[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000042

Length: 1,765

Sequence [FASTA format sequence]
CAGATTGAGG GGTCTGGACC AACAGGAAAA GGCCCCTGCC CATCCCCATG GTGACCGAGT
TGTATATAGG GAGCTGCGTC CGCCCATGTG CGGCAGGTTC TCTTACATCG ACCGCTTAAG
AGTCGCGCTG TAAGAAGCAA CAACCTCTCT TCTCCGCCAT CTGCTCGGCG CCGCAAAACA
GCAACTATGC GTGAGTGCAT CTCCATCCAC GTTGGCCAAG CTGGTGTCCA GATCGGCAAT
GCCTGCTGGG AGCTCTACTG CCTGGAACAC GGCATCCAGC CCGATGGCCA GATGCCGAGT
GACAAGACCA TTGGGGGAGG AGATGACTCC TTCAACACCT TCTTCAGTGA GACAGGCGCT
GGCAAGCATG TGCCCAGGGC AGTGTTTGTA GACCTGGAAC CCACAGTCAT TGATGAAGTT
CGCACTGGCA CCTACCGCCA GCTCTTCCAC CCTGAGCAGC TCATCACAGG CAAGGAAGAT
GCTGCCAATA ACTATGCCCG AGGTCACTAC ACCATTGGCA AGGAGATCAT TGACCTCGTC
TTGGACCGAA TTCGGAAACT GGCTGACCAG TGCACAGGTC TTCAGGGCTT CTTGGTTTTC
CACAGCTTTG GCGGGGGAAC GGGTTCTGGG TTCACCTCCC TGCTGATGGA ACGTCTCTCT
GTCGATTATG GCAAGAAGTC CAAGCTGGAG TTCTCCATTT ACCCAGCCCC CCAGGTTTCC
ACAGCTGTAG TTGAGCCCTA CAACTCCATC CTCACCACCC ACACCACCCT GGAGCACTCT
GATTGTGCCT TCATGGTAGA CAATGAGGCC ATCTATGACA TCTGTCGTAG AAACCTCGAT
ATTGAACGCC CAACCTACAC TAACCTGAAT AGGTTGATAG GTCAGATTGT GTCCTCCATC
ACTGCTTCCC TGAGGTTTGA TGGGGCCCTG AATGTTGATC TGACAGAATT CCAGACCAAC
CTGGTGCCCT ATCCCCGCAT CCATTTCCCT CTGGCCACAT ATGCCCCTGT CATCTCTGCT
GAGAAAGCCT ACCATGAACA GCTTTCTGTA GCAGAGATCA CCAATGCTTG CTTTGAGCCA
GCCAACCAGA TGGTGAAATG TGACCCTCGC CATGGTAAAT ACATGGCCTG CTGCCTGTTG
TACCGTGGTG ACGTGGTTCC CAAAGACGTC AATGCCGCCA TCGCCACCAT CAAGACCAAG
CGTACCATCC AGTTTGTGGA CTGGTGCCCC ACTGGCTTCA AGGTTGGCAT TAATTACCAG
CCCCCCACTG TGGTCCCCGG TGGAGACCTG GCCAAAGTAC AGCGGGCAGT GTGCATGCTG
AGCAACACCA CAGCCATCGC TGAGGCCTGG GCTCGCCTGG ACCACAAGTT TGACCTGATG
TATGCCAAGC GTGCCTTTGT TCACTGGTAC GTGGGTGAGG GCATGGAGGA AGGAGAGTTT
TCTGAGGCCC GTGAGGACAT GGCTGCCCTT GAGAAGGATT ACGAGGAGGT TGGTGTGGAT
TCTGTTGAAG GAGAGGGAGA GGAAGAAGGC GAGGAATACT AAAGTTAAAA TGTCACAAAG
GTGCTGCTTT TACAGGGAAG CTTATTCTGT TTTAAACATT GAAAAGTTGT GGTCTGATCA
GTTAATTTGT ATGTAGCAGT GAATACTCTC ATATACAATT ACTGACCTAT GCTTTAAAAC
ACGACGCTTT GTTACAGACC CAAGTTATTC ATTTCTCTGG GTTTGAATAA AGTATTCCCT
GTCTTAAACA AAAAAAAAAA AAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBA1Atubulin alpha-1A chain [Homo sapiens]. 8540.0O
Contig/Assembly ProteinTUBA1Ctubulin alpha-1C chain [Homo sapiens]. 8500.0O
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Homo sapiens]. 8500.0O
Contig/Assembly ProteinTUBA3Ctubulin alpha-3C/D chain [Homo sapiens]. 8470.0O
Contig/Assembly ProteinTUBA3Dtubulin alpha-3C/D chain [Homo sapiens]. 8470.0O
Contig/Assembly ProteinTUBA3Etubulin alpha-3E chain [Homo sapiens]. 8370.0O
Contig/Assembly ProteinTUBA4Atubulin alpha-4A chain [Homo sapiens]. 8340.0O
Contig/Assembly ProteinTUBA8tubulin alpha-8 chain isoform 1 [Homo sapiens]. 7860.0O
Contig/Assembly ProteinTUBA8tubulin alpha-8 chain isoform 2 [Homo sapiens]. 6810.0O
Contig/Assembly ProteinTUBAL3tubulin alpha chain-like 3 isoform 1 [Homo sapiens]. 6660.0O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTuba1atubulin alpha-1A chain [Mus musculus]. 8540.0O
Contig/Assembly ProteinTuba1ctubulin alpha-1C chain [Mus musculus]. 8510.0O
Contig/Assembly ProteinTuba1btubulin alpha-1B chain [Mus musculus]. 8500.0O
Contig/Assembly ProteinTuba3atubulin alpha-3 chain [Mus musculus]. 8470.0O
Contig/Assembly ProteinTuba3btubulin alpha-3 chain [Mus musculus]. 8470.0O
Contig/Assembly ProteinTuba4atubulin alpha-4A chain [Mus musculus]. 8340.0O
Contig/Assembly ProteinGm5620PREDICTED: tubulin alpha-1B chain isoform 1 [Mus musculus]. 8210.0O
Contig/Assembly ProteinGm5620PREDICTED: tubulin alpha-1B chain isoform 4 [Mus musculus]. 8210.0O
Contig/Assembly ProteinTuba8tubulin alpha-8 chain [Mus musculus]. 7860.0O
Contig/Assembly ProteinTubal3tubulin alpha chain-like 3 [Mus musculus]. 6660.0O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 13 [Canis familiaris]. 8540.0O
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 12 [Canis familiaris]. 8540.0O
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 1 [Canis familiaris]. 8540.0O
Contig/Assembly ProteinLOC608138PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) isoform 2 [Canis familiaris]. 8490.0O
Contig/Assembly ProteinLOC608864PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) [Canis familiaris]. 8480.0
Contig/Assembly ProteinLOC608051PREDICTED: similar to Tubulin alpha-3 chain (Alpha-tubulin 3) isoform 1 [Canis familiaris]. 8470.0O
Contig/Assembly ProteinLOC477570PREDICTED: similar to Tubulin alpha-3 chain (Alpha-tubulin 3) [Canis familiaris]. 8470.0O
Contig/Assembly ProteinLOC610636PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) [Canis familiaris]. 8450.0O
Contig/Assembly ProteinLOC478918PREDICTED: similar to Tubulin alpha-4 chain (Alpha-tubulin 4) (Alpha-tubulin isotype M-alpha-4) isoform 1 [Canis familiaris]. 8340.0O
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 5 [Canis familiaris]. 8330.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBA1Atubulin alpha-1B chain [Bos taurus]. 8540.0O
Contig/Assembly ProteinTUBA1Dtubulin alpha-1D chain [Bos taurus]. 8530.0O
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Bos taurus]. 8500.0O
Contig/Assembly ProteinTUBA1Ctubulin alpha-1C chain [Bos taurus]. 8480.0O
Contig/Assembly ProteinLOC100295712PREDICTED: GL12416-like [Bos taurus]. 8470.0O
Contig/Assembly ProteinLOC100295712PREDICTED: GL12416-like [Bos taurus]. 8470.0O
Contig/Assembly ProteinTUBA3Etubulin alpha-3 chain [Bos taurus]. 8450.0O
Contig/Assembly ProteinLOC100141266PREDICTED: tubulin alpha-1C chain-like [Bos taurus]. 8450.0O
Contig/Assembly ProteinLOC787568PREDICTED: tubulin alpha-1C chain-like isoform 1 [Bos taurus]. 8450.0O
Contig/Assembly ProteinLOC787568PREDICTED: tubulin alpha-1C chain-like [Bos taurus]. 8430.0O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Sus scrofa]. 8500.0O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 1 [Sus scrofa]. 8480.0O
Contig/Assembly ProteinLOC100510930PREDICTED: tubulin alpha-3 chain-like [Sus scrofa]. 8470.0O
Contig/Assembly ProteinTUBA3DPREDICTED: tubulin alpha-3 chain [Sus scrofa]. 8470.0O
Contig/Assembly ProteinTUBA1APREDICTED: tubulin alpha-1D chain [Sus scrofa]. 8460.0O
Contig/Assembly ProteinTUBA4APREDICTED: tubulin alpha-4A chain [Sus scrofa]. 8340.0O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 3 [Sus scrofa]. 7710.0O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 2 [Sus scrofa]. 7710.0O
Contig/Assembly ProteinLOC100621514PREDICTED: tubulin alpha-8 chain-like [Sus scrofa]. 6740.0
Contig/Assembly ProteinLOC100623355PREDICTED: tubulin alpha chain-like 3-like [Sus scrofa]. 6560.0O


Assembly Members: 181      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010047D02ADR01_0047_D02.bDB785670 
ADR010061E07ADR01_0061_E07.bDB786951 
ADR010076E05ADR01_0076_E05.bDB788257 
ADR010089D12ADR01_0089_D12.bDB789404 
AMP010004G12AMP01_0004_G12.bBW955271 AK389611
AMP010004H06AMP01_0004_H06.bBW955276 
AMP010035H01AMP01_0035_H01.bBW957561 
AMP010086A04AMP01_0086_A04.bBW961225 
AMP010094B04AMP01_0094_B04.bBW961916 
AMP010097D05AMP01_0097_D05.bBW962209 
AMP010099G04AMP01_0099_G04.bBW962418 
BFLT10002D06BFLT1_0002_D06.bFS640121 
BFLT10004A07BFLT1_0004_A07.bFS640254 
BFLT10035F04BFLT1_0035_F04.bFS642876 
BFLT10043H05BFLT1_0043_H05.bFS643463 
BFLT10054F01BFLT1_0054_F01.bFS644287 
BFLT10063D01BFLT1_0063_D01.bFS644997 
BFLT10069F07BFLT1_0069_F07.bFS645510 
BFLT10070A01BFLT1_0070_A01.bFS645533 
BFLT10072E06BFLT1_0072_E06.bFS645726 
BFLT10079D11BFLT1_0079_D11.bFS646241 
BFLT10087F11BFLT1_0087_F11.bFS646914 
BFLT10088F02BFLT1_0088_F02.bFS646993 
BFLT10091C02BFLT1_0091_C02.bFS647208 
BFLT10095C03BFLT1_0095_C03.bFS647541 
BFLT10110D05BFLT1_0110_D05.bHX202562 
BFLT10110E03BFLT1_0110_E03.bHX202572 
BFLT10110F05BFLT1_0110_F05.bHX202585 
BFLT10113G03BFLT1_0113_G03.bHX202841 
BFLT10125D12BFLT1_0125_D12.bHX203801 
BFLT10126D04BFLT1_0126_D04.bHX203878 
BFLT10136A10BFLT1_0136_A10.b  
BFLT10142E11BFLT1_0142_E11.bHX205006 
BFLT10145B06BFLT1_0145_B06.bHX205163 
BFLT10150D03BFLT1_0150_D03.bHX205463 
BFLT10151G01BFLT1_0151_G01.bHX205557 
BFLT10152D06BFLT1_0152_D06.bHX205607 
BKFL10077B04BKFL1_0077_B04.bFS653192 
CBLT10019F11CBLT1_0019_F11.bHX213185 
CBLT10021H01CBLT1_0021_H01.bHX213340 
CBLT10023B03CBLT1_0023_B03.bHX213423 
CBLT10026A09CBLT1_0026_A09.bHX213648 
CBLT10040F05CBLT1_0040_F05.bHX214567 
CBLT10044H05CBLT1_0044_H05.bHX214821 
CBLT10045E03CBLT1_0045_E03.bHX214857 
CBLT10048D10CBLT1_0048_D10.bHX215026 
CBLT10051A12CBLT1_0051_A12.bHX215208 
CBLT10059A01CBLT1_0059_A01.bHX215812 
CBLT10059D09CBLT1_0059_D09.bHX215838 
CBLT10059G06CBLT1_0059_G06.bHX215864 
CBLT10069D11CBLT1_0069_D11.bHX216646 
CBLT10087C11CBLT1_0087_C11.bHX218047 
CBLT10095D07CBLT1_0095_D07.bHX218724 
DCI010002F04DCI01_0002_F04.bDB790724 
DCI010004D12DCI01_0004_D12.bDB790850 
DCI010021A01DCI01_0021_A01.bDB792128 
DCI010021D08DCI01_0021_D08.bDB792168 
DCI010022G05DCI01_0022_G05.bDB792290 
DCI010023B02DCI01_0023_B02.bDB792322 
DCI010024E07DCI01_0024_E07.bDB792450 
DCI010027H06DCI01_0027_H06.bDB792753 
DCI010035F12DCI01_0035_F12.bDB793443 
DCI010041F03DCI01_0041_F03.bDB793858 
DCI010069B04DCI01_0069_B04.bDB795689 
DCI010069C10DCI01_0069_C10.bDB795702 
DCI010080A10DCI01_0080_A10.bDB796638 
DCI010081E05DCI01_0081_E05.bDB796764 
DCI010089C10DCI01_0089_C10.bDB797456 
DCI010091E11DCI01_0091_E11.bDB797655 
DCI010093E05DCI01_0093_E05.bDB797832 
DCI010101E01DCI01_0101_E01.bDB798543 
DCI010101H08DCI01_0101_H08.bDB798583 
DCI010104H10DCI01_0104_H10.bDB798846 
HTMT10015B05HTMT1_0015_B05.bFS665261 AK391677
HTMT10027D01HTMT1_0027_D01.bFS666195 
HTMT10044A09HTMT1_0044_A09.bFS667255 
HTMT10045E11HTMT1_0045_E11.bFS667357 
HTMT10057H05HTMT1_0057_H05.bFS668287 
HTMT10063G08HTMT1_0063_G08.bFS668717 
HTMT10067G02HTMT1_0067_G02.bFS669019 
HTMT10074H08HTMT1_0074_H08.bFS669512 AK392448
HTMT10079C02HTMT1_0079_C02.bFS669798 
HTMT10104H08HTMT1_0104_H08.bHX223532 
HTMT10105E10HTMT1_0105_E10.bHX223573 
HTMT10114G06HTMT1_0114_G06.bHX224243 
HTMT10121F03HTMT1_0121_F03.bHX224639 
HTMT10125C04HTMT1_0125_C04.bHX224839 
HTMT10126H04HTMT1_0126_H04.bHX224944 
HTMT10129E10HTMT1_0129_E10.bHX225107 
HTMT10145G01HTMT1_0145_G01.bHX226251 
HTMT10150B05HTMT1_0150_B05.bHX226546 
HTMT10151C10HTMT1_0151_C10.bHX226624 
ITT010064B08ITT01_0064_B08.bBW981668 
LNG010071A01LNG01_0071_A01.bBP433079 
LNG010095F10LNG01_0095_F10.bBP438774 
OVR010031F08OVR01_0031_F08.bBP143766 
OVR010034C02OVR01_0034_C02.bBP142189 
OVR010038E05OVR01_0038_E05.bBP143214 
OVR010048G09OVR01_0048_G09.bBP144277 
OVR010056B07OVR01_0056_B07.bBW964583 
OVR010073G11OVR01_0073_G11.bBW966147 
OVRM10006B12OVRM1_0006_B12.bBP147302 
OVRM10021H08OVRM1_0021_H08.bBP154457 
OVRM10046A09OVRM1_0046_A09.bBP145709 
OVRM10046C08OVRM1_0046_C08.bBP148128 
OVRM10053H01OVRM1_0053_H01.bBP153698 
OVRM10060G11OVRM1_0060_G11.bBP153479 
OVRM10069F08OVRM1_0069_F08.bBP151900 
OVRM10070F09OVRM1_0070_F09.bBP152008 
OVRM10077H12OVRM1_0077_H12.bBP154937 
OVRM10084E07OVRM1_0084_E07.bBP150559 
OVRM10099B04OVRM1_0099_B04.bBP146516 
OVRM10101B12OVRM1_0101_B12.bBP147374 
OVRM10107E11OVRM1_0107_E11.bBP151008 
OVRM10113A01OVRM1_0113_A01.bBP144914 
OVRM10117B10OVRM1_0117_B10.bBP147172 
OVRM10118C12OVRM1_0118_C12.bBP148634 
OVRM10130F09OVRM1_0130_F09.bBP152059 
OVRM10156C03OVRM1_0156_C03.bBP456706 AK236136
OVRM10161B02OVRM1_0161_B02.bBP455658 
OVRM10164D01OVRM1_0164_D01.bBP457513 
OVRM10165C09OVRM1_0165_C09.bBP457195 
OVRM10176E11OVRM1_0176_E11.bBP459277 
OVRM10179A06OVRM1_0179_A06.bCJ016118 
OVRM10184H02OVRM1_0184_H02.bBP461485 
OVRM10186E12OVRM1_0186_E12.bBP459358 
OVRM10190C10OVRM1_0190_C10.bBP457287 
OVRM10202H05OVRM1_0202_H05.bBP461721 
OVRM10210E08OVRM1_0210_E08.bBP459079 
OVRM10212F01OVRM1_0212_F01.bBP459468 
OVRM10215B03OVRM1_0215_B03.bBP455784 
OVRM10216D03OVRM1_0216_D03.bBP457706 
OVRM10222B12OVRM1_0222_B12.bBP456523 
OVRM10225E05OVRM1_0225_E05.bBP458848 
OVRT10002G08OVRT1_0002_G08.bFS686569 
OVRT10030D04OVRT1_0030_D04.bFS688829 
OVRT10030E01OVRT1_0030_E01.bFS688837 
OVRT10030F07OVRT1_0030_F07.bFS688854 
OVRT10099H03OVRT1_0099_H03.bFS694526 
OVRT10105E01OVRT1_0105_E01.bHX235197 
OVRT10122E02OVRT1_0122_E02.bHX236591 
OVRT10124F07OVRT1_0124_F07.bHX236760 
OVRT10125D04OVRT1_0125_D04.bHX236811 
OVRT10127D10OVRT1_0127_D10.bHX236976 
OVRT10129H10OVRT1_0129_H10.bHX237185 
OVRT10145F01OVRT1_0145_F01.bHX238455 
PCT010035A07PCT01_0035_A07.bFS696929 
PST010037F01PST01_0037_F01.bFS699745 
PTG010052G03PTG01_0052_G03.bFS709032 
SMG010069D09SMG01_0069_D09.bFS719227 
SPL010009F06SPL01_0009_F06.bBP158518 
SPL010041G06SPL01_0041_G06.bBP158880 
SPL010043D02SPL01_0043_D02.bCJ016877 
SPL010052F08SPL01_0052_F08.bCJ017720 
SPL010060E03SPL01_0060_E03.bCJ018419 
SPL010098G07SPL01_0098_G07.bCJ021871 
SPLT10043A04SPLT1_0043_A04.bHX242512 
TCH010034B04TCH01_0034_B04.bCJ024936 
TCH010073B05TCH01_0073_B05.bCJ027668 
TCH010075E04TCH01_0075_E04.bCJ027847 
TCH010091A05TCH01_0091_A05.bCJ029039 
TCH010093E02TCH01_0093_E02.bCJ029229 
TES010005H09TES01_0005_H09.bCJ030360 
TES010013A04TES01_0013_A04.bCJ030838 
TES010037D01TES01_0037_D01.b  
TES010045H03TES01_0045_H03.bCJ032932 
TES010066G05TES01_0066_G05.bCJ034274 
TES010073G04TES01_0073_G04.bCJ034730 
TES010075F08TES01_0075_F08.bCJ034840 
TES010080E01TES01_0080_E01.bCJ035159 
TES010084A10TES01_0084_A10.bCJ035403 
TES010085H12TES01_0085_H12.bCJ035527 
TES010086C11TES01_0086_C11.bCJ035554 
TES010088F11TES01_0088_F11.bCJ035712 
TES010089D11TES01_0089_D11.bCJ035768 
TES010089E10TES01_0089_E10.bCJ035777 
TES010091A05TES01_0091_A05.bCJ035862 
TES010109E01TES01_0109_E01.bCJ037202 
TES010111A09TES01_0111_A09.bCJ037296 
THY010070G11THY01_0070_G11.bBP167944 
UTR010014E01UTR01_0014_E01.bBP171509 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
411C0120.072MSATC/I
T141130.928ATT/I


Alignment:      TOP

20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
AMP01_0004_H06.b : atttaacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_G12.b : nataccgtacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_D05.b : gcgataaatacxxxx
AMP01_0094_B04.b : gcatxxxxxxxxxx
OVR01_0031_F08.b :
DCI01_0069_B04.b : nnaaa
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
AMP01_0004_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_F08.b :
DCI01_0069_B04.b : aggatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b : naaaatatctaaxxxxxxxxxx
DCI01_0101_E01.b : nnttatcgtatcctaaxxxxxxxxxxxx
OVRM1_0212_F01.b :
DCI01_0027_H06.b : nnnaacgatacaaxxxxxxxxxxx
OVRM1_0117_B10.b :
DCI01_0021_D08.b : nnnaaactaacaxxxxxxxxxxxx
CBLT1_0023_B03.b :
DCI01_0041_F03.b : nnnggatactaaxxxxxxxxx
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b : nnnnttaggatactaaxxxxxxxxxx
BFLT1_0079_D11.b :
DCI01_0022_G05.b : nnnaacgtaacaaxxxxxxxxx
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b : atcactatagncgatacttngggctxxxxx
SPL01_0052_F08.b :
DCI01_0024_E07.b : nnttacgtaacaaxxxxxxxxxxx
DCI01_0004_D12.b : aaacctatggcgtatccttaxxxxxxxxxxx
HTMT1_0145_G01.b :
DCI01_0104_H10.b : nnnaaaacgaaccatxxxxxxxxxxxx
BKFL1_0077_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0080_A10.b : nnngactaaannnntacgatactaaxxxxxxxxx
DCI01_0093_E05.b : nnccgatannnnaaacgatatctaagggctgctc
DCI01_0035_F12.b : naacgatctaaxxxxxxxx
OVRM1_0161_B02.b :
DCI01_0023_B02.b : nnnaacgatacaaxxxxxxxx
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b : atctatagggctxxx
DCI01_0101_H08.b : nnnaaccgaatccataxxxxxxxxx
TCH01_0075_E04.b :
AMP01_0099_G04.b : gcggtgaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_C10.b : nntttacgatacaaxxxxxxx
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b : ncccgttaannn
DCI01_0091_E11.b : nnn
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ...........................................CAGATTGAGGGGTCTGG
---------+---------+---------+---------+---------+---------+ 17
AMP01_0004_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTGAGGGGTCTGG
AMP01_0004_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTGAGGGGTCTGG
AMP01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_F08.b : gagagttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0145_B06.b : nnccagccgtcagcgcaggcaggxxxxxxxxxxxxxx
ADR01_0076_E05.b : nnaaagggata
BFLT1_0091_C02.b : ngggatcgtatagctgtangagtgxxxx
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b : t
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : tttttaggataggactaanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b : ctxxxxxx
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b : nnnccctttcnn
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b : nntttcttn
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b : ggaggacttatggtgca
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b : nnnng
HTMT1_0057_H05.b :
DCI01_0021_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0212_F01.b :
DCI01_0027_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B10.b :
DCI01_0021_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0023_B03.b :
DCI01_0041_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0079_D11.b :
DCI01_0022_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_A09.b :
OVR01_0048_G09.b : agaacatt
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_F08.b : nnnng
DCI01_0024_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0145_G01.b :
DCI01_0104_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0077_B04.b : nnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0161_B02.b :
DCI01_0023_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0075_E04.b :
AMP01_0099_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : agggxxxxxxxx
OVR01_0073_G11.b : agcaxxx
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : nnnng
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : nnntt
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : aaaccttat
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b : nnnggcttggact
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b : nnn
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b : nnccgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_E11.b : nngggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_H01.b : tgaaaccttaagccgtacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ACCAACAGGAAAAGGCCCCTGCCCATCCCCATGGTGACCGAGTTGTATATAGGGAGCTGC
---------+---------+---------+---------+---------+---------+ 77
AMP01_0004_H06.b : ACCAACAGGAAAAGGCCCCTGCCCATCCCCATGGTGACCGAGTTGTATATAGGGAGCTGC
AMP01_0004_G12.b : ACCAACAGGAAAAGGCCCCTGCCCATCCCCATGGTGACCGAGTTGTATATAGGGAGCTGC
AMP01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGGTGACCGAGTTGTATATAGGGAGCTGC
AMP01_0094_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGGTGACCGAGTTGTATATAGGGAGCTGC
OVR01_0031_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCGAGTTGTATATAGGGAGCTGC
DCI01_0069_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCGAGTTGTATATAGGGAGCTGC
BFLT1_0145_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggaCGAGTTGTATATAGGGAGCTGC
ADR01_0076_E05.b : aagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAGGGAGCTGC
BFLT1_0091_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAGGGAGCTGC
PCT01_0035_A07.b : nnnggggatgttatnnn
TES01_0088_F11.b :
SPLT1_0043_A04.b : nnnaaggacagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0109_E01.b : ttttcc
OVRT1_0105_E01.b : nnnccgttcgcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_D01.b : tttttcgacggtagacgcagtagtaxxxxxxxxxxxxxxxxxxxxx
HTMT1_0129_E10.b : ttttagacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0095_D07.b : nnnnggagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0048_D10.b : ntttcccagtgagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0069_F07.b : ngaatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_H08.b : nttttcgatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0150_B05.b : ttttggcaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_F03.b : nnnnccgagagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0073_B05.b : ggtngggctggactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0069_D11.b : nntttcgacggtagaggcagtagtaxxxxxxxxxxxxxxxxxxxx
CBLT1_0044_H05.b : nnncccaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0125_C04.b : tttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0079_C02.b : tttnnggaagagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0089_D12.b : nnggtttaannnnnggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_A09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0006_B12.b : agatagtcgaaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0073_G04.b : ttttcct
OVRM1_0179_A06.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_H01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_H02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0190_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0021_H08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0070_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0086_C11.b : tttt
OVRT1_0124_F07.b : nnnccacgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_E02.b : nnaatctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0150_D03.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0005_H09.b : nttcgc
OVRT1_0129_H10.b : nnnnnncccgttagcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0127_D10.b : nnnccccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0035_F04.b : nggactctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_H03.b : nttttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0145_F01.b : nnngttcgatagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0002_D06.b : nggactcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0072_E06.b : nggaccctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0013_A04.b : nnnn
BFLT1_0054_F01.b : nngggnnnccgttagcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0063_D01.b : nnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0088_F02.b : ggtaaccgttagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0041_G06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_B08.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0110_E03.b : nnccgcgcgtcagcgcaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0091_A05.b : gctaggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0057_H05.b : tttttgacggacgaggccgtaxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0212_F01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0023_B03.b : nnaaaggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_A12.b : ttaaggcaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0114_G06.b : nnnnnggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0059_A01.b : nttttacgaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0045_E11.b : tttggcatagagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0015_B05.b : tttttagaaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_B07.b : ntggcttggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_F05.b : nnnnggacgagtagaggcagtagtattaaxxxxxxxxxxxxx
HTMT1_0074_H08.b : ttttttggagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_E02.b : nnnnggataggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0059_D09.b : ttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0067_G02.b : tttttacgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0079_D11.b : gactccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_A09.b : tttttacgagagaagaggcagtagtattaaxxxxxxxxxxxxxx
OVR01_0048_G09.b : agggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_F07.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0125_D12.b : nnntttcgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_F08.b : gcataggactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0024_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0145_G01.b : ncctcattttttttggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0077_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0161_B02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0021_H01.b : tttgggacagtacgaggcagtagtaxxxxxxxxxxxxxxxxx
CBLT1_0087_C11.b : ttttgcgacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_A09.b : tttttacaggtacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0095_F10.b : ttttttggatggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0151_C10.b : ttttggcaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0075_E04.b : nnnnggctaggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_C03.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0216_D03.b : gagctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0176_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0034_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0164_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0061_E07.b : cagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0165_C09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_E03.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_E08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0215_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0071_A01.b : ttgttggacaaanacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_B12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_E11.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_E12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_H12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0038_E05.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0151_G01.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0152_D06.b : nnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0087_F11.b : ggaatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0110_F05.b : nnccggtcgtctgcgcaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_D04.b : nncccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_G07.b : taaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_G08.b : naaatcgtctagctnacngagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0070_A01.b : gaattcctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_G03.b : ttttttgataaagcagcxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0095_C03.b : ggaccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_D02.b : ntttaaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0043_H05.b : gggattcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0126_D04.b : nnnnncctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_E01.b : tttttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_B04.b : nggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_A07.b : nggatacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_D04.b : nnnnncgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_A01.b : tagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0085_H12.b :
TES01_0089_E10.b : t
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b : ttt
TES01_0080_E01.b : n
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b : tt
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b : nnnttccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0019_F11.b : ttttg
THY01_0070_G11.b : cxxxxxxxxxxxxxxxxxx
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GTCCGCCCATGTGCGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
---------+---------+---------+---------+---------+---------+ 136
AMP01_0004_H06.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
AMP01_0004_G12.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
AMP01_0097_D05.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
AMP01_0094_B04.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0031_F08.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0069_B04.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0145_B06.b : GTCCGCCCATGTCCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
ADR01_0076_E05.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0091_C02.b : GTCCGCCCATGTGCCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
PCT01_0035_A07.b : nncctacgtTGTGCCGGNAGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0088_F11.b : ntcacgttggctcTGGGCAGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPLT1_0043_A04.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0109_E01.b : taactgttgctatgGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0105_E01.b : xxxxxxxxxxxxtgGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0027_D01.b : xxxxxxxxxxxxxxGGCAGGTCCTTTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0129_E10.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0095_D07.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*TACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0048_D10.b : xxxxxxxxxxxxaaGGCAGGTTCTCTCACTTC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0069_F07.b : xxxxxxxxxxxxxaCGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0104_H08.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0150_B05.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0121_F03.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TCH01_0073_B05.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0069_D11.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0044_H05.b : xxxxxxxxxxxxaaGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0125_C04.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0079_C02.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
ADR01_0089_D12.b : xxxxxxxxxxxxxxGGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0046_A09.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATT*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0225_E05.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0006_B12.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0043_D02.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAAAGTCGCGCTGTAAGAA
TES01_0073_G04.b : acgttggctacggctGGCAGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0179_A06.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0053_H01.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0184_H02.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0118_C12.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0190_C10.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0021_H08.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0070_F09.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0086_C11.b : actgcggttgctatgGGCAGGTCTCTTACATC*GACCGCTTA*GAGTCGCGCTGTAAGAA
