Animal-Genome cDNA Clone 20030531/20030531C-0/20030531C-003029


Query

>20030531C-003029 (20030531C-003029) 20030531C-003029
TCCTTTTGTA AGAAGAGCTC AGAATCACAA GAGGGAAACT TGCCCCAAAG
ATGAGCCTCG CATGTACAAC CTTGGCCAGC TTCCTCCTGA TTTTCATTGT
TTCCAACAAA GGTACAGTCT CTCAAATTAC TGAGGTTGTC TGGGGCATCG
TGGATCAAGA CATCAACCTG GACATTCCTG AACTTTCAAA ACATGATAAC
GTAGATCATA TACGATGGCA GAAGAATGAA AACAAGATCG CAGAATTTAA
AAAAAACAAA GAAACTCACC CTGTGAAAGA CACATACATG ATGTTACCAA
ATGGAACTCT GAGAATTAAA GATCTGAAGA GAGATGATGA GGGTATCTAC
AAGGTAACTG TCTATGCTAC GGATGGAAAA CACATGCTGG AGAGAAAATT
TGATTTGCAG ATTCTAGATG GGGTCTCAAA ACCTGTAATC TCCTGGAGCT
GTGCCAACAA AACGGTGACC TGTGAGGTAG CAGAAGGAAG TGACCCTAAG
TTAAAACTGT ATGTAAATAA GTCCACTGCC AGAGAAGGTC GTCAGAAGGT
CATCCTGTGG AAGTGGAACA CCAAATGGAG CACATTATTC AAGTGTGTGG
CCAGTAACAA CGCCAGTGAG CAAATCAGCA TGGTGACCAT CAGTTGTACG
GGGCAAGGTC TGGATATCTA TCTCATCATC GGCATCTGCG GAGGAGGCAC
CGTATTCCTC ATCTTCATAG CACTACTCAT ATTCTACACC AGCAAGAGGA
AAAAGCAGAG CAGCAGGAGA AATGATGAGG AGCTGGAGAT AAGAGCGAAG
AGAGCGAGCC CCGAGGAAAG GGGCCGGAAG CCCCATCCAT TTCCAGGCTC
AACTCCTCAA AATCCGGTCA TTTCCCAAAC TCCTCCAATG CCTGGTCATC
GTTCTCAGGC ACCTACTCCT CGTCCCGGGC CTCCTGGCCC CCGTGTCCAG
CACCCACAGA AGAAGAGGCC TCCTCCTACC CCGGGCACAC AAGTTCACCA
GCAAAAAGGC CCTCCCCTCC CCAAGCCTCG AGTTCAAACA AAACCTACCC
ATGAGGCCAA AGAAAACTCA TAACTCTGTC TCCTGATGCG GTTGTCCCTT
CCCTCTAATT AAAAGAGGAC AGAAACTGTC CTTTCCTGTA AAAGGCACTG
TGGAGTTTCT CCACTCCAGG CGCGCATGCT AGCCGCTTCC ATCAAGCGTG
CTCTGCAGGG GGACCGGGAC AGCGCCCAAG CCCAGGAGCC ACAGCCCTGT
CTGTACCATC TAACTCAGCC CCGAGGCCTG ACATCTGGAG TCTCTGGCCT
CCTCCACCAC TGCAGGAAGG GAAAAACCGT CAAAGAGTAC GGATTAGGAT
GATGGGTGAC CGAGCACAAA ATCCTGGAGA TCTCTCAGCC TCTGTCTCAC
ACCATGTGCA GGCATCAGAT ATCAAGTGGA GGGTGTGGCC GTGTCTTGTT
GCAAGCAACC TGCCTGCTGG AGACATGCTT GTCATTTGCT CACCTTATGG
GGAGTAGAAG TGAAATAAAA GGCTTGACCT GACACCAGTG TTTACTCATT
GTGGAAAGGA GCCCAGCATC CAGCTACGGA ATC

Search to UniGene2 database

Query= 20030531C-003029 (20030531C-003029) 20030531C-003029
         (1583 letters)

