[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000015

Length: 1,109

Sequence [FASTA format sequence]
GCACCGGAAG CGCAGGGGGA TGGGGCGGCG GTGACGCGAT TCTGTCCGCA TTGGAGGGGC
CGGGCCGCTG CCGAAGTCGC CGCGGCTGCC GCGTGACGTG GCACAGGCGA AGATTTAACG
CCAGAGCCGG AGCTGCCCCG CCAGTCGTCG AGCAGGTCCT TGCCCCGCTA ATTTCTGTCC
CGGGGCTTCG TCCGACACGC CGGCTAGCGA GCTGTCCCTG CCGCGCTCTT TCTGCCTTAG
CTCTTCTTCG CCCTCTGACT TTGCCAGGAG CGTGAAAGGA GAAGGCCCGG GGACGCCCCA
AGCCCCTTCT GCTCCTGCCC ATTGCAAGTG CCATTACCGC CATGGGCCTC ACCATCTCCT
CCCTCTTCTC CCGCCTCTTC GGCAAGAAGC AGATGCGCAT TTTGATGGTT GGATTGGATG
CTGCTGGCAA GACGACCATT CTGTATAAAC TGAAGTTAGG GGAGATAGTC ACCACCATTC
CTACCATTGG TTTTAATGTG GAAACAGTAG AATATAAGAA CATTTGTTTC ACAGTATGGG
ATGTTGGTGG TCAAGATAAA ATTAGGCCTC TCTGGAGGCA TTACTTCCAA AATACCCAGG
GTCTTATTTT TGTGGTAGAT AGCAATGATC GTGAAAGAAT CCAGGAAGGA GCAGATGAGC
TGCAGAAGAT GCTTCAGGAA GATGAGTTGC AAGATGCAGT GTTGCTGCTT TTTGCAAACA
AACAGGATTT GCCAAATGCT ATGGCCATTA GCGAAATGAC AGATAAATTA GGTCTTCAGT
CTCTTCGTAA CAGAACATGG TATGTTCAAG CCACTTGTGC TACACAAGGA ACTGGTCTGT
ATGAGGGACT TGACTGGCTG TCAAATGAGC TTTCAAAACG TTAAATGAAA CTGGATGTCT
AACCAAGGAC ATGTTTGATA GAATTGGTCT AGGCTTGTTA CAACAAAATT AGTTTGCATC
TTGGTTATTA AAGAGTATCT GGGACTGGTT TGGGCAGAAT ATTACAATGT TTAAACTTAT
TTTGTTGCCA ATTATTGTTT ACCAAGTATA ATGTTGCTGT TAAGCAAAGT ATGCTTGGTT
TTAAAGAAAT TCTCCTTACC TTGGAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinARF4ADP-ribosylation factor 4 [Homo sapiens]. 3492e-96O
Contig/Assembly ProteinARF5ADP-ribosylation factor 5 [Homo sapiens]. 3432e-94O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Homo sapiens]. 3041e-82O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Homo sapiens]. 3041e-82O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Homo sapiens]. 3041e-82O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Homo sapiens]. 3041e-82O
Contig/Assembly ProteinARF3ADP-ribosylation factor 3 [Homo sapiens]. 2994e-81O
Contig/Assembly ProteinARF6ADP-ribosylation factor 6 [Homo sapiens]. 2463e-65O
Contig/Assembly ProteinARL1ADP-ribosylation factor-like protein 1 [Homo sapiens]. 2188e-57O
Contig/Assembly ProteinTRIM23E3 ubiquitin-protein ligase TRIM23 isoform alpha [Homo sapiens]. 2062e-53


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinArf4ADP-ribosylation factor 4 [Mus musculus]. 3531e-97O
Contig/Assembly ProteinArf5ADP-ribosylation factor 5 [Mus musculus]. 3431e-94O
Contig/Assembly ProteinArf1ADP-ribosylation factor 1 [Mus musculus]. 3049e-83O
Contig/Assembly ProteinArf1ADP-ribosylation factor 1 [Mus musculus]. 3049e-83O
Contig/Assembly ProteinArf2ADP-ribosylation factor 2 [Mus musculus]. 3024e-82O
Contig/Assembly ProteinArf3ADP-ribosylation factor 3 [Mus musculus]. 2993e-81O
Contig/Assembly ProteinArf6ADP-ribosylation factor 6 [Mus musculus]. 2462e-65O
Contig/Assembly ProteinArl1ADP-ribosylation factor-like protein 1 [Mus musculus]. 2171e-56O
Contig/Assembly ProteinTrim23E3 ubiquitin-protein ligase TRIM23 [Mus musculus]. 2062e-53
Contig/Assembly ProteinArl5aADP-ribosylation factor-like protein 5A [Mus musculus]. 1755e-44O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607073PREDICTED: similar to ADP-ribosylation factor 4 isoform 2 [Canis familiaris]. 3593e-99O
Contig/Assembly ProteinLOC475206PREDICTED: similar to ADP-ribosylation factor 5 isoform 1 [Canis familiaris]. 3432e-94O
Contig/Assembly ProteinLOC475206PREDICTED: similar to ADP-ribosylation factor 5 isoform 2 [Canis familiaris]. 3055e-83O
Contig/Assembly ProteinLOC480487PREDICTED: similar to ADP-ribosylation factor 2 isoform 2 [Canis familiaris]. 3016e-82O
Contig/Assembly ProteinLOC480487PREDICTED: similar to ADP-ribosylation factor 2 isoform 1 [Canis familiaris]. 3016e-82O
Contig/Assembly ProteinLOC486562PREDICTED: similar to ADP-ribosylation factor 3 isoform 1 [Canis familiaris]. 2994e-81O
Contig/Assembly ProteinLOC480487PREDICTED: similar to ADP-ribosylation factor 2 isoform 3 [Canis familiaris]. 2955e-80O
Contig/Assembly ProteinLOC486562PREDICTED: similar to ADP-ribosylation factor 3 isoform 2 [Canis familiaris]. 2902e-78O
Contig/Assembly ProteinLOC474591PREDICTED: similar to ADP-ribosylation factor 1 [Canis familiaris]. 2886e-78O
Contig/Assembly ProteinLOC611567PREDICTED: similar to ADP-ribosylation factor 1 [Canis familiaris]. 2785e-75O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinARF4ADP-ribosylation factor 4 [Bos taurus]. 3593e-99O
Contig/Assembly ProteinARF5ADP-ribosylation factor 5 [Bos taurus]. 3432e-94O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Bos taurus]. 3041e-82O
Contig/Assembly ProteinLOC785421PREDICTED: ADP-ribosylation factor 1 isoform 1 [Bos taurus]. 3023e-82O
Contig/Assembly ProteinLOC785421PREDICTED: ADP-ribosylation factor 1-like [Bos taurus]. 3023e-82O
Contig/Assembly ProteinARF4ADP-ribosylation factor 2 [Bos taurus]. 3024e-82O
Contig/Assembly ProteinARF3ADP-ribosylation factor 3 [Bos taurus]. 2993e-81O
Contig/Assembly ProteinLOC100294979PREDICTED: mCG3164-like [Bos taurus]. 2463e-65O
Contig/Assembly ProteinLOC100294979PREDICTED: mCG3164-like [Bos taurus]. 2463e-65O
Contig/Assembly ProteinARL1ADP-ribosylation factor-like protein 1 [Bos taurus]. 2181e-56O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinARF4ADP-ribosylation factor 4 [Sus scrofa]. 362e-100O
Contig/Assembly ProteinARF5ADP-ribosylation factor 5 [Sus scrofa]. 3431e-94O
Contig/Assembly ProteinARF1ADP-ribosylation factor 1 [Sus scrofa]. 3047e-83O
Contig/Assembly ProteinARF4ADP-ribosylation factor 4 [Sus scrofa]. 3001e-81O
Contig/Assembly ProteinARF3ADP-ribosylation factor 3 [Sus scrofa]. 2978e-81O
Contig/Assembly ProteinARF6ADP-ribosylation factor 6 [Sus scrofa]. 2462e-65O
Contig/Assembly ProteinARL1ADP-ribosylation factor-like protein 1 [Sus scrofa]. 2186e-57O
Contig/Assembly ProteinLOC100622631PREDICTED: e3 ubiquitin-protein ligase TRIM23-like [Sus scrofa]. 2062e-53O
Contig/Assembly ProteinLOC100513958PREDICTED: e3 ubiquitin-protein ligase TRIM23-like isoform 1 [Sus scrofa]. 2062e-53
Contig/Assembly ProteinLOC100513958PREDICTED: e3 ubiquitin-protein ligase TRIM23-like isoform 2 [Sus scrofa]. 1801e-45


Assembly Members: 82      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010008D07ADR01_0008_D07.bDB782230 
ADR010032C05ADR01_0032_C05.bDB784315 
ADR010035G03ADR01_0035_G03.bDB784622 AK389283
ADR010044G08ADR01_0044_G08.bDB785442 
ADR010045D09ADR01_0045_D09.bDB785497 
AMP010005E10AMP01_0005_E10.bBW955324 
AMP010026B09AMP01_0026_B09.bBW956926 
AMP010036D12AMP01_0036_D12.bBW957613 
AMP010036G11AMP01_0036_G11.bBW957642 
AMP010042D05AMP01_0042_D05.bBW957983 
AMP010056F02AMP01_0056_F02.bBW959031 
AMP010063E07AMP01_0063_E07.bBW959567 
AMP010086B10AMP01_0086_B10.bBW961242 
AMP010087F08AMP01_0087_F08.bBW961368 
BFLT10051F03BFLT1_0051_F03.bFS644043 
BFLT10127G11BFLT1_0127_G11.bHX203995 
BMWN10023H11BMWN1_0023_H11.bHX206997 
BMWN10026B06BMWN1_0026_B06.b  
CBLT10050B01CBLT1_0050_B01.bHX215138 
CLNT10056G05CLNT1_0056_G05.bFS661508 
CLNT10117B10CLNT1_0117_B10.bHX220447 
DCI010013F04DCI01_0013_F04.bDB791474 
DCI010028F05DCI01_0028_F05.bDB792806 
DCI010036F10DCI01_0036_F10.bDB793531 
DCI010037E04DCI01_0037_E04.bDB793603 
DCI010043H10DCI01_0043_H10.bDB794067 
DCI010046F04DCI01_0046_F04.bDB794304 
DCI010061H01DCI01_0061_H01.bDB795034 
DCI010063F06DCI01_0063_F06.bDB795199 
DCI010064A06DCI01_0064_A06.bDB795232 
DCI010068A02DCI01_0068_A02.bDB795586 
DCI010072H07DCI01_0072_H07.bDB796013 
DCI010074A01DCI01_0074_A01.bDB796107 
DCI010075H12DCI01_0075_H12.bDB796280 
DCI010076F11DCI01_0076_F11.bDB796345 
DCI010076H08DCI01_0076_H08.bDB796361 
DCI010077F02DCI01_0077_F02.bDB796418 
DCI010080B02DCI01_0080_B02.bDB796642 
DCI010081A04DCI01_0081_A04.bDB796719 
DCI010084E08DCI01_0084_E08.bDB797031 
DCI010085G12DCI01_0085_G12.bDB797146 
DCI010087H06DCI01_0087_H06.bDB797331 
DCI010088C04DCI01_0088_C04.bDB797362 
DCI010090H02DCI01_0090_H02.bDB797591 
DCI010091G11DCI01_0091_G11.bDB797679 
DCI010096H07DCI01_0096_H07.bDB798129 
DCI010098F10DCI01_0098_F10.bDB798287 
DCI010100H02DCI01_0100_H02.bDB798487 
DCI010101H12DCI01_0101_H12.bDB798587 
DCI010106E06DCI01_0106_E06.bDB798984 
DCI010107A02DCI01_0107_A02.bDB799021 
DCI010116B06DCI01_0116_B06.bDB799828 
DCI010116G09DCI01_0116_G09.bDB799886 
HTMT10054H02HTMT1_0054_H02.bFS668065 
HTMT10081G02HTMT1_0081_G02.bFS669940 
HTMT10097C04HTMT1_0097_C04.bFS671056 
HTMT10109A08HTMT1_0109_A08.bHX223828 
ILNT10020H01ILNT1_0020_H01.bHX228283 
ITT010005G02ITT01_0005_G02.bBW976472 
ITT010017F03ITT01_0017_F03.bBW977550 
KDN010065A10KDN01_0065_A10.bFS675591 
LVRM10005H04LVRM1_0005_H04.bBP140868 AK232687
LVRM10071H04LVRM1_0071_H04.bBP454018 
LVRM10123E11LVRM1_0123_E11.bBP452080 
OVR010035F10OVR01_0035_F10.bBP143846 AK234272
OVR010061C11OVR01_0061_C11.bBW965050 
OVRM10064D09OVRM1_0064_D09.bBP149524 
OVRM10082G05OVRM1_0082_G05.bBP152835 
OVRM10118D10OVRM1_0118_D10.bBP149685 
OVRM10126F06OVRM1_0126_F06.bBP151745 
OVRM10164B04OVRM1_0164_B04.bBP455825 
OVRM10182D11OVRM1_0182_D11.bBP458330 
OVRT10132D11OVRT1_0132_D11.bHX237382 
OVRT10133B07OVRT1_0133_B07.bHX237437 
PBL010023A06PBL01_0023_A06.bBP155105 
PST010029C06PST01_0029_C06.bFS699242 
PST010040F03PST01_0040_F03.bFS699986 
PST010051G10PST01_0051_G10.bFS700893 
PTG010014F05PTG01_0014_F05.bFS705659 
SMG010007D11SMG01_0007_D11.bFS714036 
SPL010093F12SPL01_0093_F12.bCJ021411 
SPLT10063F09SPLT1_0063_F09.bHX244108 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
244C2600.317W-
T4790.683
309C7360.963MSCTG/L
T030.037TTG/L
425C2200.275WSGCC/A
T4990.725GCT/A


Alignment:      TOP

20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ADR01_0035_G03.b : nnggtgaaacxxxxxxxxxxx
HTMT1_0097_C04.b :
BMWN1_0026_B06.b :
ILNT1_0020_H01.b :
ITT01_0005_G02.b :
DCI01_0096_H07.b : nnnnaacataccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_A08.b :
DCI01_0061_H01.b : nnttaagatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0056_G05.b :
DCI01_0028_F05.b : nnnaacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0081_G02.b :
AMP01_0005_E10.b : atttaccgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G11.b : nnnnnnggatacatxxxxxxxxxxxxxxxxx
DCI01_0075_H12.b : naattactaacttxxxxxxxxxxxxxxx
DCI01_0036_F10.b : gtatctaaxxxxxxxxxxx
DCI01_0013_F04.b : nnccgtaacttngggctxxxxxx
OVR01_0035_F10.b :
DCI01_0037_E04.b : nnggtatcttxxxxxxxxxxxx
DCI01_0106_E06.b : aaaaaaggatactatagggctgctc
AMP01_0087_F08.b : nnggcgtatcttxxxxxxxxxx
DCI01_0088_C04.b : aaaanttctacctaaxxxxxxxxxx
DCI01_0046_F04.b : nnnnnncctaaccatxxxxxxxxxxxxxx
DCI01_0080_B02.b : nggcaaannnnnccgaaccatxxxxxxxxxxxx
DCI01_0081_A04.b : nnccgtatannnnaaagatatcaaxxxxxxxxxx
DCI01_0116_G09.b : nnnnaacgatnnnnnaacgatacttaxxxxxxxxxxx
HTMT1_0054_H02.b :
DCI01_0107_A02.b : nnnaaattcannnaaaactaatctatgggctxxx
DCI01_0116_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0043_H10.b : gtatcttxxxxxxxxxxx
DCI01_0076_F11.b : nnnaacgtaacttgggggctxxx
DCI01_0063_F06.b : nnnnaaagatacatxxxxxxxxxxx
DCI01_0076_H08.b : nnaatcgatactatagggctxxx
DCI01_0087_H06.b : nnnnnncctacaatxxxxxxxxx
DCI01_0077_F02.b : nnnnaacgatacatxxxxxxxxxx
DCI01_0064_A06.b : aaaaaaacgatacatxxxxxxxxx
AMP01_0063_E07.b : nnggagatannataagggatatcttxxxxxxxxxxx
AMP01_0036_G11.b : nnngggaaatttatagcgatatcttxxxxxxxxxx
AMP01_0026_B09.b : nntttagtattttxxxxxxxxx
DCI01_0090_H02.b : nnnnaaagatacttxxxxxxxxx
DCI01_0084_E08.b : nnnnnccgtaacatgggggctxxxx
DCI01_0074_A01.b : nnnnccctaacttxxxxxxxxx
DCI01_0085_G12.b : nnnncctagaatccataxxxxxxxxxx
DCI01_0098_F10.b : nnnaacgatactatagggctxxxx
DCI01_0068_A02.b : nnnnaacgatacttgggggctgct
SPL01_0093_F12.b :
ADR01_0032_C05.b :
AMP01_0042_D05.b : nnggcgatattntaagggatatcttxxxxxxxxx
AMP01_0036_D12.b : nnggcgatanantaagggatatcttxxxx
DCI01_0100_H02.b : nnnnaaacatacttxxxx
OVRM1_0064_D09.b :
KDN01_0065_A10.b :
BFLT1_0127_G11.b :
PTG01_0014_F05.b :
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b :
PST01_0040_F03.b :
CLNT1_0117_B10.b :
BMWN1_0023_H11.b :
OVRM1_0082_G05.b :
OVRT1_0132_D11.b :
OVRT1_0133_B07.b :
CBLT1_0050_B01.b :
SPLT1_0063_F09.b :
ITT01_0017_F03.b :
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b :
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b :
ADR01_0044_G08.b :
ADR01_0045_D09.b :
BFLT1_0051_F03.b :
OVR01_0061_C11.b :
PST01_0051_G10.b :
DCI01_0072_H07.b :
DCI01_0101_H12.b :
PST01_0029_C06.b :
20110601C-000015 : ..................................GCACCGGAAGCGCAGGGGGATGGGGC
---------+---------+---------+---------+---------+---------+ 26
ADR01_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCGGAAGCGCAGGGGGATGGGGC
HTMT1_0097_C04.b : ttttggatggtaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0026_B06.b : nnnggcagtgagaggccg
ILNT1_0020_H01.b : ctttcgaaggagaggccgtagtatta
ITT01_0005_G02.b : nnggagtaacaxxxx
DCI01_0096_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_A08.b : nnntgggatggtaaga
DCI01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0056_G05.b : ggatccgtttgcgnac
DCI01_0028_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0081_G02.b : tttttagacga
AMP01_0005_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_F10.b : ttttttttttttttttttcttcagctaggx
DCI01_0037_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_E06.b : gcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0046_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0054_H02.b :
DCI01_0107_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_B06.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0063_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_A02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0093_F12.b : ntt
ADR01_0032_C05.b :
AMP01_0042_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_D09.b :
KDN01_0065_A10.b :
BFLT1_0127_G11.b :
PTG01_0014_F05.b :
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b :
PST01_0040_F03.b :
CLNT1_0117_B10.b :
BMWN1_0023_H11.b :
OVRM1_0082_G05.b :
OVRT1_0132_D11.b :
OVRT1_0133_B07.b :
CBLT1_0050_B01.b :
SPLT1_0063_F09.b :
ITT01_0017_F03.b :
AMP01_0056_F02.b : nngtgataaatatagggatatcttagggctgctcccgcxxxxxxxxxxxxxx
AMP01_0086_B10.b : nggtatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b :
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b :
ADR01_0044_G08.b :
ADR01_0045_D09.b :
BFLT1_0051_F03.b :
OVR01_0061_C11.b :
PST01_0051_G10.b :
DCI01_0072_H07.b : nnnnnttgatacttgggggctxxxxxxxxxxxxxxxxx
DCI01_0101_H12.b : ntaaaacgtaatcttxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0029_C06.b :
20110601C-000015 : GGCGGTGACGCGATTCTGTCCGCATTGGAGGGGCCGGGCCGCTGCCGAAGTCGCCGCGGC
---------+---------+---------+---------+---------+---------+ 86
ADR01_0035_G03.b : GGCGGTGACGCGATTCTGTCCGCATTGGAGGGGCCGGGCCGCTGCCGAAGTCGCCGCGGC
HTMT1_0097_C04.b : xxxxxxxxxxgGATTCTGTCCGCGTTGGAGGGGCCGGGCCGCTGCCGAAGTCGCCGCGGC
BMWN1_0026_B06.b : tagtatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCTGCCGCCCCTGTCGGGGC
ILNT1_0020_H01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccGCTGCCGAAGTCGCCGCGGC
ITT01_0005_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGCCGAAGTCGCCGCGGC
DCI01_0096_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCCGAAGTCGCCGCGGC
HTMT1_0109_A08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAAGTCGCCGCGGC
DCI01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGTCGCCGCGGC
CLNT1_0056_G05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGGC
DCI01_0028_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGC
HTMT1_0081_G02.b : gaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGC
AMP01_0005_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0046_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0054_H02.b : tttttggacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0063_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0093_F12.b : tgcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0032_C05.b : nnnnnnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0042_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_D09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0065_A10.b : tt
BFLT1_0127_G11.b : nnnnccgtacgcgnaggagtgxxxxxxxxxxxxxxxxxxxx
PTG01_0014_F05.b : nnnttccttttatttaggagtaagcagcxxxxxxxxx
LVRM1_0123_E11.b : nagttgtcxxxxxxxxxxxxxxxxx
OVRM1_0126_F06.b : nagtttgtcxxxxxxxxxxxxxxxx
SMG01_0007_D11.b : nggccttaannnnngggctaacagcxxxxx
PST01_0040_F03.b :
CLNT1_0117_B10.b : tttttcctatagctgacgxxxxxxxxxx
BMWN1_0023_H11.b : tttta
OVRM1_0082_G05.b : cgtt
OVRT1_0132_D11.b : nnnttactttcnnnnnnnccgttcgcgc
OVRT1_0133_B07.b : nnnaaacttcnnnnnnnnccgttcgcgn
CBLT1_0050_B01.b : nnnnn
SPLT1_0063_F09.b : nnn
ITT01_0017_F03.b :
AMP01_0056_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_H04.b : cxxxxxxx
OVRM1_0164_B04.b : cagtt
PBL01_0023_A06.b :
LVRM1_0071_H04.b : nagt
OVRM1_0182_D11.b : ccgt
OVRM1_0118_D10.b : nagt
ADR01_0008_D07.b :
ADR01_0044_G08.b :
ADR01_0045_D09.b :
BFLT1_0051_F03.b : nnnaacgtcagcgna
OVR01_0061_C11.b : ntttggcttggactatgacxx
PST01_0051_G10.b :
DCI01_0072_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0029_C06.b :
20110601C-000015 : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
---------+---------+---------+---------+---------+---------+ 146
ADR01_0035_G03.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
HTMT1_0097_C04.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
BMWN1_0026_B06.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTCCCGTCAGAGCCGGAGCTGCCCCGCCAGTC
ILNT1_0020_H01.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
ITT01_0005_G02.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0096_H07.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
HTMT1_0109_A08.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0061_H01.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
CLNT1_0056_G05.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0028_F05.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
HTMT1_0081_G02.b : TGCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0005_E10.b : xxCCGCGTGACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0091_G11.b : xxxxxxxxxACGTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0075_H12.b : xxxxxxxxxxxxTGGCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0036_F10.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0013_F04.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
OVR01_0035_F10.b : xxxxxxxxxxxxxcaCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0037_E04.b : xxxxxxxxxxxxxxaCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0106_E06.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0087_F08.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0088_C04.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0046_F04.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0080_B02.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0081_A04.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0116_G09.b : xxxxxxxxxxxxxxxCACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
