[Help]

[Overview] [RefSeq] [UniGene] [Cluster & SNP] [Alignment]

Assembly Name:  20030531C-001710

Length: 860

Sequence:  [FASTA format sequence]
AGCAGCCTCG GGGCGGGGTG GGCGGGTGCA CTCCGGCGCG GACGCCGGTG AGGGGGCGTG
TTCCCCGTGC CCGGCGGCTG CCCGCGGGAC CCCCGAGGGC CCTCCCGGGC TCCCGGTGCG
ACCATGGCGC GGAGCCTCCG GAACTGGCTG GGCGGCTGCC TACTGGTGTC AGCATTAGGA
ATGGTGGTGC CACCTCCTGA AAACGTCAGA ATGAATTCAG TTAATTTCAA GAACATTCTC
CAGTGGGACT CACCTGCTTT TCCCCAGGGG GATCTGACCT TCACAGCTCA GTATCACAGT
TATAGGCAAT TCCAGGATCA GTGTGTGAGC ATCATCTTGA CGGAGTGTGA TTTCTCAAGT
CTTTCCAAGT ACGGTGACCA CATCTTAAGA GTCAGGGCTG AATTTGCAGA CGAGCATTCA
GACTGGATAA ACATCACCTT CTGTCCTGTG GATGACACCA TTATTGGACC TCCTGGAATG
CAAGTAGAGG CACTTGCGAA TTCTTTACAT ATGCGTTTCT TAGCCCCCAA AATTGAGAAT
GAACCTGAAA CATGGACTGT GAGGAATATT TATAACTCAT GGGCTTATCA TGTGCAATAT
TGGAAGAATG GCTCCGATGA AAAGTTTGCA GTTACCGCCC AGTATGACTT CGAGGTCCTT
CGAAATCTGG AGTCATCCAC AACTTACTGT GTTCAAGTCC GAGCGTTTCT TCCCGATCGG
AACAAAACCG GGGAATGGAG TGATCCTGTC TGTGGGCAGA CGACCAATGA CGAAACCACC
CCCACCTGGA TCGTGGCCTG TGTCCTGGCC GCCTCGGTGG TCGCCGCCTT CCTGCTGCTC
CCTCGCTGCT TCATCTTGCT


Assembly Overview:      TOP


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Nucleotide ProteinIL10RBinterleukin 10 receptor, beta precursor; cytokine receptor family II, member 4; cytokine receptor class-II CRF2-4396e-111O
Nucleotide ProteinIL20RAinterleukin 20 receptor, alpha; class II cytokine receptor ZCYTOR788.65e-18O
Nucleotide ProteinIFNAR1interferon (alpha, beta and omega) receptor 1; human interferon-alpha receptor (HuIFN-alpha-Rec)80.12e-15
Nucleotide ProteinIFNGR2interferon gamma receptor 2 (interferon gamma transducer 1); interferon gamma receptor accessory factor-1; interferon-gamma receptor beta chain precursor625e-10O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Nucleotide ProteinIl10rbinterleukin 10 receptor, beta 3468e-96O
Nucleotide ProteinIfnar1interferon (alpha and beta) receptor 1; interferon (alpha and beta) receptor; INF-a receptor 82.43e-16O
Nucleotide ProteinIl20rahypothetical protein E230031K19 77.49e-15O
Nucleotide ProteinIl22ra2interleukin 22 soluble receptor 50.11e-06O


BLAST on UniGene:      TOP
DefinitionScoreE valueFL
UniGene GenBankHomo sapiens interleukin 10 receptor, beta (IL10RB), mRNA601e-170O
UniGene GenBankMus musculus adult male aorta and vein cDNA, RIKEN full-length enriched library, clone:A530048E20 product:interleukin 10 receptor, beta, full insert sequence.1031e-20
UniGene GenBankMus musculus interleukin 10 receptor, beta (Il10rb), mRNA1031e-20O
UniGene GenBankBos taurus inositol 1,4,5-triphosphate receptor, type 3 (ITPR3), mRNA38.20.65
UniGene GenBankHomo sapiens synaptogyrin 3 (SYNGR3), mRNA38.20.65
UniGene GenBankHomo sapiens mRNA; cDNA DKFZp761E198 (from clone DKFZp761E198)36.22.6
UniGene GenBankHomo sapiens G protein-coupled receptor 27 (GPR27), mRNA36.22.6
UniGene GenBankHomo sapiens cDNA FLJ30246 fis, clone BRACE2002202, weakly similar to SERINE/THREONINE-PROTEIN KINASE SNK (EC 2.7.1.-).36.22.6
UniGene GenBankzu56f05.r1 Soares ovary tumor NbHOT Homo sapiens cDNA clone IMAGE:742017 5', mRNA sequence36.22.6
UniGene GenBankHomo sapiens hypothetical protein BC004895 (LOC91056), mRNA36.22.6