OVRT1_0124_F07.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0122_E02.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0009_F06.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0150_D03.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0005_H09.b : gttggctactgggatGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0129_H10.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0127_D10.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0035_F04.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0099_H03.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0145_F01.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0002_D06.b : xxxxxxxxxxxxxxtGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0072_E06.b : xxxxxxxxxxxxxxtGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0013_A04.b : actacggtggctctgGGCAGTTCTCTTA*ATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0054_F01.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0063_D01.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0088_F02.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0041_G06.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
ITT01_0064_B08.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0110_E03.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TCH01_0091_A05.b : xxxxxxxxxxxxxxxGCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0057_H05.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0021_A01.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0101_E01.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0212_F01.b : xxxxxxxxxxxxxxxgGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0027_H06.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCCGTAAGAA
OVRM1_0117_B10.b : xxxxxxxxxxxxxxxgGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0021_D08.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0023_B03.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*TACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0041_F03.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0051_A12.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0114_G06.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0059_A01.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACCTC*TACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0045_E11.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0015_B05.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0056_B07.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0040_F05.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATCTTACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0074_H08.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TCH01_0093_E02.b : xxxxxxxxxxxxxxxaCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0059_D09.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*TACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0067_G02.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0089_C10.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0079_D11.b : xxxxxxxxxxxxxggtCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0022_G05.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0044_A09.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0048_G09.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0030_F07.b : xxxxxxxxxxxxxxxtCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0125_D12.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0002_F04.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0052_F08.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0024_E07.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0004_D12.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0145_G01.b : xxxxxxxxxxxxxxxxGAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0104_H10.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BKFL1_0077_B04.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0080_A10.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0093_E05.b : xxxxxxxxxxxxxxxxCAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0035_F12.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0161_B02.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0023_B02.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0021_H01.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*TACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0087_C11.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
CBLT1_0026_A09.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GATCGCTTAAGAGTCGCGCTGTAAGAA
LNG01_0095_F10.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
HTMT1_0151_C10.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
AMP01_0086_A04.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0101_H08.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TCH01_0075_E04.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
AMP01_0099_G04.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0069_C10.b : xxxxxxxxxxxxxxxxxAGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0156_C03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0216_D03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0176_E11.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0034_C02.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0073_G11.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0222_B12.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0164_D01.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
ADR01_0061_E07.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0046_C08.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0060_G11.b : xxxxxxxxxxxxxxxxxgGGCTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0165_C09.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0060_E03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0210_E08.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0099_B04.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0215_B03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0084_E07.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0130_F09.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0069_F08.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
LNG01_0071_A01.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0101_B12.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0202_H05.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0107_E11.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0186_E12.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0077_H12.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVR01_0038_E05.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0151_G01.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0152_D06.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0087_F11.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCCGTAAGAA
BFLT1_0110_F05.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0125_D04.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
SPL01_0098_G07.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0002_G08.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0070_A01.b : xxxxxxxxxxxxxxcggtGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
PTG01_0052_G03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0095_C03.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
ADR01_0047_D02.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GGCCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0043_H05.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0126_D04.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0030_E01.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TCH01_0034_B04.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTATAAGAA
BFLT1_0004_A07.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRT1_0030_D04.b : xxxxxxxxxxxxxxxxxxGGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
OVRM1_0113_A01.b : xxxxxxxxxxxxxxxxxxcGTTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0085_H12.b : ntggcagtggctatggagGTTCCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0089_E10.b : ttttctggcgttgctatggaGTTCCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0066_G05.b : ntctactgtggctctggagGTTCCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
PST01_0037_F01.b : tagctgtggctctggaGTTCCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0089_D11.b : ttcctacggttgctactggaGTTCCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0080_E01.b : tttactacagtggctatggagTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0084_A10.b : tttcctgctgttgcactggagTCTCTTAC*TC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0037_D01.b : cgttggctatggaggTCTCTTACATC*GACCGCTTA*GAGTCGCGCTGTAAGAA
TES01_0111_A09.b : cctgcgttggctactgcgcagTCTCTTACATC*GACCGCTTAAGAGTCGCGCTGTAAGAA
TES01_0045_H03.b : tacgttggctatggaggTCTCTTACATC*GACCGCTTA*GAGTCGCGCTGTAAGAA
TES01_0075_F08.b : ttttcgctgtggctctgagttccttCTC*GACCGCTTAAGAGTCGCGCTGTAAGAA
BFLT1_0113_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCGCTTAAGAGTCGCGCTGTAAGAA
DCI01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAAGAGTCGCGCTGTAAGAA
DCI01_0091_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccTAAGAGTCGCGCTGTAAGAA
AMP01_0035_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTAAGAA
CBLT1_0019_F11.b : gacggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAAGAA
THY01_0070_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0069_D09.b : tccaannnggctatagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0126_H04.b : ttttaagacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0091_A05.b : tttnncttgctg
BFLT1_0110_D05.b : nnnngctcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0142_E11.b : nnnggctctcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
---------+---------+---------+---------+---------+---------+ 196
AMP01_0004_H06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0004_G12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0097_D05.b : GCAACAACCTCTCTTCTCCGCCATCTACTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0094_B04.b : GCAACAACCTCTCTTCTCCGCCATCTACTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0031_F08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0069_B04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0145_B06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
ADR01_0076_E05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0091_C02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
PCT01_0035_A07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0088_F11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPLT1_0043_A04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0109_E01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0105_E01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0027_D01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0129_E10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0095_D07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0048_D10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0069_F07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0104_H08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0150_B05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0121_F03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TCH01_0073_B05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0069_D11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0044_H05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0125_C04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0079_C02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
ADR01_0089_D12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0046_A09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0225_E05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0006_B12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0043_D02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0073_G04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0179_A06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0053_H01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0184_H02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0118_C12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0190_C10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0021_H08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAATACAGCAACTATGCGTGAGT
OVRM1_0070_F09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACGGCAACTATGCGTGAGT
TES01_0086_C11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0124_F07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0122_E02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0009_F06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0150_D03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0005_H09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0129_H10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0127_D10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0035_F04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0099_H03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0145_F01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0002_D06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0072_E06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0013_A04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0054_F01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0063_D01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0088_F02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0041_G06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
ITT01_0064_B08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0110_E03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TCH01_0091_A05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0057_H05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0021_A01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0101_E01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0212_F01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0027_H06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0117_B10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0021_D08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0023_B03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0041_F03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0051_A12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0114_G06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0059_A01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0045_E11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0015_B05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0056_B07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0040_F05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0074_H08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TCH01_0093_E02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0059_D09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0067_G02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0089_C10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0079_D11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0022_G05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0044_A09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0048_G09.b : GCAACAACCCCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0030_F07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0125_D12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0002_F04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0052_F08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0024_E07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0004_D12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0145_G01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0104_H10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BKFL1_0077_B04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0080_A10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0093_E05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0035_F12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGCGAGT
OVRM1_0161_B02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0023_B02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0021_H01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0087_C11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0026_A09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
LNG01_0095_F10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0151_C10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0086_A04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0101_H08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TCH01_0075_E04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0099_G04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0069_C10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0156_C03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0216_D03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0176_E11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0034_C02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0073_G11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0222_B12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0164_D01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
ADR01_0061_E07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0046_C08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0060_G11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0165_C09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0060_E03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0210_E08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0099_B04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0215_B03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0084_E07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0130_F09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0069_F08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
LNG01_0071_A01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0101_B12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0202_H05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0107_E11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0186_E12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0077_H12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVR01_0038_E05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0151_G01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGGGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0152_D06.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0087_F11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0110_F05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0125_D04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SPL01_0098_G07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0002_G08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0070_A01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
PTG01_0052_G03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0095_C03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
ADR01_0047_D02.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0043_H05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0126_D04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0030_E01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TCH01_0034_B04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0004_A07.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRT1_0030_D04.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
OVRM1_0113_A01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0085_H12.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0089_E10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0066_G05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
PST01_0037_F01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0089_D11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0080_E01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0084_A10.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0037_D01.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0111_A09.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0045_H03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0075_F08.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0113_G03.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0081_E05.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
DCI01_0091_E11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
AMP01_0035_H01.b : GCAGCAACCTCCCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
CBLT1_0019_F11.b : GCAACAACCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
THY01_0070_G11.b : xxxxxxxxCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
SMG01_0069_D09.b : xxxxxxxxCTCTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0126_H04.b : xxxxxxxxxxxTCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
TES01_0091_A05.b : ttgctctggctcCTTCTCCGCCATCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0110_D05.b : xxxxxxxxxxxxxxxxxxxxxxxTCTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
BFLT1_0142_E11.b : xxxxxxxxxxxxxxxxxxxxxccttTGCTCGGCGCCGCAAAACAGCAACTATGCGTGAGT
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
---------+---------+---------+---------+---------+---------+ 255
AMP01_0004_H06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0004_G12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0097_D05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0094_B04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0031_F08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0069_B04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0145_B06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
ADR01_0076_E05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0091_C02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
PCT01_0035_A07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0088_F11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPLT1_0043_A04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0109_E01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0105_E01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0027_D01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0129_E10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0095_D07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0048_D10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0069_F07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0104_H08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0150_B05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0121_F03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TCH01_0073_B05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0069_D11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0044_H05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0125_C04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0079_C02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
ADR01_0089_D12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0046_A09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0225_E05.b : GCACCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0006_B12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGATAGCTC
SPL01_0043_D02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0073_G04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0179_A06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0053_H01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0184_H02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0118_C12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0190_C10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0021_H08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0070_F09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0086_C11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0124_F07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0122_E02.b : GCATCTCCAACCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPL01_0009_F06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0150_D03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0005_H09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0129_H10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0127_D10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0035_F04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0099_H03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0145_F01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0002_D06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0072_E06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0013_A04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0054_F01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0063_D01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0088_F02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPL01_0041_G06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
ITT01_0064_B08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0110_E03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TCH01_0091_A05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0057_H05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0021_A01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0101_E01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0212_F01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0027_H06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0117_B10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0021_D08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0023_B03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0041_F03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0051_A12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0114_G06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0059_A01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0045_E11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0015_B05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0056_B07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0040_F05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0074_H08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TCH01_0093_E02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0059_D09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0067_G02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0089_C10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0079_D11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0022_G05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0044_A09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0048_G09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0030_F07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0125_D12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0002_F04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPL01_0052_F08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0024_E07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0004_D12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0145_G01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0104_H10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BKFL1_0077_B04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0080_A10.b : GCATCTCCATCCACGTTGGCCAAGCCGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0093_E05.b : GCATCTCCATCCACGTTGGCCAAGCCGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0035_F12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0161_B02.b : GCGTCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0023_B02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0021_H01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0087_C11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0026_A09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
LNG01_0095_F10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0151_C10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0086_A04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0101_H08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TCH01_0075_E04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0099_G04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0069_C10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0156_C03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0216_D03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0176_E11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0034_C02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0073_G11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0222_B12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0164_D01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
ADR01_0061_E07.b : GCATCTCCACCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0046_C08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0060_G11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0165_C09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPL01_0060_E03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0210_E08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0099_B04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0215_B03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0084_E07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0130_F09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0069_F08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
LNG01_0071_A01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0101_B12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0202_H05.b : GCATCTCCATCCACGTTGGCCAAGCAGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0107_E11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0186_E12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0077_H12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVR01_0038_E05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0151_G01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0152_D06.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0087_F11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0110_F05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0125_D04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SPL01_0098_G07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0002_G08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0070_A01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
