataggaattac 1605
               |||||||||  |||| ||||| || ||||||| ||||||||| ||||||||| |||||||
Sbjct: 9881634 ctttgtggacatgaattgttctacgatgaatttttgctttagtattttaataagaattac 9881575


Query: 1606    aaag 1609
               ||||
Sbjct: 9881574 aaag 9881571


 Score = 44.1 bits (22), Expect = 0.24
 Identities = 49/58 (84%)
 Strand = Plus / Minus


Query: 748     gaagaagatacaaatgaggagaccctggttccccaggaaatggaaaaagaagaggaaa 805
               ||||||||||| |||| ||||| ||  |||||||| ||||  ||| ||||||||||||
Sbjct: 9882396 gaagaagatacgaatggggagagccacgttccccaagaaaatgaagaagaagaggaaa 9882339


 Score = 42.1 bits (21), Expect = 0.94
 Identities = 36/41 (87%)
 Strand = Plus / Minus


Query: 1351    gaggagtgaaaggggcagtttggcaaaagcctttctctgaa 1391
               |||||||||||||| || ||||||  ||| |||||||||||
Sbjct: 9881808 gaggagtgaaagggacaatttggctgaagtctttctctgaa 9881768



>gi|20559789|ref|NT_011387.7|Hs20_11544 Homo sapiens chromosome 20 reference
                genomic contig
          Length = 26257626

 Score = 46.1 bits (23), Expect = 0.060
 Identities = 23/23 (100%)
 Strand = Plus / Plus


Query: 1334     ccccagcacagccctgggaggag 1356
                |||||||||||||||||||||||
Sbjct: 23691803 ccccagcacagccctgggaggag 23691825



>gi|22050229|ref|NT_026437.8|Hs14_26604 Homo sapiens chromosome 14 reference
                genomic contig
          Length = 39365623

 Score = 46.1 bits (23), Expect = 0.060
 Identities = 23/23 (100%)
 Strand = Plus / Minus


Query: 479      cccctgtgcccagccctccccca 501
                |||||||||||||||||||||||
Sbjct: 27287890 cccctgtgcccagccctccccca 27287868



>gi|22047485|ref|NT_023132.9|Hs5_23288 Homo sapiens chromosome 5 reference
               genomic contig
          Length = 10043041

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 1542    aaacctttgtggaattgaactg 1563
               ||||||||||||||||||||||
Sbjct: 6980327 aaacctttgtggaattgaactg 6980348



>gi|22046448|ref|NT_004858.12|Hs1_5015 Homo sapiens chromosome 1
             reference genomic contig
          Length = 4176780

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Plus


Query: 475   ccttcccctgtgcccagccctccccc 500
             |||| |||||||||||||||||||||
Sbjct: 34796 ccttaccctgtgcccagccctccccc 34821



>gi|22046740|ref|NT_007758.8|Hs7_7915 Homo sapiens chromosome 7 reference
                genomic contig
          Length = 12459970

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 1033     aaaggggagcttacagagggg 1053
                |||||||||||||||||||||
Sbjct: 11256612 aaaggggagcttacagagggg 11256592



>gi|17484914|ref|NT_011519.9|Hs22_11676 Homo sapiens chromosome 22 reference
               genomic contig
          Length = 3457401

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 24/25 (96%)
 Strand = Plus / Plus


Query: 861     tgcagaaaaccaagtgcatgagaga 885
               ||||||||| |||||||||||||||
Sbjct: 1519294 tgcagaaaagcaagtgcatgagaga 1519318



>gi|22069148|ref|NT_019609.8|Hs16_19765 Homo sapiens chromosome 16
              reference genomic contig
          Length = 1085037

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 962    gcggggagctcagcgagggca 982
              |||||||||||||||||||||
Sbjct: 717723 gcggggagctcagcgagggca 717743



>gi|22045511|ref|NT_004610.12|Hs1_4767 Homo sapiens chromosome 1
             reference genomic contig
          Length = 3502383