Assembly Members: 3      TOP
LibraryPlateLoc.Read NameAccession
LNG010100E02LNG01_0100_E02.b.ab1BP437081
OVRM10009G09OVRM1_0009_G09.b.ab1BP153214
OVRM10096D11OVRM1_0096_D11.b.ab1BP149777

  

Alignment:      TOP

20030531C-001710     : ...........................................................A
---------+---------+---------+---------+---------+---------+ 1
OVRM1_0096_D11.b.ab1 : ccggtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA
LNG01_0100_E02.b.ab1 : ttggctagctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : GCAGCCTCGGGGCGGGGTGGGCGGGTGCACTCCGGCGCGGACGCCGGTGAGGGGGCGTGT
---------+---------+---------+---------+---------+---------+ 61
OVRM1_0096_D11.b.ab1 : GCAGCCTCGGGGCGGGGTGGGCGGGTGCACTCCGGCGCGGACGCCGGTGAGGGGGCGTGT
LNG01_0100_E02.b.ab1 : xxxxxxxxxxxxxxxxxxxxxxaGGTGCACTCCGGCGCGGACGCCGGTGAGGGGGCGTGT
OVRM1_0009_G09.b.ab1 : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20030531C-001710 : TCCCCGTGCCCGGCGGCTGCCCGCGGGACCCCCGAGGGCCCTCCCGGGCTCCCGGTGCGA
---------+---------+---------+---------+---------+---------+ 121
OVRM1_0096_D11.b.ab1 : TCCCCGTGCCCGGCGGCTGCCCGCGGGACCCCCGAGGGCCCTCCCGGGCTCCCGGTGCGA
LNG01_0100_E02.b.ab1 : TCCCCGTgcccggcggctgcccgcgggccccccgagggccctcccgggcTCCCGGTGCGA
OVRM1_0009_G09.b.ab1 : xxxxxxxxCCCGGCGGCTGCCCGCGGGACCCCCGAGGGCCCTCCCGGGCTCCCGGTGCGA
20030531C-001710 : CCATGGCGCGGAGCCTCCGGAACTGGCTGGGCGGCTGCCTACTGGTGTCAGCATTAGGAA
---------+---------+---------+---------+---------+---------+ 181
OVRM1_0096_D11.b.ab1 : CCATGGCGCGGAGCCTCCGGAACTGGCTGGGCGGCTGCCTACTGGTGTCAGCATTAGGAA
LNG01_0100_E02.b.ab1 : CCATGGCGCGGAGCCTCCGGAACTGGCTGGGCGGCTGCCTACTGGTGTCAGCATTAGGAA
OVRM1_0009_G09.b.ab1 : CCATGGCGCGGAGCCTCCGGAACTGGCTGGGCGGCTGCCTACTGGTGTCAGCATTAGGAA
20030531C-001710 : TGGTGGTGCCACCTCCTGAAAACGTCAGAATGAATTCAGTTAATTTCAAGAACATTCTCC
---------+---------+---------+---------+---------+---------+ 241
OVRM1_0096_D11.b.ab1 : TGGTGGTGCCACCTCCTGAAAACGTCAGAATGAATTCAGTTAATTTCAAGAACATTCTCC
LNG01_0100_E02.b.ab1 : TGGTGGTGCCACCTCCTGAAAACGTCAGAATGAATTCAGTTAATTTCAAGAACATTCTCC
OVRM1_0009_G09.b.ab1 : TGGTGGTGCCACCTCCTGAAAACGTCAGAATGAATTCAGTTAATTTCAAGAACATTCTCC
20030531C-001710 : AGTGGGACTCACCTGCTTTTCCCCAGGGGGATCTGACCTTCACAGCTCAGTATCACAGTT
---------+---------+---------+---------+---------+---------+ 301
OVRM1_0096_D11.b.ab1 : AGTGGGACTCACCTGCTTTTCCCCAGGGGGATCTGACCTTCACAGCTCAGTATCACAGTT
LNG01_0100_E02.b.ab1 : AGTGGGACTCACCTGCTTTTCCCCAGGGGGATCTGACCTTCACAGCTCAGTATCACAGTT
OVRM1_0009_G09.b.ab1 : AGTGGGACTCACCTGCTTTTCCCCAGGGGGATCTGACCTTCACAGCTCAGTATCACAGTT
