Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-001710


Query

>20030531C-001710 (20030531C-001710) 20030531C-001710
AGCAGCCTCG GGGCGGGGTG GGCGGGTGCA CTCCGGCGCG GACGCCGGTG
AGGGGGCGTG TTCCCCGTGC CCGGCGGCTG CCCGCGGGAC CCCCGAGGGC
CCTCCCGGGC TCCCGGTGCG ACCATGGCGC GGAGCCTCCG GAACTGGCTG
GGCGGCTGCC TACTGGTGTC AGCATTAGGA ATGGTGGTGC CACCTCCTGA
AAACGTCAGA ATGAATTCAG TTAATTTCAA GAACATTCTC CAGTGGGACT
CACCTGCTTT TCCCCAGGGG GATCTGACCT TCACAGCTCA GTATCACAGT
TATAGGCAAT TCCAGGATCA GTGTGTGAGC ATCATCTTGA CGGAGTGTGA
TTTCTCAAGT CTTTCCAAGT ACGGTGACCA CATCTTAAGA GTCAGGGCTG
AATTTGCAGA CGAGCATTCA GACTGGATAA ACATCACCTT CTGTCCTGTG
GATGACACCA TTATTGGACC TCCTGGAATG CAAGTAGAGG CACTTGCGAA
TTCTTTACAT ATGCGTTTCT TAGCCCCCAA AATTGAGAAT GAACCTGAAA
CATGGACTGT GAGGAATATT TATAACTCAT GGGCTTATCA TGTGCAATAT
TGGAAGAATG GCTCCGATGA AAAGTTTGCA GTTACCGCCC AGTATGACTT
CGAGGTCCTT CGAAATCTGG AGTCATCCAC AACTTACTGT GTTCAAGTCC
GAGCGTTTCT TCCCGATCGG AACAAAACCG GGGAATGGAG TGATCCTGTC
TGTGGGCAGA CGACCAATGA CGAAACCACC CCCACCTGGA TCGTGGCCTG
TGTCCTGGCC GCCTCGGTGG TCGCCGCCTT CCTGCTGCTC CCTCGCTGCT
TCATCTTGCT

Search to UniGene2 database

Query= 20030531C-001710 (20030531C-001710) 20030531C-001710
         (860 letters)

Database: UniGene(Bt+Hs+Ssc+Mm)
           230,285 sequences; 241,976,893 total letters

Searching..................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gnl|UG|Hs#S1730667 Homo sapiens interleukin 10 receptor, beta (...   601  e-170
Alignment   gnl|UG|Mm#S10866118 Mus musculus adult male aorta and vein cDNA...   103  1e-20
Alignment   gnl|UG|Mm#S8040667 Mus musculus interleukin 10 receptor, beta (...   103  1e-20
Alignment   gnl|UG|Hs#S1732444 Homo sapiens synaptogyrin 3 (SYNGR3), mRNA /...    38  0.65
Alignment   gnl|UG|Bt#S12073021 Bos taurus inositol 1,4,5-triphosphate rece...    38  0.65
Alignment   gnl|UG|Hs#S4621279 Homo sapiens mRNA; cDNA DKFZp761E198 (from c...    36  2.6
Alignment   gnl|UG|Hs#S2294321 Homo sapiens G protein-coupled receptor 27 (...    36  2.6
Alignment   gnl|UG|Hs#S3991386 Homo sapiens cDNA FLJ30246 fis, clone BRACE2...    36  2.6
Alignment   gnl|UG|Hs#S717148 zu56f05.r1 Soares ovary tumor NbHOT Homo sapi...    36  2.6
Alignment   gnl|UG|Hs#S5978401 Homo sapiens hypothetical protein BC004895 (...    36  2.6


>gnl|UG|Hs#S1730667 Homo sapiens interleukin 10 receptor, beta
           (IL10RB), mRNA /cds=(100,1077) /gb=NM_000628
           /gi=24430214 /ug=Hs.173936 /len=1935
          Length = 1935

 Score =  601 bits (303), Expect = e-170
 Identities = 584/677 (86%), Gaps = 3/677 (0%)
 Strand = Plus / Plus