Database: UniGene(Bt+Hs+Ssc+Mm)
           230,285 sequences; 241,976,893 total letters

Searching..................................................done

                                                                               Score     E
            Sequences producing significant alignments:                        (bits)  Value

Alignment   gnl|UG|Hs#S1726413 Homo sapiens CD2 antigen (p50), sheep red bl...   172  3e-41
Alignment   gnl|UG|Hs#S1970097 Homo sapiens cDNA FLJ20833 fis, clone ADKA02...    42  0.078
Alignment   gnl|UG|Bt#S12053437 485080 MARC 2BOV Bos taurus cDNA 5', mRNA s...    42  0.078
Alignment   gnl|UG|Mm#S8081945 Mus musculus CD2 antigen (Cd2), mRNA /cds=(6...    40  0.31
Alignment   gnl|UG|Hs#S1645752 UI-H-BI1-abw-h-08-0-UI.s1 NCI_CGAP_Sub3 Homo...    38  1.2
Alignment   gnl|UG|Hs#S5978414 Homo sapiens hypothetical protein BC007706 (...    38  1.2
Alignment   gnl|UG|Mm#S9087511 602389611F1 NIH_MGC_94 Mus musculus cDNA clo...    38  1.2
Alignment   gnl|UG|Mm#S10828554 Mus musculus RIKEN cDNA E330008O22 gene (E3...    38  1.2
Alignment   gnl|UG|Mm#S10851364 Mus musculus 16 days neonate heart cDNA, RI...    38  1.2
Alignment   gnl|UG|Mm#S7391134 Mus musculus ubiquitin protein ligase (Itch)...    38  1.2


>gnl|UG|Hs#S1726413 Homo sapiens CD2 antigen (p50), sheep red blood
            cell receptor (CD2), mRNA /cds=(7,1062) /gb=NM_001767
            /gi=4502652 /ug=Hs.89476 /len=1504
          Length = 1504

 Score =  172 bits (87), Expect = 3e-41
 Identities = 340/421 (80%), Gaps = 5/421 (1%)
 Strand = Plus / Plus


Query: 655  aaggtctggatatctatctcatcatcggcatctgcggaggaggcaccgtattcctcatct 714
            |||||||||| |||||||||||||| ||||| || |||||||||| | | ||  |  |||
Sbjct: 623  aaggtctggacatctatctcatcattggcatatgtggaggaggcagcctcttgatggtct 682


Query: 715  tcatagcactactcatattctacaccagcaagaggaaaaagcagagcagcaggagaaatg 774
            |  | ||||| ||| | ||||| | || ||| |||||||| ||||| ||  |||||||||
Sbjct: 683  ttgtggcactgctcgttttctatatcaccaaaaggaaaaaacagaggagtcggagaaatg 742


Query: 775  atgaggagctggagataagagcgaagagagcgagcccc-gaggaaaggggccggaagccc 833
            ||||||||||||||| ||||||  | ||||  |||  | || ||||||||||||||||||
Sbjct: 743  atgaggagctggagacaagagcccacagagt-agctactgaagaaaggggccggaagccc 801


Query: 834  catccatttccaggctcaactcctcaaaatccggtcatttcccaaa---ctcctccaatg 890
            || | | ||||||  ||||| ||||| ||||| |  | |||||||    ||||||||
Sbjct: 802  caacaaattccagcttcaacccctcagaatccagcaacttcccaacatcctcctccacca 861


Query: 891  cctggtcatcgttctcaggcacctactcctcgtcccgggcctcctggcccccgtgtccag 950
            |||||||||||||| |||||||||| || |||||||  ||||||||| | |||||| |||
Sbjct: 862  cctggtcatcgttcccaggcacctagtcatcgtcccccgcctcctggacaccgtgttcag 921


Query: 951  cacccacagaagaagaggcctcctcctaccccgggcacacaagttcaccagcaaaaaggc 1010
            ||||  |   |||||||||||||| || |  |||||||||||||||||||||| ||||||
Sbjct: 922  caccagcctcagaagaggcctcctgctccgtcgggcacacaagttcaccagcagaaaggc 981