20030531C-001710 : ATAGGCAATTCCAGGATCAGTGTGTGAGCATCATCTTGACGGAGTGTGATTTCTCAAGTC
---------+---------+---------+---------+---------+---------+ 361
OVRM1_0096_D11.b.ab1 : ATAGGCAATTCCAGGATCAGTGTGTGAGCATCATCCTGACGGAGTGTGATTTCTCAAGTC
LNG01_0100_E02.b.ab1 : ATAGGCAATTCCAGGATCAGTGTGTGAGCATCATCTTGACGGAGTGTGATTTCTCAAGTC
OVRM1_0009_G09.b.ab1 : ATAGGCAATTCCAGGATCAGTGTGTGAGCATCATCTTGACGGAGTGTGATTTCTCAAGTC
20030531C-001710 : TTTCCAAGTACGGTGACCACATCTTAAGAGTCAGGGCTGAATTTGCAGACGAGCATTCAG
---------+---------+---------+---------+---------+---------+ 421
OVRM1_0096_D11.b.ab1 : TTTCCAAGTACGGTGACCACATCTTCATAGTCAGGGCTGAATTTGCAGACGAGCATTCAG
LNG01_0100_E02.b.ab1 : TTTCCAAGTACGGTGACCACATCTTAAGAGTCAGGGCTGAATTTGCAGACGAGCATTCAG
OVRM1_0009_G09.b.ab1 : TTTCCAAGTACGGTGACCACATCTTAAGAGTCAGGGCTGAATTTGCAGACGAGCATTCAG
20030531C-001710 : ACTGGATAAACATC*ACCTTCTGTCCTGTGGATGACACCATTATTGGACCTCCTGGAATG
---------+---------+---------+---------+---------+---------+ 480
OVRM1_0096_D11.b.ab1 : ACTGGATAAACATCCACCTTCTGTCCTGTGGACGACCCCTTTATTGGACCTCCCGGAATG
LNG01_0100_E02.b.ab1 : ACTGGATAAACATC*ACCTTCTGTCCTGTGGATGACACCATTATTGGACCTCCTGGAATG
OVRM1_0009_G09.b.ab1 : ACTGGATAAACATC*ACCTTCTGTCCTGTGGATGACACCATTATTGGACCTCCTGGAATG
20030531C-001710 : CAAGTAGAGGCACTTGCGAATTCTTTACATATGCGTTTCT*TAGCCCCCAAAATTGAGAA
---------+---------+---------+---------+---------+---------+ 539
OVRM1_0096_D11.b.ab1 : CAACTACAGGCACCTGCGAATTCTTTACATACGCCTTTCTCTAGCCCCTACTATTCGTAA
LNG01_0100_E02.b.ab1 : CAAGTAGAGGCACTTGCGAATTCTTTACATATGCGTTTCT*TAGCCCCCAAAATTGAGAA
OVRM1_0009_G09.b.ab1 : CAAGTAGAGGCACTTGCGAATTCTTTACATATGCGTTTCT*TAGCCCCCAAAATTGAGAA
20030531C-001710 : TGAACCTGAAACATGGACTGTGAGGAATATTTATAACTCATGGGCTTATCATGTGCAATA
---------+---------+---------+---------+---------+---------+ 599
OVRM1_0096_D11.b.ab1 : CGAACCTGAAACATGGATTGTGAGCCATCTTTATAACCCATGGGCTGATCATGTGCccca
LNG01_0100_E02.b.ab1 : TGAACCTGAAACATGGACTGTGAGGAATATTTATAACTCATGGGCTTATCATGTGCAATA
OVRM1_0009_G09.b.ab1 : TGAACCTGAAACATGGACTGTGAGGAATATTTATAACTCATGGGCTTATCATGTGCAATA
20030531C-001710 : TTGGAAGAATGGCTCCGATGAAAAGTTTGCAGTTACCGCCCAGTATGACTTCGAGGTCCT
---------+---------+---------+---------+---------+---------+ 659
OVRM1_0096_D11.b.ab1 : ctgtactaacgtcttctatcaaaccttgctactctccttctccatgacttcccagtctct
LNG01_0100_E02.b.ab1 : TTGGAAGAATGGCTCCGACGAAAAGTTTGCAGTTACCGCCCAGTATGACTTCGAGGTCCT
OVRM1_0009_G09.b.ab1 : TTGGAAGAATGGCTCCGATGAAAAGTTTGCAGTTACCGCCCAGTATGACTTCGAGGTCCT
20030531C-001710 : TCGAAATCTGGAGTCATCCACAACTTACTGTGTTCAAGTCCGAGCGTTTCTTCCCGATCG