HTMT1_0054_H02.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0107_A02.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0116_B06.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0043_H10.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0076_F11.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0063_F06.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0076_H08.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0087_H06.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0077_F02.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0064_A06.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0063_E07.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0036_G11.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0026_B09.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0090_H02.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0084_E08.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0074_A01.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0085_G12.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0098_F10.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0068_A02.b : xxxxxxxxxxxxxxxxACAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
SPL01_0093_F12.b : xxxxxxxxxxxxxxxxxCAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
ADR01_0032_C05.b : xxxxxxxxxxxxxxxxxCAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0042_D05.b : xxxxxxxxxxxxxxxxtCAGGCGAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
AMP01_0036_D12.b : xxxxxxxxxxxxxxxxxxxxxxxAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
DCI01_0100_H02.b : xxxxxxxxxxxxxxxxxxxxxxxAAGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
OVRM1_0064_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxGATTTAACGCCAGAGCCGGAGCTGCCCCGCCAGTC
KDN01_0065_A10.b : ttttactgcgttggctcggacggcgagaTTTACGCCAGAGCCGGAGCTGCCCCGCCAGTC
BFLT1_0127_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACGCCAGAGCCGGAGCTGCCCCGCCAGTC
PTG01_0014_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCCAGAGCCGGAGCTGCCCCGCCAGTC
LVRM1_0123_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCGGAGCTGCCCCGCCAGTC
OVRM1_0126_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCGGAGCTGCCCCGCCAGTC
SMG01_0007_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCGGAGCTGCCCCGCCAGTC
PST01_0040_F03.b : nccctgctgtggctctggacgccGAGCCGGAGCTGCC*CGCCAGTC
CLNT1_0117_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGAGCTGCCCCGCCAGTC
BMWN1_0023_H11.b : ggcaggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTC
OVRM1_0082_G05.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC
OVRT1_0132_D11.b : acgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC
OVRT1_0133_B07.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC
CBLT1_0050_B01.b : ggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTC
SPLT1_0063_F09.b : ccgcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTC
ITT01_0017_F03.b : nnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGTC
AMP01_0056_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTC
AMP01_0086_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTC
LVRM1_0005_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
OVRM1_0164_B04.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
PBL01_0023_A06.b : nnggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
LVRM1_0071_H04.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
OVRM1_0182_D11.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
OVRM1_0118_D10.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
ADR01_0008_D07.b : nnnttatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
ADR01_0044_G08.b : nttgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
ADR01_0045_D09.b : nggggaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
BFLT1_0051_F03.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC
OVR01_0061_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
PST01_0051_G10.b : nttcctgctgtggctctggagC
DCI01_0072_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0029_C06.b : tttttttcctacggtggctatggat
20110601C-000015 : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
---------+---------+---------+---------+---------+---------+ 206
ADR01_0035_G03.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
HTMT1_0097_C04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
BMWN1_0026_B06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ILNT1_0020_H01.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ITT01_0005_G02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0096_H07.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
HTMT1_0109_A08.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0061_H01.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
CLNT1_0056_G05.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0028_F05.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
HTMT1_0081_G02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0005_E10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0091_G11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0075_H12.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0036_F10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0013_F04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCATCCGACACGCCGGCTA
OVR01_0035_F10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0037_E04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0106_E06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0087_F08.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0088_C04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTC
DCI01_0046_F04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0080_B02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0081_A04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0116_G09.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
HTMT1_0054_H02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0107_A02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0116_B06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0043_H10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0076_F11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0063_F06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0076_H08.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0087_H06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0077_F02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0064_A06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0063_E07.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0036_G11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0026_B09.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0090_H02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0084_E08.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0074_A01.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0085_G12.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0098_F10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0068_A02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
SPL01_0093_F12.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ADR01_0032_C05.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0042_D05.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0036_D12.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0100_H02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0064_D09.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
KDN01_0065_A10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
BFLT1_0127_G11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
PTG01_0014_F05.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
LVRM1_0123_E11.b : GTCGAGCAGGTCCTTGCCCCGCTAACTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0126_F06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
SMG01_0007_D11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
PST01_0040_F03.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
CLNT1_0117_B10.b : GTCGAGCAGGTCCTTGCCCCGCTAACTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
BMWN1_0023_H11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0082_G05.b : GTCGAGCAGGTCCTTGCCGCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRT1_0132_D11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRT1_0133_B07.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
CBLT1_0050_B01.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
SPLT1_0063_F09.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ITT01_0017_F03.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0056_F02.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
AMP01_0086_B10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
LVRM1_0005_H04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0164_B04.b : GTCGAGCAGGTCCTTGCCGCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
PBL01_0023_A06.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
LVRM1_0071_H04.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0182_D11.b : GTCGAGCAGGTCCTTGCCGCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVRM1_0118_D10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ADR01_0008_D07.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ADR01_0044_G08.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
ADR01_0045_D09.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
BFLT1_0051_F03.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
OVR01_0061_C11.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
PST01_0051_G10.b : GTCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0072_H07.b : xxCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
DCI01_0101_H12.b : xxCGAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCGACACGCCGGCTA
PST01_0029_C06.b : cgtcAGCAGGTCCTTGCCCCGCTAATTTCTGTCCCGGGGCTTCGTCCC*CTTGCCGGCTA
20110601C-000015 : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
---------+---------+---------+---------+---------+---------+ 266
ADR01_0035_G03.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
HTMT1_0097_C04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
BMWN1_0026_B06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ILNT1_0020_H01.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ITT01_0005_G02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0096_H07.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
HTMT1_0109_A08.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0061_H01.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
CLNT1_0056_G05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0028_F05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
HTMT1_0081_G02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
AMP01_0005_E10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCG
DCI01_0091_G11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0075_H12.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGTCA
DCI01_0036_F10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0013_F04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
OVR01_0035_F10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0037_E04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0106_E06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
AMP01_0087_F08.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTCAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0088_C04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0046_F04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0080_B02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0081_A04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0116_G09.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
HTMT1_0054_H02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0107_A02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCCCTGACTTTGCCA
DCI01_0116_B06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0043_H10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0076_F11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0063_F06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0076_H08.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0087_H06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0077_F02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0064_A06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
AMP01_0063_E07.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
AMP01_0036_G11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
AMP01_0026_B09.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0090_H02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0084_E08.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0074_A01.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0085_G12.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCCCTGACTTTGCCA
DCI01_0098_F10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
DCI01_0068_A02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
SPL01_0093_F12.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ADR01_0032_C05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
AMP01_0042_D05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
AMP01_0036_D12.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0100_H02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
OVRM1_0064_D09.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
KDN01_0065_A10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
BFLT1_0127_G11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
PTG01_0014_F05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
LVRM1_0123_E11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRM1_0126_F06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
SMG01_0007_D11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
PST01_0040_F03.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
CLNT1_0117_B10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
BMWN1_0023_H11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRM1_0082_G05.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRT1_0132_D11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRT1_0133_B07.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
CBLT1_0050_B01.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
SPLT1_0063_F09.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ITT01_0017_F03.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
AMP01_0056_F02.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTCCTTCGCCCTCTGACTTTGCCA
AMP01_0086_B10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
LVRM1_0005_H04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRM1_0164_B04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
PBL01_0023_A06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
LVRM1_0071_H04.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRM1_0182_D11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVRM1_0118_D10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ADR01_0008_D07.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ADR01_0044_G08.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
ADR01_0045_D09.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
BFLT1_0051_F03.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
OVR01_0061_C11.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCCTCTTCGCCCTCTGACTTTGCCA
PST01_0051_G10.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0072_H07.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
DCI01_0101_H12.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
PST01_0029_C06.b : GCGAGCTGTCCCTGCCGCGCTCTTTCTGCCTTAGCTCTTCTTCGCCCTCTGACTTTGCCA
20110601C-000015 : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
---------+---------+---------+---------+---------+---------+ 326
ADR01_0035_G03.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
HTMT1_0097_C04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
BMWN1_0026_B06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ILNT1_0020_H01.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ITT01_0005_G02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0096_H07.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
HTMT1_0109_A08.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0061_H01.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
CLNT1_0056_G05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0028_F05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
HTMT1_0081_G02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0005_E10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0091_G11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0075_H12.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0036_F10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0013_F04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVR01_0035_F10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0037_E04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0106_E06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0087_F08.b : GGAGCGTGAAAGGAGAAGGCTCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0088_C04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0046_F04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0080_B02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0081_A04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0116_G09.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
HTMT1_0054_H02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0107_A02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0116_B06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0043_H10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0076_F11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0063_F06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0076_H08.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0087_H06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0077_F02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0064_A06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCGAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0063_E07.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0036_G11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0026_B09.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0090_H02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0084_E08.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0074_A01.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0085_G12.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0098_F10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0068_A02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