Query: 122 ccatggcgcggagcctccggaactggctgggcggctgcctactggtgtcagcattaggaa 181
           |||||||| |||||||  ||| ||||||||| |||||||| |||||||||||||| ||||
Sbjct: 98  ccatggcgtggagccttgggagctggctgggtggctgcctgctggtgtcagcattgggaa 157


Query: 182 tggtggtgccacctcctgaaaacgtcagaatgaattcagttaatttcaagaacattctcc 241
           ||||    |||||||| ||||| |||||||||||||| |||||||||||||||||||| |
Sbjct: 158 tggta---ccacctcccgaaaatgtcagaatgaattctgttaatttcaagaacattctac 214


Query: 242 agtgggactcacctgcttttccccagggggatctgaccttcacagctcagtatcacagtt 301
           ||||||| |||||||||||| || | ||| | ||||| |||||||||||||| |  ||||
Sbjct: 215 agtgggagtcacctgcttttgccaaagggaacctgactttcacagctcagtacctaagtt 274


Query: 302 ataggcaattccaggatcagtgtgtgagcatcatcttgacggagtgtgatttctcaagtc 361
           |||||  |||||| ||| | ||  |||  |  | ||||||||| ||||||||||||||||
Sbjct: 275 ataggatattccaagataaatgcatgaatactaccttgacggaatgtgatttctcaagtc 334


Query: 362 tttccaagtacggtgaccacatcttaagagtcagggctgaatttgcagacgagcattcag 421
           |||||||||| |||||||||| ||| ||||||||||||||||||||||| ||||||||||
Sbjct: 335 tttccaagtatggtgaccacaccttgagagtcagggctgaatttgcagatgagcattcag 394


Query: 422 actggataaacatcaccttctgtcctgtggatgacaccattattggacctcctggaatgc 481
           ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 395 actgggtaaacatcaccttctgtcctgtggatgacaccattattggaccccctggaatgc 454


Query: 482 aagtagaggcacttgcgaattctttacatatgcgtttcttagcccccaaaattgagaatg 541
           ||||||| | ||||||  |||||||||||||||||||||||||||| |||||||||||||
Sbjct: 455 aagtagaagtacttgctgattctttacatatgcgtttcttagcccctaaaattgagaatg 514


Query: 542 aacctgaaacatggactgtgaggaatatttataactcatgggcttatcatgtgcaatatt 601
           ||   ||||| |||||| ||| |||| | |||||||||||| ||||| |||||||||| |
Sbjct: 515 aatacgaaacttggactatgaagaatgtgtataactcatggacttataatgtgcaatact 574


Query: 602 ggaagaatggctccgatgaaaagtttgcagttaccgcccagtatgacttcgaggtccttc 661
           |||| || ||  | ||||||||||||  | ||||  ||||||||||||| ||||||||
Sbjct: 575 ggaaaaacggtactgatgaaaagtttcaaattactccccagtatgactttgaggtcctca 634


Query: 662 gaaatctggagtcatccacaacttactgtgttcaagtccgagcgtttcttcccgatcgga 721
           |||| |||||| |||  |||||||| ||||||||||| |||| ||||||||| |||||||
Sbjct: 635 gaaacctggagccatggacaacttattgtgttcaagttcgagggtttcttcctgatcgga 694


Query: 722 acaaaaccggggaatggagtgatcctgtctgtgggcagacgaccaatgacgaaaccaccc 781
           ||||| | |||||||||||||| |||||||||| ||| || ||| ||||||||||   ||
Sbjct: 695 acaaagctggggaatggagtgagcctgtctgtgagcaaacaacccatgacgaaacggtcc 754


Query: 782 ccacctggatcgtggcc 798
           || ||||||| ||||||
Sbjct: 755 cctcctggatggtggcc 771



>gnl|UG|Mm#S10866118 Mus musculus adult male aorta and vein cDNA,
           RIKEN full-length enriched library, clone:A530048E20
           product:interleukin 10 receptor, beta, full insert
           sequence. /gb=AK040938 /gi=26088163 /ug=Mm.194531
           /len=1483
          Length = 1483