PTG01_0052_G03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGCCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0095_C03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
ADR01_0047_D02.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0043_H05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0126_D04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0030_E01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TCH01_0034_B04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGCCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0004_A07.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRT1_0030_D04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
OVRM1_0113_A01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0085_H12.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0089_E10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0066_G05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
PST01_0037_F01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0089_D11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0080_E01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0084_A10.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0037_D01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0111_A09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0045_H03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0075_F08.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0113_G03.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0081_E05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
DCI01_0091_E11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
AMP01_0035_H01.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
CBLT1_0019_F11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
THY01_0070_G11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
SMG01_0069_D09.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0126_H04.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
TES01_0091_A05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0110_D05.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGCCCAGATCGGCAATGCCTGCTGGG*AGCTC
BFLT1_0142_E11.b : GCATCTCCATCCACGTTGGCCAAGCTGGTGTCCAGATCGGCAATGCCTGCTGGG*AGCTC
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
---------+---------+---------+---------+---------+---------+ 314
AMP01_0004_H06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0004_G12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0097_D05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0094_B04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0031_F08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0069_B04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0145_B06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
ADR01_0076_E05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0091_C02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
PCT01_0035_A07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0088_F11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPLT1_0043_A04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0109_E01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0105_E01.b : CACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0027_D01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0129_E10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0095_D07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0048_D10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0069_F07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0104_H08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0150_B05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0121_F03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TCH01_0073_B05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0069_D11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0044_H05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0125_C04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0079_C02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
ADR01_0089_D12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0046_A09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0225_E05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0006_B12.b : TACTGTCTGGAACACGGCATCCAGCCCGATGGCCATATGCCGAGTGACAAGACCATTGG*
SPL01_0043_D02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0073_G04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0179_A06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0053_H01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0184_H02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0118_C12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0190_C10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0021_H08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0070_F09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0086_C11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0124_F07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0122_E02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPL01_0009_F06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0150_D03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0005_H09.b : CACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0129_H10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0127_D10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0035_F04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0099_H03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0145_F01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0002_D06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0072_E06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0013_A04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTAG*
BFLT1_0054_F01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0063_D01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0088_F02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPL01_0041_G06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
ITT01_0064_B08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0110_E03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TCH01_0091_A05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0057_H05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0021_A01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0101_E01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0212_F01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0027_H06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0117_B10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0021_D08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0023_B03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0041_F03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0051_A12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0114_G06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0059_A01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0045_E11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0015_B05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0056_B07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0040_F05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0074_H08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TCH01_0093_E02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0059_D09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0067_G02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0089_C10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0079_D11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0022_G05.b : TACTGCCTGGAACACGGCATCCAGTCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0044_A09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0048_G09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0030_F07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0125_D12.b : TACTGCCTGGAACACGGCATTCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0002_F04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPL01_0052_F08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0024_E07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0004_D12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0145_G01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0104_H10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BKFL1_0077_B04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0080_A10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0093_E05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0035_F12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTG**
OVRM1_0161_B02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0023_B02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0021_H01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0087_C11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0026_A09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
LNG01_0095_F10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0151_C10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0086_A04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0101_H08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TCH01_0075_E04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0099_G04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0069_C10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0156_C03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0216_D03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0176_E11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0034_C02.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0073_G11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0222_B12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0164_D01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
ADR01_0061_E07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0046_C08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0060_G11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0165_C09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPL01_0060_E03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0210_E08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0099_B04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0215_B03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0084_E07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0130_F09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGGN
OVRM1_0069_F08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
LNG01_0071_A01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0101_B12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0202_H05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0107_E11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0186_E12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0077_H12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVR01_0038_E05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0151_G01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0152_D06.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0087_F11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0110_F05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0125_D04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
SPL01_0098_G07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0002_G08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0070_A01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
PTG01_0052_G03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACATGACCATTGG*
BFLT1_0095_C03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
ADR01_0047_D02.b : TACTGCCTGGAACACGGCTTCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0043_H05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0126_D04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0030_E01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TCH01_0034_B04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0004_A07.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRT1_0030_D04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
OVRM1_0113_A01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0085_H12.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0089_E10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0066_G05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
PST01_0037_F01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0089_D11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0080_E01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0084_A10.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0037_D01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0111_A09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0045_H03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0075_F08.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0113_G03.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0081_E05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
DCI01_0091_E11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
AMP01_0035_H01.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
CBLT1_0019_F11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
THY01_0070_G11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACTAGACCATTGG*
SMG01_0069_D09.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0126_H04.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
TES01_0091_A05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0110_D05.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
BFLT1_0142_E11.b : TACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGCCGAGTGACAAGACCATTGG*
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
---------+---------+---------+---------+---------+---------+ 374
AMP01_0004_H06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0004_G12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0097_D05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0094_B04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0031_F08.b : GGGAGGAGATGACCCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0069_B04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0145_B06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
ADR01_0076_E05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0091_C02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
PCT01_0035_A07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0088_F11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPLT1_0043_A04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0109_E01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0105_E01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0027_D01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0129_E10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0095_D07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0048_D10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0069_F07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0104_H08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0150_B05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0121_F03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TCH01_0073_B05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0069_D11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0044_H05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0125_C04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0079_C02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
ADR01_0089_D12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0046_A09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0225_E05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0006_B12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0043_D02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0073_G04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0179_A06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0053_H01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0184_H02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0118_C12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0190_C10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0021_H08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0070_F09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0086_C11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0124_F07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0122_E02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0009_F06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0150_D03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0005_H09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0129_H10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0127_D10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0035_F04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0099_H03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0145_F01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0002_D06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0072_E06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0013_A04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0054_F01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0063_D01.b : GGGAGGAGATGACTCCTTCAGCACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0088_F02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0041_G06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
ITT01_0064_B08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0110_E03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TCH01_0091_A05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0057_H05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0021_A01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0101_E01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0212_F01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0027_H06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0117_B10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0021_D08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0023_B03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0041_F03.b : GGGAGGAGATGACTCCTTCAACACCTTCT*CAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0051_A12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0114_G06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0059_A01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0045_E11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0015_B05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0056_B07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0040_F05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0074_H08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TCH01_0093_E02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0059_D09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0067_G02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0089_C10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCCAGCATGTGCC
BFLT1_0079_D11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0022_G05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0044_A09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0048_G09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0030_F07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0125_D12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0002_F04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0052_F08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0024_E07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0004_D12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0145_G01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0104_H10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGTCAGGCGCTGGCAAGCATGTGCC
BKFL1_0077_B04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0080_A10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0093_E05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0035_F12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0161_B02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0023_B02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0021_H01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0087_C11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0026_A09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
LNG01_0095_F10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0151_C10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0086_A04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0101_H08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TCH01_0075_E04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0099_G04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0069_C10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0156_C03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0216_D03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0176_E11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0034_C02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0073_G11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0222_B12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0164_D01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
ADR01_0061_E07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0046_C08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0060_G11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0165_C09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0060_E03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0210_E08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0099_B04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0215_B03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0084_E07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0130_F09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0069_F08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
LNG01_0071_A01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0101_B12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0202_H05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0107_E11.b : GGGAGGAGATGACTCCTTCAACATCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0186_E12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0077_H12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVR01_0038_E05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0151_G01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0152_D06.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0087_F11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0110_F05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0125_D04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SPL01_0098_G07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0002_G08.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0070_A01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
PTG01_0052_G03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0095_C03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
ADR01_0047_D02.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0043_H05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0126_D04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0030_E01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TCH01_0034_B04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0004_A07.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRT1_0030_D04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
OVRM1_0113_A01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0085_H12.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0089_E10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0066_G05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
PST01_0037_F01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0089_D11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0080_E01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0084_A10.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0037_D01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0111_A09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0045_H03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0075_F08.b : GGGAGGAGATGGCTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0113_G03.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0081_E05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
DCI01_0091_E11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
AMP01_0035_H01.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
CBLT1_0019_F11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
THY01_0070_G11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
SMG01_0069_D09.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0126_H04.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
TES01_0091_A05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0110_D05.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
BFLT1_0142_E11.b : GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACAGGCGCTGGCAAGCATGTGCC
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
---------+---------+---------+---------+---------+---------+ 434
AMP01_0004_H06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0004_G12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0097_D05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0094_B04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVR01_0031_F08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0069_B04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0145_B06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
ADR01_0076_E05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0091_C02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
PCT01_0035_A07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0088_F11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SPLT1_0043_A04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0109_E01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0105_E01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0027_D01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0129_E10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0095_D07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0048_D10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0069_F07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0104_H08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0150_B05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0121_F03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TCH01_0073_B05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0069_D11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0044_H05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0125_C04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0079_C02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
ADR01_0089_D12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0046_A09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0225_E05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0006_B12.b : CAGGGCAGTGTTTGTAGACCTGTAACCCACAGCTATTGATGAAGTTCGCACTGGCACCTA
SPL01_0043_D02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0073_G04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0179_A06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0053_H01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0184_H02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0118_C12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0190_C10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0021_H08.b : CAGGGCAGTGTTTGTAGGCCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0070_F09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0086_C11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0124_F07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0122_E02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SPL01_0009_F06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0150_D03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0005_H09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0129_H10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0127_D10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0035_F04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0099_H03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0145_F01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0002_D06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0072_E06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0013_A04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0054_F01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0063_D01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0088_F02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SPL01_0041_G06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