SPL01_0093_F12.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ADR01_0032_C05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0042_D05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0036_D12.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0100_H02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVRM1_0064_D09.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
KDN01_0065_A10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
BFLT1_0127_G11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
PTG01_0014_F05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
LVRM1_0123_E11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVRM1_0126_F06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
SMG01_0007_D11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
PST01_0040_F03.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
CLNT1_0117_B10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
BMWN1_0023_H11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVRM1_0082_G05.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTTTGCTCCTGCCCATTGCA
OVRT1_0132_D11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVRT1_0133_B07.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
CBLT1_0050_B01.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
SPLT1_0063_F09.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ITT01_0017_F03.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0056_F02.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
AMP01_0086_B10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
LVRM1_0005_H04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVRM1_0164_B04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTTTGCTCCTGCCCATTGCA
PBL01_0023_A06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
LVRM1_0071_H04.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCTAGCCCCTTCTGCTCCTGCCCATTGCA
OVRM1_0182_D11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTTTGCTCCTGCCCATTGCA
OVRM1_0118_D10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ADR01_0008_D07.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ADR01_0044_G08.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
ADR01_0045_D09.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
BFLT1_0051_F03.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
OVR01_0061_C11.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
PST01_0051_G10.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0072_H07.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
DCI01_0101_H12.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
PST01_0029_C06.b : GGAGCGTGAAAGGAGAAGGCCCGGGGACGCCCCAAGCCCCTTCTGCTCCTGCCCATTGCA
20110601C-000015 : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
---------+---------+---------+---------+---------+---------+ 386
ADR01_0035_G03.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
HTMT1_0097_C04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
BMWN1_0026_B06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ILNT1_0020_H01.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ITT01_0005_G02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0096_H07.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGAAAG
HTMT1_0109_A08.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0061_H01.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
CLNT1_0056_G05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0028_F05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
HTMT1_0081_G02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0005_E10.b : AGTGCCATTACCGCCACGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0091_G11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0075_H12.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0036_F10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0013_F04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGACAAG
OVR01_0035_F10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0037_E04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0106_E06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0087_F08.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0088_C04.b : AGTGCCATTACCGCCGTGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0046_F04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0080_B02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0081_A04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0116_G09.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
HTMT1_0054_H02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0107_A02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCCCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0116_B06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0043_H10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0076_F11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0063_F06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0076_H08.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0087_H06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0077_F02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0064_A06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0063_E07.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0036_G11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0026_B09.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0090_H02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0084_E08.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0074_A01.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0085_G12.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCCCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0098_F10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0068_A02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
SPL01_0093_F12.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ADR01_0032_C05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0042_D05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0036_D12.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCCTCTCCCGCCTCTTCGGCAAG
DCI01_0100_H02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0064_D09.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
KDN01_0065_A10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
BFLT1_0127_G11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
PTG01_0014_F05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
LVRM1_0123_E11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0126_F06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
SMG01_0007_D11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
PST01_0040_F03.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
CLNT1_0117_B10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
BMWN1_0023_H11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0082_G05.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRT1_0132_D11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRT1_0133_B07.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
CBLT1_0050_B01.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
SPLT1_0063_F09.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ITT01_0017_F03.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0056_F02.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
AMP01_0086_B10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
LVRM1_0005_H04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0164_B04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
PBL01_0023_A06.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
LVRM1_0071_H04.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0182_D11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVRM1_0118_D10.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ADR01_0008_D07.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ADR01_0044_G08.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
ADR01_0045_D09.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
BFLT1_0051_F03.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
OVR01_0061_C11.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
PST01_0051_G10.b : AGTACCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0072_H07.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
DCI01_0101_H12.b : AGTGCCATTACCGCCATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
PST01_0029_C06.b : AGTGCCATTACCGCCATGGGCCTCGGCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAG
20110601C-000015 : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
---------+---------+---------+---------+---------+---------+ 446
ADR01_0035_G03.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
HTMT1_0097_C04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
BMWN1_0026_B06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ILNT1_0020_H01.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ITT01_0005_G02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0096_H07.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
HTMT1_0109_A08.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0061_H01.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
CLNT1_0056_G05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0028_F05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
HTMT1_0081_G02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
AMP01_0005_E10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0091_G11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0075_H12.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0036_F10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0013_F04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
OVR01_0035_F10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0037_E04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0106_E06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
AMP01_0087_F08.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0088_C04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0046_F04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0080_B02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0081_A04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0116_G09.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
HTMT1_0054_H02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0107_A02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0116_B06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0043_H10.b : AAGCAGATGCGCATTTTGATGGTTGGATCGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0076_F11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0063_F06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0076_H08.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0087_H06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0077_F02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0064_A06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
AMP01_0063_E07.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0036_G11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0026_B09.b : AAGCAGACGCGCATTTTGATGGTTGGATTGGATGCTGTTGGCAAGACGACCATTCTGTAT
DCI01_0090_H02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0084_E08.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0074_A01.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0085_G12.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0098_F10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
DCI01_0068_A02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
SPL01_0093_F12.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ADR01_0032_C05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0042_D05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0036_D12.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0100_H02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCCGGCAAGACGACCATTCTGTAT
OVRM1_0064_D09.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
KDN01_0065_A10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
BFLT1_0127_G11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
PTG01_0014_F05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
LVRM1_0123_E11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRM1_0126_F06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
SMG01_0007_D11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
PST01_0040_F03.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
CLNT1_0117_B10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
BMWN1_0023_H11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRM1_0082_G05.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRT1_0132_D11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRT1_0133_B07.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
CBLT1_0050_B01.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
SPLT1_0063_F09.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ITT01_0017_F03.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0056_F02.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
AMP01_0086_B10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
LVRM1_0005_H04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRM1_0164_B04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
PBL01_0023_A06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
LVRM1_0071_H04.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRM1_0182_D11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVRM1_0118_D10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ADR01_0008_D07.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ADR01_0044_G08.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
ADR01_0045_D09.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
BFLT1_0051_F03.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
OVR01_0061_C11.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
PST01_0051_G10.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0072_H07.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
DCI01_0101_H12.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
PST01_0029_C06.b : AAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACGACCATTCTGTAT
20110601C-000015 : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
---------+---------+---------+---------+---------+---------+ 506
ADR01_0035_G03.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
HTMT1_0097_C04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
BMWN1_0026_B06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ILNT1_0020_H01.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ITT01_0005_G02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0096_H07.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
HTMT1_0109_A08.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0061_H01.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
CLNT1_0056_G05.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0028_F05.b : AAACCGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
HTMT1_0081_G02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0005_E10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACG
DCI01_0091_G11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0075_H12.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0036_F10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0013_F04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVR01_0035_F10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0037_E04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0106_E06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0087_F08.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0088_C04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0046_F04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0080_B02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0081_A04.b : AAACTGAAGTTAGGGGTGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0116_G09.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
HTMT1_0054_H02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0107_A02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0116_B06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0043_H10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0076_F11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0063_F06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0076_H08.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0087_H06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0077_F02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0064_A06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0063_E07.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0036_G11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0026_B09.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0090_H02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0084_E08.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0074_A01.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0085_G12.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0098_F10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0068_A02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
SPL01_0093_F12.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ADR01_0032_C05.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0042_D05.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0036_D12.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0100_H02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0064_D09.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
KDN01_0065_A10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
BFLT1_0127_G11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
PTG01_0014_F05.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
LVRM1_0123_E11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0126_F06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
SMG01_0007_D11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
PST01_0040_F03.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
CLNT1_0117_B10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
BMWN1_0023_H11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0082_G05.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRT1_0132_D11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRT1_0133_B07.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
CBLT1_0050_B01.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
SPLT1_0063_F09.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ITT01_0017_F03.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0056_F02.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
AMP01_0086_B10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
LVRM1_0005_H04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0164_B04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