 Score =  103 bits (52), Expect = 1e-20
 Identities = 163/200 (81%)
 Strand = Plus / Plus


Query: 388 agagtcagggctgaatttgcagacgagcattcagactggataaacatcaccttctgtcct 447
           ||||||||||||||||| || || || ||||| || ||| | ||  |||||||||| ||
Sbjct: 267 agagtcagggctgaattggcggatgaacattcggagtgggtcaatgtcaccttctgcccc 326


Query: 448 gtggatgacaccattattggacctcctggaatgcaagtagaggcacttgcgaattcttta 507
           ||||| |||||||| |||||||||||||  |||||  ||||  | |||||  | ||||||
Sbjct: 327 gtggaagacaccatcattggacctcctgagatgcagatagaatcccttgctgagtcttta 386


Query: 508 catatgcgtttcttagcccccaaaattgagaatgaacctgaaacatggactgtgaggaat 567
           ||  ||||||||| ||||||  ||||||||||||| ||||| || |||||  ||| |||
Sbjct: 387 cacctgcgtttctcagccccacaaattgagaatgagcctgagacgtggaccttgaagaac 446


Query: 568 atttataactcatgggctta 587
           |||||| |||||||||||||
Sbjct: 447 atttatgactcatgggctta 466


 Score = 89.7 bits (45), Expect = 2e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus


Query: 190 ccacctcctgaaaacgtcagaatgaattcagttaatttcaagaacattctccagtgggac 249
           ||||| ||||| || ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 69  ccaccccctgagaaggtcagaatgaattcagttaatttcaagaacattctacagtgggag 128


Query: 250 tcacctgcttttccccagggggatctgaccttcacagctcagtat 294
             ||||||||| ||| |   | | ||||| |||||||||||||||
Sbjct: 129 gtacctgctttccccaaaacgaacctgactttcacagctcagtat 173



>gnl|UG|Mm#S8040667 Mus musculus interleukin 10 receptor, beta
           (Il10rb), mRNA /cds=(3,1052) /gb=NM_008349 /gi=6680390
           /ug=Mm.4154 /len=1670
          Length = 1670

 Score =  103 bits (52), Expect = 1e-20
 Identities = 163/200 (81%)
 Strand = Plus / Plus


Query: 388 agagtcagggctgaatttgcagacgagcattcagactggataaacatcaccttctgtcct 447
           ||||||||||||||||| || || || ||||| || ||| | ||  |||||||||| ||
Sbjct: 264 agagtcagggctgaattggcggatgaacattcggagtgggtcaatgtcaccttctgcccc 323


Query: 448 gtggatgacaccattattggacctcctggaatgcaagtagaggcacttgcgaattcttta 507
           ||||| |||||||| |||||||||||||  |||||  ||||  | |||||  | ||||||
Sbjct: 324 gtggaagacaccatcattggacctcctgagatgcagatagaatcccttgctgagtcttta 383


Query: 508 catatgcgtttcttagcccccaaaattgagaatgaacctgaaacatggactgtgaggaat 567
           ||  ||||||||| ||||||  ||||||||||||| ||||| || |||||  ||| |||
Sbjct: 384 cacctgcgtttctcagccccacaaattgagaatgagcctgagacgtggaccttgaagaac 443


Query: 568 atttataactcatgggctta 587
           |||||| |||||||||||||
Sbjct: 444 atttatgactcatgggctta 463


 Score = 89.7 bits (45), Expect = 2e-16
 Identities = 90/105 (85%)
 Strand = Plus / Plus


Query: 190 ccacctcctgaaaacgtcagaatgaattcagttaatttcaagaacattctccagtgggac 249
           ||||| ||||| || ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 66  ccaccccctgagaaggtcagaatgaattcagttaatttcaagaacattctacagtgggag 125


Query: 250 tcacctgcttttccccagggggatctgaccttcacagctcagtat 294
             ||||||||| ||| |   | | ||||| |||||||||||||||
Sbjct: 126 gtacctgctttccccaaaacgaacctgactttcacagctcagtat 170