ITT01_0064_B08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0110_E03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TCH01_0091_A05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0057_H05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0021_A01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0101_E01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0212_F01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0027_H06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0117_B10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0021_D08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0023_B03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0041_F03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0051_A12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0114_G06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0059_A01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0045_E11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0015_B05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVR01_0056_B07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0040_F05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0074_H08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TCH01_0093_E02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0059_D09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0067_G02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0089_C10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0079_D11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0022_G05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0044_A09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVR01_0048_G09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0030_F07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0125_D12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0002_F04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SPL01_0052_F08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0024_E07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0004_D12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0145_G01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0104_H10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BKFL1_0077_B04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCACTGATGAAGTCCGCACTGGCACCTA
DCI01_0080_A10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0093_E05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0035_F12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0161_B02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0023_B02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0021_H01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0087_C11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0026_A09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
LNG01_0095_F10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0151_C10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0086_A04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0101_H08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TCH01_0075_E04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0099_G04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0069_C10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0156_C03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCAATGAAGTTCGCACTGGCACCTA
OVRM1_0216_D03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCTATGAAGTTCGCACTAGGTCGTA
OVRM1_0176_E11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVR01_0034_C02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVR01_0073_G11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0222_B12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0164_D01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
ADR01_0061_E07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0046_C08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0060_G11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0165_C09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
SPL01_0060_E03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0210_E08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0099_B04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0215_B03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0084_E07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0130_F09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0069_F08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
LNG01_0071_A01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0101_B12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0202_H05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVRM1_0107_E11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0186_E12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0077_H12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
OVR01_0038_E05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0151_G01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0152_D06.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0087_F11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0110_F05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0125_D04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SPL01_0098_G07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0002_G08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0070_A01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
PTG01_0052_G03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0095_C03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
ADR01_0047_D02.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0043_H05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0126_D04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0030_E01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TCH01_0034_B04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0004_A07.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRT1_0030_D04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
OVRM1_0113_A01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGATGAAGTTCGCACTGGCACCTA
TES01_0085_H12.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0089_E10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0066_G05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
PST01_0037_F01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0089_D11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0080_E01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0084_A10.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0037_D01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0111_A09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0045_H03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0075_F08.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0113_G03.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0081_E05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
DCI01_0091_E11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
AMP01_0035_H01.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
CBLT1_0019_F11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
THY01_0070_G11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
SMG01_0069_D09.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0126_H04.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
TES01_0091_A05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0110_D05.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
BFLT1_0142_E11.b : CAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGATGAAGTTCGCACTGGCACCTA
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : tatccacaggagagagaatagtcaaatnnggaaangatct
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
---------+---------+---------+---------+---------+---------+ 494
AMP01_0004_H06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0004_G12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0097_D05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0094_B04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0031_F08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0069_B04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0145_B06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
ADR01_0076_E05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0091_C02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
PCT01_0035_A07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0088_F11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SPLT1_0043_A04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0109_E01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0105_E01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0027_D01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0129_E10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0095_D07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0048_D10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0069_F07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0104_H08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0150_B05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0121_F03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TCH01_0073_B05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0069_D11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0044_H05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0125_C04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0079_C02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
ADR01_0089_D12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0046_A09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0225_E05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0006_B12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAAGAAGATGCTGCCAATAACTA
SPL01_0043_D02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0073_G04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACCGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0179_A06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0053_H01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0184_H02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0118_C12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0190_C10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0021_H08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0070_F09.b : CCGCCAGCTCTTCCACCTTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0086_C11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0124_F07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0122_E02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SPL01_0009_F06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0150_D03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGGAGATGCTGCCAATAACTA
TES01_0005_H09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0129_H10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0127_D10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0035_F04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0099_H03.b : CCGCCAGCTCCTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0145_F01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0002_D06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0072_E06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0013_A04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0054_F01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0063_D01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0088_F02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SPL01_0041_G06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
ITT01_0064_B08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0110_E03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TCH01_0091_A05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0057_H05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTNGCCATAACTA
DCI01_0021_A01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAGGGAAGATGCTGCCAATAACTA
DCI01_0101_E01.b : CCGCCAGCTCTTCCACCCTGGGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0212_F01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0027_H06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0117_B10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGACAAGGAAGATGCTGCCAATAACTA
DCI01_0021_D08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0023_B03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0041_F03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0051_A12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0114_G06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0059_A01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0045_E11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0015_B05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0056_B07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0040_F05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0074_H08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TCH01_0093_E02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0059_D09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0067_G02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0089_C10.b : CCGCTAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0079_D11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0022_G05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0044_A09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0048_G09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0030_F07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0125_D12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0002_F04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SPL01_0052_F08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0024_E07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0004_D12.b : CCGCCAGCTCTTCCACCTTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0145_G01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0104_H10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BKFL1_0077_B04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0080_A10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0093_E05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0035_F12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0161_B02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0023_B02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0021_H01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0087_C11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0026_A09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
LNG01_0095_F10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0151_C10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0086_A04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0101_H08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TCH01_0075_E04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0099_G04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0069_C10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0156_C03.b : CCGCCAGCTCTTCCAGCCAGAGCAACTCATCGCAGGCtatagaacatgcagccaattact
OVRM1_0216_D03.b : CCGCCAGCTCTTCTTCCCTGAGCAGCTCATCACAGGCTAGGAATATGCTGCCActcacta
OVRM1_0176_E11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0034_C02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0073_G11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCTATAACTA
OVRM1_0222_B12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0164_D01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
ADR01_0061_E07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0046_C08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0060_G11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGTTGCTGCCAATAACTA
OVRM1_0165_C09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACGGGCAAGGAAGATGCTGCCAATAACTA
SPL01_0060_E03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0210_E08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0099_B04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0215_B03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0084_E07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0130_F09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0069_F08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGGTGCTGCCAATAACTA
LNG01_0071_A01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0101_B12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0202_H05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0107_E11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0186_E12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0077_H12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVR01_0038_E05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0151_G01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0152_D06.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0087_F11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0110_F05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0125_D04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SPL01_0098_G07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0002_G08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0070_A01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
PTG01_0052_G03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0095_C03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
ADR01_0047_D02.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0043_H05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0126_D04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0030_E01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TCH01_0034_B04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0004_A07.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRT1_0030_D04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
OVRM1_0113_A01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0085_H12.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0089_E10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0066_G05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
PST01_0037_F01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0089_D11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0080_E01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0084_A10.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0037_D01.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0111_A09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0045_H03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0075_F08.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0113_G03.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0081_E05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
DCI01_0091_E11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
AMP01_0035_H01.b : CCGCCAGTTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
CBLT1_0019_F11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
THY01_0070_G11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
SMG01_0069_D09.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0126_H04.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
TES01_0091_A05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0110_D05.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
BFLT1_0142_E11.b : CCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAGGAAGATGCTGCCAATAACTA
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : ccttggaggcggtgtacaacccccacagagaaacaggggtttcattctcttgggcgggca
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
---------+---------+---------+---------+---------+---------+ 554
AMP01_0004_H06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0004_G12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0097_D05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0094_B04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVR01_0031_F08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0069_B04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0145_B06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
ADR01_0076_E05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0091_C02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
PCT01_0035_A07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0088_F11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPLT1_0043_A04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0109_E01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0105_E01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0027_D01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0129_E10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0095_D07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0048_D10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0069_F07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0104_H08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0150_B05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0121_F03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TCH01_0073_B05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0069_D11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0044_H05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0125_C04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0079_C02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
ADR01_0089_D12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0046_A09.b : TGCCCGAGGGCACTACACCATTGGCAAGGAGATCATTGACCTCGTGTTGGACCTAATTCT
OVRM1_0225_E05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0006_B12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGCACCGAATTCT
SPL01_0043_D02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0073_G04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0179_A06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0053_H01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0184_H02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0118_C12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0190_C10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0021_H08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0070_F09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0086_C11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0124_F07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0122_E02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPL01_0009_F06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0150_D03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0005_H09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0129_H10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0127_D10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0035_F04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0099_H03.b : TGCCCGAGGTCACTACACTATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0145_F01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0002_D06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0072_E06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0013_A04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0054_F01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0063_D01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0088_F02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPL01_0041_G06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
ITT01_0064_B08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0110_E03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TCH01_0091_A05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0057_H05.b : TGCCCGAAGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAAATCG
DCI01_0021_A01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0101_E01.b : TGCCCGAAGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0212_F01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0027_H06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGGCCTCGTCTTGGACCGAATTCG
OVRM1_0117_B10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0021_D08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0023_B03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0041_F03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0051_A12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0114_G06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0059_A01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0045_E11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0015_B05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVR01_0056_B07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0040_F05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0074_H08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TCH01_0093_E02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0059_D09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0067_G02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0089_C10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0079_D11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0022_G05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0044_A09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVR01_0048_G09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0030_F07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0125_D12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0002_F04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPL01_0052_F08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0024_E07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0004_D12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0145_G01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0104_H10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BKFL1_0077_B04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0080_A10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0093_E05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0035_F12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCC
OVRM1_0161_B02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0023_B02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0021_H01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0087_C11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0026_A09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
LNG01_0095_F10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0151_C10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0086_A04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0101_H08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAAATTC
TCH01_0075_E04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0099_G04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0069_C10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0156_C03.b : atgcgttaaggtcacgacacctctggtggaggaaatgactggccacataacgtaaccgac
OVRM1_0216_D03.b : ttttcgatgatcacacataactgtttaggagatctaataccacacctcttacataccccc
OVRM1_0176_E11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCA
OVR01_0034_C02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVR01_0073_G11.b : TGCCCGAGGTCACTACACCTTTGGTAAGGAGATCATTGACCTCGTCTTGTACCGAATTCT
OVRM1_0222_B12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0164_D01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
ADR01_0061_E07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0046_C08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0060_G11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0165_C09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPL01_0060_E03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0210_E08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0099_B04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0215_B03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0084_E07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0130_F09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0069_F08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
LNG01_0071_A01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0101_B12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0202_H05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0107_E11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0186_E12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0077_H12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVR01_0038_E05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0151_G01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0152_D06.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0087_F11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0110_F05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0125_D04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SPL01_0098_G07.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0002_G08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0070_A01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
PTG01_0052_G03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0095_C03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
ADR01_0047_D02.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0043_H05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0126_D04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0030_E01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TCH01_0034_B04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0004_A07.b : TGCCCGAGGTCACTACACCACTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRT1_0030_D04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
OVRM1_0113_A01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0085_H12.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0089_E10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0066_G05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
PST01_0037_F01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0089_D11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0080_E01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0084_A10.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0037_D01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0111_A09.b : TGCCCGAGGCCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0045_H03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0075_F08.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0113_G03.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0081_E05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
DCI01_0091_E11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
AMP01_0035_H01.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
CBLT1_0019_F11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
THY01_0070_G11.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
SMG01_0069_D09.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
HTMT1_0126_H04.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
TES01_0091_A05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0110_D05.b : TGCCCGAGGTCACTACACCATTGGCAAGGAGATCATTGACCTCGTCTTGGACCGAATTCG
BFLT1_0142_E11.b : TGCCCGAGGTCccctaacccattgggcaggagatcattgacctcgttcttggaccgaatt