PBL01_0023_A06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
LVRM1_0071_H04.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0182_D11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVRM1_0118_D10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ADR01_0008_D07.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ADR01_0044_G08.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
ADR01_0045_D09.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
BFLT1_0051_F03.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
OVR01_0061_C11.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
PST01_0051_G10.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0072_H07.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
DCI01_0101_H12.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
PST01_0029_C06.b : AAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACA
20110601C-000015 : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
---------+---------+---------+---------+---------+---------+ 565
ADR01_0035_G03.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
HTMT1_0097_C04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
BMWN1_0026_B06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ILNT1_0020_H01.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ITT01_0005_G02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0096_H07.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
HTMT1_0109_A08.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0061_H01.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
CLNT1_0056_G05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0028_F05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAN
HTMT1_0081_G02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0005_E10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0091_G11.b : GTAGAATATAAGAACATTTGTTTCACAGTAGGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0075_H12.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0036_F10.b : GTAAAATATAAGAACATTTGTTTTCCAGTATGGGATGTTGGTGGGTCAAGATAAAATTAA
DCI01_0013_F04.b : GTAGAATATAAGAACATTTGCTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVR01_0035_F10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0037_E04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0106_E06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0087_F08.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0088_C04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0046_F04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0080_B02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0081_A04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0116_G09.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
HTMT1_0054_H02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0107_A02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0116_B06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0043_H10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0076_F11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0063_F06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0076_H08.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0087_H06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0077_F02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTCGGTGG*TCAAGATAAAATTAG
DCI01_0064_A06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0063_E07.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0036_G11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0026_B09.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0090_H02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0084_E08.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0074_A01.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATGAAATTAG
DCI01_0085_G12.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0098_F10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0068_A02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
SPL01_0093_F12.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ADR01_0032_C05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0042_D05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0036_D12.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0100_H02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0064_D09.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
KDN01_0065_A10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
BFLT1_0127_G11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
PTG01_0014_F05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
LVRM1_0123_E11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0126_F06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
SMG01_0007_D11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
PST01_0040_F03.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
CLNT1_0117_B10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
BMWN1_0023_H11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0082_G05.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRT1_0132_D11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRT1_0133_B07.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
CBLT1_0050_B01.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
SPLT1_0063_F09.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ITT01_0017_F03.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0056_F02.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
AMP01_0086_B10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
LVRM1_0005_H04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0164_B04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
PBL01_0023_A06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
LVRM1_0071_H04.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0182_D11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVRM1_0118_D10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ADR01_0008_D07.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ADR01_0044_G08.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
ADR01_0045_D09.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
BFLT1_0051_F03.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
OVR01_0061_C11.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
PST01_0051_G10.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0072_H07.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
DCI01_0101_H12.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
PST01_0029_C06.b : GTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGG*TCAAGATAAAATTAG
20110601C-000015 : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
---------+---------+---------+---------+---------+---------+ 624
ADR01_0035_G03.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
HTMT1_0097_C04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
BMWN1_0026_B06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ILNT1_0020_H01.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ITT01_0005_G02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0096_H07.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
HTMT1_0109_A08.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0061_H01.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
CLNT1_0056_G05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0028_F05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCCAGGTCTTAT*TTTTGTGGTAGATAGNC
HTMT1_0081_G02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0005_E10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTACATAGCA
DCI01_0091_G11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTGGATAGCA
DCI01_0075_H12.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0036_F10.b : GGCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTTCTATTTTTTGGGGTAGATAACA
DCI01_0013_F04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVR01_0035_F10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0037_E04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0106_E06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0087_F08.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0088_C04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0046_F04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0080_B02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0081_A04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0116_G09.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
HTMT1_0054_H02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0107_A02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGTTAGCA
DCI01_0116_B06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0043_H10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0076_F11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0063_F06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0076_H08.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0087_H06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0077_F02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCCTAT*TTTTGTGGTAGATAGCA
DCI01_0064_A06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0063_E07.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0036_G11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0026_B09.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0090_H02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0084_E08.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0074_A01.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0085_G12.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGTTAGCA
DCI01_0098_F10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0068_A02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
SPL01_0093_F12.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ADR01_0032_C05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0042_D05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0036_D12.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0100_H02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRM1_0064_D09.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
KDN01_0065_A10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
BFLT1_0127_G11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
PTG01_0014_F05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGNC
LVRM1_0123_E11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRM1_0126_F06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
SMG01_0007_D11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
PST01_0040_F03.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
CLNT1_0117_B10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
BMWN1_0023_H11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRM1_0082_G05.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRT1_0132_D11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRT1_0133_B07.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
CBLT1_0050_B01.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
SPLT1_0063_F09.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ITT01_0017_F03.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0056_F02.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
AMP01_0086_B10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
LVRM1_0005_H04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGGCTTAT*ATTTGTGGTAGATAGCA
OVRM1_0164_B04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
PBL01_0023_A06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
LVRM1_0071_H04.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRM1_0182_D11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVRM1_0118_D10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ADR01_0008_D07.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
ADR01_0044_G08.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGCGGTAGATAGCA
ADR01_0045_D09.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
BFLT1_0051_F03.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
OVR01_0061_C11.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
PST01_0051_G10.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0072_H07.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
DCI01_0101_H12.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAT*TTTTGTGGTAGATAGCA
PST01_0029_C06.b : GCCTCTCTGGAGGCATTACTTCCAAAATACCCAGGGTCTTAC*TTTTGTGGTAGATAGCA
20110601C-000015 : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
---------+---------+---------+---------+---------+---------+ 684
ADR01_0035_G03.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
HTMT1_0097_C04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
BMWN1_0026_B06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ILNT1_0020_H01.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ITT01_0005_G02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0096_H07.b : *TGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
HTMT1_0109_A08.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0061_H01.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
CLNT1_0056_G05.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0028_F05.b : ATGATCGTGAAAGATTCCAGNANGGAGCAGATGAGCTGCAGAAGATGCTTCAAGAAGATG
HTMT1_0081_G02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0005_E10.b : TTGATCGTGAAAGAATCCAGGAATGAGCATATGATCTGCCAAAGATGCTTCACGAAGATG
DCI01_0091_G11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0075_H12.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0036_F10.b : ATGATCGTGAAAGAATCCCGGAAaggaacgaatgacctgccaaaaatgctttcctggaaa
DCI01_0013_F04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
OVR01_0035_F10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0037_E04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCNAGGAGATG
DCI01_0106_E06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
AMP01_0087_F08.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0088_C04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0046_F04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
DCI01_0080_B02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0081_A04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0116_G09.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
HTMT1_0054_H02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0107_A02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
DCI01_0116_B06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGGGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0043_H10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
DCI01_0076_F11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0063_F06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0076_H08.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0087_H06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0077_F02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0064_A06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0063_E07.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0036_G11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0026_B09.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0090_H02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0084_E08.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0074_A01.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0085_G12.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0098_F10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0068_A02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
SPL01_0093_F12.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ADR01_0032_C05.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0042_D05.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0036_D12.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0100_H02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRM1_0064_D09.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
KDN01_0065_A10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
BFLT1_0127_G11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
PTG01_0014_F05.b : ATGATCGTGAAAGAATCAAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
LVRM1_0123_E11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRM1_0126_F06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
SMG01_0007_D11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
PST01_0040_F03.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
CLNT1_0117_B10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
BMWN1_0023_H11.b : ATGATCGTGAAAAAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRM1_0082_G05.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRT1_0132_D11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRT1_0133_B07.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
CBLT1_0050_B01.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
SPLT1_0063_F09.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ITT01_0017_F03.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0056_F02.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
AMP01_0086_B10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
LVRM1_0005_H04.b : CTGATCGCGAAAGAATCCATGAAGGAGCAGATGAGCTGCAGAACATGCCCCAGGAAGACG
OVRM1_0164_B04.b : ATGATACTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
PBL01_0023_A06.b : ATGATCGTGAAAGAATCCAGGAAAGAGCAGATGAGCTGCAGAAGATGCTTCANGAAGATG
LVRM1_0071_H04.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCCAGAAGATG
OVRM1_0182_D11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVRM1_0118_D10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ADR01_0008_D07.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ADR01_0044_G08.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
ADR01_0045_D09.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
BFLT1_0051_F03.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
OVR01_0061_C11.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
PST01_0051_G10.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
DCI01_0072_H07.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGGGCTGCAGAAGATGCTTCANGAAGATG
DCI01_0101_H12.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGGGCTGCAGAAGATGCTTCANGAAGATG
PST01_0029_C06.b : ATGATCGTGAAAGAATCCAGGAAGGAGCAGATGAGCTGCAGAAGATGCTTCAGGAAGATG
20110601C-000015 : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
---------+---------+---------+---------+---------+---------+ 743
ADR01_0035_G03.b : AATTGCAAGATGCANTGTTGCTGCTTTTTTGCAAACAAAACAGATTTTGCAAATGCTATG
HTMT1_0097_C04.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
BMWN1_0026_B06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGGATTGCCAAATGCTATG
ILNT1_0020_H01.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
ITT01_0005_G02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0096_H07.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