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 478   tcccctgtgcccagccctccc 498
             |||||||||||||||||||||
Sbjct: 63370 tcccctgtgcccagccctccc 63390



>gi|22045482|ref|NT_004547.12|Hs1_4704 Homo sapiens chromosome 1 reference
              genomic contig
          Length = 929829

 Score = 42.1 bits (21), Expect = 0.94
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 1331   gtcccccagcacagccctggg 1351
              |||||||||||||||||||||
Sbjct: 611750 gtcccccagcacagccctggg 611730



>gi|22057101|ref|NT_011719.8|HsX_11876 Homo sapiens chromosome X reference
               genomic contig
          Length = 3387371

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 785     aaatggaaaaagaagaggaa 804
               ||||||||||||||||||||
Sbjct: 2527934 aaatggaaaaagaagaggaa 2527953



>gi|22056869|ref|NT_011689.9|HsX_11846 Homo sapiens chromosome X reference
               genomic contig
          Length = 6614465

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 1383    ttctctgaacaaactcagacaaaa 1406
               |||||||||| |||||||||||||
Sbjct: 1357278 ttctctgaactaactcagacaaaa 1357301



>gi|22047115|ref|NT_008470.12|Hs9_8627 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 9268166

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 1340    cacagccctgggaggagtga 1359
               ||||||||||||||||||||
Sbjct: 2123192 cacagccctgggaggagtga 2123173



>gi|22047017|ref|NT_008413.12|Hs9_8570 Homo sapiens chromosome 9 reference
               genomic contig
          Length = 10760913

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 785     aaatggaaaaagaagaggaa 804
               ||||||||||||||||||||
Sbjct: 9486872 aaatggaaaaagaagaggaa 9486891



>gi|22049640|ref|NT_008150.11|Hs8_8307 Homo sapiens chromosome 8 reference
               genomic contig
          Length = 2825984

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 972     cagcgagggcacccgcagcc 991
               ||||||||||||||||||||
Sbjct: 2275186 cagcgagggcacccgcagcc 2275167



>gi|22043401|ref|NT_006198.12|Hs4_6355 Homo sapiens chromosome 4 reference
               genomic contig
          Length = 4803649

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 658     cccacctctgcctcaggctccttg 681
               |||||||||||||||| |||||||
Sbjct: 2150661 cccacctctgcctcagactccttg 2150684



>gi|22042092|ref|NT_022853.11|Hs4_23009 Homo sapiens chromosome 4
              reference genomic contig
          Length = 7057099

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 654    cgagcccacctctgcctcag 673
              ||||||||||||||||||||
Sbjct: 318571 cgagcccacctctgcctcag 318590



>gi|22044979|ref|NT_005795.12|Hs3_5952 Homo sapiens chromosome 3 reference
               genomic contig
          Length = 3773526

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus


Query: 1573    gaattattgctttagcattttaat 1596
               |||||||||||||| |||||||||
Sbjct: 2399528 gaattattgctttatcattttaat 2399551



>gi|22044213|ref|NT_005588.12|Hs3_5745 Homo sapiens chromosome 3 reference
               genomic contig
          Length = 3144845

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 671     caggctccttgaaggaactc 690
               ||||||||||||||||||||
Sbjct: 1685230 caggctccttgaaggaactc 1685249



>gi|22043200|ref|NT_034560.1|Hs3_34722 Homo sapiens chromosome 3 reference
              genomic contig
          Length = 1996788

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 782    aggaaatggaaaaagaagaggaaa 805
              ||||||||||||||||| ||||||
Sbjct: 587154 aggaaatggaaaaagaaaaggaaa 587131


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Nov 13, 2002  9:59 PM
  Number of letters in database: 2,826,392,627
  Number of sequences in database:  1395

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1615
length of database: 2,826,392,627
effective HSP length: 21
effective length of query: 1594
effective length of database: 2,826,363,332
effective search space: 4505223151208
effective search space used: 4505223151208
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)