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : cgcacgggttgtatcgccacattctgaatacacggactcccctttctccgggggttaaga
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
---------+---------+---------+---------+---------+---------+ 614
AMP01_0004_H06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0004_G12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0097_D05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0094_B04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVR01_0031_F08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0069_B04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0145_B06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
ADR01_0076_E05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0091_C02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
PCT01_0035_A07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0088_F11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPLT1_0043_A04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0109_E01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0105_E01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0027_D01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0129_E10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0095_D07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0048_D10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0069_F07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0104_H08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0150_B05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0121_F03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TCH01_0073_B05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0069_D11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0044_H05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0125_C04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0079_C02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
ADR01_0089_D12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0046_A09.b : GAGACTGGCTGACCAGTGCACAGGTCCTTAAGGCTTCTTGGcactccacagataggccgg
OVRM1_0225_E05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0006_B12.b : GAAACTGTCTGACCAGTGCACATGTCTTCAGGGCTTCTTGGCTTTCCACAGCTTTGGCCG
SPL01_0043_D02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGGCG
TES01_0073_G04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0179_A06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0053_H01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0184_H02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTCCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0118_C12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0190_C10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0021_H08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0070_F09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0086_C11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0124_F07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0122_E02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPL01_0009_F06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0150_D03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0005_H09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0129_H10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0127_D10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0035_F04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0099_H03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0145_F01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0002_D06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0072_E06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0013_A04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0054_F01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0063_D01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0088_F02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPL01_0041_G06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGCTTTCCACAGCTTTGGCGG
ITT01_0064_B08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0110_E03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TCH01_0091_A05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0057_H05.b : GAAACTGGCTGAACAGTGCACAGGTCCTCAGGCCTTCTTGGTTTTCCAC*GCTTTGGCGG
DCI01_0021_A01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0101_E01.b : GGAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGG*TTTCCACAGCTTTGGCGG
OVRM1_0212_F01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0027_H06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0117_B10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0021_D08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0023_B03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0041_F03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0051_A12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0114_G06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0059_A01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0045_E11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0015_B05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVR01_0056_B07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0040_F05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0074_H08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TCH01_0093_E02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0059_D09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0067_G02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0089_C10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0079_D11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0022_G05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0044_A09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVR01_0048_G09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0030_F07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0125_D12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0002_F04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPL01_0052_F08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0024_E07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0004_D12.b : GAAACTGGCTGACCAGTGCATAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0145_G01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0104_H10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTACACAGCTTTGGCGG
BKFL1_0077_B04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0080_A10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACGGCTTTGGCGG
DCI01_0093_E05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACGGCTTTGGCGG
DCI01_0035_F12.b : GAAACTGGCTGACCAGTGCACAGG*CTTCAGGGCTTCCTGGTTTTCCACAGCTTTGGCTG
OVRM1_0161_B02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0023_B02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0021_H01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0087_C11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0026_A09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
LNG01_0095_F10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0151_C10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0086_A04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0101_H08.b : GGAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTTCTGGTTTTC*ACAGCTTTGGCGG
TCH01_0075_E04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0099_G04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0069_C10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0156_C03.b : gtccggaaaatcgcctggacggagtaccacatatacagggacacggcggtcaccagaggg
OVRM1_0216_D03.b : aaaatcgacgtaaatgttgcacagcacgtctcgcgcgctccgaacatatatcacacaggc
OVRM1_0176_E11.b : GAAACTGGCTGACCAATGCACAAGTCTACAAGGCTTCT*GGTTTTTCACAGCTTCGGAGG
OVR01_0034_C02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVR01_0073_G11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACACATTTGGTGG
OVRM1_0222_B12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0164_D01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
ADR01_0061_E07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0046_C08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0060_G11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0165_C09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPL01_0060_E03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0210_E08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0099_B04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0215_B03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0084_E07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0130_F09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0069_F08.b : GGAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
LNG01_0071_A01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0101_B12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0202_H05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0107_E11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0186_E12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0077_H12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVR01_0038_E05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0151_G01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0152_D06.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0087_F11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0110_F05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0125_D04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SPL01_0098_G07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0002_G08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0070_A01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGGTTTCCACAGCTTTGGCGG
PTG01_0052_G03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0095_C03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
ADR01_0047_D02.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0043_H05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGGTTTCCACAGCTTTGGCGG
BFLT1_0126_D04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0030_E01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TCH01_0034_B04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0004_A07.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRT1_0030_D04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
OVRM1_0113_A01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0085_H12.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0089_E10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0066_G05.b : GAGACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
PST01_0037_F01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0089_D11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0080_E01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0084_A10.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0037_D01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0111_A09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0045_H03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0075_F08.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0113_G03.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0081_E05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
DCI01_0091_E11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
AMP01_0035_H01.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
CBLT1_0019_F11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
THY01_0070_G11.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
SMG01_0069_D09.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
HTMT1_0126_H04.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
TES01_0091_A05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0110_D05.b : GAAACTGGCTGACCAGTGCACAGGTCTTCAGGGCTTCTTGGTTTTCCACAGCTTTGGCGG
BFLT1_0142_E11.b : ccggaaactggcctgaaccagtgcacaggttcttcagggcttccttggtttttccacaac
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : ggagagggggaaataaccgggtgctaccttagagggaatattctttctggaatattaaaa
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
---------+---------+---------+---------+---------+---------+ 672
AMP01_0004_H06.b : GGGAACGGGTTCTGGG*TTTCACTCCCTGCTGATGGGAAGTCTCTCctgtcataaggcaa
AMP01_0004_G12.b : GGGAACGGGTTCTGGG*TTTACCTCCCTGCGGAT*GAACTTCTCTCTTGTCTATTATTGC
AMP01_0097_D05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
AMP01_0094_B04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVR01_0031_F08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0069_B04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0145_B06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
ADR01_0076_E05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0091_C02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
PCT01_0035_A07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0088_F11.b : GGGAACGGGTTCTGGG*TTCACCTCCCCGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPLT1_0043_A04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0109_E01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0105_E01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0027_D01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0129_E10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0095_D07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0048_D10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0069_F07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0104_H08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0150_B05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0121_F03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TCH01_0073_B05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0069_D11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0044_H05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0125_C04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0079_C02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
ADR01_0089_D12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0046_A09.b : ggtacgcgcctcgtgtccactccccgctcaaggcaagaccgtttggatacgtcacatcgc
OVRM1_0225_E05.b : GCGAACGGGCTCTGGG*TTCAACTCCCTGCCGATGGAcctcaccctgtcgattatggcca
OVRM1_0006_B12.b : GGGAACGGTATCTGGGTTTCACCTACCTGCTGATGGAACGTTTCTCT*GTCTATTATGGC
SPL01_0043_D02.b : GGGAACGGGTTCTGGG*TTCAC*TCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0073_G04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0179_A06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GCCGATTATGGC
OVRM1_0053_H01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0184_H02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0118_C12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0190_C10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0021_H08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0070_F09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0086_C11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0124_F07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0122_E02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPL01_0009_F06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0150_D03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0005_H09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0129_H10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0127_D10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0035_F04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0099_H03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0145_F01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0002_D06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0072_E06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0013_A04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0054_F01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0063_D01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0088_F02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPL01_0041_G06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
ITT01_0064_B08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0110_E03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TCH01_0091_A05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0057_H05.b : GGGAAC*GGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATTGG
DCI01_0021_A01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0101_E01.b : GGAAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0212_F01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0027_H06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGG
OVRM1_0117_B10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0021_D08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0023_B03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0041_F03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0051_A12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0114_G06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0059_A01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0045_E11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0015_B05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVR01_0056_B07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0040_F05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0074_H08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TCH01_0093_E02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0059_D09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0067_G02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0089_C10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0079_D11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0022_G05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0044_A09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVR01_0048_G09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0030_F07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0125_D12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0002_F04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPL01_0052_F08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0024_E07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0004_D12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0145_G01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0104_H10.b : GGGAACGGGCTCCGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BKFL1_0077_B04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGGTTATGGC
DCI01_0080_A10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0093_E05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0035_F12.b : GGGAAAGGGGTCCGGG*GTTCACctcccgcgaaaggaacgtctcttcggccaataatggc
OVRM1_0161_B02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0023_B02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0021_H01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0087_C11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0026_A09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
LNG01_0095_F10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0151_C10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
AMP01_0086_A04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0101_H08.b : GGGAACGGGGTCTGGG*TTCANCCTCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TCH01_0075_E04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
AMP01_0099_G04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0069_C10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0156_C03.b : agttgaggtttagcctacatatagttggtcggtctgtccccatgtagacacgtacagata
OVRM1_0216_D03.b : ctagacaacaaatccctgtgttcttttctcatcttaatcactngcagtccaatccgaaca
OVRM1_0176_E11.b : GGGAACGGaacatggacccaatcccaacacatagacatgcctccagcccatttcgcaata
OVR01_0034_C02.b : GGGAcaccggctctgggttccccctccctgcctgatggaacgtctctctgtctattcatg
OVR01_0073_G11.b : GGAAACCGTTTCTGGttactactccctgattagggacagctccctgcctattctgatacc
OVRM1_0222_B12.b : GGGAACGGGTTCTGGG*TTCACCTCCATGCTGATGGAACGTCTCTCT*GTCCATTATGGC
OVRM1_0164_D01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAATGTCTCTCT*GTCGATTATGGC
ADR01_0061_E07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0046_C08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0060_G11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0165_C09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPL01_0060_E03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0210_E08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0099_B04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0215_B03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0084_E07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0130_F09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0069_F08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
LNG01_0071_A01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCTATTATGGC
OVRM1_0101_B12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0202_H05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0107_E11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0186_E12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0077_H12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVR01_0038_E05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0151_G01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0152_D06.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0087_F11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0110_F05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0125_D04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SPL01_0098_G07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0002_G08.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0070_A01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
PTG01_0052_G03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0095_C03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
ADR01_0047_D02.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0043_H05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0126_D04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0030_E01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TCH01_0034_B04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0004_A07.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRT1_0030_D04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
OVRM1_0113_A01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGCACGTCTCTCT*GCCTATTATGGC
TES01_0085_H12.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0089_E10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGG
TES01_0066_G05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
PST01_0037_F01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0089_D11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0080_E01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0084_A10.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0037_D01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0111_A09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0045_H03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0075_F08.b : GGGAAACGGGTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0113_G03.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0081_E05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
DCI01_0091_E11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
AMP01_0035_H01.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
CBLT1_0019_F11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
THY01_0070_G11.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
SMG01_0069_D09.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
HTMT1_0126_H04.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
TES01_0091_A05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0110_D05.b : GGGAACGGGTTCTGGG*TTCACCTCCCTGCTGATGGAACGTCTCTCT*GTCGATTATGGC
BFLT1_0142_E11.b : ttttggcggggggaaacgggtttccggggttcacccccccgtgctgaatggaaacgtccc
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : ggggaaccgcccagtttcgggtttttttttcaccagtgggggggaaggtttgggttccct
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
---------+---------+---------+---------+---------+---------+ 732
AMP01_0004_H06.b : gaagtcccaactggagttctcctttaaccacccccccagttttcacacctgtatttgaag
AMP01_0004_G12.b : AAGAATTCCAAGCTGGAGTTCTCCAATTACCCAAtctccatttttccacatctagaattg
AMP01_0097_D05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCANGTTTCCACAGCTGTAGTT
AMP01_0094_B04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVR01_0031_F08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0069_B04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0145_B06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTTCCCAGCCCCCCAGGTTTCCACAGCTGTAGTG
ADR01_0076_E05.b : AAGAAGTCCAAGCTGGAGTTCACCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0091_C02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
PCT01_0035_A07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0088_F11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCACCCCCCCA*GTTTTCACCGCTTGAATT
SPLT1_0043_A04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0109_E01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0105_E01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0027_D01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0129_E10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0095_D07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0048_D10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0069_F07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0104_H08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0150_B05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0121_F03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TCH01_0073_B05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0069_D11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0044_H05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0125_C04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCCGTAGTT
HTMT1_0079_C02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
ADR01_0089_D12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0046_A09.b : taacactcctcgcaacccctttctcatttcttcgctgtcgactctgctccgacgcgcttt
OVRM1_0225_E05.b : gaatccaacctggacttcccctttacacacaccccgaggttccacagctgtanttgtagc
OVRM1_0006_B12.b : AAGAAcccaagcttggagtcttcatttacccatgcccacatgtgttcacagatgtagttg
SPL01_0043_D02.b : AAGAATTCCAGCTTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCAacagctggtat
TES01_0073_G04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0179_A06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0053_H01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0184_H02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0118_C12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0190_C10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0021_H08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0070_F09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCC*ACGTTTCCACAGCTGTAGTT
TES01_0086_C11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0124_F07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0122_E02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SPL01_0009_F06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0150_D03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0005_H09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAACTGTAGTT
OVRT1_0129_H10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0127_D10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0035_F04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0099_H03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0145_F01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0002_D06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0072_E06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0013_A04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0054_F01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGGTGTAGTT
BFLT1_0063_D01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0088_F02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SPL01_0041_G06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
ITT01_0064_B08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0110_E03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TCH01_0091_A05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0057_H05.b : AAGAGtcccagctggattctccattacccagcccccaggtttcacagctgtagttgaccc
DCI01_0021_A01.b : AGAAATTCCAAGC*GGAATTCTCCATTTACCCACCCCCCCA*GTTTCCACAGCTGgtatt
DCI01_0101_E01.b : A*GAAGTCCCAGCTGGAGTTCTC*ATTTCACCAGCCCCCCAGGTTTC*ACAGCTGTAGTg
OVRM1_0212_F01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0027_H06.b : CAGAAGTCCAAGCTGGAGTTCTCCATT*ACCCAGCCCCC*AGGTTTCCACAGCTGTAGTT
OVRM1_0117_B10.b : AAGAGTTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0021_D08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0023_B03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0041_F03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCANGTTTCCACAGCTGTAGTT
CBLT1_0051_A12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0114_G06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0059_A01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0045_E11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0015_B05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVR01_0056_B07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0040_F05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0074_H08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TCH01_0093_E02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0059_D09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0067_G02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0089_C10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0079_D11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0022_G05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0044_A09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVR01_0048_G09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0030_F07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0125_D12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0002_F04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SPL01_0052_F08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0024_E07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0004_D12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0145_G01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0104_H10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTATCCAGCCCCCCAGGTTTCTACAGCTGTAGTT