HTMT1_0109_A08.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0061_H01.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
CLNT1_0056_G05.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0028_F05.b : AAGTGCCAGATGCAATGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCaaatgctattg
HTMT1_0081_G02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0005_E10.b : AGTTGCCATATCCATTGTTGCTGCTTTTT*GCAAAtacacctgatttcccaatgtctatg
DCI01_0091_G11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0075_H12.b : AGTTGCAAGATGCAGTGTTGCTGTTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0036_F10.b : agaattgccaaaaggccatggttgctgcttttttgcaacaaaccgggatttgccaaaggg
DCI01_0013_F04.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVR01_0035_F10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0037_E04.b : AGTTGCAAGATGCAGTGTTGCTGGCTTTTTGCAAACAAACAGGAATTTGCAAATGCTATG
DCI01_0106_E06.b : AGTTTGCAGATGCAGTGTTGCTGCTTTTT*GCAAAC*AACAGGATTTGCCCAATGCTATG
AMP01_0087_F08.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0088_C04.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0046_F04.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0080_B02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0081_A04.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0116_G09.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCNAATGCTATG
HTMT1_0054_H02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0107_A02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAA*CAGGATTTTGCCAATGCTATG
DCI01_0116_B06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0043_H10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0076_F11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0063_F06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0076_H08.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0087_H06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0077_F02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0064_A06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0063_E07.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0036_G11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0026_B09.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0090_H02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0084_E08.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0074_A01.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0085_G12.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0098_F10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0068_A02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
SPL01_0093_F12.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
ADR01_0032_C05.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0042_D05.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0036_D12.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0100_H02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVRM1_0064_D09.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
KDN01_0065_A10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
BFLT1_0127_G11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
PTG01_0014_F05.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAA*CAAGATTTTGCAAATGCTATG
LVRM1_0123_E11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCACACAAACAGGATTTGCCAAATGCTATG
OVRM1_0126_F06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
SMG01_0007_D11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
PST01_0040_F03.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
CLNT1_0117_B10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
BMWN1_0023_H11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*TGCAACAAACAGGATTTGCCA*ATGCTATG
OVRM1_0082_G05.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVRT1_0132_D11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVRT1_0133_B07.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
CBLT1_0050_B01.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
SPLT1_0063_F09.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
ITT01_0017_F03.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0056_F02.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
AMP01_0086_B10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
LVRM1_0005_H04.b : AGTTGCAAGATGCAGTGATGCTGCTTTTT*GCAAACAAACAGagacgcgcccgacgcgta
OVRM1_0164_B04.b : AGTTGCAAGATGCAGTGTTGCTGCTTNTT*GCA*ACAAACACGATTTGCCAAATGCTATG
PBL01_0023_A06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCA*ACAAACAGGATTTGCCAA*TGCTATG
LVRM1_0071_H04.b : AGTTGCAAGATGCAATGTTGCTGCTTTTG*TC*AACAAACAGGATTTGCC*AATGCTATG
OVRM1_0182_D11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVRM1_0118_D10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GNCAACAAACAGGATTTGCCAAATGCTATG
ADR01_0008_D07.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
ADR01_0044_G08.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
ADR01_0045_D09.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
BFLT1_0051_F03.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
OVR01_0061_C11.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
PST01_0051_G10.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0072_H07.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
DCI01_0101_H12.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTTGCCAATGCTATG
PST01_0029_C06.b : AGTTGCAAGATGCAGTGTTGCTGCTTTTT*GCAAACAAACAGGATTTGCCAAATGCTATG
20110601C-000015 : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
---------+---------+---------+---------+---------+---------+ 801
ADR01_0035_G03.b : G*CCATTATCGAATTGACAGATAAATTtaggttctcattcttcttcctacaaaaaaatgg
HTMT1_0097_C04.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
BMWN1_0026_B06.b : G*CCATTAACGAAATGACAGATAAATTATGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ILNT1_0020_H01.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ITT01_0005_G02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0096_H07.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
HTMT1_0109_A08.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0061_H01.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
CLNT1_0056_G05.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0028_F05.b : gccatancgaaatgacagaataataggtcttcaatctcttcttaccaaacatggtatggt
HTMT1_0081_G02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0005_E10.b : ccatttacgaatatgacactttatttaggtcttcatctccttttaaactaaaatggtatg
DCI01_0091_G11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0075_H12.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0036_F10.b : tttggcccttttccgaaatggccaataaatttagggcttccttccctttcctaacaaaaa
DCI01_0013_F04.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGT*ACAGAAC*ATGGT
OVR01_0035_F10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0037_E04.b : G*CCATTAGCCGAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0106_E06.b : G*CCATTAGCGAANTGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0087_F08.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0088_C04.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0046_F04.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0080_B02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0081_A04.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0116_G09.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
HTMT1_0054_H02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0107_A02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0116_B06.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0043_H10.b : GGCCATTACCGAAATGACAGATAAATTAGGTCCTCAGTCTCTTCGTAACCGAAC*ATGGT
DCI01_0076_F11.b : G*CCATTAGCGAAATGCCAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0063_F06.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0076_H08.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0087_H06.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0077_F02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0064_A06.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0063_E07.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0036_G11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0026_B09.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*AAGGT
DCI01_0090_H02.b : G*CCATTAGCGAAATGCCAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0084_E08.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0074_A01.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0085_G12.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0098_F10.b : G*CCATTAGCGAGATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0068_A02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
SPL01_0093_F12.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ADR01_0032_C05.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0042_D05.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0036_D12.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0100_H02.b : G*CCATTAGCNGAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVRM1_0064_D09.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
KDN01_0065_A10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
BFLT1_0127_G11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
PTG01_0014_F05.b : G*Cattaacggaatgacagataattaagtgctcagtctcttcgtaccgaacatggtatgt
LVRM1_0123_E11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVRM1_0126_F06.b : G*CCATTAGCGAAATGACAGATTAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
SMG01_0007_D11.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGNTACAGAAC*ATGGT
PST01_0040_F03.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
CLNT1_0117_B10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
BMWN1_0023_H11.b : C*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAnnnnnnn
OVRM1_0082_G05.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVRT1_0132_D11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVRT1_0133_B07.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
CBLT1_0050_B01.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
SPLT1_0063_F09.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ITT01_0017_F03.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0056_F02.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
AMP01_0086_B10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
LVRM1_0005_H04.b : tgaccctcgcgaaggccacaatacataggcgccaaccccctcctcgcataccacggtccg
OVRM1_0164_B04.b : G*CCATTTACGAAATGACAAATGAATTAGGTCTTCAGTCTCTTCGTA*CAGAAC*ATGGT
PBL01_0023_A06.b : G*CCA*TAGCGAAATGACAGATAAATTA*GTCTTCAGTCTCTTCGTA*CAGAAC*ATGGT
LVRM1_0071_H04.b : G*GCATTAGCGAAATGACAGATAAATTAAGTCTTTCGTCTCTTCGTAACAAAACCATGGG
OVRM1_0182_D11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVRM1_0118_D10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ADR01_0008_D07.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ADR01_0044_G08.b : G*CCATTANCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
ADR01_0045_D09.b : G*CCATTANCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
BFLT1_0051_F03.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
OVR01_0061_C11.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
PST01_0051_G10.b : G*CCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0072_H07.b : G*CCATTAGCGAAATGACAGATAAATTANGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
DCI01_0101_H12.b : G*GCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
PST01_0029_C06.b : G*CCATTAGCGAAATGACAGATGAATTAGGTCTTCAGTCTCTTCGTAACAGAAC*ATGGT
20110601C-000015 : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
---------+---------+---------+---------+---------+---------+ 858
ADR01_0035_G03.b : tatgtttcagccatttgtgttcccaaggaacttggtttgtattaaggacttgatgggctg
HTMT1_0097_C04.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
BMWN1_0026_B06.b : ATGTTCAAGCCCC*TTGTGCTACAAAAGGAACTGGGCTG*TATGAGGGACTTGAAGTGGC
ILNT1_0020_H01.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAAGGACTTGAC*TGGC
ITT01_0005_G02.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0096_H07.b : ATGTTCAAGCCAC*TTGTGCTACACAGGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
HTMT1_0109_A08.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0061_H01.b : ACGTTTCAGCCCA*CTGTGCTACACAGAGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
CLNT1_0056_G05.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0028_F05.b : caaccacttgggctacccaagaactggtctgatataaggaatgacgggctggcaatgacc
HTMT1_0081_G02.b : ATGTTNCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
AMP01_0005_E10.b : tcactgtctcatgtctatctaaagtaattgttttctactaggaacttatctggcttttat
DCI01_0091_G11.b : ATGTTTCAGCCAC*TTGTGCTACACANGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
DCI01_0075_H12.b : ATGTTCAAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
DCI01_0036_F10.b : tggggagtgttcaaccccctttgggctaccaaaggaaatgggttgttttaaaggaaattg
DCI01_0013_F04.b : ATGTTCAA*CCAC*CTGTGCTACACA*GGGACTGGTCTG*TAtgagggactgactggctg
OVR01_0035_F10.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0037_E04.b : ATGGTCAAGGCACTTTGTGCTACCCANGGAACTGGTCTG*TATGAGGGACTTGAC*TGCC
DCI01_0106_E06.b : ATGTTTCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
AMP01_0087_F08.b : ATGTTNCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0088_C04.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
DCI01_0046_F04.b : ATGTTCAAGCCAC*TTGTGCTACACACGGAACTGGTCTG*TATGAGGAACTTGAC*TGGC
DCI01_0080_B02.b : ATGTTTCAGCCAC*TTGTGCTACACANGGAACTGGTCTG*TATGANGGACTTGAC*TGGC
DCI01_0081_A04.b : ATGTTTCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0116_G09.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAAGGACTTGAC*TGGC
HTMT1_0054_H02.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0107_A02.b : ATGTTCAAGCCAC*TTGTGCTACCCAAG*AACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0116_B06.b : ATGTTTCAGCCAC*TTGTGCTACACANGGAACTGGTCTG*TATGAGGGACTTGAC*TGGG
DCI01_0043_H10.b : ATGTTCAAGCCAC*TTGTGCTACACAA*GAACTGGTCTG*TATGAGGGAACTGAC*TGGC
DCI01_0076_F11.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0063_F06.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0076_H08.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0087_H06.b : ATGTTNCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGANGGACTTGAC*TGGC
DCI01_0077_F02.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAAGGACTTGAC*TGGC
DCI01_0064_A06.b : ATGTTTCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0063_E07.b : ATGTTTCAGCCAC*TTGTGCTACACAGGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0036_G11.b : ATGTTCAAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0026_B09.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0090_H02.b : ATGTTNCAGCCAC*TTGTGCTACACANGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
DCI01_0084_E08.b : ATGTTCAAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0074_A01.b : ATGTTCAAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGTGGGACTTGAC*TGGC
DCI01_0085_G12.b : ATGTTTCAGCCAC*TTGTGCTACACAGGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0098_F10.b : ATGTTCAAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0068_A02.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
SPL01_0093_F12.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
ADR01_0032_C05.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0042_D05.b : ATGTTNCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0036_D12.b : ATNGTTCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0100_H02.b : ATGTTCAAGCCAC*TTGTGCTACACCAGGAACTGGTCTG*TATGAAGAACTTGAC*TGGC
OVRM1_0064_D09.b : ATGNTTCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
KDN01_0065_A10.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
BFLT1_0127_G11.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
PTG01_0014_F05.b : tcaaaccactgggctacacaaggacctggcgtgataaggaacttgactgcctgtcaaatg
LVRM1_0123_E11.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
OVRM1_0126_F06.b : ATGGTTCAGCCAC*TTGTGCTACACANGGA*CTGGTCTG*TAATGAGGACTTGAC*TGGC
SMG01_0007_D11.b : ATGTTTCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
PST01_0040_F03.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
CLNT1_0117_B10.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
BMWN1_0023_H11.b : nnnntnnaaccctttgctacacaagaatgttctgatgaggactgactgctgcaaatgact
OVRM1_0082_G05.b : ATGTTNCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
OVRT1_0132_D11.b : ATGTTTCAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGNACTTGAC*TGGC
OVRT1_0133_B07.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
CBLT1_0050_B01.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
SPLT1_0063_F09.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
ITT01_0017_F03.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
AMP01_0056_F02.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAAGGACTTGAC*TGGC
AMP01_0086_B10.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
LVRM1_0005_H04.b : cgtaccccacccctctcacccgagagatgacactgataaagcactcagtgagttcccaaa
OVRM1_0164_B04.b : ATGTTCAAGCCAC*TTGTGCTACAC
PBL01_0023_A06.b : AATGTTCAGCCA**TTGTGCTACACAAGGAACTGGTCTA*TATGGAGGACTTGAC*TGGC
LVRM1_0071_H04.b : ATGTTCAAGCCCC*CTGTGCTACACAAGGAACTGGTCTGGTATGAGGGACTTGAC*GGGC
OVRM1_0182_D11.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
OVRM1_0118_D10.b : ATGTTCAAGCCAC*TTGTGCTACACNAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
ADR01_0008_D07.b : ATGTTNCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
ADR01_0044_G08.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGNAGGACTTGAC*TGGC
ADR01_0045_D09.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
BFLT1_0051_F03.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
OVR01_0061_C11.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
PST01_0051_G10.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0072_H07.b : ATGTTTCAGCCAC*TTGTGCTACANCAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
DCI01_0101_H12.b : ATGTTCAGCCCAC**TGTGCTACACAAGGAACTGGTCTG*TATGAGGAACTTGAC*TGCC
PST01_0029_C06.b : ATGTTCAAGCCAC*TTGTGCTACACAAGGAACTGGTCTG*TATGAGGGACTTGAC*TGGC
20110601C-000015 : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
---------+---------+---------+---------+---------+---------+ 918
ADR01_0035_G03.b : tctaattgacttttcaaatgttaattgaaacgggatgtctaacctaggactgttttaaaa
HTMT1_0097_C04.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGGTTGA
BMWN1_0026_B06.b : TGTCAAATGAACTTTCAAACGTTTAAATGAAACGGGATGTCAAACCAAGGGACtggtttg
ILNT1_0020_H01.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACAGGATGTCTAACCAAGGACATGTTTGA
ITT01_0005_G02.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
DCI01_0096_H07.b : TNGTCAATGAGCTTTCAAAACGTTNAATGAAACTGGATGTCTACCNANNGACATGTT*GA
HTMT1_0109_A08.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTACAAAAGGACATGTTTGA
DCI01_0061_H01.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAAGACATGTTTGA
CLNT1_0056_G05.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCNAAGACATGTTTGA
DCI01_0028_F05.b : tttcaaacgttaatggaactgattgctaacaaggacagtttgaaaaattggtctagcctg
HTMT1_0081_G02.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
AMP01_0005_E10.b : ttgtactttaaatatatcaacatatatatgtatgtttacccatgacctggctctacaaca
DCI01_0091_G11.b : TGTCAAATGAGCTTTTCAAAACGTTAATGAAACTGGATGTCCNACCAAAGACATNGTTGA
DCI01_0075_H12.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTA*CCNAGGACATGTTTGA
DCI01_0036_F10.b : atgggggggccaaagaacctcttcaaaccttaaaaggaaacgggggggtctccccaggga
DCI01_0013_F04.b : tcaatgagcttttcaacgttaatgaaactggaagtctaccagggactgttgaaaaattgg
OVR01_0035_F10.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAAACccagggactgtttt
DCI01_0037_E04.b : TGTCAAATGAGCTTTCAAAACGTTAAATGGAACTGGATGTCTA*CCAAGGAACTGTTTGA
DCI01_0106_E06.b : TGTCAAATGAGCTTTTCAAACGT*AAATNGAACTGGATGTCNTACCANG*ACATGTTNGA
AMP01_0087_F08.b : TGTCAAATGAGCTTTCAAAACGTTAANTGAAACTGGATGTCNTACCNAGGACATGTTNGA
DCI01_0088_C04.b : TGTCNAATGAGCTTTNCAAACGTTAAATGAAACTGGATGTCTA*CCAAGGACATGTTTGA
DCI01_0046_F04.b : TGTCGAATGAGCTTTCAACGNTTNAA**TGAACTGGATGTCTAACCNAGGACATGTTTGA
DCI01_0080_B02.b : TGTNCAATGAGCTTTTCAAACGTTNAAATGAACTGGATGTCTACCNANGGGACATGTTGA
DCI01_0081_A04.b : TGTCNAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCNAAGGACATGTTGA
DCI01_0116_G09.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGGTTGA
HTMT1_0054_H02.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
DCI01_0107_A02.b : TGTCGAATGAGCTTTCAAAG*GTTAAATGAAACTGGATGTCTACCCA*GGACTTGTTTGA
DCI01_0116_B06.b : CTGTCAATGAGCTTTCAANNACGTAA*TGAAACTGGATGTCTA*CCNAGGACATGTTTGA
DCI01_0043_H10.b : TGGCCAATGACCTTTTCAAAAGGTTAATGGAACTGGATGTCTAACCAAGGACATGTTTGA
DCI01_0076_F11.b : TGTCAAATGAGCTTTCAAAACGTTAAAATGAACTGGATGTCNTACCNANGACATGTTTGA
DCI01_0063_F06.b : TGTNCAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCNTACCAAGGACATGTTTGA
DCI01_0076_H08.b : TGTCNAATGAGCTTTCNAAACGTTAAATGAAACTGGATGTCNTACCNNAGGACATGTTGA
DCI01_0087_H06.b : TGTCNAATGAGCTTTCAAAACGTTAAAATGAACTGGATGTCTACCNNANNGACATGTTGA
DCI01_0077_F02.b : TGTCAAATGAGCTTTTCAAACGTTAANTGAAACTGGATGTCTACCAAAGGACATGTTTGA
DCI01_0064_A06.b : TGTCAAATGAGCTTTTCAAAACGTAAATGAAACTGGATGTCNTACCA*GGACATGTTTGA
AMP01_0063_E07.b : TGTNCAATGAGCTTTCAAAGCGTTAAANTGAACTGGATGTCNTACCAAGGACATGTTTGA
AMP01_0036_G11.b : TGTCAAATGAGCTTTCAAAACGT*AAATGAAACTGGATGTCNTACCNAGGACATGTTTGA
AMP01_0026_B09.b : TGTCCAATGAGCTTTCAAAACGTTAAATGAAACTGGATGGTCTACCAAGGACATGGTTGA
DCI01_0090_H02.b : TGTCAAATGAGCTTTCAAAACGTTAAATGGAACTGGATGTCTAAC*AAGGACATGTTTGA
DCI01_0084_E08.b : TGTCAAATGAGCTTTCAAANCGTTAAATGAAACTGGATGTCTAACCAAGGGACATGTTGA
DCI01_0074_A01.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCNTACCANGGGACATGTTGA
DCI01_0085_G12.b : TGTCGAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAAACAA*GACATGTTTGA
DCI01_0098_F10.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCNTACCNAGGACATGTTTGA
DCI01_0068_A02.b : TNGTCAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAAACCAGGACATGTTTGA
SPL01_0093_F12.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
ADR01_0032_C05.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTA*CCAAGGACATGTTTGA
AMP01_0042_D05.b : TGTCAAATGAGCTTTTCAAAACGTAAAATGAACTGGATGTCTAACCNAGGACATGTTTGA
AMP01_0036_D12.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
DCI01_0100_H02.b : TGTCAAATGAGCTTTCCAAACGTTAAATGAAACTGAATGTCTAACCAAGGACATGTTTGA
OVRM1_0064_D09.b : TGTCAAATGAGCTTTCCAAACGTTAAATGA*ACTGGATGTCTn
KDN01_0065_A10.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
BFLT1_0127_G11.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAAACANGGACATGTTTGA
PTG01_0014_F05.b : gactttaaaaaactttaatgaaactggaagtcaaaaccaggaaatgtttgaaaaaattgg
LVRM1_0123_E11.b : TGTCTAATGAGCTTTCTAAACGTTA
OVRM1_0126_F06.b : TGTCAAATGAGCTTTCAAAACGTT*AATGAAACTGGATGTCTA*CCAAGGACATGTT
SMG01_0007_D11.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAGGGACATGTTTGA
PST01_0040_F03.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
CLNT1_0117_B10.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
BMWN1_0023_H11.b : tcnnnnnntttcaaaactttaaatggaactggatgtccaaccaaggacttgtggaaaaaa
OVRM1_0082_G05.b : TGTCA
OVRT1_0132_D11.b : TGTCAAATGAGCCTTCAAAACGTTAAATGAAACTGAATGTCTAACCCAGGACTTGTTTGA
OVRT1_0133_B07.b : TGTCAAATGAGCTTTC*AAACGTTAAATGAAACTGGATGTCNTACCAAGGACATGTTTGA
CBLT1_0050_B01.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
SPLT1_0063_F09.b : TGTCNAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAAACNAGGACATGTTTGA
ITT01_0017_F03.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
AMP01_0056_F02.b : TGTC*AATGACCTTTCAAAAC*TTAAATGAAACTGGATGTCaacccaggacatggttgaa
AMP01_0086_B10.b : TGTCAAATGAGCTTTCNAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
LVRM1_0005_H04.b : tgacatcctgagctatgtgtgatccggtgctatatgtttgagacattacttcaacg
OVRM1_0164_B04.b :
PBL01_0023_A06.b : TGTCAAATGActttcaaaacgtaaatgaaactggatgcctacccaggactggttgataga
LVRM1_0071_H04.b : TGTCtaaagtaacttttaacacgttaaaggaaactggatgtcg
OVRM1_0182_D11.b : TGTNCAATGAGCTTTCAAAACGTn
OVRM1_0118_D10.b : TGTCAAATGAGCTTTTCAAACGTTAAATGAAACTGGATGTCNTACCNAAGACATGTTTGA
ADR01_0008_D07.b : TGTCAAATGAGCTTTTCAAACGTTAAATGAAACTGGATGTCNTACCAA*GACATGTTTGA
ADR01_0044_G08.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCCAGGACATGTTTGA
ADR01_0045_D09.b : TGTCAAATGAGCTTTC*AAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
BFLT1_0051_F03.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
OVR01_0061_C11.b : TGTCAAATGAGCTTTTCAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
PST01_0051_G10.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
DCI01_0072_H07.b : TGTC*AATGAGCTTTC*AAACGTTAAATGAA*CTGGATGTCTACCNANNGACATGT*TGA
DCI01_0101_H12.b : TGTCAAAATGAGCTTCCAAACGTTAAATGAAACTGGATGTCTAACAAAGGACATGTTTGA
PST01_0029_C06.b : TGTCAAATGAGCTTTCAAAACGTTAAATGAAACTGGATGTCTAACCAAGGACATGTTTGA
20110601C-000015 : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
---------+---------+---------+---------+---------+---------+ 975
ADR01_0035_G03.b : attggtcctaggttgttacatataaattttttgtcttctggttatataaatatcctggaa
HTMT1_0097_C04.b : *AAGAAATGGTCTAGGGCTGGTACAACAAAATTAG*TTgcttcttggtattaaaaatatc
BMWN1_0026_B06.b : aaaaatttggcctaggcttggtacaacaaaaattattggcatctgggttaataaaaaaat
ILNT1_0020_H01.b : *TAAAAATGGTCTAGGCCTGGTTACACAAAATTTA*GTTGCATCTTGGTTATTAAA*GAG
ITT01_0005_G02.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTAATAAA*GAG
DCI01_0096_H07.b : *TAGAATTGGTCTAGGCTTGNNTACACAAAAT*AG*TTNGCATCNTGGnttataangata
HTMT1_0109_A08.b : ATAGAATGGGTCTAGGCTTGTTACAACAAAATTAG*TT*GCATCTTGGNTATTAAA*GAG
DCI01_0061_H01.b : *TAGAATTGGTCTAGGCTTGTTACACCAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
CLNT1_0056_G05.b : *TAGAATTGGTCTAAGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
DCI01_0028_F05.b : ttacacaaattaatttcacctggttttaaaaataccgggaaggtttgggcaaaaattcaa
HTMT1_0081_G02.b : *TAGAATTGGTCTAGGCTT*TGTACACAAAATNAG*TTTGCATCTTGGGTTAT*AA*GAG
AMP01_0005_E10.b : ttgttctaccaattgtttcatacatatcatctgcttcactttcatatatatctactttga
DCI01_0091_G11.b : *TAGAATTGGTCTAGGCTTGTTTACACAAAATTAG*TTTGCATNCTGGGTA*TAAA*GAG
DCI01_0075_H12.b : *TAGATTGGNTCTAGGCTTNNGTACACAAAAATAG*TTTGCATNCTGGTTA*TAAA*GAG
DCI01_0036_F10.b : ctgttttgaaaaaatggggccaggctttttaacacaaaataaaattgcccctggggtttt
DCI01_0013_F04.b : cctggcttgttcaacaaaatagttggccctgggtattaaaatatctggacggtttgggca
OVR01_0035_F10.b : gatagaaatttggtctaggctttgttacaacaaaatttatttgcatcttggttattaaaa
DCI01_0037_E04.b : aaaattggtcaaggcttgttccacaaattaatttgcatcctggtattaagaaaatctggg
DCI01_0106_E06.b : *TAG*AATGGTCTAGGCTTtgtacacaaattagtttgcatctggnttataangatatctg
AMP01_0087_F08.b : *TAGAATGGNTCTAGGGCTGNTTACACAAAAT*AG*TTTGCATCTTGGNNTAT*AA*GAG
DCI01_0088_C04.b : *TAG*ATTGGTCTAGGATTGTT*ACACAAAATTAG*TTNGCATNNCTGGTA*TNAA*GAG
DCI01_0046_F04.b : *TAGAATTGGTCTANGCTTGNNTACACAAAATTAG*TTTGCATNCTGANTAN**AA*GAG
DCI01_0080_B02.b : *TAG*ATTGGTCTAGGCTTTTGTACACAAAAT*AG*TTTGCATCTGGGGTATT*AA*GAG
DCI01_0081_A04.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATNCTGGNTATAAAA*GA*
DCI01_0116_G09.b : *TAAGAATGGTCTANNGGCTGTTACACAAAATTAG*TTTGCATCTTGGNTAATAAA*GAG
HTMT1_0054_H02.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTA*TAAA*GAG
DCI01_0107_A02.b : *TAaaatggttctagcttggtaccaccaaatagttggcatctggttattaagagtatcgg
DCI01_0116_B06.b : *TANAAT*GGTCTAGGCTTGTAACAACAAAtagtttgcatcttggttattaagatatctg
DCI01_0043_H10.b : *AAAAATTGGCCCAGGCTTGGTTCAACCAAATTAG*TTTGCCTCCTGGGTATTAAAaaaa
DCI01_0076_F11.b : *TAGAATGGNTCTANNGCTGNTGCAACAAAAT*AG*TTTGCATNCTGGNNTAT*AA*GAG
DCI01_0063_F06.b : *TAGAATTGGTCTAGGCTTGNNTACACAAAATTAG*TTTGCATCCTGGNNTAT*AA*GAG
DCI01_0076_H08.b : *TAGAATGGNTCTANGCTTGNNTACACAAAATTAG*TTTGCATNCTGGTTA*TAAA*GAG
DCI01_0087_H06.b : *TAGAATTGGTCTAGGCTTTTGTACAC*AAATTAG*TTTGCATCTGGGGGTAT*AA*GAG
DCI01_0077_F02.b : *TAGAATTGGTCTAGGCTTGNNTACACAAAATTAG*TTTGCATCTTGGTTATT*AA*GAG
DCI01_0064_A06.b : *TAGAATTGGTCTAGGCTTGNNTACACAAAAT*AG*TTTGCATNCTGGNTTAT*AA*GAG
AMP01_0063_E07.b : *TAGAATTGGTCTAGGCTTNGGTACAC*AAATTAG*TTTGCATNCTGANTATNAAN*GA*
AMP01_0036_G11.b : *TAGAATTGGTCTAGGCTTTTGTACACAAAAT*AG*TTTGCATCTTGNATA*TAAA*GAG
AMP01_0026_B09.b : *TAGATTTGGTCCAGGCCTTGTTACACAAAATTAG*TTTGGCTCCTGGTTATT*AA*GAA
DCI01_0090_H02.b : *TAGAA*TGGTCTAGGCTTG*TTGCACAAAAT*AG*TTTGCATCTTGGTAATAAAA*GA*
DCI01_0084_E08.b : *TAGAATTGGTCTANGGCTGNNTACACAAAATTAG*TTTGCATNCTGGNNTAT*AA*GAG
DCI01_0074_A01.b : *TAGAATTGGTCTAGGCTTGGTTACACAAAATTAG*TTTGCATCNTTGGTA*TAAA*GAG
DCI01_0085_G12.b : *TAG*AATTGTCTAGGCTTGTTACAACAAAAT*AG*TTTGCATCTTGATTAATTAA*GAG
DCI01_0098_F10.b : *TAGAATTGGTCTANGCTTGNTNN*ACACAAATAG*TTTGCATCTTGGNTA*TNAA*GAG
DCI01_0068_A02.b : *TAGAATTGGTCTAGGCTTGGNTACACAAAANTAA*GTTGCATCTTGGTTATTAAA*GAG
SPL01_0093_F12.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTtagtttgcatctttggttattaaagag
ADR01_0032_C05.b : *TAGAATTGGTCTAGGCTTGTTTACACAAANTTAG*TTNGCATCTGGGGTA*TNAA*GAG
AMP01_0042_D05.b : *TAGAATTGGTCTANGGNCTGCTACACAAAAT*AG*TTTGCATCTTGGGATAT*AA*GAG
AMP01_0036_D12.b : *TAGAATTGGTCTAGGCTTGNTACAACAAAAT*AG*TTTGCATCTTGGATA*TAAA*GAG
DCI01_0100_H02.b : *TAGATTTGGTCTAGGCTTGGTACAACAAAAATAG*TTTGCATCTTGGGTAAT*AA*GAG
OVRM1_0064_D09.b :
KDN01_0065_A10.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
BFLT1_0127_G11.b : *TAGAAATGGTCTAGGCTTTGTACAACAAAATTAG*TTTGCATCCTGGGTATTAAA*GAG
PTG01_0014_F05.b : cctagggctggttaaccaaaaaaaatttggcacttgggtttataaaaaaattctggggag
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : *TAGAATTGGTCTAAGCTTGGTACAACAAAATTAG*TTTGCATCTTGGTTA*TAAA*GAG
PST01_0040_F03.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
CLNT1_0117_B10.b : *TAAAATTGGTCTAGGCTTGGTACAACAAAATTAG*TTTGCATCTTGGGTA*TAAA*GAG
BMWN1_0023_H11.b : tttggtctaggctggttaaaacaaaattaatttgctcttggttataaaaaaaaacgggga
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : *TAGAATTGGTCTAGcctggtacaacaaaataatttggctcttggttattaaagattatc
OVRT1_0133_B07.b : *TAGAATTGGTCTAGGCTTGTTTACACAAAATTAG*TTTTGCATCTGGTTA*TAAA*GAG
CBLT1_0050_B01.b : *TAGAATTGGTCTAGGCTTGTTTACACAAAATTAG*TTTGCATCTTGGTTATT*AA*GAG
SPLT1_0063_F09.b : *TAGAATTGGTCTAAGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTAATAAAAGAG
ITT01_0017_F03.b : *TAGAATTGGTCTANGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
AMP01_0056_F02.b : aaaattgtctaagcctgttaccacaaattatttgctcctgggtataaagaaaaacctgga
AMP01_0086_B10.b : *TAGAATTGGTCTANGCTTGTTTACACAAAATTAG*TTTGCATCCTTGGTTATAAA*GAG
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : attgtctagcttggtacaacaaattaagttgcatcctggttataaagagaatctggaatg
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : *TAGAATTGGTCTAGGCTTGTTACAACA*AATTAG*TTTGCATCTTGGTTA*TAAA*GAG
ADR01_0044_G08.b : *AAGGAATGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*AAT
ADR01_0045_D09.b : *TAGGATTGGTCAAGGCTTGTTACAACAAAATTAA*TTTGCATCTTGGTTATT*AA*GAG
BFLT1_0051_F03.b : *TAGAATTGGTCTAGGCTTGTTACAACA*AATTAG*TTTGCATCTTGGTTATTTAA*GAG
OVR01_0061_C11.b : *TAGAATTGGTCTAGGCTTGTTACCACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
PST01_0051_G10.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
DCI01_0072_H07.b : *TAGAATTGGTCTAGGCTTGGTACAcaaattagtttgcatctgggtattaaaaatatctg
DCI01_0101_H12.b : TAGAAATTGGTCTAGGCTTGTTACAACAAAAATAANTTTGCATCTTGGTTAATAAAaaag
PST01_0029_C06.b : *TAGAATTGGTCTAGGCTTGTTACAACAAAATTAG*TTTGCATCTTGGTTATTAAA*GAG
20110601C-000015 : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGTTGCCAATT
---------+---------+---------+---------+---------+---------+ 1033
ADR01_0035_G03.b : ttgtttgggaaaaattttaatgttttaattatttttgcgctttttttttttctagaatat
HTMT1_0097_C04.b : tgggactgntttgggcaaaatattccaagttttaactttatttggtggccattattgttt
BMWN1_0026_B06.b : accggggatgggtttggggcaaaaattacaatgtttaaatttttttggtgccaatttttg
ILNT1_0020_H01.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGTTGCCAATT
ITT01_0005_G02.b : TATCTGGGACTGGTTTGGGCAGAANTATTACATGT*TTTAAACTAATTTTGTTGCCAATT
DCI01_0096_H07.b : tctgggactgggttgggcagattatacaatgtttaacttatttgntgccnattatgttta
HTMT1_0109_A08.b : TATCTTGGACTGGTTGGGGCAAAA*TAATACCATG*TTTAAACTTATTTTGGTGCCcaat
DCI01_0061_H01.b : TATCTGGGACTGGTTTGGGCCAAA*TATTACAtgtttaaacttatttggttgccatttat
CLNT1_0056_G05.b : TGTCTGGGACTGTTTTGGccaaattatacaatggttaaacttatttgttggccaatattg
DCI01_0028_F05.b : agttaaactttttggccccattttgttaccaaataaattccttttaacaaaattccttgt
HTMT1_0081_G02.b : TATCTGGGACTGGGTTGGGCAaatataacatggtttaacttattttgtggcaattatgtt
AMP01_0005_E10.b : aatgttttcatccctctaacctctgacattctgcttaatccttctcgttaatacatgata
DCI01_0091_G11.b : TATCTGGGACTGGTTGGGGCAGAnntatacatgtttaaactattttgntgcccattatgt
DCI01_0075_H12.b : TATCTGGGACTGGTTTGGGCAGAtattacatgtttaaacttatttgttgcccattattgt
DCI01_0036_F10.b : aaaaaaatatcgggagaggggttggggaaaaaataaaaggggttaaactttttttgggcc
DCI01_0013_F04.b : aaattacaagtttaactttttgttgcattatggttaccaaataaggttcggtaaccaaat
OVR01_0035_F10.b : atatctgggactgggttgggcagaatattaacatggttaaaacttattttgttgcccatt
DCI01_0037_E04.b : acgggttgggccaaaaattacaatgttaaactttattgttgcccattatggttaccaagt
DCI01_0106_E06.b : ggactggttngggcagatatacatgttnaaactnnattgtgcnnnatatgttacnagtat
AMP01_0087_F08.b : TATCTGGGACTGGTTGGGGgcagatatacaatgtttaacttattttgttgccaatttatg
DCI01_0088_C04.b : TATCTGGGACTGGTTGGGcagataatacatggttaaactattttgtnngcaatatgttta
DCI01_0046_F04.b : TATCTGGGACTGGTTTGGcacatattacatgtttaaactattttgtgcccatattgttaa
DCI01_0080_B02.b : TATCTGGGACTGGTTNGGGCAGAtattacatgttnaaacttatttnngtgccnatatgtt
DCI01_0081_A04.b : TATCTGGGACTGTTTTGGGCAGAtaataacatgttaaacttatttgttggccattatggt
DCI01_0116_G09.b : AATCTGGAACTGGTTTGGGCCAAA*TATAAC*ATG*TTTAAACTTATTTTGTgccaataa
HTMT1_0054_H02.b : TATCTGGGACTGGTTTGGGCAAAA*TATaaatgttttaactaatttttgtgcccaataat
DCI01_0107_A02.b : gaactggttgggcaaataatacaatgtttaacctaatttgtgcccaatatgtttaccagt
DCI01_0116_B06.b : gaactgtttgggcagaatatacaatgttaaacttatttttgtgccaatattgttacaagt
DCI01_0043_H10.b : actgggatgggtttgggcaaaaatttcaaagggttaactttttttggttgcccattttgg
DCI01_0076_F11.b : TATCTGGGACtggnttgggcannnatatacatgttaaacttattttgttgccattatgtt
DCI01_0063_F06.b : TATCTGGGACTGGTTggnngcagatatacatggttagacttattttgtgncccatatgtt
DCI01_0076_H08.b : TATCTGGGACTGGGTTGGGgcagaatatacatgttnaannctatttgntgccnanntatg
DCI01_0087_H06.b : TATCTGGGACTGGTTTGGGgcagatattacatgttnaaacttatttnngtgccanntatg
DCI01_0077_F02.b : TATCTGGGACTGGGTTGGGgcagatatacatgtttaanctattttgttgccaatatgtta
DCI01_0064_A06.b : TATCTGGGACTGGTTGGGGCAGAtatacaatgtttaacttatttgntgcccattatgttt
AMP01_0063_E07.b : TATCTGGGACTGGTTNGGGCannatatacangnttaaacttatttngtgccnantatgnn
AMP01_0036_G11.b : TATCTGGGACTGGTTNGGGCAAAA*TATacaggtttaaacttattttgtgccnattatcg
AMP01_0026_B09.b : TTACCGGGAAGGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTgttgccaatta
DCI01_0090_H02.b : TATCTGGGACTGGTTNGGGCAGAA*TAT*ACAATG*TTTAANCTTATTTgntgccnatta
DCI01_0084_E08.b : TATCTGGGACTGGTTNGGGGCAGA*TATTTACATG*TTTAAACTTATTTgntgccnaatt
DCI01_0074_A01.b : TATCTGGGACTGGTTTGGGCAG*A*TATTACAATG*TTTAACTTTATTTTGTgcaatttt
DCI01_0085_G12.b : TATCTGGGACTGGTTTGGCCAGAT*TATTACA*TG*TTTAAACTTATTTTGCTGCCAATa
DCI01_0098_F10.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG**TTAAACTTATTTTGTTGCCAATT
DCI01_0068_A02.b : TATCTGGGACTGGTTTGGGCAGAA*TAT*ACAATG*GTTAAACTTATTTTGTTGCCAATT
SPL01_0093_F12.b : tatcctgggactggttttggggcaaaatattacaatggtttaaactttattttggttgcc
ADR01_0032_C05.b : TATCTGGGACTGGTTGGGGCAGAAatatacatgttnaaactatttngtgccannttatgt
AMP01_0042_D05.b : TATCTggnactggttggncannatatacatgtttaacttattttcgtgccattatgttta
AMP01_0036_D12.b : TATCTGGGACTGGTTNGGGCANNA*TATacaatgttaancttattttgntgccattattg
DCI01_0100_H02.b : TATCCTGGACTGGTTTGGGCAGAA*TAATACAATG*TTTNAACTTATTTTGTTGCCA*TT
OVRM1_0064_D09.b :
KDN01_0065_A10.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGNTGCCAATT
BFLT1_0127_G11.b : TATCTGGGACTGGTTTGGGCAAAA*TATTACAATG*TTTAAACTAATTTTGTGGCCA*TT
PTG01_0014_F05.b : gggttggggcaaaaaattaaagagtttaaaccttttttttgggccatatttgtttttcca
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : TATCTGGGACTGGTTTGGGCAAAtattacaatgttaaacttatttggttgcaaattattg
PST01_0040_F03.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTTGTGCCAATT
CLNT1_0117_B10.b : TATCTGGGACTGGTTTGGGgagataatacaatgtttaaactattttgttgccaattatgt
BMWN1_0023_H11.b : acgggttggggaaaaatttaacaggggtaaactgtttttggggccaatttttgtttcaca
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : tgggaatggttggggccaaatattacatggtttaaacttatttggtggcaattaatgttt
OVRT1_0133_B07.b : TATCTGGGACTGGTTTGGGCAAAA*TAT*ACAATG*TTTAAACTTATTTTGTTGCCAtta
CBLT1_0050_B01.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACNAAT*GTTTAACTTATTTTGTTGCCAAT*
SPLT1_0063_F09.b : TATCTGGGACTGGTTGGGGCAAAA*TATTACAATGGTTTAAACTTATTTTGTTGCCCATT
ITT01_0017_F03.b : TATCTGGGACTGGTTTGGGCAGAA*TATTAACATG*GTTAAACTTATTTTNGTGCCCAAT
AMP01_0056_F02.b : ctggttgggcccaaaattccaaggttaaatttatttgcccccattatgttaaccagtata
AMP01_0086_B10.b : TATCTGGGACTGGTTNGGGCAGAA*TATTtacatgttaannctattttgtgccnattatg
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : ttttggccgaaaattacaaggttaacttattttgtggccattatgtttaccagaaaaagg
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : TATCTGGGACTGGTTTGGGCAGAtaatacatgtttaaacttatttggtgccatttatgtt
ADR01_0044_G08.b : TATCTGGGACTGGTTTGGGCAGAA*TATaccatgtttaaactttattggttgcccattat
ADR01_0045_D09.b : TATCTGGGAATGGTTTGGGCA*AA*TATTACAATG*TTTAACCTTATTTggtgccaataa
BFLT1_0051_F03.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGTTGCCAATT
OVR01_0061_C11.b : TATCTGGGgactgggtttgggcaagaatattaacaatgtttaaaaccttattttgttggc
PST01_0051_G10.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGTTGCCAATT
DCI01_0072_H07.b : ggactggttgggcagatattacatggtttaacttatttgttgccattattgttaccagaa
DCI01_0101_H12.b : tatctggggactgttttgggcaaaatataacaaggtttaaccttattttgtttgccattt
PST01_0029_C06.b : TATCTGGGACTGGTTTGGGCAGAA*TATTACAATG*TTTAAACTTATTTTGTTGCCAATT
20110601C-000015 : ATTGTTTACCAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTAAAGAAATTCT
---------+---------+---------+---------+---------+---------+ 1093
ADR01_0035_G03.b : gttgctgtaagtaacctatcctgttttttaaatattccttttacttttaaatgtatcctt
HTMT1_0097_C04.b : accagtaataggttgctgttaaccaagtatgcctggttttaagaatttccccttacctgg