Query: 1011 cctcccctccccaagcctcgagttcaaacaaaacctacccatgaggccaaagaaaactca 1070
            || ||||||||||  |||||||||||  |||||||| |||||| |||   ||||||||||
Sbjct: 982  ccgcccctccccagacctcgagttcagccaaaacctccccatggggcagcagaaaactca 1041


Query: 1071 t 1071
            |
Sbjct: 1042 t 1042


 Score = 65.9 bits (33), Expect = 5e-09
 Identities = 144/181 (79%)
 Strand = Plus / Plus


Query: 299 aaatggaactctgagaattaaagatctgaagagagatgatgagggtatctacaaggtaac 358
           |||||||||||||| ||||||  |||||||||  |||||| ||| ||||||||||||| |
Sbjct: 270 aaatggaactctgaaaattaagcatctgaagaccgatgatcaggatatctacaaggtatc 329


Query: 359 tgtctatgctacggatggaaaacacatgctggagagaaaatttgatttgcagattctaga 418
             | |||| |||  | |||||| |  || |||| | || |||||||||| |||||| |||
Sbjct: 330 aatatatgatacaaaaggaaaaaatgtgttggaaaaaatatttgatttgaagattcaaga 389


Query: 419 tggggtctcaaaacctgtaatctcctggagctgtgccaacaaaacggtgacctgtgaggt 478
             |||||||||||||    ||||||||||  |||  ||||| |||  |||||||||||||
Sbjct: 390 gagggtctcaaaaccaaagatctcctggacttgtatcaacacaaccctgacctgtgaggt 449


Query: 479 a 479
           |
Sbjct: 450 a 450


 Score = 46.1 bits (23), Expect = 0.005
 Identities = 41/47 (87%)
 Strand = Plus / Plus


Query: 75  gccagcttcctcctgattttcattgtttccaacaaaggtacagtctc 121
           ||||||||||| |||||||||| ||||||   ||||||| |||||||
Sbjct: 31  gccagcttccttctgattttcaatgtttcttccaaaggtgcagtctc 77


 Score = 38.2 bits (19), Expect = 1.2
 Identities = 53/63 (84%), Gaps = 1/63 (1%)
 Strand = Plus / Plus


Query: 1092 ttgtcccttccctctaattaaaagaggacagaaactgtcctttcctgtaaaaggcactgt 1151
            ||||||| | ||||||||||||| | || |||||||||| ||| |  ||||| |||||||
Sbjct: 1042 ttgtccccttcctctaattaaaa-aagatagaaactgtctttttcaataaaaagcactgt 1100


Query: 1152 gga 1154
            |||
Sbjct: 1101 gga 1103



>gnl|UG|Hs#S1970097 Homo sapiens cDNA FLJ20833 fis, clone ADKA02957.
            /gb=AK000840 /gi=7021159 /ug=Hs.365692 /len=1914
          Length = 1914

 Score = 42.1 bits (21), Expect = 0.078
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 994  ttcaccagcaaaaaggccctc 1014
            |||||||||||||||||||||
Sbjct: 37   ttcaccagcaaaaaggccctc 57



>gnl|UG|Bt#S12053437 485080 MARC 2BOV Bos taurus cDNA 5', mRNA
            sequence /clone_end=5' /gb=BI976274 /gi=16350679
            /ug=Bt.10954 /len=476
          Length = 476

 Score = 42.1 bits (21), Expect = 0.078
 Identities = 27/29 (93%)
 Strand = Plus / Plus


Query: 1500 gggagtagaagtgaaataaaaggcttgac 1528
            |||||||| ||||||||||||| ||||||
Sbjct: 398  gggagtagcagtgaaataaaagccttgac 426


 Score = 40.1 bits (20), Expect = 0.31
 Identities = 36/40 (90%), Gaps = 1/40 (2%)
 Strand = Plus / Plus


Query: 1128 gtcctttcctgtaaaaggcactgtggagtttctccactcc 1167
            |||||||||  ||||| |||||||||| ||||||||||||
Sbjct: 9    gtcctttcccataaaa-gcactgtggaatttctccactcc 47