BKFL1_0077_B04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0080_A10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0093_E05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0035_F12.b : cagaaattccaagccggaagttctcccttttacccacccccccaggttttcacaactgta
OVRM1_0161_B02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0023_B02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0021_H01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0087_C11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0026_A09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
LNG01_0095_F10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0151_C10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
AMP01_0086_A04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0101_H08.b : A*GAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTC*ACAGCTGTAGTT
TCH01_0075_E04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
AMP01_0099_G04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0069_C10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0156_C03.b : taccacatcaaaaccgccaagcgaaagtgcccacgatgagtaggcgtatgctgggaagaa
OVRM1_0216_D03.b : cagacctattcacttaaagctaccctaatcctactcacatccttacctcttacaccccca
OVRM1_0176_E11.b : aaacacagatgaaatttgtgttaccagctcccangtctgatacctttaaacaaatgcaca
OVR01_0034_C02.b : gccaccaagtcccacagctggagctctccattttaccccccccccctagccctcccacag
OVR01_0073_G11.b : caattcaagccggattcgtccattgaccgttcctctctgctttttatagctgtgctttag
OVRM1_0222_B12.b : CAGAAGCCAAAGCTGGAactgtgcctttatcgagcccacaaattatcccaaccgaaattg
OVRM1_0164_D01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTTCACAGC
ADR01_0061_E07.b : AGAAAGTCCA*GCTGGNAGTCTCCATTTACCAGCCCCCCCAG**TTCCACAGCTGTAGTT
OVRM1_0046_C08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCTCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0060_G11.b : AAGAAGCCCAAGCTGGAGTTCTCCATTT*CCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0165_C09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SPL01_0060_E03.b : AAGAAGTCCAAGCTGGAGTTCTTCATTTACCCAGCCCCCCAAGTTTCCACAGCTGTAGTT
OVRM1_0210_E08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0099_B04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAACCCTCCAGGTTTCCACAGCTGTAGTT
OVRM1_0215_B03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAAGTTTCCACAGCTGTAGTT
OVRM1_0084_E07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0130_F09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCANGTATCCACAGCTGTAGTT
OVRM1_0069_F08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
LNG01_0071_A01.b : AAGAAATCCAAACTGGAGTTCTCCATTTACCCAACCACCCAGGTTTCCACAGCTGTTATT
OVRM1_0101_B12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACACCTGTAGTT
OVRM1_0202_H05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0107_E11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0186_E12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0077_H12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVR01_0038_E05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0151_G01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0152_D06.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0087_F11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0110_F05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0125_D04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SPL01_0098_G07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0002_G08.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0070_A01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
PTG01_0052_G03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0095_C03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCAAGGTTTCCACAGCTGTAGTT
ADR01_0047_D02.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0043_H05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0126_D04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0030_E01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TCH01_0034_B04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0004_A07.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRT1_0030_D04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
OVRM1_0113_A01.b : AAGAAATCTCAACTGGAGTTtttccgttacctcgccccccgttttccccttctgtttctt
TES01_0085_H12.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0089_E10.b : CAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCC*ANGTTTCCACAGCTGTAGTT
TES01_0066_G05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
PST01_0037_F01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0089_D11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0080_E01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCCAGGTTCCACAGCTGTAGTT
TES01_0084_A10.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0037_D01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0111_A09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0045_H03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0075_F08.b : AAGAAGCCCAAGCTGGAGTTCTCCATTTCCCAGCCCCCCCAGTTT**CACAGCTGTAGTT
BFLT1_0113_G03.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0081_E05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
DCI01_0091_E11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
AMP01_0035_H01.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
CBLT1_0019_F11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
THY01_0070_G11.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
SMG01_0069_D09.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
HTMT1_0126_H04.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
TES01_0091_A05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0110_D05.b : AAGAAGTCCAAGCTGGAGTTCTCCATTTACCCAGCCCCCCAGGTTTCCACAGCTGTAGTT
BFLT1_0142_E11.b : ccctggtccattttatggccaagaaagtcccaagccggggatttctcccatttttaccca
HTMT1_0063_G08.b : ttttgcgacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_E01.b :
BFLT1_0136_A10.b : ccccggggggaaggtttttctggatggcaaagatccaagggggttttccttttcccagcc
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
---------+---------+---------+---------+---------+---------+ 790
AMP01_0004_H06.b : cctaaacatcatcctcacatcaacaccatcctggaacactctgtatgggcccttcttgaa
AMP01_0004_G12.b : agccctacaactccttccccaccttcgatatctacgcctggacaaaactaatttcgcctt
AMP01_0097_D05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
AMP01_0094_B04.b : GAGCCCTACAACTCCATCCTCACC*CCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVR01_0031_F08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0069_B04.b : GAGCCCTANAAACTCATCCTCNACACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0145_B06.b : GAGCCCTACAAATCCATCCTCACCACCCACACCACCCTGGGAGCATT*CTGATTGTGCCC
ADR01_0076_E05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0091_C02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
PCT01_0035_A07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0088_F11.b : GAGCCCTACAACTCCATCCTCAACCACCAaaacaaccctgaagcaccccgaatgtgccct
SPLT1_0043_A04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0109_E01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0105_E01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0027_D01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0129_E10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0095_D07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0048_D10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0069_F07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0104_H08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0150_B05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0121_F03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TCH01_0073_B05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0069_D11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0044_H05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0125_C04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0079_C02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
ADR01_0089_D12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0046_A09.b : tatagcttctcccgagcgcgtccgctcgctaaatgtctcatcgctagttctttcgtcgca
OVRM1_0225_E05.b : ccttactctctcaccctactccacaaccttggatcctccgattgtgccctcctgaaacac
OVRM1_0006_B12.b : acccctacacctacttctcacctccactaccactctggagctcttctgatgtgccttcag
SPL01_0043_D02.b : ttgaaccctaaaattcaatcctcaccacccaaaaccaacctggagacactcgattggggc
TES01_0073_G04.b : GAGCCCTANNACTTCATCCTCACCCACCACA*CACCCTG*GAGCACT*CTGATTGTG*CT
OVRM1_0179_A06.b : GAGCCCTACGACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGAATGTGCCT
OVRM1_0053_H01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0184_H02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGTCT
OVRM1_0118_C12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0190_C10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0021_H08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0070_F09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0086_C11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0124_F07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTATGCCT
OVRT1_0122_E02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SPL01_0009_F06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0150_D03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0005_H09.b : GAGCCCTACAACTCCATCCTTACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0129_H10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0127_D10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0035_F04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0099_H03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0145_F01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0002_D06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0072_E06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0013_A04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTCTGCCT
BFLT1_0054_F01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0063_D01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0088_F02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SPL01_0041_G06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
ITT01_0064_B08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0110_E03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TCH01_0091_A05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0057_H05.b : taaaatccatcctcacaaccaaacaccctggagcatctgatgtgcttcctggtaaaaagg
DCI01_0021_A01.b : tgagccctacaaatccaatcttaacaacaacacaaccctggagaactctgaatgtggctt
DCI01_0101_E01.b : aagccctaaaattccttccttacaaccaaaacacccttgaaccacctgaatgtgctttct
OVRM1_0212_F01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0027_H06.b : GAGCCCTAANACTCCATTCCTCACACCCACACaccttggagactctgattgtgcctcatg
OVRM1_0117_B10.b : GAGCCCTACAACTCCATCCTCACCACCCCACACACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0021_D08.b : GAGCCCTACAACTCCATCCTCACNACCCACACCAACCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0023_B03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0041_F03.b : GAGCCCTANAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0051_A12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0114_G06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0059_A01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0045_E11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0015_B05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVR01_0056_B07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0040_F05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0074_H08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TCH01_0093_E02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0059_D09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0067_G02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0089_C10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*TAGCACT*CTGATTGTGCCT
BFLT1_0079_D11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0022_G05.b : GAGCCCTACAACTCCATCCTCAACCACCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0044_A09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVR01_0048_G09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0030_F07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0125_D12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0002_F04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SPL01_0052_F08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0024_E07.b : GAGCCCTACAACTCCATCCCTCACACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0004_D12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0145_G01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0104_H10.b : GAGCCCTACAACTCCATGCTCACGACCCAGA*CACCCTG*GAGCACT*CTGATTGTGCCT
BKFL1_0077_B04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0080_A10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0093_E05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0035_F12.b : attgaaccctaaaaattcattcttcacatcccaaacacacctgggaaaacttgaatttgg
OVRM1_0161_B02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0023_B02.b : GAGCCCTANAACNTCAATCTCACCACCACACCAACCCTG*AAGCACT*CTGATTGTGCCT
CBLT1_0021_H01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0087_C11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0026_A09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
LNG01_0095_F10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0151_C10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
AMP01_0086_A04.b : GAGCCCTACAACTCCATCCTCGCCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0101_H08.b : GAGCCCTANANNT*CATCCTCANNCACCAAACNACCNTG*AAGCACT*CTGATTGTGCCC
TCH01_0075_E04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
AMP01_0099_G04.b : GAGCCCTANCACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0069_C10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0156_C03.b : ttctaccattgcgtagaccagtgaaggagagaacaagcagaaaagcggaggtagaataga
OVRM1_0216_D03.b : tatcaatacctcctcacatatctcacccaccgctaaaataccaaataagagcgataatta
OVRM1_0176_E11.b : cccccatagaccagactctgtgccatatagaaacaacttttttagatatgttcataaagc
OVR01_0034_C02.b : ctcggtactcgaaccctacaacttcatcctcaccaccccacacctacccccggagcacct
OVR01_0073_G11.b : ccgctactatttgacataacttctcattctcccgcagagttttttcatcggttattactg
OVRM1_0222_B12.b : aaccccacaaataaaaccaatagacttaaccaccaggcaccaccccatcggagatcaaga
OVRM1_0164_D01.b :
ADR01_0061_E07.b : GAGCCCTAANANNTCATNNCTCACACCannacacctgganactctgatggtgcctcatgt
OVRM1_0046_C08.b : GAGCCCTACATCTCC*TGCTTACCACNCACACAACACTG*GAGCACT*CTGATTGTGCCT
OVRM1_0060_G11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0165_C09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SPL01_0060_E03.b : GAGCCCTACAAATCCATCCTCACCACCCAAAACCACCCTGGAGGACTCTGAATGGGGCCT
OVRM1_0210_E08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0099_B04.b : GAGCCCTACAATTCCCTACTCACCACTTAAACCACACTG*GAGCAAT*CTCGATTGTGCC
OVRM1_0215_B03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0084_E07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0130_F09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0069_F08.b : GAGCCCTACAACT*CATCCTCACCACCC*CACACCCCTG*GAGCACT*TTGATTGTGCCC
LNG01_0071_A01.b : CAGACCTACAAATCCCTCCTCATCACCCAGAAAACCCGTGGAGCATTCTTGATTGTGCCC
OVRM1_0101_B12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0202_H05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0107_E11.b : GAGCCCTANCACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0186_E12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0077_H12.b : GAGCCCTACNACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVR01_0038_E05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0151_G01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0152_D06.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0087_F11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0110_F05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0125_D04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SPL01_0098_G07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0002_G08.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0070_A01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
PTG01_0052_G03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0095_C03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
ADR01_0047_D02.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0043_H05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0126_D04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0030_E01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TCH01_0034_B04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0004_A07.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRT1_0030_D04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
OVRM1_0113_A01.b : acccttcttatccttcccttccaccgcctccccagcgaagcaccctgatttcgcttcgtc
TES01_0085_H12.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0089_E10.b : GAGCCCTACAAACTCATCCTCNACA*CCACACCACCCTG*GAGCACT*CTGAATGTGCCT
TES01_0066_G05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACTTCTGATTGTGCCT
PST01_0037_F01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0089_D11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0080_E01.b : GAGCCCTACAAATCCTTCCTCACCCACCACAACACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0084_A10.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0037_D01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0111_A09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0045_H03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0075_F08.b : GAGCCCTANA**TTCCATCTTCACAACCAAAACACCTTG*GAGCACT*CTGATTGTGCCT
BFLT1_0113_G03.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0081_E05.b : GAGCCCTACAACTCCATCCCCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
DCI01_0091_E11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCGCCCTG*GAGCACT*CTGATTGTGCCT
AMP01_0035_H01.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
CBLT1_0019_F11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
THY01_0070_G11.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
SMG01_0069_D09.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
HTMT1_0126_H04.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
TES01_0091_A05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0110_D05.b : GAGCCCTACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
BFLT1_0142_E11.b : accccccccaaggttttccaccaccttgtaatttaaacccctaaaaaattccctttcctc
HTMT1_0063_G08.b : xxxxxxxACAACTCCATCCTCACCACCCACACCACCCTG*GAGCACT*CTGATTGTGCCT
UTR01_0014_E01.b : ggggxxxxxxxxxxxxxxxxxx
BFLT1_0136_A10.b : cccccgtttcccaaggggtggtgggcctaaaaattcatcttccccacccccccccccgga
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
---------+---------+---------+---------+---------+---------+ 846
AMP01_0004_H06.b : aacattaagccaatcataattctgtcgtaaaaaacccatatttaacccccacctatcata
AMP01_0004_G12.b : tatggttaaacaatatagcccattacagacacctttcctaaaatccttctatatgaagcc
AMP01_0097_D05.b : TCATGG*GTAGACATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
AMP01_0094_B04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVR01_0031_F08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0069_B04.b : TCATGG*TAGACAATGANG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0145_B06.b : TCATGGGTAGACAATGAGG*CCATCTATGACATC*GGGCGTAGAAAACCTCGAATTTGAA
ADR01_0076_E05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0091_C02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
PCT01_0035_A07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0088_F11.b : tccggggaaacaatgaagccatctatgaactctgtccaaaaaaacctccaaatttgaacg
SPLT1_0043_A04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAA*AAACCTCGATATTGAA
TES01_0109_E01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0105_E01.b : TCATGG*TAGACAATGANG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0027_D01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0129_E10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0095_D07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0048_D10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0069_F07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0104_H08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0150_B05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0121_F03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TCH01_0073_B05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0069_D11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0044_H05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0125_C04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0079_C02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
ADR01_0089_D12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0046_A09.b : gcgattttatttgaataatcatagtacccgttctatcagtaccccggtccctattcgatc
OVRM1_0225_E05.b : aagaacgcctttaagacctcggcccacaacctctacaccn
OVRM1_0006_B12.b : gctatatatgtcgcctttctttactttcgttctcactctttattttctcccccacctcct
SPL01_0043_D02.b : ctcctggaaaaaaaggaaggccatccatgaaatcctgcgaaaaaacccccaaattgaaag
TES01_0073_G04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGGAA*AAAACTCAATATTTGA
OVRM1_0179_A06.b : TCATGG*TAGACNATGAAG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGGA
OVRM1_0053_H01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0184_H02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0118_C12.b : TCATGG*TAGACAATGAGG*GCATCTATGACATC*TGTCGTAA*GAACCTCGATATTGAA
OVRM1_0190_C10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0021_H08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0070_F09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCCATATTGAA
TES01_0086_C11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0124_F07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0122_E02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
SPL01_0009_F06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0150_D03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0005_H09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0129_H10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0127_D10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0035_F04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0099_H03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0145_F01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0002_D06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0072_E06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0013_A04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0054_F01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0063_D01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0088_F02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
SPL01_0041_G06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
ITT01_0064_B08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0110_E03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TCH01_0091_A05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0057_H05.b : aggcatctataactctgtcgaaaaacctcgatttggacgccaaccacactaactgaaaag
DCI01_0021_A01.b : tcgtggtaaacaaggaggccatctatgacattcgttcgtaaaaaccctgatattgaaacc
DCI01_0101_E01.b : ggtaaacaatgagggcacctttgaattcggtctaaaaacctcatattgaacgccaaccaa
OVRM1_0212_F01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0027_H06.b : taaaacatgaggccatctatgacatctgtcgtaaaaacttcgaaatggacgcccaactac
OVRM1_0117_B10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGA*
DCI01_0021_D08.b : TCATGG*TAGAC*ATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0023_B03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0041_F03.b : TCATGG*TAGACAATGANG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0051_A12.b : TCATGG*TANACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0114_G06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0059_A01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0045_E11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0015_B05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVR01_0056_B07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0040_F05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0074_H08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TCH01_0093_E02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0059_D09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0067_G02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0089_C10.b : TCATGG*TAGACAATGAGG*ACATCTATGACATC*TGTCGTAG*AGACATCGATATTGAA
BFLT1_0079_D11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0022_G05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCAATATTGAA
HTMT1_0044_A09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVR01_0048_G09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0030_F07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0125_D12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0002_F04.b : TCGTGG*TAGACAATGAGG*CCATCTATGACGTC*TGTCGTAA*AAACCTCGATATTGAA
SPL01_0052_F08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0024_E07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGAGATTGAA
DCI01_0004_D12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAA*AAACCTCGATATTGAA
HTMT1_0145_G01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0104_H10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BKFL1_0077_B04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0080_A10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0093_E05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0035_F12.b : cctcaggggaaaaaaaggaggccttctattacattcggtctaaaaaaacctcctaaatgg
OVRM1_0161_B02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTC
DCI01_0023_B02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACTTCGATATTGAA
CBLT1_0021_H01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0087_C11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0026_A09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
LNG01_0095_F10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0151_C10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
AMP01_0086_A04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0101_H08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TCH01_0075_E04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
AMP01_0099_G04.b : TCATGG*TAGACAATGANG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0069_C10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0156_C03.b : aatataggtttaaactaaagaaagtcagtttgcctctatacatagaatgatcaatagcac
OVRM1_0216_D03.b : tttttattgcccattacgctacgattccatacataccccccaaaataaatatacatacac
OVRM1_0176_E11.b : cacaccccatctttcctaatatcaatat
OVR01_0034_C02.b : ctccttgtgcctccctcgccaaacccactgatgccatcatgaacatcttctcgtccatac
OVR01_0073_G11.b : cgttactgtgccgctcgtcttgn
OVRM1_0222_B12.b : tcaaaagaaagaccctaagacatcgtcttacacccataataagaggggcgatgaagagaa
OVRM1_0164_D01.b :
ADR01_0061_E07.b : tagacatggagcc
OVRM1_0046_C08.b : TCATGG*TGGACAATGAGG*CCATTTATGACATC*TGTTGTAG*AAACTCtatttttacg
OVRM1_0060_G11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAA*AAACCTCGATATTGAA
OVRM1_0165_C09.b : TCATGG*TAGACAATGAGG*CCATCTATGAAATC*TGTCGTAG*A*ACCTCGATA
SPL01_0060_E03.b : TCATGGTAGAACAATGAGG*CCATCTATGACATC*TGgccgaagaaaccctcaaaaattg
OVRM1_0210_E08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0099_B04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGGCGTAC*AAACCTCCATACTGAA
OVRM1_0215_B03.b : TCATGG*TAGACAATGAGG*CCCTCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0084_E07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0130_F09.b : TCATGG*TAGACAATGAGG*GCATCTATGACATC*TGTCGTAG*AAACTTCGATATTGAA
OVRM1_0069_F08.b : TTCATG*GAGACAATGAGG*CCATATATGACATC*TGTCGTA**AAACCTCGATATTGAA
LNG01_0071_A01.b : TCATGG*TAGACAATGATG*CCATCTATGACATC*TGTCTTAT*AAACCTCCCTATTGAA
OVRM1_0101_B12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0202_H05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0107_E11.b : TCATGG*TAGACAATGANG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0186_E12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0077_H12.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*NAACCTCGATATTTGA
OVR01_0038_E05.b : TCATGG*TAGACAATGAAG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0151_G01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0152_D06.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0087_F11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0110_F05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0125_D04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
SPL01_0098_G07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATAATGAA
OVRT1_0002_G08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0070_A01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
PTG01_0052_G03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0095_C03.b : TCATGG*TAGACAATGAGG*CCATCTATGACACC*TGTCGTAG*AAACCTCGATATTGAA
ADR01_0047_D02.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0043_H05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0126_D04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0030_E01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TCH01_0034_B04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0004_A07.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRT1_0030_D04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
OVRM1_0113_A01.b : cttccctttgctgcgctcgttttttccctttttgacccctccatct
TES01_0085_H12.b : TCATGGTTAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0089_E10.b : TCATGT*TAGACCATGAAG*GCATCTATGACATC*TGTCGTAA*AAACTTCCATTATGAA
TES01_0066_G05.b : TCATGG*TAGACAATGAGG*CCCTCTATGACATCCTGTCGTAA*AAACCTCGATATTGAA
PST01_0037_F01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0089_D11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0080_E01.b : TCATGG*TAGACAATGAGGGCCATCAATGACATC*TGTCGTAA*AAACCTCGATATTGAA
TES01_0084_A10.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0037_D01.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0111_A09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0045_H03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0075_F08.b : TCCTGG*TAAACAATGAGG*CCATtccttgacttccgtcctaaaaaacctcaatattgac