BMWN1_0026_B06.b : tttacaagaaaaaggtgcctgtaaacaaatatggctggtttaaaaaaatctccctaattg
ILNT1_0020_H01.b : ATTGgttaaccaagtataatggtgcctgttaaaccaagaatggttgggtttaaagaaatt
ITT01_0005_G02.b : ATTGTTTACCCAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTtaaagaattct
DCI01_0096_H07.b : ccaatttaagttgctgttagccaagttagctggtttaagaaatcccctaactgggaaaag
HTMT1_0109_A08.b : tttgtttaccagtataaatgttgcggttagcaaagtatgcttggtttaaagaaattcccc
DCI01_0061_H01.b : tgttaccagttatatgtttctgttaaccaaatatgcttggtttttaaaaaaatcccttaa
CLNT1_0056_G05.b : tttaccaagtatatgttgctgttaaccaagtatgcttgtttttaaaaaatccccctaact
DCI01_0028_F05.b : ttaaaaattccctacttgggaaaagttcccttattttttccctacccaaacgcggaaaag
HTMT1_0081_G02.b : taacaagttaatgttgcctgtaagcaaagatgctgggtttaaaaaaatccccttactggg
AMP01_0005_E10.b : tacatttattactaagcaattttcttatcttatcggtttcataaattctcattatatttc
DCI01_0091_G11.b : ttacaagtataatggtgctgttaacaaaagtatgctggtttaaagaatttctcttactgg
DCI01_0075_H12.b : tacaaagtatatgttgctgttagcaaatatgcttggttttaaaaattctcctaactgggg
DCI01_0036_F10.b : ccatttgttttacccaaaataggggtgggttttaaaaaaaaatgtgtgtttttaaaattc
DCI01_0013_F04.b : ggttggtttaaaaaattccttactggaaaaatggcccttatttctccttaaccaaggccg
OVR01_0035_F10.b : atttgtttaccaagtattatggttgctgttaagcaaagtatggtttggtttttaaagaaa
DCI01_0037_E04.b : aaaggttgctgtttaccaagatagctgggtttaaagaatttccctaactgggaaaaaggg
DCI01_0106_E06.b : atgtgctgttagcaatatgcttggtttaagaanttctctacctggaaaaatgtctcctat
AMP01_0087_F08.b : ttaccaagtatatgttgctgtaagcaagtatgcttggtttaagaaattctctttacttgg
DCI01_0088_C04.b : ccaggtatatgtgctgntagcaaanatgctgggtttaaagaaatccctttacttggaaaa
DCI01_0046_F04.b : cagtataatgtgctgtaagcaaatatgcttggtttaagaaatctccttactgggaaaaag
DCI01_0080_B02.b : ttacagtatatgntgctgttagcnaagtacgctgggtttaaaaattccccntacttggga
DCI01_0081_A04.b : taccagtataatgtgctgtaagcaaagttagctggttttaagaaatctcccttactgggg
DCI01_0116_G09.b : tgtttaccagtatatgttgctgttaaccaaatacccttggtttaagaattcccctaactg
HTMT1_0054_H02.b : gtttaaccanaatatgttgctgttaagcaaagtatgcttggttttaaaaaaatctccctt
DCI01_0107_A02.b : ataaggtgccgttaacaaaataggctggttttaagaatttcccttaattgggaaaaaggt
DCI01_0116_B06.b : aaaagttgctgttaacaaatatgctggttttaaaaaatctccttatcttggaaaaaggct
DCI01_0043_H10.b : ttaccgataaaaggtggcggttaaccaaaaatgcttggtttataaaaatttcccttattt
DCI01_0076_F11.b : taccagtatatggtgctggtaagcaagtatgcctgggtttaagaaattccccttactggg
DCI01_0063_F06.b : tacaagtatatggtgctgttnagcaagtatgcttggntttaaggaatcttccttactggg
DCI01_0076_H08.b : ttnnaccagtatatgnntgctggtagcaagtattgctgggtttaaagaattcttcctacc
DCI01_0087_H06.b : tttacnagtatnnnatgtgctgtaagcaagtatgctggtttaaagaaaatctccntacct
DCI01_0077_F02.b : caagtatatggtgctgttancaagtatgcttggtttaaggaatctccttactgggaaaaa
DCI01_0064_A06.b : acaagtatatgggtgctgtaggcaagtatgctgggntttaagaaatctcctaactgggaa
AMP01_0063_E07.b : taccagtataatgtgctgtaaacaagtatgcttggataaaagaaatccccttacttggaa
AMP01_0036_G11.b : ttacaagtatatggtgctgttagcaaatatgcttggtttaangaattctttgacttggga
AMP01_0026_B09.b : tgtttacaaagtataatgtgccgttaaacaaaaaaggcttggtttaaagaaatcccctta
DCI01_0090_H02.b : ttgttacccagtatatggtgctgtaagcaaatatgcttggttttaaggaatcctctnacc
DCI01_0084_E08.b : atgtttaccagtataatgttgctgttnagcaaatatgcttggtttaaagaattctcccta
DCI01_0074_A01.b : atgttaccagttatatggtgctgntaaccaagtatgcttggttttaagaaattctcctta
DCI01_0085_G12.b : ttggttaacaagtataatgtgctgttaagccaaatatgcttggtttaaaaaaatccccct
DCI01_0098_F10.b : ATTgttnacccagtatatggtgctgttaacaaagtatgcttggttttaaagaaattctcc
DCI01_0068_A02.b : ATTGTTTACCAgtaatatgttgctgttaaccaagtatgcttggttttaagaaattcctct
SPL01_0093_F12.b : caattatcgttttacccaagtataaatggttgctgtttaagccaaaggtatgccttgggt
ADR01_0032_C05.b : taccagtatatgggtgctgtagcaagtatgcttggtttaaagaatctcctaactgggaaa
AMP01_0042_D05.b : caagtatatgttgctttaaacaagtattgctggttttaaagaatctccttagctgggaaa
AMP01_0036_D12.b : ttnaccaagtataatgtgctgatagcaaagtatgctgatttaaaggaattctcttaactg
DCI01_0100_H02.b : ATTGTTTACC*AGTATTATGTTGCTGTTAAGCAAAGTATGCTTGTTTTTAAAAAAATTCT
OVRM1_0064_D09.b :
KDN01_0065_A10.b : TATGTTTACAAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGGTTTAAAGAATTTCT
BFLT1_0127_G11.b : ATTGTTTAccaagtaaatggtgctgttaagcaaagtaggcttggttttaaagaaattccc
PTG01_0014_F05.b : aataaaaggtgggttttaaaaaaaaagggcgggttttaaaaaaattccctttattgggga
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : tttaccaagattagggtgttggtaagcaaagtagcttgggttttaagaaattctccctta
PST01_0040_F03.b : AATGTTTACCAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTAAGAAAATTCT
CLNT1_0117_B10.b : ttacaaagtaaaaggttctgttaaccaaagtagctgggtttaaagaattccccttactgg
BMWN1_0023_H11.b : aatttttggtgccatttaaacaaaatagggggttttttaaaaaaattctcttaaaaaaaa
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : accaagttaatgttgctgtaaacaaagtaggcttggtttaaaaaattcccctttacttgg
OVRT1_0133_B07.b : ttgtttaccagtatatggtgctgtaagcaagtatgctggttttaagaaatctcctaactg
CBLT1_0050_B01.b : ATTGTTTACCAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTAAagaaatttc
SPLT1_0063_F09.b : ATTGTTTACCAGGTATAATGTGGCTGTTAAACAAAGTAGGCTTGGTTTTAAAGAAATTtc
ITT01_0017_F03.b : TATGTTTNACCAGTATAATGTTGCTGTTNAGCAAAGTATGCTTGGTTTTAAAGAAATTCT
AMP01_0056_F02.b : agttgcttgtaacaaatatgctgggtttaaagaaattctcctaactgggaaaaagggtcc
AMP01_0086_B10.b : ttnanncagtatatgtttgctgttagcaagtatgctggnttttaaangaattctcctaac
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : tcctgtaaccaaaatgctggttttaaaaattccctctactggaaaaaaggccccttaatt
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : ttacagtatatgttgcggttaacaaagtatgcctggtttaagaaattctcttaacttgga
ADR01_0044_G08.b : tgtttaccaatataaaggtgctggtaaccaaaaaaggcttgggtttaaaaaaattctcct
ADR01_0045_D09.b : ttgtttaccagttaaatgtgtgcggtaacacaaaatggctgggttttaaaaaattctcct
BFLT1_0051_F03.b : ATTGTT*ACCAAGTATAATGTTGCTGTTTAGCAAAGTATGCTTGGTTTTAAAGAAATccc
OVR01_0061_C11.b : caattattttttttacccaggtattaatgtttgcctgtttaaaccaaaattatgccttgg
PST01_0051_G10.b : ATTTGTTACCAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTaagaaaatctc
DCI01_0072_H07.b : taaggtgctgtaagccaagatgctgggtttaagaattccccctactgggaaaaacgcctc
DCI01_0101_H12.b : attggttaaccaagtataatgttgcctgttaaccaaagtatgccttggttttaaaaaaaa
PST01_0029_C06.b : ATTGTTTACCAAGTATAATGTTGCTGTTAAGCAAAGTATGCTTGGTTTTAAagaaattct
20110601C-000015 : CCTTACCTTGGAAAAA............................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b : tatcttatttccttaatttaattctttattgtgttacactttataatcttttttatcttc
HTMT1_0097_C04.b : gaaaaaaggccccctattttactccctaagccaaaggccgggacatgggggaccccttaa
BMWN1_0026_B06.b : tgaaaaaagggcctctttatttctctccttaaccaagaggcgggaatgggggcaccctta
ILNT1_0020_H01.b : ccccttaaacttgggaaaaagagggcctcctaattttacttccccttaacccaaaaggcc
ITT01_0005_G02.b : ccnttacttgggaaaaaggtgtcctctaattttacttcccctagccctaatgctggnact
DCI01_0096_H07.b : gggcccctaatttactcccttagccaaagccgggaaaaaggggacctcttaaaacccctt
HTMT1_0109_A08.b : taactgggggaaaaatgtcccccttattttcctcccctaagccaaagggcgggacagggg
DCI01_0061_H01.b : cctgggaaaaaaggccctctaaattaacttccctaacccaaagcgctgaaaaatagtgca
CLNT1_0056_G05.b : tgggaaaaagggccccctaatttacttccctaaccctaaggcctgaaataaggggaaccc
DCI01_0028_F05.b : gggacccttaaaaccccttaagttttttgcccacacaaaggtaaagttccccgcactttg
HTMT1_0081_G02.b : gaaaaaggggccccttaattaacttccctaagcccaaaggccgggaaaaggggaacccct
AMP01_0005_E10.b : tattaattatccctctcaatatctgcaccttttcctctatcaatccttattcttagct
DCI01_0091_G11.b : ggaaaaaggccctcttaattcactccctaacccaaagcctggaaaaggcgaacctttaaa
DCI01_0075_H12.b : aaaaagggcccccttatttacttcccttaagcccaaggccgggaataaggggaaccttta
DCI01_0036_F10.b : ccctcttcttggaaaaaaggctcccctttttttttcctcttcaccaaaggcgcgggagag
DCI01_0013_F04.b : aaaagggaccttaaaaacctttgaggtttttaccccaaaaaaggttaaaattccctgcct
OVR01_0035_F10.b : atttccccttaactttggaaaaaaaagggggcccttttaaatttttactttcccctttaa
DCI01_0037_E04.b : tcccttaattacttccttaacctaaagcccgaaaaaggggacccttaaaaatcctttgaa
DCI01_0106_E06.b : ttactccnntagcctatgctgaaaangggaccttaaaanccatttgagttttggacccac
AMP01_0087_F08.b : gaaaaagtgtctcctattttactcccttaacccaaatgctggacaaagggggaactttaa
DCI01_0088_C04.b : aaggtcctctaatttacttcccttagcccaatgcctggaaaatggggacatttaaaaatc
DCI01_0046_F04.b : gtcctctaattacctccctaccctaagccggactaggggacccttaaaaatccttttgaa
DCI01_0080_B02.b : aaaaagtcccctaatttcactcctaagccaatgccggacatagggaacccttaaaaaacc
DCI01_0081_A04.b : aaaaaaggcctctaaattaacttcccttacccaaaggccgggaaaaagggaaccctttaa
DCI01_0116_G09.b : ggaaaaatgtcccctattttactccctaagccaaagcctggaatagggggaccctttaaa
HTMT1_0054_H02.b : acctgggaaaaaagtgcccccttaatttacctcccttagccaaatggctggaaaaagggg
DCI01_0107_A02.b : gcccctaattacttccctaacctaaggtccggaaagagggaccccttaaaaaacccttta
DCI01_0116_B06.b : tttaatttactccctaaccccaggcggacaaagggacacctaaaaaaccctttgaaggtt
DCI01_0043_H10.b : tggaaaaaagggccccctaatttttttccctaaacccaaaggccgggaacaaggggaccc
DCI01_0076_F11.b : aaaaaggggcccctaaattacttccctaagcaaaagcccggacaaagggggacaccttaa
DCI01_0063_F06.b : aaaaattgtctcttatttacttcccttacctaaatgctgaactaatgggaccctaaaaaa
DCI01_0076_H08.b : tgggaaaaaaagtcccctaattttactccctaacccaatgcctggaaaagggggcccctt
DCI01_0087_H06.b : gggaaaaagtgtctccttaatttactccctaaaccnnaatgctggnacaaggggacacct
DCI01_0077_F02.b : gggcttctaatttactcccctacctaatgccggcacagggggaccctaaaaatccttttg
DCI01_0064_A06.b : aaaatgtccctctaatttacttcccntagccaatgccgggacaagtgggcaccttaaaaa
AMP01_0063_E07.b : aaagtgtcccttaatttactccctaaactcaggccggaagaagggcccataaaaaaccat
AMP01_0036_G11.b : aaaagtgtctcttatttactccctaaaccnaagcctgaacaaggggaaccctaaaaaatc
AMP01_0026_B09.b : acttgggaaaaaaggccccctaatttatttccctaaccccaatcccgggcctatggtgac
DCI01_0090_H02.b : ttggaaaaagtgtcctctaaattacctcccctaagccaaagcctgaaaaaaggggcaccc
DCI01_0084_E08.b : cctggggaaaaaggtcctctaatttactccctaagccaaggcctggaaaaggggcacctt
DCI01_0074_A01.b : actgggaaaaagggtcctctaaatttactcccctaagccaattgctgggactgtggggcc
DCI01_0085_G12.b : aacttgggaaaaaggggcccctaaatttaactcccttaacccaaaagccgggaaaagggt
DCI01_0098_F10.b : ttaactgggaaaaaaaggcccccttaatttacttccctaaccaaaaggccggaaaaaggg
DCI01_0068_A02.b : tnacttgggaaaaaaggtcctcttaatttactcccttaaccnaaagcctggaacaaggga
SPL01_0093_F12.b : t
ADR01_0032_C05.b : aaaggcctctaaatttactcccttagcctaaggctggaatatggggaccctaaaaaaacc
AMP01_0042_D05.b : agtgttctcttattttccttcctaagcgagggggcaacctaaaaaaacattttgagtttt
AMP01_0036_D12.b : gggaaaaaggtcctcttattttacttccttaacccaaatgcgtggactaaggtgacacct
DCI01_0100_H02.b : CCTaacttggaaaaaagtgtccctctaattttctttccctaacccaaaaggccggaaaaa
OVRM1_0064_D09.b :
KDN01_0065_A10.b : Cttaactgggaaaaaagtgtcctcttattttactccccntagcctaatgcctggactagt
BFLT1_0127_G11.b : cttacttggggaaaaaggtgcccctaattttccttccctaaccccaatggcgggaattgg
PTG01_0014_F05.b : aaaaagggcccccttttttatttctctataaacaagggggggggaaaggggggggcctct
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : cttgggaaaaaaggggccccttaattttacttcccttaagccaaaggccgggacaaaggt
PST01_0040_F03.b : CCTTAACTTGGGAAAAaagtgtcctcttaattttacttccttaagctaaatgccgggaat
CLNT1_0117_B10.b : gaaaaagggccccttaatttacttcctaaaccaaaggcggactttggggaaccttaaaaa
BMWN1_0023_H11.b : aaaaagtgcgacaaaattttttttttttttcccctaaggggggggggggggggggcccct
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : gaaaaaggcccccttaattttcttcccttaacccaaatgcccggaaataggggaaacctt
OVRT1_0133_B07.b : gggaaaaatgcctcctattttactccctaaccaatggtggaaaaaggggacccttaaaaa
CBLT1_0050_B01.b : tcttaacttggaaaaaagtgtccntcttattttacttcccttnagcctaatgcctggaca
SPLT1_0063_F09.b : tcttaacttgggaaaaaagtgcccccctaattttacttcccttaaccccaaatgcctgga
ITT01_0017_F03.b : CCTTACTTTGGAAAAAagtgtcctctnattttacttcccctagcctaaatgcctgaaata
AMP01_0056_F02.b : tctaatttactcccctaacccaaatgctggacatagggaaccctttaaataatccctttt
AMP01_0086_B10.b : tngggaaaaagtgtcctnnntatttacttccctaagccctaatgctgnactaangggaca
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : tctcccttaacccaaatgctgggaaaagggaaccttaaaaaaaccttttaaggtttttga
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : aaaaaggtcttcctattttacttccctaagccaaatgccggaaaatgggaacctttaata
ADR01_0044_G08.b : taacttggaaaaaaaaggccctctatttttacttcccttagccaaaatgccggaaaaatg
ADR01_0045_D09.b : taattgggaaaaagtgcccccttattttacttcccttaacccaaaggcgggaaaaagggg
BFLT1_0051_F03.b : ccttactttggaaaaaaggggcctcttaattttacttcccttaaccctaatgccgggaca
OVR01_0061_C11.b : gcttttaaaagaaaattccccctttaaattggggggaaaaaaggtggccctcccctaaaa
PST01_0051_G10.b : cttaanctgggaaaaagtgtcctcttaatttactttcctaagctaaatgcctggaatagg
DCI01_0072_H07.b : taaattaacttcctaacccaaagccctgaaaaggggaccctttaaaaaaccctttgaggt
DCI01_0101_H12.b : ttcccctttaaccttgggaaaaaaagcgtcccccctaatttttaccttcccctaaaaccc
PST01_0029_C06.b : ccttnaactgggaaaaaagtgtcctcttaantttacttcccnttagcctaaatgcctgga
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b : ttatccccaccatatattaatatattttctcatattatgattttattcctatcacttact
HTMT1_0097_C04.b : taaaaccttttgaaggttttttggccccaaaaaaaaggggttaaatttcccctggcattt
BMWN1_0026_B06.b : aaaccccctttagaggtttttttcccccacaaaaaactttataaatccccgtgtatttag
ILNT1_0020_H01.b : tggaaatagtgggacccctttaaataaactccttttgaaggttttttggagcccccacaa
ITT01_0005_G02.b : atggtgacccttttaaataatccttttgaatgtaaaaaaaaaaaaaaaggcacatttgct
DCI01_0096_H07.b : taaggtgttttgagcccaccaaaaggtttaaaaaccccgcgcttttggagctttaattcc
HTMT1_0109_A08.b : ggaacctttaaaaaaccctttgagggttttttggcccccaaaaaaggttttaaggttccc
DCI01_0061_H01.b : ccccttaaaaaaccccatttgaagtt
CLNT1_0056_G05.b : cttaaaaaacccttttgaaggttttttgagcccacaaaaaaatgttttaagtttcccctt
DCI01_0028_F05.b : aaccttattcggggagtggtttaaaaaaatctcttttttttttctctgaaaatttttttg
HTMT1_0081_G02.b : taaaaaacccttttgaaggttttggacccccaacaaaaaggtttaaggtcccccgggact
AMP01_0005_E10.b :
DCI01_0091_G11.b : aatccatttgaaggttttttacccccccaaaaatggtaaaattaccctggacttatggaa
DCI01_0075_H12.b : aaaaacccttttga
DCI01_0036_F10.b : ggggggcccttaataaaacacttttttggggtttttgcccccacacaaaagggtataaat
DCI01_0013_F04.b : ttaaactttattcgggaacgggttaaaaaaaactccttttattttctcctcaaatttatg
OVR01_0035_F10.b : cccctaaagggccgtggaacaataatgggggagaccccttttttaaaaaaaaattcccct
DCI01_0037_E04.b : gttcctgaccccaccaaaaggataaggttccctggccttaggaaccttatatcgggaaga
DCI01_0106_E06.b : aaaagttaaggtccctgnactatgaacttaatccgaaccgggattaaaagacttctgttt
AMP01_0087_F08.b : aaatccatttgatgttttttaacccccaccaaaatgttttaagtaccccctggcctttcg
DCI01_0088_C04.b : catttgaagttttttgagcccaccaaaaaggtttagtttccctggcactaggaaccttta
DCI01_0046_F04.b : gtttttgaccccacaaaaggttaaaataccctggccttaagaacctttatctcggaaacc
DCI01_0080_B02.b : cttggaaggtttttgacccacaaaaaagtttaagatcccctggactttaggaaactttat
DCI01_0081_A04.b : aaaaccctttggaggtttttggacccccaacaaaaggttaaaagttcccctgccaattag
DCI01_0116_G09.b : aatcctttgaagtttttggcccacaaaaaaggtttagtttcccgtgcacttcggaacttt
HTMT1_0054_H02.b : gaaccttaaaaaatccttttgaaagtttttggacccaacaaaatattgtttaggattacc
DCI01_0107_A02.b : aaggtttttggcccccacaaaaggttaaattcccccgcccttaaggcccttatttccggg
DCI01_0116_B06.b : ttgcccccaacaaaggttaaaataccctggcttttggaacttttttccggaaacgcgttt
DCI01_0043_H10.b : ctttataaaaccctttttggaagtttttttagaccaccaaaaagaggtttaaagatctcc
DCI01_0076_F11.b : aaaaaccttttaaaggtttttgggccccccaaaaaggtttaaagttccccttgccctttc
DCI01_0063_F06.b : accctttgaggttttgagcccaaaaaaaggtttaattatccctgcactaaggaacctaaa
DCI01_0076_H08.b : aaaaaaaccctttgaagggtttttggccaccacaaaaaggtttaaaaatacccctggact
DCI01_0087_H06.b : taaaaaatccatttggaagttttttggcccaacacaaaggttttaaggtccccctgcact
DCI01_0077_F02.b : agtttttgagccccacaaaagtttaaagttccctgcctttagaactttaatccgggaaac
DCI01_0064_A06.b : accctttgatgttttttgaacccaacaaaaggttttaggtatccttggacattaaggacc
AMP01_0063_E07.b : tttaagggttttgagcacacccaaaggttaaaatacccgtgccttatgaaccttattccg
AMP01_0036_G11.b : ctttgatgttttttacccc
AMP01_0026_B09.b : cccttt
DCI01_0090_H02.b : ttaaaaaacccatttgaaggttttttgcccccacaaaaaggtttaagtttcccctgacac
DCI01_0084_E08.b : aaaaaaccctttgaaagtttttggccccaaaaaaaggtttaaatatcccctgcacttaag
DCI01_0074_A01.b : ccccaaaaaaccctttgaaagtttttttagcccccacaaaaagtgttaatattcccctgg
DCI01_0085_G12.b : ggccccttaaaaaaaccctttg
DCI01_0098_F10.b : ggcacctttaaaaaacccttttaaagttttttaggccccacaaaaaggtttaaagtttcc
DCI01_0068_A02.b : aaccttaaaaaaacactttgaaggttttttgaccccacacaaaaggtttaaagtatccgt
SPL01_0093_F12.b :
ADR01_0032_C05.b : ctttgaaggtttttgaacccaacaaaaaggtttaagttttccttgggacttaggaacctt
AMP01_0042_D05.b : tctccccaccaaaagatttaaaacccccgtactaagaaacttaatccggggggcgcgaat
AMP01_0036_D12.b : ttaaaaacccatttgaatgttttttaaccccaacaaataaggtctaacgttcccccttcc
DCI01_0100_H02.b : gggggaaccctttaaaaaaaccttttgaaaggtttttgagcccccacacaaaggttttaa
OVRM1_0064_D09.b :
KDN01_0065_A10.b : gtgacactttaaataatcattttgatggttttttgagccaccacaaatatggtttaaggt
BFLT1_0127_G11.b : tggaaacctttaaaaatcccttttgaatgtttttggaccccaaaaaaaaaggtttaagat
PTG01_0014_F05.b : taaaaaaacctctttgggttgttttttccccccacaaaaaggggtttaaaaccccccgcc
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : ggaacctttaaaaaatccctttggaggttttttgagaccccaaaaaaaatgggttaaaag
PST01_0040_F03.b : agtgtgacacctttaataatccattttgatgttttttgagccccaacaataatggtttaa
CLNT1_0117_B10.b : accttttaaaggtttttgaccccaaaataagtttaaattacccttggccttaggaccttt
BMWN1_0023_H11.b : aaaaaaaccttttgtgtttttcccccaccaaaaaaaaaaaaaaacccccctttttagaaa
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : aaaaaaacccttttgaagggtttttggacccaaccaaaaagggtttaaaattccccctgg
OVRT1_0133_B07.b : acctttggaagtttttggcccccacaaaaagtttaaatttcccctggcattaggaacctt
CBLT1_0050_B01.b : taatgtgacacctttaaataatccatttgaaggttttttgacccacaacaataagtttta
SPLT1_0063_F09.b : aaataggggaaccctttaaaaaaatccctttggaaggtttttttgaaccccaaaaaaaaa
ITT01_0017_F03.b : gtgtgaccccttaaataaatcattttgaatgttttttgagcccacacaaatatgtttaaa
AMP01_0056_F02.b : gatgtttttgtaccccaaccataaagttttaatttcccctttctctt
AMP01_0086_B10.b : ccttaantaatcccttttgatggtttttgagcaccacaaataaggtttaagtttcccctg
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : ccccacaaaaagggtttaagttcccctgcgcttacggaaccttaattccggaaactcgcg
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : aatcatttgaaggtttttaagccacacaataagtttaaagtttcccttgcacttacgaaa
ADR01_0044_G08.b : gggacccctttaaaaaaccctttttgagggttttttgcccccaccaaaataggttttaga
ADR01_0045_D09.b : accctttaaaaaattccttttgaagtctttttaacccccaacaaatggttttaaatttcc
BFLT1_0051_F03.b : tatgggaaccctttaataaacccttttgaaatgttttttgacccccaacaaaaagtttta
OVR01_0061_C11.b : tttttacatctccccttataacccataaaatggccctgggaaccaatagtggtgggccaa
PST01_0051_G10.b : gtgacactttaaataaatccatttgaaatgtttttgagccccacaataatgtttaaagta
DCI01_0072_H07.b : ttttgaaccccccaaaaagtttaaggtacccctgccatttcggacctttaatcccgggag
DCI01_0101_H12.b : aaaatgcccggaacaatagtggggaaccccttttaaaaaaaacccctttttgaaagggtt
PST01_0029_C06.b : catagtgtgacaccttaaantaatccatttgaatgtttttttgagccccaacaaatagtg
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b : ttattatttctctgacttctctttattctctcttattatattttaaataattttcccatt
HTMT1_0097_C04.b : aggaacctttatctcggggaaggcggttattaaaaaaaggcctctcttgtatttttcccc
BMWN1_0026_B06.b : aaacatttatttggggaagctggtttaaaaaagtaaccccttgtttttttcccccacaaa
ILNT1_0020_H01.b : aaaagggtttaaaggttatccccttggcacctataggaaacctttaactatcccgggaaa
ITT01_0005_G02.b : caactgcagtccggccgctccaagaatcctcggggggccaattatccgtacccgtttttg
DCI01_0096_H07.b : gggagagggggttataaaagagtccccttgtttt
HTMT1_0109_A08.b : ctggcaattagaagacctttttctccggggaagtcgggtattaaaaaaggaccttccttg
DCI01_0061_H01.b :
CLNT1_0056_G05.b : gccactttaggaacctttatattccgggaaaacggggtgtttaaaaaaagggaccccccc
DCI01_0028_F05.b : ttacccgggcccacatttttttgcggagattcctctttcctcccccccactggggttaac
HTMT1_0081_G02.b : ttttgggaccttttatttccggggggaccccggattaaaaaaagaggccccctttttttt