>gnl|UG|Mm#S8081945 Mus musculus CD2 antigen (Cd2), mRNA
            /cds=(61,1095) /gb=NM_013486 /gi=7304948 /ug=Mm.22842
            /len=1144
          Length = 1144

 Score = 40.1 bits (20), Expect = 0.31
 Identities = 29/32 (90%)
 Strand = Plus / Plus


Query: 984  ggcacacaagttcaccagcaaaaaggccctcc 1015
            ||||||||  |||||||||| |||||||||||
Sbjct: 988  ggcacacagattcaccagcagaaaggccctcc 1019



>gnl|UG|Hs#S1645752 UI-H-BI1-abw-h-08-0-UI.s1 NCI_CGAP_Sub3 Homo
           sapiens cDNA clone IMAGE:2713574 3', mRNA sequence
           /clone=IMAGE:2713574 /clone_end=3' /gb=AW138112
           /gi=6142430 /ug=Hs.437516 /len=914
          Length = 914

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 749 gaaaaagcagagcagcagg 767
           |||||||||||||||||||
Sbjct: 327 gaaaaagcagagcagcagg 309



>gnl|UG|Hs#S5978414 Homo sapiens hypothetical protein BC007706
            (LOC90268), mRNA /cds=(85,531) /gb=NM_138348 /gi=24308401
            /ug=Hs.91192 /len=2326
          Length = 2326

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 1224 gcccaagcccaggagccac 1242
            |||||||||||||||||||
Sbjct: 596  gcccaagcccaggagccac 578



>gnl|UG|Mm#S9087511 602389611F1 NIH_MGC_94 Mus musculus cDNA clone
           IMAGE:4501610 5', mRNA sequence /clone=IMAGE:4501610
           /clone_end=5' /gb=BG292952 /gi=13052292 /ug=Mm.260964
           /len=1202
          Length = 1202

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus


Query: 379 aacacatgctggagagaaa 397
           |||||||||||||||||||
Sbjct: 718 aacacatgctggagagaaa 736



>gnl|UG|Mm#S10828554 Mus musculus RIKEN cDNA E330008O22 gene
            (E330008O22Rik), mRNA /cds=(129,1526) /gb=NM_172662
            /gi=27369951 /ug=Mm.216325 /len=2555
          Length = 2555

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus


Query: 298  caaatggaactctgagaat 316
            |||||||||||||||||||
Sbjct: 2226 caaatggaactctgagaat 2208



>gnl|UG|Mm#S10851364 Mus musculus 16 days neonate heart cDNA, RIKEN
            full-length enriched library, clone:D830007B15
            product:hypothetical protein, full insert sequence.
            /gb=AK085772 /gi=26102960 /ug=Mm.135947 /len=1715
          Length = 1715

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 987  acacaagttcaccagcaaaaagg 1009
            ||||||||||| |||||||||||
Sbjct: 1004 acacaagttcagcagcaaaaagg 1026



>gnl|UG|Mm#S7391134 Mus musculus ubiquitin protein ligase (Itch) mRNA,
            complete cds /cds=(150,2714) /gb=AF037454 /gi=2827197
            /ug=Mm.8975 /len=5122
          Length = 5122

 Score = 38.2 bits (19), Expect = 1.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus


Query: 1484 atttgctcaccttatggggagta 1506
            ||||||| |||||||||||||||
Sbjct: 2525 atttgctgaccttatggggagta 2547


  Database: UniGene(Bt+Hs+Ssc+Mm)
    Posted date:  May 6, 2003  5:18 PM
  Number of letters in database: 241,976,893
  Number of sequences in database:  230,285

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 269544
Number of Sequences: 230285
Number of extensions: 269544
Number of successful extensions: 21650
Number of sequences better than 10.0: 39
length of query: 1583
length of database: 241,976,893
effective HSP length: 19
effective length of query: 1564
effective length of database: 237,601,478
effective search space: 371608711592
effective search space used: 371608711592
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)