BFLT1_0113_G03.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0081_E05.b : TCATGG*TAGACAATGAAG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
DCI01_0091_E11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
AMP01_0035_H01.b : TCATGG*TAGACAATGAGG*CCATCTATAACATC*TGTCGTAG*AAACCTCGATATTGAA
CBLT1_0019_F11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
THY01_0070_G11.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
SMG01_0069_D09.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
HTMT1_0126_H04.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
TES01_0091_A05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0110_D05.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
BFLT1_0142_E11.b : acaaacccaaaaccaaccttggaaacaccccctgaatttgtcccctccatgggtaaaaaa
HTMT1_0063_G08.b : TCATGG*TAGACAATGAGG*CCATCTATGACATC*TGTCGTAG*AAACCTCGATATTGAA
UTR01_0014_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0136_A10.b : gaatttgaatgggcctttatggtgacacagggggcatttttgcatttgttgtgggaaccc
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
---------+---------+---------+---------+---------+---------+ 903
AMP01_0004_H06.b : accagaaaggttgataggccaaatggggcccccctccctgatccctgaaattcaaagtgc
AMP01_0004_G12.b : ctaacccttccttccctaaactagttgaaaggccaaattgtttctctaaaactgccttcc
AMP01_0097_D05.b : CGCCCAA*CTACACctaaccgaaaaggttgaaaggcccaatgtgtcctcctccctgcttt
AMP01_0094_B04.b : CGGCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVR01_0031_F08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0069_B04.b : CGCCCNA*NCTACACNTACCTGAA*TANGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0145_B06.b : acgcccaacctacactaacctggaaaaaggttgatgggccagaatgggtccctcatccac
ADR01_0076_E05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0091_C02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
PCT01_0035_A07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0088_F11.b : ccccaccctaccctaacctgaataaggttgaaaggtccaaattggggccccctcacccct
SPLT1_0043_A04.b : CGCCCAA*C*TACACTACCTTGAA*TAGGTTGAAAGGTCAGAATGTGTCCTCCAT*CACT
TES01_0109_E01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAAATTGTGTCCTCCAT*CACT
OVRT1_0105_E01.b : CGCCCCA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
HTMT1_0027_D01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0129_E10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0095_D07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0048_D10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0069_F07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTTGATAGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0104_H08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0150_B05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0121_F03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TCH01_0073_B05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0069_D11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0044_H05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0125_C04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0079_C02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
ADR01_0089_D12.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRM1_0046_A09.b : gccgctgctt
OVRM1_0225_E05.b :
OVRM1_0006_B12.b : ttccgtcct
SPL01_0043_D02.b : cccaaacctaaacaacctgaaaaaggtgaaaaggccaaattggggccctcatcaaggctt
TES01_0073_G04.b : CGCCCAA*ACTACCCTACCCTGAA*TAGGTTGAaaaggccaaatggggtcctccaccctg
OVRM1_0179_A06.b : C
OVRM1_0053_H01.b : CGCCCAC
OVRM1_0184_H02.b : CGCCCCA*CCTACAC
OVRM1_0118_C12.b : CGCCCAA*CCTACACTAACCg
OVRM1_0190_C10.b : CGCCCNA*CCTACACTAACCTGAA*TAGGTTGATAGGTCn
OVRM1_0021_H08.b : CGCCC*A*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTG
OVRM1_0070_F09.b : CGCCCA**CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGT
TES01_0086_C11.b : CGCCCAA*CCTACACTACCCTGAA*TAAGTTGATAAGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0124_F07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0122_E02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
SPL01_0009_F06.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0150_D03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0005_H09.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0129_H10.b : CGCCCCA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGAGTCCTCCAT*CACT
OVRT1_0127_D10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0035_F04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0099_H03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0145_F01.b : ACGCCAA*ACTACACTAACCTGAA*TAGGTTGATAAGTCAGAATGTGTCCCTCAT*CACT
BFLT1_0002_D06.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCCTCAT*CACT
BFLT1_0072_E06.b : CGCCCAA*CCTACACTAACCTGAA*TANGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0013_A04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0054_F01.b : CGCCCAA*CCTACACTAACCTGAA*TAGNNGTGATAGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0063_D01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0088_F02.b : CGCCCCA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
SPL01_0041_G06.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
ITT01_0064_B08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0110_E03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
TCH01_0091_A05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0057_H05.b : ggtgaaagccaaatgggtccccaccctgctcccggaggttaaggggcctgaatgttaatc
DCI01_0021_A01.b : cccaacccaaactaacctgaaaaaggttgaaaaggctaaattggtccccccaacccggcc
DCI01_0101_E01.b : cctaacctggaaaagttgaaaaggcaaaatgggccccccacccgggctccctaaggttta
OVRM1_0212_F01.b : CGCCCA
DCI01_0027_H06.b : actaacctgaatagttgataagtcagatgtgtcctcctcacggcctcccggagtttgatg
OVRM1_0117_B10.b : CGCCCAA*NCTACACTAACCTGAA
DCI01_0021_D08.b : CGCCCAA*C*TACACTAACCTGAA*TAGttgataagtcaaatgtgtcctcatcactggct
CBLT1_0023_B03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
DCI01_0041_F03.b : CGCCCAA*CCTACACTAACCTGAA*TA*GTTGATAGGTCAAAATGTGTCCTCCAT*CACT
CBLT1_0051_A12.b : CGCCCAA*ACTACACTAACCTGAA*TAGGTTGATAGGTCAAAATGTGTCCTCCAT*CACT
HTMT1_0114_G06.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0059_A01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0045_E11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0015_B05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVR01_0056_B07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0040_F05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0074_H08.b : CGCCCAA*CCTACACTACCCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TCH01_0093_E02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0059_D09.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0067_G02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0089_C10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATACGTCAGAATGTGTCCTCCAT*CACT
BFLT1_0079_D11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0022_G05.b : CG*CCAA*CCTACACTAACCTGAA*TAGGTTGATTAGTCAGATTGTGTCCTC*AT*CCAT
HTMT1_0044_A09.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVR01_0048_G09.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0030_F07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0125_D12.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0002_F04.b : CGCCCCA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCCT*CACC
SPL01_0052_F08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0024_E07.b : CGCCCAA*CCTACACTAACCTGAA*TA*GTTGACAGGTCAGAATGTGTCCTCCAT*CACT
DCI01_0004_D12.b : CGCCCAA*CCTACACTAACCTGAA*TAGGGTGATAGGTCAGATTGTGTCCTCCAT*CCCT
HTMT1_0145_G01.b : CGCCCAA*CCTACACTAANCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
DCI01_0104_H10.b : CGCCCAA**CTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BKFL1_0077_B04.b : CGCCCAANCCTACACTAACTGAAA*TAGGTTGATA*GTCAGATCGTGTCCTCCAT*CACT
DCI01_0080_A10.b : CGCCCCA*CCTACACTAACCTGAAATAGGTTGATA*GTCAGATTGTGTCCTCCAT*CACT
DCI01_0093_E05.b : CGCCCNA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0035_F12.b : aaggcccctctttaacaaaacctgaaaaaggtttatagggcccaaaatgtgtcctcccta
OVRM1_0161_B02.b :
DCI01_0023_B02.b : CGCCCAA*CCTACACTAACtgaataagtgataagtcaaatgtgtctccatccctgcttcc
CBLT1_0021_H01.b : CGCCCAA*CCCACACTAACCTGAA*TAAGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0087_C11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0026_A09.b : CGCCCAA*ACTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
LNG01_0095_F10.b : CGCCCCA*ACTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
HTMT1_0151_C10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
AMP01_0086_A04.b : CGCCCCA*CCTACACTAACCCTGA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0101_H08.b : CGCC*AA*CCTACACTAACCTTGA*TAGGGTGATAGGTCAGAATGTGTCCTCCAT*CACT
TCH01_0075_E04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
AMP01_0099_G04.b : CGCCC*A*CCTACACTAACCTGAA*TAGGTTGATAAGTCAGAATGTGTCCTCCAT*CACT
DCI01_0069_C10.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRM1_0156_C03.b : gatcacggcagaaaagc
OVRM1_0216_D03.b : cca
OVRM1_0176_E11.b :
OVR01_0034_C02.b : cctctcatcattgaactcccctccctacccttacccgcattcccgtctcacgttcccatc
OVR01_0073_G11.b :
OVRM1_0222_B12.b : c
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b : cccatccttactacctgtatatgttgtatggtacatgtgc
OVRM1_0060_G11.b : CGCCCAC*CTACcctacctgaatagg
OVRM1_0165_C09.b :
SPL01_0060_E03.b : aacgcccaaacctaacactaacccgaaaaaggttgaaaaggtccaaaatgttgtcctcca
OVRM1_0210_E08.b : CGCC
OVRM1_0099_B04.b : TGCCCn
OVRM1_0215_B03.b : CGCCCAA*CCC
OVRM1_0084_E07.b : CGCCCAA*CCTACACT
OVRM1_0130_F09.b : CGCCCAA*CCTACACTAAC
OVRM1_0069_F08.b : CGCGCAA*CCT*CACTAAcccgagtaggt
LNG01_0071_A01.b : Atccccactccactaaccgaatatgttgagaagcaaattgtctcccccctcccccattcc
OVRM1_0101_B12.b : CGCCCAA*CCTACACTAACCTGAA*T
OVRM1_0202_H05.b : CGCCCAA*CCTACACTAACCTGAA*ATAGn
OVRM1_0107_E11.b : CGCCCCA*CCTACACTAACCTGAA*TANGGTGATAGG
OVRM1_0186_E12.b : CG*CCAA*CCTACACTGACCTGAA*TAGGTTGATAGGT
OVRM1_0077_H12.b : CGCCCAA*CCTACACTAACCTGAA*ATAGGTGATAGGTCAGAATGTGT
OVR01_0038_E05.b : C*CCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCATTCACT
BFLT1_0151_G01.b : CGCCCAA*CCTACACTAACCTGAA*TANGGTTGATAGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0152_D06.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
BFLT1_0087_F11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
BFLT1_0110_F05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
OVRT1_0125_D04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
SPL01_0098_G07.b : CGCCCAA*CCTACACTAACCTGAA*TAAGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0002_G08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0070_A01.b : CGCCCAA*CCTGCACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
PTG01_0052_G03.b : ACGCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
BFLT1_0095_C03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
ADR01_0047_D02.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0043_H05.b : CGCCCAA*CCTGCACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0126_D04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCCTCAT*CACT
OVRT1_0030_E01.b : CGCCCAA*CCTACACTAAACTGAA*TAGGTTGATAGGTCAGAATGTGTCCNTCAT*CACT
TCH01_0034_B04.b : CGCCCAA*CCTACGCTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0004_A07.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRT1_0030_D04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
OVRM1_0113_A01.b :
TES01_0085_H12.b : CGCCCAA*ACTTACCCTAActgaaaaaggtgaataggccaaattgtgtccctccatccac
TES01_0089_E10.b : CGCCCAA*CCTAC*CTAACCTGAA*TAGGTTGAaaaggccaaatggggtcctccatcccg
TES01_0066_G05.b : CGCCCAA*CCTACACTAACCTGAAATAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACG
PST01_0037_F01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0089_D11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0080_E01.b : CGCCCCA*CCTACACTAACCCTGA*Aaaagttgaaaggccaaatggggtcccccaccctt
TES01_0084_A10.b : CGCCCAA*CCTACACTAACCTTGAATAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0037_D01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0111_A09.b : CGTCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0045_H03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0075_F08.b : gccccaacctaccctaacctgaaaagggtggaaagggcaaattggggccccccccccccg
BFLT1_0113_G03.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGAATGTGTCCTCCAT*CACT
DCI01_0081_E05.b : CGCCCCA*CCTACACTAACCTGAA*TANGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
DCI01_0091_E11.b : CGCCCCA*CCTACACTAACCTGAA*ATAGGTGATAGGTCAGATTGTGTCCTCCAT*CACT
AMP01_0035_H01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
CBLT1_0019_F11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
THY01_0070_G11.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
SMG01_0069_D09.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
HTMT1_0126_H04.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
TES01_0091_A05.b : CGCCC*A*CCTACACTAACCCTGA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0110_D05.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0142_E11.b : aaaggaggcccattcttttaaaattcctggtcgaaaaaaaccctccaatatttgaaacgc
HTMT1_0063_G08.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
UTR01_0014_E01.b : CGCCCAA*CCTACACTAACCTGAA*TAGGTTGATAGGTCAGATTGTGTCCTCCAT*CACT
BFLT1_0136_A10.b : tggtatgaaagcccaacctacactaacctgaaaagggtgaaggtcagaatttttcctcca
CBLT1_0045_E03.b :
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
---------+---------+---------+---------+---------+---------+ 958
AMP01_0004_H06.b : ccggaattaatttgtataaaatcctaaaaacctggtgccaactccctactcattatcctg
AMP01_0004_G12.b : ctgatatataatcatccacataaatactctatataaacaaaatttataaattaatcttgt
AMP01_0097_D05.b : cctgaggtttgtggggcccgaaagttaatctaacgaatttccgaccaacctgtggcccat
AMP01_0094_B04.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAAATGTT*ATCTGACAGAATT*CC**GACAA
OVR01_0031_F08.b : GCTT*CCCTGAAGGTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCAGAACCA
DCI01_0069_B04.b : GCTT*CCCTGAGGGTTGATGGGGCCtgnaatgtgatctgancgattccagaacaactgnt
BFLT1_0145_B06.b : ggcttcccggaggtttgagggggccccgaaggttgattctgaaaaattctccgacaaacg
ADR01_0076_E05.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CA**GAACA
BFLT1_0091_C02.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CC**AGACC
PCT01_0035_A07.b : GCTT*CCCTGAAAGTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCAGAAACA
TES01_0088_F11.b : ggcttccccggaaggtttgatggggcccccgaaatggttaatcttgaaagaatttcccaa
SPLT1_0043_A04.b : GCTT*CCC*GAAGTTTGATGGGGCCC*TGAAAGGTT*ATCTGAAAAAATTtccaaccaaa
TES01_0109_E01.b : GCTT*CCCTGAGGTTTGAAGGGGGCC*TGAATGTTGGATCTGACAAAATTTCCGAAACCA
OVRT1_0105_E01.b : GCTT*CCCTGGAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CA***AACC
HTMT1_0027_D01.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGATTGTTG*ATCTGACAGAATT*CC**AGACC
HTMT1_0129_E10.b : GCTT*CCCTGAGGTTNNGATGGGCCC*TGAATGTTG*ATCTGACAGAATT*CC**AGACA
CBLT1_0095_D07.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CC**AGACC
CBLT1_0048_D10.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATT*CCA*GACCA
BFLT1_0069_F07.b : GCTT*CCCCTGAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCAGAACCA
HTMT1_0104_H08.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
HTMT1_0150_B05.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*AAACA
HTMT1_0121_F03.b : GCTT*TCCTGAAGGTTGATGGGGGCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
TCH01_0073_B05.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CA**GACCA
CBLT1_0069_D11.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CAG*GCCCA
CBLT1_0044_H05.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*GACCA
HTMT1_0125_C04.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*GACNA
HTMT1_0079_C02.b : GCTT*CCCTGANGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*GAACN
ADR01_0089_D12.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CA**GAACN
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : ccccggaggtttaaagggcccctaaatgttattctaaaaaaatccaaaacaacgtggggg
TES01_0073_G04.b : ccttcccgaagtttgaaggggccccgaaagtttattttaaaaaatcccaaaacaaccggg
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : GCTTTCCCTGAAGTTTGATGGGGCCCCTGAATGTTG*Aatctaacaaaattcccaaccaa
OVRT1_0124_F07.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATT*CC**AAAAC
OVRT1_0122_E02.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTC*CCA*GACAA
SPL01_0009_F06.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGAAAGAATT*CAA*AACCA
BFLT1_0150_D03.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTC*CA**GACCA
TES01_0005_H09.b : GCTT*CCCTGGAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
OVRT1_0129_H10.b : GCTT*CCCTGAGGTTNGATGGGGGCC*TGAATGTTG*ATCTGACAGATTC*CA***GACN
OVRT1_0127_D10.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATT*CC**AGACC
BFLT1_0035_F04.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CA**GAACC
OVRT1_0099_H03.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATC*CA**GAACA
OVRT1_0145_F01.b : GCNT*CCCTGAAGTTTGATGGGGCCN*NTGAATGTG*ATCTGACAGAATT*CA***GACA
BFLT1_0002_D06.b : GCTT*TCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CA**GAACA
BFLT1_0072_E06.b : GCTT*CCCTGAANGTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CC**AGACA
TES01_0013_A04.b : GCTT*CCCTGAAGTTTGATGGTGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0054_F01.b : GCTT*CCCTGAAGTTNGATGGGGCCN*TGAAATGTG*ATCTGACAGAATT*CA**GAACC
BFLT1_0063_D01.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CA**GAACA
BFLT1_0088_F02.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CAG*AACAA
SPL01_0041_G06.b : GCTT*CCCTGGGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCAGAACCA
ITT01_0064_B08.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0110_E03.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*TCAGAACCA
TCH01_0091_A05.b : GCTT*CCCTGAGGGTTGATGGGGCCC*TGAATGTTA*ATCTGACAGAATT*CCA*GACCA
HTMT1_0057_H05.b : gaaaaattcaaaacaactggggccatcccgcatcctttccttgggccaatttgcctgtat
DCI01_0021_A01.b : tcccccaaggttggaaggggccctgaaagttttatttgtaaaaattccaaaacaaccggg
DCI01_0101_E01.b : tggggcccttaagtttattttcaaaattcccaaacaaccgggggcctatccccgatcctt
OVRM1_0212_F01.b :
DCI01_0027_H06.b : gggccctgaagttgattgacggatttcgaacaaccggtggcctatcccggatcatttccc
OVRM1_0117_B10.b :
DCI01_0021_D08.b : ccctgaggttgatggggccctgatgtttatctgacaaaatccaaacaacctggtgcccta
CBLT1_0023_B03.b : GCCT*CCCTGAGGTTTGATGGGGCCC*TGAAGGTTG*ATCTGACGAAATT*CCA*AACCA
DCI01_0041_F03.b : GCTT*TCCTGAAGTTTGATGGGGCCtgaaaattgatctgacgaatttcagacaacccggg
CBLT1_0051_A12.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CA***GACC
HTMT1_0114_G06.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CA**GAACC
CBLT1_0059_A01.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CCA*GACCA
HTMT1_0045_E11.b : GCTC*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CC**AGACC
HTMT1_0015_B05.b : GCTT*CCCTGAGGTTTGATGGGGGCC*TGAATGTTG*ATCTGACAGAATC*CCA*GACCA
OVR01_0056_B07.b : GCTT*CCCTGAGGTTTGATGGGGCCCCTGAATGTTG*ATCTGACAGAATT*CCAGACCAA
CBLT1_0040_F05.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CA**GACCA
HTMT1_0074_H08.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGGTG*ATCTGACAGATTT*CA**GACCA
TCH01_0093_E02.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
CBLT1_0059_D09.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
HTMT1_0067_G02.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CA**GAACN
DCI01_0089_C10.b : GCTT*CCCTGAGGTTTGATGGGCCCN*TGA*TGTTG*ATCTGACATAAAT*CC**AGACA
BFLT1_0079_D11.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTCG*ATCTGACAAATTC*CA**GACCA
DCI01_0022_G05.b : GCT**CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACGAATTT*CA**GAACA
HTMT1_0044_A09.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
OVR01_0048_G09.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGGTG*ATCTGACAGAATT*CCA*GACCA
OVRT1_0030_F07.b : GCTT*CCCTGAAGGTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*AAACA
BFLT1_0125_D12.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CAG*GACAA
DCI01_0002_F04.b : GCTT*CCCTGAGGTTTGACGGGCCCC*TGAATGTTG*ATCTGACAGAATT*CCA*AAACA
SPL01_0052_F08.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CC**AGACA
DCI01_0024_E07.b : GCTT*CCCTGANNGTTGATGGGGCCC*TGAACGTTG*ATCTGACAGAATT*CA**GAACN
DCI01_0004_D12.b : GCTT*CCCTGAAGTTTGATGGGGGCC*TGAATGTTG*ATCTGACANAATT*CC**AAACC
HTMT1_0145_G01.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*GACAA
DCI01_0104_H10.b : GCAT*CCCCTGAGTTTGATGGGGCCC*CTGAATGTG*ATCTGACAGAATT*CA**GAACA
BKFL1_0077_B04.b : GCTT*CCCTGANGTTNGATGGGGNCC*TGNNATGTG*ATCTGACAGAATT*CCA*GACNA
DCI01_0080_A10.b : GCTT*CCCTGNNAGTTGATGGGGCCN*TGNNATGTG*ATCTGACAGAATT*CCA*GACCA
DCI01_0093_E05.b : GCTT*CCCTGANGTTNNGATGGGCCC*NNTGATGTG*ATCTGACAGAATT*CA**GAACC
DCI01_0035_F12.b : cacgggttctccggaaggttttaaggggcccttaaagatttaatttcaacaaatctccaa
OVRM1_0161_B02.b :
DCI01_0023_B02.b : ctgagtttgatggggcctgaatgtgatctgaacaaattccaacaaccttggtgcctaccc
CBLT1_0021_H01.b : GCTT*CCCTGAGGGTTAGAGGGGGCC*TGAATGTTG*ATCTGAACAAAAT*CCAGAACCA
CBLT1_0087_C11.b : GCTT*CCCTGAGGGTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTC*CA**AACCA
CBLT1_0026_A09.b : GCTT*TCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GAACA
LNG01_0095_F10.b : GCTT*TCCTGAAGTTTGATGGGGCCT*TGAATGTTG*ATCTGACAAAATT*CCA*GAACA
HTMT1_0151_C10.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
AMP01_0086_A04.b : GCTT*CCCNTGAGNTTGATGGGGCCC*TGNAATGTG*ATCTGACAGAATT*CA**GACCC
DCI01_0101_H08.b : GCTT*CCCTGAGGTTNGATGGGGCCT*GNNATG*TG*ATCTGACAGAATC*CA**GAACN
TCH01_0075_E04.b : GCTT*TCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GAACA
AMP01_0099_G04.b : GCTT*CCCTGANGTTTGATGGGGCCT*TGAATGTTG*ATCTGACAGAATT*CC*GACCAA
DCI01_0069_C10.b : GCTT*TCCTGAGGTTNGATGGGGCCC*TGNAATGTG*ATCTGACAGAATT*CA**GGCCN
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : cccccctccatcaacgtctccctcccccttgatccctcccttcatcctactctccttacc
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : atcaagtggctttccctgaaagttttgaaggggggccctgaaaaggtttaatctgaacaa
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : tttagtttaatgggcccccaatcttctcggccgaattccaaaaaaagaggtccctaaccc
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : GCTT*CCCTGAGGTTTGATGGGGCCCTGAAATGTTG*ATCTGACAGAAATTCCAAACCAA
BFLT1_0151_G01.b : GCTT*TCCCTGAGTTTGATGGGGCCC*TGAATGTTG*ATCTGAACGAATT*NCAAGACCA
BFLT1_0152_D06.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACAA
BFLT1_0087_F11.b : GCTT*TCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CA**AGACC
BFLT1_0110_F05.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CA**AAACA
OVRT1_0125_D04.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CCA*GACAA
SPL01_0098_G07.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAGATT*CCAAGACCA
OVRT1_0002_G08.b : GCTT*CCCTGAAGTTTGAATGGGCCC*TGAATGTTG*ATCTGACAGAATT*CA**GAACA
BFLT1_0070_A01.b : GCTT*TCCTGAGGTTNGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCAGAACCA
PTG01_0052_G03.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CA**GACCC
BFLT1_0095_C03.b : GCCT*CCTTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATC*CA**GACCA
ADR01_0047_D02.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0043_H05.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCC
BFLT1_0126_D04.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CA**GAACC
OVRT1_0030_E01.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATT*CCA*AACCA
TCH01_0034_B04.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0004_A07.b : GCTT*TCCTGAAGTTTGATGGGGCCC*TGAAATGTG*ATCTGACAGATTT*CA**GAACC
OVRT1_0030_D04.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CC**AGACA
OVRM1_0113_A01.b :
TES01_0085_H12.b : tgcttccctgaagttttgatgggggccctgaaagttgaatcctgaacagaatttccaaaa
TES01_0089_E10.b : gcttccccgaagttttgatggggccttgaaaggttaatttgacaaaaattccaaaccaac
TES01_0066_G05.b : GCCT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTGATTCTGACAAAATT*CCA*AACCA
PST01_0037_F01.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CAA*GACCA
TES01_0089_D11.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAAAT*TCA*GAACA
TES01_0080_E01.b : gcttccctgaagtttgaatggggcccttaattgttgatttgaaaaaaattccaaaacaaa
TES01_0084_A10.b : GCTT*CCCTGAGGTTTGATGGGGGCC*TTGATGTTG*ATCTTGACAAATT*CCA*GACCA
TES01_0037_D01.b : GCTT*CCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGAAAAAATT*CC*GGACCA
TES01_0111_A09.b : GCTT*TCCTGAAGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAAAATT*CCA*GACCA
TES01_0045_H03.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGATTT*CC**AGACA
TES01_0075_F08.b : ctccccgaagtttgaagggggcccccaaagtttatttgaacaaattcccaaaaaacctgg
BFLT1_0113_G03.b : GCTT*CCCTGAANGTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATC*CCA*AACCA
DCI01_0081_E05.b : GCTT*CCCTGANGTTNGATGGGGCCN*TGNNATGTG*ATCTGACAGAATT*CA**GAACC
DCI01_0091_E11.b : GCTT*CCCCTGAGGTTGATGGGGCCN*TGNNATGTG*ATCTGACAGAATT*CA**GAACC
AMP01_0035_H01.b : GCTT*CCCTGAANGTTGATGGCGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
CBLT1_0019_F11.b : GCTT*CCCTGAGGTTTGATGGGGCCC*CTGAATGTG*ATCTGACGAAATT*CAA*GACCA
THY01_0070_G11.b : GCTT*CCCTGAG
SMG01_0069_D09.b : GCTT*CCCTGAGGTTTGATGGGCCCC*TGA*TGTTG*ATCTGACAGAATT*CC**AGACA
HTMT1_0126_H04.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTGG*ATCTGACAGAATT*CA**GAACA
TES01_0091_A05.b : GCTT*CCCTGAANGTTGATGGGGCCC*TGAATGGTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0110_D05.b : GCTT*CCCTTANGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GAACA
BFLT1_0142_E11.b : cccaacccctaaacttaaacccggaaaaaagggttgaaaaggggcaaaaattggggtccc
HTMT1_0063_G08.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
UTR01_0014_E01.b : GCTT*CCCTGAGGTTTGATGGGGCCC*TGAATGTTG*ATCTGACAGAATT*CCA*GACCA
BFLT1_0136_A10.b : ccacggttccctgaagttgaaggggcccggaaGTTG*ATTTGACAGAATT*CC**GACCA
CBLT1_0045_E03.b : tttcccaagtacacg
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
---------+---------+---------+---------+---------+---------+ 1016
AMP01_0004_H06.b : gtccaatactccgttaaccttcgataaaccctcccatgccctttctctcataaaaccact
AMP01_0004_G12.b : tttattataaaagatttgtctattccccaccaccactcttcccctcgc
AMP01_0097_D05.b : cccccctcccttttccctgggtccacattccccctgtctttcccgctaaaaaacctaccc
AMP01_0094_B04.b : ACCTGGTGCCCTAT*CCCCGCATCATTTT*CCTC*TGGtccatatgcccctgtctccctg
OVR01_0031_F08.b : CCTTGGTGGCCTAT*CCCCGCATCCATTT*CCCT*CTGGGCCCcatatgcccccggccac
DCI01_0069_B04.b : gccctatccgcatcatttcctctggcacatatgccctgtcatcttgctgagaaagctacc
BFLT1_0145_B06.b : tggggccctacccccgtatcctttttccttggggaaattttggccctgttatttttgggg
ADR01_0076_E05.b : ANCTGGTGCCNTAT*CCCCCGCATCATTC*CNTC*TGGCACATAT*GCCC*TGTCATCTC
BFLT1_0091_C02.b : AACTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGNCACATATGCCCC*TGTCATCTC
PCT01_0035_A07.b : ACT**GTGCCCTA**CCCCGCATCCATTTCC****TCTGGCACATACCCCCCGTCA*CTC
TES01_0088_F11.b : accaaccctggtggccctatccccccgcattccattttcccccttgggcccccaaatgcc
SPLT1_0043_A04.b : ccgggtgccctatccccgcattcattttcccctcgggccaaaatgcccctgttatttttg
TES01_0109_E01.b : ACCTGGTGCCCTATCCCCCGCATCCATTTTCCTCTGGgccaaaattgccccctgtcatct
OVRT1_0105_E01.b : AACCTGTGGCCTAT*CCCCGCATCAATTTCCCTC**GGCCAATAAGCCCC*TGTCATCTC
HTMT1_0027_D01.b : AACTGGTGCCCTAT*CCCCGCATCCTTTTCCTC**TGGCCAATATGCCCC*TGTCATCTC
HTMT1_0129_E10.b : ANCTGGTGCCCTAT*CCCCGCATC*ATTTCCCTCTGGNCACATATGCCCC*TGTCATCTC
CBLT1_0095_D07.b : ACCTGGTGCCCTAT**CCCGCATTCATTTCCCTC*TGCCACATATGCCCC*TGTCATCTC
CBLT1_0048_D10.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCCTGCCAAATAAGCCCC*TGTCATCTC
BFLT1_0069_F07.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
HTMT1_0104_H08.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*GGTCATCTC
HTMT1_0150_B05.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTCCCTCTGGNCACATATGCCCC*TGTCATCTC
HTMT1_0121_F03.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTC*TGGCACATATGCCCC*TGTCATCTC
TCH01_0073_B05.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
CBLT1_0069_D11.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTTCCTCTGGGCACATATGCCCC*TGTCATCTC
CBLT1_0044_H05.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
HTMT1_0125_C04.b : NNCTGGTGCCTTAT*CCCCGCATCCATTTTCCTCTGGCCACATATGCCCC*TGTCATCTC
HTMT1_0079_C02.b : ANCTGGTGCCCTAC*CCCCGCATCCATTTCCCTCTGGNCACATATGCCCC*TGTCATCTC
ADR01_0089_D12.b : NAACTGGTGCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : ccctattcccccatcattttcctctgggcaaaatattcccctggtatttttgctgaaaaa
TES01_0073_G04.b : gccccatccccccatccatttccccttgggcccaaatgccccctggtattttggttaaaa
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : acctgggtgccttatccccgcttccattttcccttcgggccaatttgcccccctggcacc
OVRT1_0124_F07.b : AACTGGTGCCCTAT**CCCGCAATCATTTCCTCTGGCAacaatgccctgtcatcctgctg
OVRT1_0122_E02.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTTCGGCCAatatgcccctgttcttctct
SPL01_0009_F06.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCCCTGTCATtcc
BFLT1_0150_D03.b : ACCTGGTGCCCTAT**CCCGCATTCATT**CCNTCTGGCCAATATGCCCC*TGTCATCTC
TES01_0005_H09.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTTCCTCTGGCCACATATGCCCCCTGTCATCTC
OVRT1_0129_H10.b : AACTGGTGCCCTAT**CCCGCATCCATTTCC****TCGGGCACATAGGCCCTGTCATCTC
OVRT1_0127_D10.b : ACCTGGTGGCCTAT*CCCCGCATCAATTTTCCTC*TGGCCAATATGCCCC*TGTCATCTC
BFLT1_0035_F04.b : ACCTGNTGCCNTAC*CCCCGCATCCATTCCCTC**TGCCACATATGCCCC*TGTCATCTC
OVRT1_0099_H03.b : ACCTGGTGGCCTAC*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
OVRT1_0145_F01.b : ACNTGGTGCCCTA**CCCCGCATCATTTCCCTC**TGGCACATATGCCC**TGTCATCTC
BFLT1_0002_D06.b : ANCTGGTGCCNN*TATCCCGCATCCATTTCCTC**TGGCACATATGCCCC*TGTCATCTC
BFLT1_0072_E06.b : AACTGNTGCCCTAT*CCCCGCATCCATT*CCCTCTGGCCCAATATGCCCC*TGTCATCTC
TES01_0013_A04.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
BFLT1_0054_F01.b : AACTGGTGCCNTAT*CCCCGCATCAATTCCCNTC*TGCCACATATGCCCC*TGTCATCTC
BFLT1_0063_D01.b : AACTGGTGCCCTA**CCCCGCATCCATTTCCCTC*TGGCCAATATGCCCC*TGTCATCTC
BFLT1_0088_F02.b : ACCTGTTGCCCTAC*CCCCGCATCCATT*CCCTCTGGCCACATATGCCCC*TGTCATCTC
SPL01_0041_G06.b : ACCTGGTGCCCTATCCCCGCATCCAATTTCCCTCTGGGCCCATATGCCCCTTGTCATCTC
ITT01_0064_B08.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
BFLT1_0110_E03.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
TCH01_0091_A05.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
HTMT1_0057_H05.b : tctgttaaaaaaccaactgaaacttttgtaaagaaaacccaatggttgtttgacccccaa
DCI01_0021_A01.b : ggcccttctcccccaaccttttcctttgggccaaaaatcccctggttttttttcaaaaaa
DCI01_0101_E01.b : ttcctttgggccaatagcccctgctactctggcgaaaaaacctaccaggaaaactttttt
OVRM1_0212_F01.b :