AMP01_0005_E10.b :
DCI01_0091_G11.b : acctttatttccggaaaatggggatttaaaaaagaccctcctttgtttttttttcccccc
DCI01_0075_H12.b :
DCI01_0036_F10.b : acccctcccgctttggaaactattatttctggagaggggggttattaaaaaaaacatctc
DCI01_0013_F04.b : tttacgggggcccaaataattttgggagattttccctttccgccccccaccaggggggtt
OVR01_0035_F10.b : ttttttgaaaagtggttttttttttttataggccccccccacaaacacaaaaaa
DCI01_0037_E04.b : cgcggtttaaaagtacattcttttttttttcccgccaaattttataggggaaccgagagg
DCI01_0106_E06.b : tttcttccaaattaatggtgaccgggccaacataattgggaatattctttcgcccccccc
AMP01_0087_F08.b : aaacctttcattc
DCI01_0088_C04.b : attcgggaaacgcgggttaaaaggagcctcccttgttttttcccttgccaaaatttttat
DCI01_0046_F04.b : ggaattaaaaatgcatccttttttttttttctgccaaaattttattctgttaaccggagg
DCI01_0080_B02.b : ccggggaatcgggattaaaaagacatccttgtattttttccctgccaaaattttttggtg
DCI01_0081_A04.b : ggaacctttaatccgggaaactgtgttttaaaaaagggcctccctttttttttttctccc
DCI01_0116_G09.b : tattccggaaccgcctttaaaaaagcacttcctttttttttttcctggccaaattttttt
HTMT1_0054_H02.b : cctggcacttaaggaaaacttaaaatccggggaaaccgcgtaattaaaaaaagggacccc
DCI01_0107_A02.b : agccgcggattaaaaagtgcctcctttttttttttcctcgcaaatttttatgtgtgcacg
DCI01_0116_B06.b : aaaaagaaccctttgttttttccctcccaatttttctgggtcgggggggaccataaattt
DCI01_0043_H10.b : ggtgcatttggagacctttattttccgggagactggtgatttaaaaaagatctctctctt
DCI01_0076_F11.b : ggaac
DCI01_0063_F06.b : ttcgggaaaccgggattaaaaagaacctccttgttttttccctgtcaaatttttatggtg
DCI01_0076_H08.b : taaggaaactttaattcggggaacccgggtttaaaaaaatgctcctctttt
DCI01_0087_H06.b : ttaggaactttaattcccgggaacctgcgatttaaaaagtaccatccttggttttttccc
DCI01_0077_F02.b : cggattaaaaaggacatcccttgtttttttcctgccaaattttatcgtgttcccggagtc
DCI01_0064_A06.b : tttatatccgggaaactgggttataaaaaggaatctctttgtttttttccctgccaaaaa
AMP01_0063_E07.b : ggagcgcgaataaaaaaaattccttttttttttccttccaaattttttggtggaccgggg
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b : ttaggaaaccttacattccgggaaacgcggtttaaaaaaggaactctccttgttattttc
DCI01_0084_E08.b : aaactttaattccgggaaccgcggttaaaaaggacatccctgtattttttccccccccaa
DCI01_0074_A01.b : ccctattggaacctttatttccgggaagccggggaataaaaaaaaagacctcccttgttt
DCI01_0085_G12.b :
DCI01_0098_F10.b : cctggcatttaggggccctttatttccgggagagcgccgatttaaaaa
DCI01_0068_A02.b : tggccttataggaacctttaatcccggggaagcggggatataaaaaagacactcctttgt
SPL01_0093_F12.b :
ADR01_0032_C05.b : ttaatccggggaagctgcgatttaaaaaagaaccttcctttttttattttccctgccaaa
AMP01_0042_D05.b : aaaaaaaattcttttttttttcccccacaaattttagggggagccggggccaattcttt
AMP01_0036_D12.b : ct
DCI01_0100_H02.b : ggttcccccgggtctttacgaaaccctttaattcccaaaaaactcttgatttaaaaaaga
OVRM1_0064_D09.b :
KDN01_0065_A10.b : acccctggcacttaacgaaacttttcatcccgggaaatctgctgattaagaaaatgagct
BFLT1_0127_G11.b : ttccccgtggcattttggaaacctttaaatccggggaagatcggttattaaaaaaaggac
PTG01_0014_F05.b : ctctttatagaaaaatttattctcggggggggggggggttaaaaaaaaaaaaacaccttc
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : taccccttgggacttaacggaaccttaaattccggggaaacctggggatttaaaaaaaag
PST01_0040_F03.b : gtatcccctgctacttactgaaactttaccatcctggaaagtcgctgattagaaaaagta
CLNT1_0117_B10.b : aatccgggaaacggtgattaaaaagtcactccttttttttttccccggccaaaatttaaa
BMWN1_0023_H11.b : tttttttggggggggggtaaaaaaaaaaaaatctttttttttttccccccccaaaaattt
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : cactttctggaacctttatttccggggagaagggggagttaaaaaaagagcactcccttt
OVRT1_0133_B07.b : tattcggggaatgcgcgattaaaaaaggaccctccttgttttttttcccctcccaaaatt
CBLT1_0050_B01.b : aagtaaccccttgcaacttacgaaaccttaacattccggggaagtctgcgattaaaaaaa
SPLT1_0063_F09.b : ggttttaaagttacccccttgccaattttaggaaacccttttaattcggggaaagttcgg
ITT01_0017_F03.b : gtaccccctgctacttacgaaaaccttacatccgggaacgttgctgattaagaaatgtac
AMP01_0056_F02.b :
AMP01_0086_B10.b : ccacttacgaaactttaccatccgggaaaatcgctgattaaaaaaag
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : attaaaaaaaggaaattccttgattttttttccctcccaaaattttaaatcctggaagcc
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : cttaacttctgggacatctgcgattaaaaaaggacctccattgatttatttcccctggca
ADR01_0044_G08.b : ttttcccttggtcctttaagaatacctataaatcctgggaaacctcgctgattaaaaaaa
ADR01_0045_D09.b : ccttgtactttctaaaacttttcttccgtgaaatcttggatttaaaaaagtaaattcctt
BFLT1_0051_F03.b : agatttcccctggacattaagaaaccttaacatccggggaagccggtgatttaaaaaagt
OVR01_0061_C11.b : ccccttttaaaattaaatcccccc
PST01_0051_G10.b : tcccctgctacttactgaaccttgtcatcctgggacatctgctgattaagaaaaggacca
DCI01_0072_H07.b : accgggttttaaaaagagcctcccttgttttttttccctcccaaaatttttattgttggg
DCI01_0101_H12.b : tttttt
PST01_0029_C06.b : tttaagttattcccttgccacttaacggacacttaacaatctggggaagcctggtgatta
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b : tattatatcattaatattcctcttatcttaattctattcttctaatctcncttttccata
HTMT1_0097_C04.b : ttgccagattttttaagggtggaaccggagggcgcaaatttaaatttgtggggaaatttt
BMWN1_0026_B06.b : atttatagcggggacgggagagtacaaaattattcctgggagaactttccccataatgcg
ILNT1_0020_H01.b : gtcgtgtgttttataaaaagtgaacacttccttgtgattatatttctcccctggcacaaa
ITT01_0005_G02.b : taaaaagggcccctaaggggcctattaagcaggcccgggcgcgttttaactccggcggga
DCI01_0096_H07.b :
HTMT1_0109_A08.b : tttttttttccccggccaaaatttttagtggtttgagggggagggccaccatttaattcc
DCI01_0061_H01.b :
CLNT1_0056_G05.b : ttgttttttttcccccgggccaagatttttatatgtttgttagccgggggggccccaaat
DCI01_0028_F05.b : acacccggaaaagaaatacaatctttttttttggt
HTMT1_0081_G02.b : tttttccccgcgccaaaatttttaagggtgtttcacagagggt
AMP01_0005_E10.b :
DCI01_0091_G11.b :
DCI01_0075_H12.b :
DCI01_0036_F10.b : cttttatttttttcctcccccaaatattttagtgttgggcgcgggaggacaccacacata
DCI01_0013_F04.b : aaacacccgcgagaataaaacaaacatctctttttt
OVR01_0035_F10.b :
DCI01_0037_E04.b : ccaatttattctgcggaaaatttcccttaccgcgcccccaaccgggggggttacactccc
DCI01_0106_E06.b : gggggtgaaaatccgggaaaaaaaacaacctttttttnnnccccnnngtgtttttttaat
AMP01_0087_F08.b :
DCI01_0088_C04.b : gttgtagcgggaggccaacaataatctcgcgggaatattccctttactcgctcccccccc
DCI01_0046_F04.b : ccaccaattatcttctggaaaatttctcctttt
DCI01_0080_B02.b : gacccggggcccaactt
DCI01_0081_A04.b : ccaaaatattat
DCI01_0116_G09.b : ggttgagccggggtccaaattttattccgggaaaatttcctttatcgcttcccacacgcg
HTMT1_0054_H02.b : ccttgttttttttttccccgtgcaaaaatttttttaagggtgttaacccgggaaggtcca
DCI01_0107_A02.b : gggggccacaataacttctgcgagaatttcccttttccgcctcccacaccggggggggta
DCI01_0116_B06.b : ggggaatattcctcttccgccccccaccgggggggaaatattccgagagaaattacaaca
DCI01_0043_H10.b : tttttttctctctctccaaatttttataggtggttgaccggaggcccaaaatatttattg
DCI01_0076_F11.b :
DCI01_0063_F06.b : gaccggggccgaaattaatttgggggaaatttcctttctcgcccccacctcggtgg
DCI01_0076_H08.b :
DCI01_0087_H06.b : cccccaaaaatttaatggtttgacccggaagcccaacattcaatttctgggagaatttcc
DCI01_0077_F02.b : caactttttt
DCI01_0064_A06.b : tttttatttggttaccgggagccca
AMP01_0063_E07.b : gcccacactatttgcgtgattt
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b : cctctgcaaaattttaatggggttgaccgga
DCI01_0084_E08.b : atatttattgtgttgcccgggggccaaactttatcttgcggagaattt
DCI01_0074_A01.b : attttccccctcccaaaatttttttgtggtgttaccggggaggcccaccattttatttt
DCI01_0085_G12.b :
DCI01_0098_F10.b :
DCI01_0068_A02.b : ttttttttcctggcaaaatttttatggttgtagcccgggagctcaacttt
SPL01_0093_F12.b :
ADR01_0032_C05.b : gatttttaagggtgtgaagcgggagcccaaaacttaaattttgggggggaaaatttcccc
AMP01_0042_D05.b :
AMP01_0036_D12.b :
DCI01_0100_H02.b : aaaa
OVRM1_0064_D09.b :
KDN01_0065_A10.b : tccattggattattttcccctgccaaaagatttttaaacgctgtacacccgggatgccca
BFLT1_0127_G11.b : ccccctttgtttttttttccccggccaaaaaattttataagggttgaacccggaggttcc
PTG01_0014_F05.b : tttttttttttttcccccccccaaaaatttttttttttgtgtggggggggggggccacaa
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : acccccccctggggtttattttcccccttgccaaaaatttttaatctgtgtgtaacccgg
PST01_0040_F03.b : acatcctttgaattatttccccctgccaaaaattttaaaggctgtaagacggaatggcca
CLNT1_0117_B10.b : cggtgtaacgcgggggccaaatttttatttgcgggaaaatttcccctttgcccggcccac
BMWN1_0023_H11.b : ggcggggggggggggagaaaaaaaagggggggggggttctttctctcccccccccccccc
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : gttttttttttcccccccaaaaaatttttattttgtgttggccggggggggcccacaaaa
OVRT1_0133_B07.b : ttaatgtgttgccggggggcccaaattttatttttgcggggaatatttccccctgtcccg
CBLT1_0050_B01.b : ggagcatcccttggatttattttcccctggcaaaaatttttaaacgcttggaagccggga
SPLT1_0063_F09.b : cggtttaaaaaaaagtaccaccccctttggattatttttcccccgggcaaaaaaatttta
ITT01_0017_F03.b : catcccattgaattatttctccctgcaaaaaatttttaaatgctgtacacccggaagccc
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : ggaggtccaaacaattattttttgggggaaaaaattccccttttaccccgccccccaaaa
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : aaaatttttaacggttgtaaaccgggatgtccaaactttcatttctgcggggaacatatt
ADR01_0044_G08.b : tgaaacctccttttggtatttttttccccttccaaaaaattttattaatttttaacatac
ADR01_0045_D09.b : tttattattttcccttggcaaaaatttatattggttgtacactccggaagttctcattta
BFLT1_0051_F03.b : gacatccttgtgattttttctcccggaaaaaatttttatttggttggcaccggggagccc
OVR01_0061_C11.b :
PST01_0051_G10.b : tcccattgattattttctccctgcaaaaaatttttatactgctgacaaccagggatgccc
DCI01_0072_H07.b : aaccgggagcccaaaatttaattcttccgggaaattttccccatatcccgctcccacaca
DCI01_0101_H12.b :
PST01_0029_C06.b : aaaaaaatgaacatccctttggattattttccccctggcaaaaaattttttacggcttgt
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b : tccactt
HTMT1_0097_C04.b : ccccatatgccggccccaccacacccggggggggtgaaaaaattcccgcggaacctttga
BMWN1_0026_B06.b : ctcacaccttgtgggggtggcaacatctcctctgacaattatatttaaccagctcttttc
ILNT1_0020_H01.b : aattttttaaccggtttttaaacaccgggatggtctacaacctttg
ITT01_0005_G02.b : aactttccctggatttttgaagaccttcctgtggtgtacaatt
DCI01_0096_H07.b :
HTMT1_0109_A08.b : gggggggaatatttccccctagcccgggcccaccccccggggggggtggtaacatcttcc
DCI01_0061_H01.b :
CLNT1_0056_G05.b : attttatattgggggggaaaatttatcccctc
DCI01_0028_F05.b :
HTMT1_0081_G02.b :
AMP01_0005_E10.b :
DCI01_0091_G11.b :
DCI01_0075_H12.b :
DCI01_0036_F10.b : tctcctgggaaatattctccctttctcct
DCI01_0013_F04.b :
OVR01_0035_F10.b :
DCI01_0037_E04.b : tgcacttttat
DCI01_0106_E06.b : tatgaaaacggggtgccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
AMP01_0087_F08.b :
DCI01_0088_C04.b : tctggggggt
DCI01_0046_F04.b :
DCI01_0080_B02.b :
DCI01_0081_A04.b :
DCI01_0116_G09.b : tggtgtaaaat
HTMT1_0054_H02.b : aaaatttaattttggggggaaaatattttcccccattagcccgggct
DCI01_0107_A02.b : ccacctcccgcacgagatttctc
DCI01_0116_B06.b : cttttttttt
DCI01_0043_H10.b :
DCI01_0076_F11.b :
DCI01_0063_F06.b :
DCI01_0076_H08.b :
DCI01_0087_H06.b : ctttttt
DCI01_0077_F02.b :
DCI01_0064_A06.b :
AMP01_0063_E07.b :
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b :
DCI01_0084_E08.b :
DCI01_0074_A01.b :
DCI01_0085_G12.b :
DCI01_0098_F10.b :
DCI01_0068_A02.b :
SPL01_0093_F12.b :
ADR01_0032_C05.b : tttaaccgggcccccaaacccgggggggggtggaacatcctccccggatcttgtattttt
AMP01_0042_D05.b :
AMP01_0036_D12.b :
DCI01_0100_H02.b :
OVRM1_0064_D09.b :
KDN01_0065_A10.b : aacttttcaattctgccggggaaataatttcccctattatgaccggttcaaacaaattac
BFLT1_0127_G11.b : aacatttttatttttggggggaaaaaatttcccctaattaaccgcctccccaacccaccc
PTG01_0014_F05.b : aaaatttgttttgggggggggatatttttttcttttttgtggggcccgcccccaaaaggg
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : ggaggttcaaaacattttaattttggcggaagaaatattttcccccataagccccggtcc
PST01_0040_F03.b : accttttgattttggcggaaaataatttcccatatgacccggttcaaccaaatacctggg
CLNT1_0117_B10.b : acaccggggggtggtagattctccgcgcaaattgaaaattccaagctctaatttttttgg
BMWN1_0023_H11.b : cgcgtgggggggggtctccaccccccaaaaaaaaaaaaaacatctttttttttttttttt
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : ttttattgtggggggagataatttccccctttagacggcgccccacaaacaagggggggg
OVRT1_0133_B07.b : gccccccaaccccgggggtgtgtaacactcctcccgaggaatgtgaaaataaacactttt
CBLT1_0050_B01.b : agcccaaacttttcgaattttgccggggaattattttcccccttttgccccggctccaac
SPLT1_0063_F09.b : aacgcgcttgaaagccggggaggtccccaaaaattttaaattttggcggggggaatattt
ITT01_0017_F03.b : caaactttcaattcttgccggggaattaattccccccaatggaccggttccacccacctc
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : caccggggggtgttgaacaaaccccggcgccagctttgaaattttaccaaagcctttttt
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : tccccctttaaccggcctccccaaacactgggggtgggttgacaatatttgcggtcaaat
ADR01_0044_G08.b : gatgtgctaataaatattataaattccgttgggaaaatatttcctctatttatacttttc
ADR01_0045_D09.b : ttttattttttacggagaaattattcctccataatttcggcttcactccaccttctgggt
BFLT1_0051_F03.b : aaaaatttaaaatctggggagagaattatttccccattggacgggcctcccacaaaatcc
OVR01_0061_C11.b :
PST01_0051_G10.b : aaacttttcaatctctgccggagaataatttccccaattgaaccgggtccaaacaactaa
DCI01_0072_H07.b : catggg
DCI01_0101_H12.b :
PST01_0029_C06.b : aagcccgggaggctccaaacttttcaattcttgccggggaaattaaatttcccccttatg
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b :
HTMT1_0097_C04.b : tata
BMWN1_0026_B06.b : tttttgtgtcggttcctcgctcggtaggttataatatcaccaaatttcatatatataaaa
ILNT1_0020_H01.b :
ITT01_0005_G02.b :
DCI01_0096_H07.b :
HTMT1_0109_A08.b : tcccaaagttatgatatacaccagctcttttattttgtggtgt
DCI01_0061_H01.b :
CLNT1_0056_G05.b :
DCI01_0028_F05.b :
HTMT1_0081_G02.b :
AMP01_0005_E10.b :
DCI01_0091_G11.b :
DCI01_0075_H12.b :
DCI01_0036_F10.b :
DCI01_0013_F04.b :
OVR01_0035_F10.b :
DCI01_0037_E04.b :
DCI01_0106_E06.b :
AMP01_0087_F08.b :
DCI01_0088_C04.b :
DCI01_0046_F04.b :
DCI01_0080_B02.b :
DCI01_0081_A04.b :
DCI01_0116_G09.b :
HTMT1_0054_H02.b :
DCI01_0107_A02.b :
DCI01_0116_B06.b :
DCI01_0043_H10.b :
DCI01_0076_F11.b :
DCI01_0063_F06.b :
DCI01_0076_H08.b :
DCI01_0087_H06.b :
DCI01_0077_F02.b :
DCI01_0064_A06.b :
AMP01_0063_E07.b :
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b :
DCI01_0084_E08.b :
DCI01_0074_A01.b :
DCI01_0085_G12.b :
DCI01_0098_F10.b :
DCI01_0068_A02.b :
SPL01_0093_F12.b :
ADR01_0032_C05.b : cccacct
AMP01_0042_D05.b :
AMP01_0036_D12.b :
DCI01_0100_H02.b :
OVRM1_0064_D09.b :
KDN01_0065_A10.b : ggggggttgaattgagccatacttgggtgtgaagactttgggat
BFLT1_0127_G11.b : ggggggggtgtaagaaaattcttggcggcga
PTG01_0014_F05.b : cggggggggtgggggaaccccccctcgcgcccgt
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : ccccccacaatcggggggggggtttagaaaaaaatttctggtgggaaattttttgggatt
PST01_0040_F03.b : gtggattaaccaaaacttggcgggaaactttgaaatttaccccaagcttctttgatcttt
CLNT1_0117_B10.b : gtgccctcccagggggtgtgtttttttccnnatttttttttttaatataaaaaagcgcgg
BMWN1_0023_H11.b : ggctccccccccgtttttaataaaaaaaaact
OVRM1_0082_G05.b :
OVRT1_0132_D11.b : ggggtgaaaaaacaccgcgcccgcggaggtgtgattttttatcccct
OVRT1_0133_B07.b : ttttttttttgtcccccccccgggggggtgttttttnnnnnnnnttttcccttttaaaaa
CBLT1_0050_B01.b : acaactcccggggggtttgggttgaacaattccttgggggtcaaaagtctttggagattt
SPLT1_0063_F09.b : ttcccccataagaccgcgctccacacacaacttctggggggggggagtaaaaaaattctt
ITT01_0017_F03.b : cgtggggttgaattaagcaatccttggcttgcaagctcttgagatttaatccccagtgtt
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : ttttttttgggtgccccttcccaaagcggtgggtttatatcccttgcaaaaaaaaaaaaa
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b : ttttggaatttacccaaggccttaatgacttttgggggtgtgaccttcccaaaaaccct
ADR01_0044_G08.b : ttaccaccattattgttgtggtggatataaatattattttaattatgatatatatctgac
ADR01_0045_D09.b : attagaattaaatatcttatatgaatatacttatatttatacaaatatcttcttaatttt
BFLT1_0051_F03.b : tgggggtggatttaaatttttgaggggggaagattttgaaagttttctcccag
OVR01_0061_C11.b :
PST01_0051_G10.b : ccggggggttgattaaacaaatcttggctggcaaatcttgaagatttaaccccaaggctt
DCI01_0072_H07.b :
DCI01_0101_H12.b :
PST01_0029_C06.b : aaccggctcccacaaaatacctgggggtgtgatgaaacaattccttggggggcaaaactt
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b :
HTMT1_0097_C04.b :
BMWN1_0026_B06.b : aaaaa
ILNT1_0020_H01.b :
ITT01_0005_G02.b :
DCI01_0096_H07.b :
HTMT1_0109_A08.b :
DCI01_0061_H01.b :
CLNT1_0056_G05.b :
DCI01_0028_F05.b :
HTMT1_0081_G02.b :
AMP01_0005_E10.b :
DCI01_0091_G11.b :
DCI01_0075_H12.b :
DCI01_0036_F10.b :
DCI01_0013_F04.b :
OVR01_0035_F10.b :
DCI01_0037_E04.b :
DCI01_0106_E06.b :
AMP01_0087_F08.b :
DCI01_0088_C04.b :
DCI01_0046_F04.b :
DCI01_0080_B02.b :
DCI01_0081_A04.b :
DCI01_0116_G09.b :
HTMT1_0054_H02.b :
DCI01_0107_A02.b :
DCI01_0116_B06.b :
DCI01_0043_H10.b :
DCI01_0076_F11.b :
DCI01_0063_F06.b :
DCI01_0076_H08.b :
DCI01_0087_H06.b :
DCI01_0077_F02.b :
DCI01_0064_A06.b :
AMP01_0063_E07.b :
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b :
DCI01_0084_E08.b :
DCI01_0074_A01.b :
DCI01_0085_G12.b :
DCI01_0098_F10.b :
DCI01_0068_A02.b :
SPL01_0093_F12.b :
ADR01_0032_C05.b :
AMP01_0042_D05.b :
AMP01_0036_D12.b :
DCI01_0100_H02.b :
OVRM1_0064_D09.b :
KDN01_0065_A10.b :
BFLT1_0127_G11.b :
PTG01_0014_F05.b :
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b : tataatccacagtctttttatttttttttttt
PST01_0040_F03.b : gtggggtgtaacctctccaaaatcgagtagt
CLNT1_0117_B10.b : gcgct
BMWN1_0023_H11.b :
OVRM1_0082_G05.b :
OVRT1_0132_D11.b :
OVRT1_0133_B07.b : aacgacagggcc
CBLT1_0050_B01.b : aaccccaagggcctcttaaagcttttgtgcggggtgggaccctcccacaaaaaatccggt
SPLT1_0063_F09.b : cgcgtgggaaaatttttagaaagtttatccccatgtttttttttttattt
ITT01_0017_F03.b : tataaatttttggggggctgtgaccctc
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b : gggggcccccgcccccccccccnnnnncccccnnttttttttttaaatattttt
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b :
ADR01_0044_G08.b : ta
ADR01_0045_D09.b : tatccatagctct
BFLT1_0051_F03.b :
OVR01_0061_C11.b :
PST01_0051_G10.b : ttagaactttatagggcttggaaccttcccaaaaagcgcgtttgtttgaatcccattgga
DCI01_0072_H07.b :
DCI01_0101_H12.b :
PST01_0029_C06.b : ttggagattttatcccaaggctcctattgacctttttgagaggttggacctttcccagaa
20110601C-000015 : ............................................................
---------+---------+---------+---------+---------+---------+ 1109
ADR01_0035_G03.b :
HTMT1_0097_C04.b :
BMWN1_0026_B06.b :
ILNT1_0020_H01.b :
ITT01_0005_G02.b :
DCI01_0096_H07.b :
HTMT1_0109_A08.b :
DCI01_0061_H01.b :
CLNT1_0056_G05.b :
DCI01_0028_F05.b :
HTMT1_0081_G02.b :
AMP01_0005_E10.b :
DCI01_0091_G11.b :
DCI01_0075_H12.b :
DCI01_0036_F10.b :
DCI01_0013_F04.b :
OVR01_0035_F10.b :
DCI01_0037_E04.b :
DCI01_0106_E06.b :
AMP01_0087_F08.b :
DCI01_0088_C04.b :
DCI01_0046_F04.b :
DCI01_0080_B02.b :
DCI01_0081_A04.b :
DCI01_0116_G09.b :
HTMT1_0054_H02.b :
DCI01_0107_A02.b :
DCI01_0116_B06.b :
DCI01_0043_H10.b :
DCI01_0076_F11.b :
DCI01_0063_F06.b :
DCI01_0076_H08.b :
DCI01_0087_H06.b :
DCI01_0077_F02.b :
DCI01_0064_A06.b :
AMP01_0063_E07.b :
AMP01_0036_G11.b :
AMP01_0026_B09.b :
DCI01_0090_H02.b :
DCI01_0084_E08.b :
DCI01_0074_A01.b :
DCI01_0085_G12.b :
DCI01_0098_F10.b :
DCI01_0068_A02.b :
SPL01_0093_F12.b :
ADR01_0032_C05.b :
AMP01_0042_D05.b :
AMP01_0036_D12.b :
DCI01_0100_H02.b :
OVRM1_0064_D09.b :
KDN01_0065_A10.b :
BFLT1_0127_G11.b :
PTG01_0014_F05.b :
LVRM1_0123_E11.b :
OVRM1_0126_F06.b :
SMG01_0007_D11.b :
PST01_0040_F03.b :
CLNT1_0117_B10.b :
BMWN1_0023_H11.b :
OVRM1_0082_G05.b :
OVRT1_0132_D11.b :
OVRT1_0133_B07.b :
CBLT1_0050_B01.b : gtgtgttaacacccgagtgtgaacccacagattttcc
SPLT1_0063_F09.b :
ITT01_0017_F03.b :
AMP01_0056_F02.b :
AMP01_0086_B10.b :
LVRM1_0005_H04.b :
OVRM1_0164_B04.b :
PBL01_0023_A06.b :
LVRM1_0071_H04.b :
OVRM1_0182_D11.b :
OVRM1_0118_D10.b :
ADR01_0008_D07.b :
ADR01_0044_G08.b :
ADR01_0045_D09.b :
BFLT1_0051_F03.b :
OVR01_0061_C11.b :
PST01_0051_G10.b : acaccgat
DCI01_0072_H07.b :
DCI01_0101_H12.b :
PST01_0029_C06.b : aagcggat