---------+---------+---------+---------+---------+---------+ 719
OVRM1_0096_D11.b.ab1 : tcaaccctggtctctcctcacttctatcgctcttagtcttaacttttcctctctacctcc
LNG01_0100_E02.b.ab1 : TCGAAATCTGGAGTCATCCCACACTTACTGTGTTNCAGTCCGAGCGTTTCTTCCCGATCG
OVRM1_0009_G09.b.ab1 : TCGAAATCTGGAGTCATCCACAACTTACTGTGTTCAAGTCCGAGCGTTTCTTCCCGATCG
20030531C-001710 : GAACAAAACCGGGGAATGGAGTGATCCTGTCTGTGGGCAGACGACCAATGACGAAACCAC
---------+---------+---------+---------+---------+---------+ 779
OVRM1_0096_D11.b.ab1 : tacaaacacccgtgaatgagcctatctcctcttatcgctttcctaactccc
LNG01_0100_E02.b.ab1 : GAACAAAACCGGGGGATGGAGTGATCCTGTCTGTGGGCAGACGACCCATGACGAAACCAC
OVRM1_0009_G09.b.ab1 : GAACAAAACCGGGGAATGGAGTGATCCTGTCTGTGGGCAGACGACCAATGACGAAACCAC
20030531C-001710 : CCCCACCTGGATCGTGGCCTGTGTCCTGGCCGCCTCGGTGGTCGCCGCCTTCCTGCTGCT
---------+---------+---------+---------+---------+---------+ 839
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : *CCCACCTGGATCCTGGCCTGTGTCCTGCCCGCCTCGGTGGTCGCCGCCCTCCTGCTGCT
OVRM1_0009_G09.b.ab1 : CCCCACCTGGATCGTGGCCTGTGTCCTGGCCGCCTCGGTGGTCGCCGCCTTCCTGCTGCT
20030531C-001710 : CCCTCGCTGCTTCATCTTGCT.......................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : CCtcgctggctcatcctgctgcggtgcattttcaagaaaaccagaaccgcctcccccccg
OVRM1_0009_G09.b.ab1 : CCCTCGCTGCTTCATCTTGCTgn
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : gaaatcccctccccagcacctgaaggagtttttgacccccccccatacaacccccttctc
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : tttatctccatccaatggtctgaaaaaaataaattttttaaaaccgaattgtcctcccaa
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : aatttcccaaaacccaaacggaaattttggggccgctccaccctcgggccccttggggga
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : agggtccttcaagtccttctcccagaggaaacccgtcacccggggtgagacccctttttc
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : tccgttggccctggggagtttgagggccccttttaagggggaagcccctgggaacccccc
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : aggaaactcttcaactggggaaccccaacccccaaaaggggggggagggctgggaaaaac
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : cccctcgggaaatgccctctttggcctttttttaaaaaaaaaaaaacggcttgtgctggt
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : tgtggcgccctaatatatccggcgcaccacacacctttttaagggcctaagttatataaa
OVRM1_0009_G09.b.ab1 :
20030531C-001710 : ............................................................
---------+---------+---------+---------+---------+---------+ 860
OVRM1_0096_D11.b.ab1 :
LNG01_0100_E02.b.ab1 : gcggcgctttataacggaaaaga
OVRM1_0009_G09.b.ab1 :