>gnl|UG|Hs#S1732444 Homo sapiens synaptogyrin 3 (SYNGR3), mRNA
           /cds=(137,826) /gb=NM_004209 /gi=22091456 /ug=Hs.6467
           /len=2054
          Length = 2054

 Score = 38.2 bits (19), Expect = 0.65
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 822 cgccgccttcctgctgctc 840
           |||||||||||||||||||
Sbjct: 382 cgccgccttcctgctgctc 400



>gnl|UG|Bt#S12073021 Bos taurus inositol 1,4,5-triphosphate receptor,
            type 3 (ITPR3), mRNA /cds=(1,7995) /gb=NM_174370
            /gi=27805962 /ug=Bt.9025 /len=7995
          Length = 7995

 Score = 38.2 bits (19), Expect = 0.65
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 57   cgtgttccccgtgcccggc 75
            |||||||||||||||||||
Sbjct: 6387 cgtgttccccgtgcccggc 6405



>gnl|UG|Hs#S4621279 Homo sapiens mRNA; cDNA DKFZp761E198 (from clone
            DKFZp761E198) /cds=(1,1534) /gb=AL834269 /gi=21739833
            /ug=Hs.397873 /len=3500
          Length = 3500

 Score = 36.2 bits (18), Expect = 2.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus


Query: 796  gcctgtgtcctggccgcc 813
            ||||||||||||||||||
Sbjct: 1038 gcctgtgtcctggccgcc 1055



>gnl|UG|Hs#S2294321 Homo sapiens G protein-coupled receptor 27
           (GPR27), mRNA /cds=(1,1128) /gb=NM_018971 /gi=9506746
           /ug=Hs.356084 /len=1128
          Length = 1128

 Score = 36.2 bits (18), Expect = 2.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus


Query: 822 cgccgccttcctgctgct 839
           ||||||||||||||||||
Sbjct: 324 cgccgccttcctgctgct 341



>gnl|UG|Hs#S3991386 Homo sapiens cDNA FLJ30246 fis, clone
           BRACE2002202, weakly similar to SERINE/THREONINE-PROTEIN
           KINASE SNK (EC 2.7.1.-). /gb=AK054808 /gi=16549420
           /ug=Hs.195352 /len=1933
          Length = 1933

 Score = 36.2 bits (18), Expect = 2.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus


Query: 818 tggtcgccgccttcctgc 835
           ||||||||||||||||||
Sbjct: 106 tggtcgccgccttcctgc 123



>gnl|UG|Hs#S717148 zu56f05.r1 Soares ovary tumor NbHOT Homo sapiens
           cDNA clone IMAGE:742017 5', mRNA sequence
           /clone=IMAGE:742017 /clone_end=5' /gb=AA405424
           /gi=2063661 /ug=Hs.194242 /len=463
          Length = 463

 Score = 36.2 bits (18), Expect = 2.6
 Identities = 18/18 (100%)
 Strand = Plus / Minus


Query: 9   cggggcggggtgggcggg 26
           ||||||||||||||||||
Sbjct: 372 cggggcggggtgggcggg 355



>gnl|UG|Hs#S5978401 Homo sapiens hypothetical protein BC004895
           (LOC91056), mRNA /cds=(44,715) /gb=NM_138368
           /gi=24308427 /ug=Hs.124962 /len=2680
          Length = 2680

 Score = 36.2 bits (18), Expect = 2.6
 Identities = 18/18 (100%)
 Strand = Plus / Plus


Query: 796 gcctgtgtcctggccgcc 813
           ||||||||||||||||||
Sbjct: 219 gcctgtgtcctggccgcc 236


  Database: UniGene(Bt+Hs+Ssc+Mm)
    Posted date:  May 6, 2003  5:18 PM
  Number of letters in database: 241,976,893
  Number of sequences in database:  230,285

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 112045
Number of Sequences: 230285
Number of extensions: 112045
Number of successful extensions: 8551
Number of sequences better than 10.0: 15
length of query: 860
length of database: 241,976,893
effective HSP length: 19
effective length of query: 841
effective length of database: 237,601,478
effective search space: 199822842998
effective search space used: 199822842998
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)