DCI01_0027_H06.b : ttggcccaaatgcccctgtcatctgctgaaaaagctacatgaaagctttctgtacaaaat
OVRM1_0117_B10.b :
DCI01_0021_D08.b : tcccgcatcatttcctctggcacctatgccccgtcatcctgctgaaaagctacatgaaca
CBLT1_0023_B03.b : ACCTGGTGCCCTAA*CCCCCCATCCTTTTCCCTCGGGGCAaaatgcccccggtaactctg
DCI01_0041_F03.b : tgcctatcccgcattcattccccttgggcacaatagccctgttctctctgcggaaaagcc
CBLT1_0051_A12.b : ACCTGGTGCCCTA**CCCCGCATCCATTCCCTC**TGGCACATATGCCCC*TGTCATCTC
HTMT1_0114_G06.b : AANCTGTGCCCTAT**CCCGCATCCATTTCCTC**TGGCACATATGCCCC**TGTCTCTC
CBLT1_0059_A01.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTC*TGGCACATATGCCCC*TGTCATCTC
HTMT1_0045_E11.b : AACTGGTGCCCTAT**CCCGGCATCATTTCCCTC*TGGCCCATATGCCCC*TGTCATCTC
HTMT1_0015_B05.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
OVR01_0056_B07.b : CCTGGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
CBLT1_0040_F05.b : ACCTGGTGCCCCTA*TCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
HTMT1_0074_H08.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTTCCTCTGGCCACATATGCCCC*TGTCATCTC
TCH01_0093_E02.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
CBLT1_0059_D09.b : ACCTGGTGCCCTA**CCCCGCATCCATTTCCCTC*TGCCACATATGCCCC*TGTCATCTC
HTMT1_0067_G02.b : ANCTGGNTGCCTAC*CCCCGCATCCATTCCCTC**TGGCACATATGCCCC*TGTCATCTC
DCI01_0089_C10.b : ACCTGGTGCCCTAT**CCCGCATCatttccntctggncaatatgccctgtcattctgctg
BFLT1_0079_D11.b : ACCTGGTGCCCTAT*CCCCGCATCCATT*CCCTCTGGCCACATAATGCCC*TGTCATCTC
DCI01_0022_G05.b : AACTGGGTGCCTAT*TCCCGCATCATTTT*CCTC*TGgccaaaagcccctggtatcctgc
HTMT1_0044_A09.b : ACCTGGTGCCCTAT*CCCCGCATCCATTCCCTC**TGGCACATATGCCCC*TGTCATCTC
OVR01_0048_G09.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
OVRT1_0030_F07.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
BFLT1_0125_D12.b : NCNTGGTGCCCTAT*CCCCGCATCATTTTCCTC**TGGGCAATATGCCCC*TGTCATCTC
DCI01_0002_F04.b : ACTGGNTGCCCTAT**CCCCCATCCATTTTCCTC*TGACACATATGCCCtgtcctctcgc
SPL01_0052_F08.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
DCI01_0024_E07.b : AACTGGTGCCCTAT*CCCCGCATCCATTT*CTTC*TGCCCACTATGGCCC*TGTCATCTC
DCI01_0004_D12.b : ACCTTNTGGCCCAT*CCCCGCATCCATTTCCCTC*TGGCCAATATGCCCC*TGTCAccct
HTMT1_0145_G01.b : NNCTGGTGCCCTAT*CCCCGCANTCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
DCI01_0104_H10.b : ACCTGGTGCCCTAT**CCCGCATC*ATTTTCCTCCTGGCAACTATGCCCC*TGTTATCTC
BKFL1_0077_B04.b : NNCTGGTGCCNTAT*CCCCGCATCCATTT*CCTCTGGNCACATATGCCCC*TGTCATCTC
DCI01_0080_A10.b : NCCTGNTGCCCTAT*CCCCGCATCCATT*CCCTCTGGNCACATATGCCCC*TGTCATCTC
DCI01_0093_E05.b : ANCTGNTGCCCNTATCNNCGCATCATT***CCNTCTGGCACATATGCCCC*TGTCAT*TC
DCI01_0035_F12.b : accaaaccggggcccaataaccccagacaattttccctttggcccacaaggcccccgggg
OVRM1_0161_B02.b :
DCI01_0023_B02.b : cgcatcatttcctctggcaacatagccctgtatctcgctaaaaggctacatgaccgcttt
CBLT1_0021_H01.b : ACCTGGTGgccatatccccgcatccattttcctttgggccaaaaatgcccctgttatctc
CBLT1_0087_C11.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCCTGGTCATCTC
CBLT1_0026_A09.b : ACCTGGTGCCTTAT*CCCCGCATCCATTTTCCTCGGGCAAATAATGCCC**TGTCATCTC
LNG01_0095_F10.b : ACCGGGTGCCCTAT*CCCCGCATCATTTT*CCTCTTGGCAACTATGCCCC*TGTCATCTC
HTMT1_0151_C10.b : ANCTGGTGCCCTAC*CCCCGCATCCATTTCCCTC*TGCCACATATGCCCC*TGTCATCTC
AMP01_0086_A04.b : ACCTGNTGCCCCTA*TCCCGCATCATTTT*CCTC*TGCCACATATGCCCC*TGTCActct
DCI01_0101_H08.b : ANCTGGTGCCCTATTCCCGCANTCA***TTCCNTCTGGCACATATGCCCN*TGTCATtct
TCH01_0075_E04.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
AMP01_0099_G04.b : CCCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
DCI01_0069_C10.b : ANCTGNTGCCCNTA*TCCCGCATCCATTCCCTC**TGGCACATATGCCCC*TGTCATCTC
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : taactctttccccactcactcttctcttttccccctctttattttcttctcggctccacc
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : aaatttccaaaaaccaaaccagggtggcccctaatcccccgaaattcatttttccccttc
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : cccatcatttccttcttgcaagaaagccccatgaatccctccctaaaaacccaccattaa
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : CCCTGGTGCCCTATCCCCcgcatccatttcccctctggcaccatattgcccctggccttt
BFLT1_0151_G01.b : AC*TGGTGCCCTAC*CCCCGCATCAATTTCCTCTGGGCACtatgcccctgtcttctcgct
BFLT1_0152_D06.b : ACCTGGTGCCTAC**CCCCGCATCCATT**CCTTCTGGCAAATATGCCCCTGTatctctg
BFLT1_0087_F11.b : ACCTGGTGCCCTAT**CCCGCATCCATTCCCTC**GGGCACATATGCCCTGTCATtctgc
BFLT1_0110_F05.b : ACCTGGTGCCCTAT**CCCGCATCCATTTCCTC**TGGCCAATATGCCCC*TGTCATCTC
OVRT1_0125_D04.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTCCTTT***GGCCACATAGCCCCTGTCATCTC
SPL01_0098_G07.b : ACCTGGTGCCCTATCCCCGCATTCATTTTCCCTCTGGCCACATATGCCCCCTGTCATCTt
OVRT1_0002_G08.b : ANCTGGTGCCCTAT**CCCCCATCCATTTCCTC**TGCCCCATATGCCCC*TGTCATCTC
BFLT1_0070_A01.b : ACTGGTGGNCCTA**CCCCCGCATCATTTCCNTCTGGNCACATATGCCCC*TGTCATCTC
PTG01_0052_G03.b : ACCTGGTGCCCTAT*CCCCGCATCAATTTCCCTCTGGCCACATATGGCCC*TGTCATCTC
BFLT1_0095_C03.b : ACCTGGTGCCCTAC*CCCCGCATCCATTTCCCTC*TGCCAAATATGCCCC*TGGCATCTC
ADR01_0047_D02.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
BFLT1_0043_H05.b : AACTGGTGCCCTAC*CCCCGCATCCATTTCCTTCTGGCCACATATGCCCC*TGTCATCTC
BFLT1_0126_D04.b : AACTGGTGCCCTAT*CCCCGCATCCATTTC**TTCTGNCACATATTGCCC*TGTCATCTC
OVRT1_0030_E01.b : AACTGGTGCCCTAT*CCCCGCATTCATTTCCCTCTGGGCAAATATGCCCC*TGTCATCTC
TCH01_0034_B04.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
BFLT1_0004_A07.b : ACCTGGTGCCCTA**CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
OVRT1_0030_D04.b : ACCTGGTGCCCTAC*CCCCGCATCCATT*CCNTCTGGCCACATATGCCCC*TGTCATCTC
OVRM1_0113_A01.b :
TES01_0085_H12.b : ccaaccctgggtgccctattcccccgccttccattttcccctccgggccaaatattgccc
TES01_0089_E10.b : ctggtggccaatccccccatccatttccccttgggccaattggcccttggcattcctgcc
TES01_0066_G05.b : ACCTGGTGCCCTAT*CCCCCCACCCTTTTCCCTCGGGCCCCTTATGCCCC*TGTCTCCCT
PST01_0037_F01.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
TES01_0089_D11.b : AACTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
TES01_0080_E01.b : cctgggggcctttcccccccatccttttcccttgggcccaaattccccctggtatctttg
TES01_0084_A10.b : ACCTGGTGCCCTAT*CCCCGCATCCTTTTCCTC**TGGCCCCTATTGCCCCTGTTATCTC
TES01_0037_D01.b : CCTGGTGGCCCTAT*CCCGCCTCCATTTC*CCTC*TGGGCCATATGGCCC*TGTCATCTC
TES01_0111_A09.b : ACTTGGTGGCCTAA*CCCCGCATCCATTTCCCTCTGGCCCCATATGCCCCCTGTCACCTC
TES01_0045_H03.b : AACCTGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
TES01_0075_F08.b : gggccctttccccccatcctttttcccctgggccaaaatgcccccgttcttcttttctaa
BFLT1_0113_G03.b : ACCTGGTGCCCTAT*CCCCGCATCCATT*CCCTNCGGCCACATATGCCCC*TGTCATCTC
DCI01_0081_E05.b : ANCTGGTGCCNN*TATCCCGCATCCATT*CCNTCTGGNCACATATGCCCC*TGTCATCTC
DCI01_0091_E11.b : AACTGNTGCCCTAT*CCCCGCATCCATT*CCNTCTGGNCACATATGCCCC*TGTCATCTC
AMP01_0035_H01.b : GGCTGGTGCCCTAT*CCCCGCATCCATTTCGCTCTGGNCACATATGCCCC*TGTCATCTC
CBLT1_0019_F11.b : ACCTGTTGCCCTAC*CCCCGCATCCATTTCCTTCTGGCCAAATATCCCCC*TGTCATCTC
THY01_0070_G11.b :
SMG01_0069_D09.b : ACCTGGTGCCCTAT*CCCCGCATCCATTT*CCTCTGGCCACATATGCCCT*TGTCATCTC
HTMT1_0126_H04.b : ANCTGGTGGCCTA**CCCCGCATCCATTTCCTC**TGGCACATATGCCC**TGTCATCTC
TES01_0091_A05.b : CCCTGGTGCCCTAT*CCCCGCATCCATTTTCCTCTGGCCACTTATGCCCC*TGTCATCTC
BFLT1_0110_D05.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGGCACATATGCCCC*TGTCATCTC
BFLT1_0142_E11.b : cccataccatgggcttcccctgaagggtttaatgggggcccccttaaagtgttatattta
HTMT1_0063_G08.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
UTR01_0014_E01.b : ACCTGGTGCCCTAT*CCCCGCATCCATTTCCCTCTGGCCACATATGCCCC*TGTCATCTC
BFLT1_0136_A10.b : ACCTGGGGCCTATC*CCCGGCATCCATTTCCCTTTGGCCACATATGCCCT*CGTCATATT
CBLT1_0045_E03.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCCC*TGTCACCTT
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
---------+---------+---------+---------+---------+---------+ 1075
AMP01_0004_H06.b : ttttttttgccctaaactttaaaa
AMP01_0004_G12.b :
AMP01_0097_D05.b : ttaaaaactttttttgaaccaaaaattaccaaggccttgctttgaacccccccaaccaaa
AMP01_0094_B04.b : ctgaaaaaaccctacctgaaaacctttctgaagcaaagattaccaatgcttgcttttgac
OVR01_0031_F08.b : ctctggctgaaaaaagcctacccaggaacagcttttttggaacaagaaaacacccaatgg
DCI01_0069_B04.b : tgaacgctttctgtacaaaatcccatgcttgcttgaccaccaccaatgggaatggtacct
BFLT1_0145_B06.b : aaaaaagccaccaagaaaagctttttggaaaaaaatatacaaggctgtgttttggccccc
ADR01_0076_E05.b : TGCTGAGAAAGC*TA*CATGAA*CAGCTTCTGTAGAG*AGATCACCA**TGCTTGCTTnn
BFLT1_0091_C02.b : TGCTGAGAAAAGCTACATGAAA*AGCTTTCTGTAACC*GAAATCACaatggctgctttga
PCT01_0035_A07.b : TGCTGAGAAAGCTA**CATGAA*CAGCTTCTGTAGCG*AAATCACAA**TGCCTGCTTga
TES01_0088_F11.b : ccctggttctttccctgctgaaaaaaagccccccccttgaaacacctttttttttgtccc
SPLT1_0043_A04.b : cttgaaaaccccaacctggaaaactttttttaaaaaaaatatccatagtgtcctttgacc
TES01_0109_E01.b : cggcctgaaaaaacctaacaggaaaaacctttctgtagcaaaaaattccaagggcttgct
OVRT1_0105_E01.b : TGCTGAAAAAcctacatgacagctttctgtacaaaaatacaatgctgctttgacccacca
HTMT1_0027_D01.b : TGCTGAGAAAGCCACCATGAcagcttttgtaacaaaaatcacaatgcttgctttgaccac
HTMT1_0129_E10.b : TGCTGAGAAAGC*TACCAGNAC*AGCTTTCTGTAGCA*Ggatcacaatgcttgctttnga
CBLT1_0095_D07.b : TGCTGAGAAAAGCTACCTGAAC*AACTTTCTGTAGCA*AAGATCAACAATGGCTGCTTTG
CBLT1_0048_D10.b : TGCTGAGAAACCTAACCAGAAC*AGCTTTCTGTACCA*AAAATCACCAAGGCTTGCTTTG
BFLT1_0069_F07.b : TGCTGAAAAAACTTACCATGAACAGCTTTCTGTAACA*AAAATCCCAAATGCTgccttga
HTMT1_0104_H08.b : TGCTGAAGAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCCTTT
HTMT1_0150_B05.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTAACA*GAAATCACAA*TGCTTGCTTTG
HTMT1_0121_F03.b : TGCTGAAAAAGC*TACCAGGAACAGCTTTCTGTAACA*AAGATTACCAATGCCTGCTTTG
TCH01_0073_B05.b : TGCTGAAGAAGCCTACCATGGACAGCTTTCTGTACCA*GAAATCACCCATGCTTGCTTTG
CBLT1_0069_D11.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
CBLT1_0044_H05.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
HTMT1_0125_C04.b : TGCTGAGAAAGCCNTACATGAACAGCTTTCTGTAGCA*GAGATCAACAATGCTTGCTTGG
HTMT1_0079_C02.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCAACCATGCTTGCTTTT
ADR01_0089_D12.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : accctacaagaaacacctttttgtaacaaaatttaccaattgctgcttttgaccccccaa
TES01_0073_G04.b : aaccctccccaaaaacctttttttgaacaaaaaaccccaaggtttttttttaccccccca
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : cctgctgaaaaaagcccaccattaaaacgcttttcgttaacaaaaaatcaccaatggctg
OVRT1_0124_F07.b : aaaagcctacatgaacactttctgtacaaaaatacatggctgctttagccaccaaccaat
OVRT1_0122_E02.b : gctgaaaaacctaccatgaacagccttctgtagcaaagatacccaaggcttgcttttagc
SPL01_0009_F06.b : ctgctgaaaaaaggcctaccatgaacaacttttctgtaccaaaaaatcacaaatgctttg
BFLT1_0150_D03.b : TGCTGAGAAgcctacatgaacagcttctgtacagagatccacatgctgctttagcagcca
TES01_0005_H09.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAACC*AAAATCACCAATGCTTTGCTTG
OVRT1_0129_H10.b : gctgaaaaagcttacatgacagcttccgtaacaagatcaccatgctggcttgacccacca
OVRT1_0127_D10.b : TGCTGAAAAAGCCTACCATGAcgcttttctgtacagaaaataccatgcttgctttgaacc
BFLT1_0035_F04.b : TGCTGAGAAAGCTACCATGAAC*AGCTTctgtancaagatcaccatgcttgctttgagcc
OVRT1_0099_H03.b : TGCTGAAAAAGCATACATGACC*AGCTTTCcgtacaaaaattaccaatgcttgcttggaa
OVRT1_0145_F01.b : TGCTGAAAAGCCTA**CATGAA*CACTTTCgttacaaaatcacaatgcttgcttgaccac
BFLT1_0002_D06.b : TGCTGAGAAAGCCTACATGAAC*AGCTTCTGTacagaaatcaccatgcttgctttgagca
BFLT1_0072_E06.b : TGCTGAGAAACCTACCATGAAC*AGCTTTCTGatacgagatcaccatggctgcttggagc
TES01_0013_A04.b : TGCTGAGAAAGCCTACATGAAC*AGCNTTCTGTAGCA*GAGATCACCAATGCTTGC*TTG
BFLT1_0054_F01.b : TGCTGAAAAGGCCCTACATGAACAGCTTTCTGaacagaaatcacaatgcttgcttggagc
BFLT1_0063_D01.b : TGCTGAGAAAACCTACATGAAA*CAGCTTCTGTAACA*GAGATCACC**Atgcttgcttt
BFLT1_0088_F02.b : TGCTGAAAAAGCTTACATGAAC*AGCTTTCTGTAACA*AAGATCACCAA*GCTTGCTTtg
SPL01_0041_G06.b : TGCTGAAAAAGCCTACCATGAAAAGCTTTTTGTAACA*AAAAatcaccattggttgcttt
ITT01_0064_B08.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTAGCA*GAGATCACCNATGCTTGCTTTG
BFLT1_0110_E03.b : TGCTGAGAAAGGCTATCATGGAAAGCTTTTTGTTACC*GAAATCACCAATGCTTGCTTTG
TCH01_0091_A05.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCNATGCTTGCTTTG
HTMT1_0057_H05.b : caaggggaaagggccctcccctgaaaaaaaggccccccccttttaccggggaaatgttcc
DCI01_0021_A01.b : aacaacacgaaaaactttctttttaccaaaaaatccaaggtttttttttaccccacaccc
DCI01_0101_E01.b : gaacaaaattaccaatggttgctttgacccccccccccaaaggggaaaagggaccccccc
OVRM1_0212_F01.b :
DCI01_0027_H06.b : cacaatgcttgcttgacccgcaaccaatgggaatgggcctcgcctggaaaacatgccgcc
OVRM1_0117_B10.b :
DCI01_0021_D08.b : gcttctgtacaaaataccatgcttgcttgaccccccaccaatgtgaaagggaccctcccg
CBLT1_0023_B03.b : ctaaaaagcctaccatgaaaacctttctgtaacaaaatcaccatggctggttttgccccc
DCI01_0041_F03.b : tacatgaacgctttcgggaaaaaaataccatgcttgctttgaccgccaccaagggggaag
CBLT1_0051_A12.b : TGCTGAAAAAcccaccatgaacacctttccgtaacaaaaatacccatgcttgctttgacc
HTMT1_0114_G06.b : TGCTGAAAAAGCTACATGAACgctttcgtaacaaaatcaccatgctgctttgagcaccca
CBLT1_0059_A01.b : TGCTGAGAAAGCCTACCATGAA*Aactttctgtagcaaaatcaccaatgcttgctttgac
HTMT1_0045_E11.b : TGCTGANAAAGCTACAATGACC*AGTTTTCTGTAacaaaaatacacaaggttgctttgac
HTMT1_0015_B05.b : TGCTGAAAAAGCCTACCATGAA*CAGCTTTCTGgtaacaaaataacaatgcttgctttga
OVR01_0056_B07.b : TGCTGAAAAAGCCTACCATGAA*CAGCTTTCctgtagcaaaagatccccaatgccttgct
CBLT1_0040_F05.b : TGCTGAGAAAGCCTAACATGGACAGCTTTCTGTAGCA*GAGATCACCAATGCTgccttta
HTMT1_0074_H08.b : TGCTGAGAAAGCCTAACAGGAC*AGCTTTCTGTAACA*AAAATCACC**Atggctgcttt
TCH01_0093_E02.b : TGCTGAGAAAGCCTACCATGGACAGCTTTCTGTANCA*AAGAcacnaatggctgctttga
CBLT1_0059_D09.b : TGCTGAAAAAGCCTTACATGAACAGCTTTCTGTAGCA*GAGATCACAATTGCTTGCCTTG
HTMT1_0067_G02.b : TGCTGAGAAAAGCTACCATGACCAGCTTTCTGTAACA*AAGAATCACAATGCTTGCTTTt
DCI01_0089_C10.b : agaaagcctacaagatcaactttctgtagcaaagtcaccaatgctgctttgaaccaccaa
BFLT1_0079_D11.b : TGCTGAAAAAGCCTACCATTGAAAGCTTTTCTGTACCAAAAATCACCAATGCTTGCTTTt
DCI01_0022_G05.b : tggaaagcctacctgaacgctttcgtaacaaattaccatgcttgctttgacaaccaacca
HTMT1_0044_A09.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTACCA*GAGATCACCAATGCTTGCTTTG
OVR01_0048_G09.b : TGCTGAGAAAAGCTACCATGAACAGCTTTCTGTAACAAAAAATCACCAATGCTTGCTTTt
OVRT1_0030_F07.b : TGCTGAAAAAGCCTACATGAAC*AGCTTTCTGTAACA**AAATCACCAATGCTTGGCTTG
BFLT1_0125_D12.b : TGCTGAAAAAGC*TACCAGGAACAGCTTTCTGTAGCA*AAAATCAC*AATGCTTGCTTTG
DCI01_0002_F04.b : tgagaaggctaccaggatcagttttcggaacaaaaatcccatgctggcttgagcacccaa
SPL01_0052_F08.b : TGCTGAGAAAAGCTACATGAAC*AGCTTTCTGTAACA*GAGATCACCAATGCTTGCTTTG
DCI01_0024_E07.b : gctgaaaagcctacatgaacagcttctgtaacgagatcaccatgctgcttgagcagccna
DCI01_0004_D12.b : aatgagaaagctacccagatcgccttccgaaacaaaatcaccattgctggcttgacccnc
HTMT1_0145_G01.b : TGCTGAAAAAGCCTACATGAAC**AGCTTCTGTAGCA*GAGATCACCAATGCCTGCTTTG
DCI01_0104_H10.b : TGCTGAaaaggcttaccagaaaaactttttgttacaaaatcccccaggcttggtttggcc
BKFL1_0077_B04.b : TGCTGAGAAAGCCCTACAggacaagctttcgtaacgagatcaccaatgctgctttgagcc
DCI01_0080_A10.b : TGCTGAGAAAGCCTACATGAAacagctttcgtancagagatcaccatgcctgctttgagc
DCI01_0093_E05.b : TGCTGAGAAAGCTA**CATGAA*CAGCTTCTGTagcgagatcaccaatgctgctttgagc
DCI01_0035_F12.b : taatctcgcggaaaaaaaccttctcttgtaaacacttttttgacaaaaacaaaacaaatt
OVRM1_0161_B02.b :
DCI01_0023_B02.b : cgtgcaagatccaatgctgctttgacagccacaaagggaaagtgacctcgcatgaaaact
CBLT1_0021_H01.b : tgccgaaaaaaccaaccctgaaaaacttttcgtacaaaaaattcccatggcttgctttta
CBLT1_0087_C11.b : Ttgctaaaaaagctaacatgaacacctttcggtaccagaaatcacaatgctttgctttac
CBLT1_0026_A09.b : TGCTGAAAAACCCTACATGAAC*AGCTTTCTGTAacaaaatcaccaaggctggtttgaac
LNG01_0095_F10.b : TGCTGAAAAAGCTAC*CATGAAaagtttccgtaccaaaatataccatgcttgctttgaac
HTMT1_0151_C10.b : TGCTGAGAAAGCCTACATGAAC*AGCCTTCTGTAGCA*AGATCACaatgcttgccttgag
AMP01_0086_A04.b : gctgagaaagctaccatgacgctttctgtagcgagatcaccaatgctgctttgagccagc
DCI01_0101_H08.b : gctgaaaaagctacatgaacagctttcgtaacaagatcaccatgctgccttgagcaccca
TCH01_0075_E04.b : TGCTGAGAAAGCCTAACATGAACAGCTTTCTGTAGCA*GAGATAACCAATGCTTGCTTTG
AMP01_0099_G04.b : TGCTGAAAAAGCTTAACCTGAA*Ccgcctttcgtaaccgagaatccccatggcttgcctg
DCI01_0069_C10.b : TGCTGAGAAAGCTTACATGAAC*AGCTTTCTGTAGCA*AAGATCACCA*TGCTTGCTTTG
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : atccctccttcattatcttgtctctaccctctacacctcccaccaaccactcccactcct
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : tggggcaaaaattatgccccccgggacattctctggcctgaaaaaaagcccctcacactg
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : aagattagaaacaaaaattccattctttcttttaccagcaaaaaagggtcaaaacccccc
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : tctgcttaaaaagcctaccatgaaacgctttttctgaaccaaaaaatcaccaatgggctt
BFLT1_0151_G01.b : gagaagcctacattgacagctttcgtagcaagatcaccatgcttgcttgagcacccacca
BFLT1_0152_D06.b : gcgagaaagcttacatgaacagctcctgtaccaaaatcacaattgctgctttgaccagcc
BFLT1_0087_F11.b : tgaaaaagctacctgaacagctttctgaacgagatcacaatggctggcttgagccaccca
BFLT1_0110_F05.b : TGCTaagaaacctaccagaacacttttcgtacaaagatcaccatgcttgcttgagccagc
OVRT1_0125_D04.b : GGCTGAAAAgcctacatgaacagcttttgtaacaaaatcaccatgcttctttgacccacc
SPL01_0098_G07.b : ctgctgagaaaagcctaccctgaaacagcttttctgttaccaaaaatcaccaatgcttgc
OVRT1_0002_G08.b : TGCTGAAAAAGCCTACATGAcagctttctgaacaaaaatcacaaagcttgctttgaccag
BFLT1_0070_A01.b : TGCTGAGAAAGCCTACATGAAC*AGCTTctgtagcagaatcacaatgcttgctttgaaca
PTG01_0052_G03.b : TGCTGAAAAACCCTACCAGGACAAGCTTTCTGTAACA*AAAATCAACAATGgctggcttg
BFLT1_0095_C03.b : TGCTGAAAAACCCACCATGAAA*AGCTTTCTGTAGCA*AAAAataccatgcctgctttga
ADR01_0047_D02.b : TGCTGAGAAAGCCTACCTGAAC*AGCTTTCTGTAGCA*GAGATCACCA*TGCTTGCTTtg
BFLT1_0043_H05.b : TGCTGAGAAAGCTTACCATGAACAGCTTTCTGTAACA*GAAATCACAATGCTTtgctttg
BFLT1_0126_D04.b : TGCTGAGAAGCCCTACATGAC**AGCTTTCTGTAGCA*G*GATCACAAATGCTTGCTTtg
OVRT1_0030_E01.b : TGCTGAAAAACCCTACATGAAC*AGCTTTCTGGAGCA*AAAATCAACCATGCTTGCTTTG
TCH01_0034_B04.b : TGCTGAGAAAGCCTACATGACC*AGCTTTCTGTAGCA*GAGATCACAA*TGCTTGCcttt
BFLT1_0004_A07.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTAACA*AAGATCACCAATGCTTGCCTTG
OVRT1_0030_D04.b : TGCTGAGAAGGCCCTACATGAC*AAGCTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
OVRM1_0113_A01.b :
TES01_0085_H12.b : cccgtttcattctccgccctaaaaaaacccttacccttgaaaaaccctttcttgtaccaa
TES01_0089_E10.b : gaaaaaacctaccttgaaagctttctgtgaaaaaaataaccaatcttgccttttgcccac
TES01_0066_G05.b : TGCTGAAAAAGCCTtccttgaaacaccttcttgatcaaaaaatcccattgcttgtttttt
PST01_0037_F01.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGC*TGCTTTG
TES01_0089_D11.b : TGCTGAAGAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
TES01_0080_E01.b : cttaaaaaaaccaaccagaaaaagttttcttgaccaaaatacaccatttcttttttttga
TES01_0084_A10.b : TGCCGAAAAAGCCctaccttgaaagccttctgtaacaaaaatcaccaatggcttgcttta
TES01_0037_D01.b : TGCTGAAAAAGCCCC*CATGAA*CActtttcgtaacaaaaacacaatgcttgctttggcc
TES01_0111_A09.b : TGCTGAAAAACCTAACCTGAAacagctttccggacccaaaatccccaatgcctggctttt
TES01_0045_H03.b : TGCTGAGAAAGCTACCATGAAC*AGCTTTCTGTAGCA*GAAATCCCCATTGCTgctttga
TES01_0075_F08.b : aaaacccctccctaaaaactttttttgtaaaaaaaaaacccaaggttttttttggccccc
BFLT1_0113_G03.b : TGCTGAAAAAGCCTACCAGGAACAGCTTTCTGTAACA*AAAATAACCAtggctgctttga
DCI01_0081_E05.b : TGCTGAAGAAGCCCTACATGAA*CAGCTTTCTGTANC*AAAGATCcaccatggctgcctt
DCI01_0091_E11.b : TGCTGAGAAAGCCTACATGAAC*AGCTTTCTGTACCA*GAGATCACCAATGCTgctttga
AMP01_0035_H01.b : TGCTGAAAAAGCCTACCATAAACAGCNTTCTGTAACA*AAAATCCCAAATGCTTGgcttt
CBLT1_0019_F11.b : TGCCGAAAAAACCCTACccagaaaagctttccgttaacaaaaatcaccaaggcttgcttt
THY01_0070_G11.b :
SMG01_0069_D09.b : TGCTGAGAAAGCCTACATGAAC*AAGCTTCTGTAACA*GA*ATCACCAATGCCTGCTTTG
HTMT1_0126_H04.b : TGCTGAAAAAGCTACCATGAcagctttcggtacgaaatcacaatgcttgcttgaccaccc
TES01_0091_A05.b : TGCTGAGAAAGCCTACTTGGAC*AGCTTTCTGaacccaaaattcacaatggctgctttga
BFLT1_0110_D05.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGGCTGCTTTG
BFLT1_0142_E11.b : gaaaaaaatttccagaaaccaaacttggggtgccccttatccccccacattcatttttcc
HTMT1_0063_G08.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
UTR01_0014_E01.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
BFLT1_0136_A10.b : TGTTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCA*GAGATCACCAATGCTTGCTTTG
CBLT1_0045_E03.b : TGCTGAGAAAGCCTACCATGAACAGCTTTCTGTAGCT*GAGATCACCAATGCTTGCTTTG
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : AGCCAG*CCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCCTGCTGC
---------+---------+---------+---------+---------+---------+ 1134
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b : agggggaaaaagtgacccccccccccagggaaaaaaaaatgggcccctgcttcccccgtt
AMP01_0094_B04.b : ccacccaaccaaaagggggaaaatgtaaccccccccccgggttaaaaaaaggggccggcg
OVR01_0031_F08.b : tttgcttttgaacccagcccaacccaaatgggggaaaatggggaacccctccgcccgggg
DCI01_0069_B04.b : gccatggaatactgcctgctccgtttcccggggactggttcaaaactcaagtcccttcgc
BFLT1_0145_B06.b : caaccaaaggggaaagggggacccccccggggaaaaaaagggcccggccccggttttacc
ADR01_0076_E05.b : gagcagcnacacgatgtgaaatgtgacctcgcatggaaaacatggctgctgctgttgtac
BFLT1_0091_C02.b : gccagccaccagatggggaaagggaccttgccagggaaatacatgcccgctgctgttgga
PCT01_0035_A07.b : cccagcaacaaatgtgaaatggganctcgccatgtaaatcatggctgctgctgttgacgt
TES01_0088_F11.b : aaaaattcccccatggcctttggtttttgagcccccccccaccccaaatgggggaaaata
SPLT1_0043_A04.b : acccaacacaaaggggaaaatggacccctcccctggaaaaaaaaaggccctcccccgttt
TES01_0109_E01.b : ttggacccccccaaccaaagggtgaaatgtgaccccccccctgggaaaaaaatggccccg
OVRT1_0105_E01.b : aacaaatgtgaatgggacctcgcatgaaaaaactggcctgctcctgtttacctggggaca
HTMT1_0027_D01.b : cccaccaatgggaaatgtaaccctcccatggtaaaaaatgcgccgcctcctgtttaccgg
HTMT1_0129_E10.b : gcagcaaccaaatgtgaatgtgaccctccgcatggtaataatggccgctgcctgtgtacc
CBLT1_0095_D07.b : Accagccaacaaaatgtgaaagggaccctgccatggaaaaacatggccgctgcctgttta
CBLT1_0048_D10.b : Accacccaaccaaaggtgaaatgtgaccctccccagggtaaaacatggcctgccgcctgt
BFLT1_0069_F07.b : gccaaccaaccaaaggggaatgggaccctccccatggaaaaaatgggccgctgccgttgt
HTMT1_0104_H08.b : GACCcagcaaaccagatggggaaatggtgaccctcgccatggaaaaaacatgcccggcgc
HTMT1_0150_B05.b : AGCCAG*Cacccagatgtggaatgtaccctcgccatgaaaatactggctgctgctgtgta
HTMT1_0121_F03.b : TACCAG*CCACCaaatggtgaaatggaccctcgccctgaaaatacaggcctgcctgcggt
TCH01_0073_B05.b : AGCCAG*CAAAC*Aaatgtgaatgtgaccctcgcatggtaaatactgcctgctgctgttg
CBLT1_0069_D11.b : AGCAAG*CAACC*AGATGGGTGAATGTGACCtccgcatggtaatacatggctgctgcctg
CBLT1_0044_H05.b : AGCAGC*CAACC*AGAAGGTGAAATGTGACCCcgccatggtaaatactggcctgctgacg
HTMT1_0125_C04.b : AGCCAG*CCACC*AGATGGTG*AATGTGACCntcgcatggtaaatacatggctgctgcct
HTMT1_0079_C02.b : GAGCCA*GCCAC*CAGATGGGGAATGTGACCctcccatggtaaaacatggcctgctgcct
ADR01_0089_D12.b : AGCCAG*CCAAC*AGATGGTGGAATGTGACCCTCGCCATGGTAAATACATGGCCCGCTGC
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : accaaatgggaaaggtgaccctcgccaggttaaaaaaaggcccggtccccgttttacccg
TES01_0073_G04.b : cccaaggggaaatgggcccccccccggggaaaaaaagggcccgcctcccctttaccccgg
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : gctttttaaccccccccacccaaagggggaaaaggtgacccctcgcccagggaaaaaaaa
OVRT1_0124_F07.b : gggaaaggaccccgccaggaatacaggcccgctcctgttaacggggtactggtcccaaaa
OVRT1_0122_E02.b : cccccaacaagaggtggaatgggaccctcccagggaatacatgcccgccgcctgtttacc
SPL01_0009_F06.b : cttttaacccaacccaaccaaaaagggggaaaatgggacccctcccccatgggtaaaaaa
BFLT1_0150_D03.b : acagatgtgaaatgtaccccgccaggtaaataatggccgctgctgtgtacgtgttgacgt
TES01_0005_H09.b : tacccgcccaaccaaatggtggaatggggacccttccccatggtaaaatacatggcccgc
OVRT1_0129_H10.b : acaaaatggggaagggacccccccaggaaaaacaggccgggcgccgtttaaccgggggac
OVRT1_0127_D10.b : acccacccaaggggaaaagggaccctccccaggaaaaacagggcctgctcctgtttaccc
BFLT1_0035_F04.b : agcaaccaaatggtgaatgtgaccctcccaagtaaaacatgccctgcggctgtgtaccgg
OVRT1_0099_H03.b : ccgccaaccaaaggtgaaatggaaccctccccatggaaaaaaagggcccggctcctgttt
OVRT1_0145_F01.b : ccaacaatggtgaatgtgacctcgcatgaaaaacatgcccgccgctgtttaacggggaac
BFLT1_0002_D06.b : cccaacagaggggaaatgtgacctcgccaggtaaatctggcctgctcctgttgaaccggt
BFLT1_0072_E06.b : cagcaacagatgtgaaagggaccctgccatggaaaaaaatggcctgtgccggtgaaccgg
TES01_0013_A04.b : AGCCAG*CCACC*AGATGG*GAAATGTGACCCTCGCatggtaatacatgcctgctgcctg
BFLT1_0054_F01.b : cagccaacagatggtgaaatgtgacctcgccatggaaaaacatggctgctgctgttgtaa
BFLT1_0063_D01.b : gagccaccaaccaatagggaaatggcaccctccccatggaaatacatggccgcctcctgt
BFLT1_0088_F02.b : agccaccaaccaatggtgaaatgtgaccctccccaggtaagtaatggctgcttctgttgt
SPL01_0041_G06.b : tgacccagccaaaccaaatggggaaaatgggaccccctcccccaggggaaaaaaaattgg
ITT01_0064_B08.b : AGCCAG*CCAAC*CAAATGGTGAATGTGACcttcgcatggtaatacatgcctgctgctgg
BFLT1_0110_E03.b : AGCCAC*CCAAC*Cgaagggggaatgtgaccctccccaggtaaataagtggccgcctccc
TCH01_0091_A05.b : AGCCAG*CCAAC*AGATGGTG*AATGTGACCCTGCCATGG**TAATACATGGGCTGCTGC
HTMT1_0057_H05.b : aaaaaaaatgcccccctccccaaaaaaaaagacacacttttgggacggggccccggggtt
DCI01_0021_A01.b : aatggggaaaagttcccttccccggggaaataaaaggccccctcccctttaaccggggaa
DCI01_0101_E01.b : ccgggaaaaaatgccccgcgccccgttttcaccgggtgacagtgttccacaaaaatatag
OVRM1_0212_F01.b :
DCI01_0027_H06.b : gctgtttaccgggtaccggttccaaaattatgcccctcccacttaaacaaggacatcatt
OVRM1_0117_B10.b :
DCI01_0021_D08.b : ggtaataatggccgcgccggttgaccggggacgggttcaaaaagtaagtcccttcccccc
CBLT1_0023_B03.b : ccaccaaagggtaaaggggacccccccaggaaaaaaagggccgcgcccttttaacctggt
DCI01_0041_F03.b : ggaccttcgccggtaatacttgcctgcgccggtggaccgggggacgggttccaaaaagtc
CBLT1_0051_A12.b : caccaaaccaaatggggaaagtgaccctgccagggtaaaaaatgggccgccccccggttt
HTMT1_0114_G06.b : acagatgtgaaagggaccctcgcatgaaaaacatgcccgccgctgttgtacgggggactg
CBLT1_0059_A01.b : ccaccaacaaaatggggaatgtgaccctggccagggaaaaaacatggctgctgccggttg
HTMT1_0045_E11.b : ccaccaaccaaatggggaaaggtgacctccccagggaaaaaaatgggccgcctcccgttt
HTMT1_0015_B05.b : gccacccaccaaatggggaatgggaccctccccagggaaataaatgccctgctgcccgtt
OVR01_0056_B07.b : tttgaaccaacccaacccaaagggtgaaaatgtgaccccccgccagggtaaaaaacatgg
CBLT1_0040_F05.b : acccagcaaacagagggtaaatgtgaccctcccagggaaatacatggctgctgcctgtgt
HTMT1_0074_H08.b : gaaccaccaacccaatggtgaaatgtgaccctcccctgtaaaaacatgcctgcctgctgt
TCH01_0093_E02.b : gcagccaacagaaggtgaatgtgaccctcgcatggtaatacatgcctgctgcctgtgtac
CBLT1_0059_D09.b : AGCaaccaaccaaatgggaaatgtgacccccccctggtaatactgggctgctgcctgtgt
HTMT1_0067_G02.b : gagccacccaccaaatgtgaaatgtgaccctcgccatggaaaaaaatgggctgctgcctg
DCI01_0089_C10.b : cccgatggtgaaagcgaaccctcccatgtaaaaaactgaccgactccggttgaacctggg
BFLT1_0079_D11.b : gaccagccaaacaaaatgggaaatgtgaccctccccagggaaaaaaatggcctgctgccc
DCI01_0022_G05.b : aagtgaaatggaccttcccaggaaatactggccgctgccgtgaacctgggactggtccaa
HTMT1_0044_A09.b : AACCAG*CCAAC*CAGATGTggattgtgaccctcgcatggtatataatgccctgctgccc
OVR01_0048_G09.b : gacccagcccaacaaaatggggaaattgggaaccctccgccatgggtaaaaaacatgggc
OVRT1_0030_F07.b : AGCCAG*CCAAccaaatgggaaaagggaccctcgccaggtaaaatcatggctgctgcctg
BFLT1_0125_D12.b : AGCCAG*CCAACaaatggggaaatgtgaccctcccctggaaaaaaatggccggctgctgt
DCI01_0002_F04.b : ccgaagtggaacgtcccctcccatgtaaacatgcccgctgctgtgtacgggggactggtc
SPL01_0052_F08.b : AACCAC*CCAAC*AGAatgggaaatgggacctccgccagggaaaatacatggcctggtgg
DCI01_0024_E07.b : cagatggtgaatggaccctgccaggatatactggctgctgctggttaccgggtgagtgtt
DCI01_0004_D12.b : ccaacaaaggggaaatgggcccctcgccagaaaaatcctggcctgccttccggttgaccc
HTMT1_0145_G01.b : AACCAG*CCAAC*CGATTGTGAAAGGTGACCCTCGCCtgtaaaataatggccggcgccgt
DCI01_0104_H10.b : ccccaaccaagggggaaagtggaccccccctgggaataaatggccggacccggtttaccg
BKFL1_0077_B04.b : accaaccggatgtgaaagggacctcgcctgggtaaaactggctgctgccgtttaccgggg
DCI01_0080_A10.b : cgcccacccaatggtgaatgtggaccctgccatggaaaaaaatgcccgcttcctgttgta
DCI01_0093_E05.b : cagcaacagatggggaatggaccctngcatggaatacatggctgctgcgtttgaccgggt
DCI01_0035_F12.b : gttgttgtttaaccccccacccacaagtgggaatattgacccccctccgcggaaaaaaaa
OVRM1_0161_B02.b :
DCI01_0023_B02.b : gccgctgccgtgacaggtgactgttccaaactcaggcgcatccccataaacaaggacatc
CBLT1_0021_H01.b : gcccccccaaccaaagggtgaaaggggcccccccccagggaaaaaaaggggccggccccc
CBLT1_0087_C11.b : caacccaaccaaatgggaaaagtgacccctcccctgggaaaaaaaggcccggcgccctgt
CBLT1_0026_A09.b : cacccaacaaaagttgaaggtgaacctccccatggaaaaaaatggcccggcgccggttta
LNG01_0095_F10.b : ccaccaaccaaaatgggaattggaacctccccatggaaaaaaatggcccgctgcctgtgt
HTMT1_0151_C10.b : ccagccaacaggatggtgaatgtgaccctcgccaggtaaatactggccggctgcctgttg
AMP01_0086_A04.b : caccaaatgtgaaatgtgacttcgccatgtaaatactggccgctgcccggtgaaccggtg
DCI01_0101_H08.b : ccgatggggaaagggacctcgccagggaaacatggcctctcctgttgaccgggtgaaggg
TCH01_0075_E04.b : ACCCAC*CCACC*AGAAGGTGAAAAGTGACCCTCGCCAggtaaaaaatggcccgctgccg
AMP01_0099_G04.b : gagcccacccaaccagaatggggaaatggggaccctcggcctggggaaattcattggccc
DCI01_0069_C10.b : AGCCAG*CCAAC*CAGATGTGAAATGGGACCCTCGCCATGGaaatacctggctgctccct
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : caactaccccacttccctctcttccctcctatcctctctctctcccttcccacccctcca
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : taaacagaccttcttcggtatgacagtaaaatcacccccaatgtgctttgtccctttaaa
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : aaaccagtccatatgggcccctccgtgcatccgatttcttttttcaagaaaaataaccat
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : tctttttgacccaacccaacccaaatgggggaaattggggaacccctcccatggggaaaa
BFLT1_0151_G01.b : aatggtgaatgggacctcccaggtaaaactgcccgctgctgttgacggggggactggtca
BFLT1_0152_D06.b : aacaaatggtgaatgtgaccccgccaggtaaaaatggccgctgctgtgtaccgggtgact
BFLT1_0087_F11.b : acagatggggaaaggggacccccccaggaaaaacatgcctgctgcctgtgaaccgggtga
BFLT1_0110_F05.b : caccgaaggggaatgggacctcccaaggtaaatactgcccgctgccgttgacctggggac
OVRT1_0125_D04.b : aacagatgggaaatggacctccccgggaaaacatggccgcccctgtttaacgggtgaagg
SPL01_0098_G07.b : ttttgaaccagcccaaccgaaatggggaaatgtgaaccctccccctgggaaaaaaaattg
OVRT1_0002_G08.b : ccaacagatggggaatggaacctcccatggaaaaaaatgcctggtgcctgttgaaccgtt
BFLT1_0070_A01.b : accaaccaaatgtgaatgggacctcccatggaataactgnctgctgctgttgtacgtggt
PTG01_0052_G03.b : aacccaccaaacaaatggggaaatgggaccctcgccagggaaaaaaatggcccgctgccg
BFLT1_0095_C03.b : accagccaaccaaaggggaaaagggacccccccctggtaaatacagggctggctgccgtg
ADR01_0047_D02.b : agccgccaaccagaggtgaaatgtgaccctcgcctggtaatacatgcctgctgcctgtgt
BFLT1_0043_H05.b : acccgcaaaccgaaggggaaatgtgaccttcccctggaaatacatggcggctgccggttt
BFLT1_0126_D04.b : aaccagccaacagatgggaaatgggacccccccatggtaatcatgcctgctgccgttgac
OVRT1_0030_E01.b : Aacccaccaaccaaagggtaaatgggacccctcccagggaaaaaaatggccggcttcccg
TCH01_0034_B04.b : gaccgccaacaagatggtgaaatgtgaccttccccatgtaaatacatggcctgctgccgt
BFLT1_0004_A07.b : GACCAG*CCACCCGAATGGTGAAAgggaccctccccaggtaaataattgcctgctgctgt
OVRT1_0030_D04.b : AGCCAC*CCACC*CAGATGTGAAATGtgaacctcgcatggtaataactggcctgctgctg
OVRM1_0113_A01.b :
TES01_0085_H12.b : aaaaatcccccaatggccttgttttttgaacccccccccaaccacaaatgggtgagaaat
TES01_0089_E10.b : caacccaaaggggaaatggacccttcccagggaaaaacgtgcccgccccctgtaaaccgg
TES01_0066_G05.b : acccccccaacacattgggaaattggaaccctccccagggaaaataatggcctgctcctt
PST01_0037_F01.b : AGCCGC*CCACC*AGATG*TGAAATGTGACCtcgccatgttaatacatggcctgctgcct
TES01_0089_D11.b : AGC*AG*CCAAC*AGATGGGGAAATGTGACCCTCGCCTGG**TAATACATGGCCTGCTGC
TES01_0080_E01.b : ccctcccacccaagtgggaatagtgcccccccccccggggaaataacagtcccccccctc
TES01_0084_A10.b : accccccaaacccaaaggtgaatggtgaaccccccccgggaaaaaaactgggccggcttc
TES01_0037_D01.b : ccccaaccaaaggggaaatgtgacccccccctggtaaaacatgggccgctcctgttttcc
TES01_0111_A09.b : agcccgccaacccaaagggtgaaatgggacccctccccagggaaaaaaaatggcccggcc
TES01_0045_H03.b : cccacccaccaaaggtgaaatgtgaccctcgccatntaaatacatggcctgctgcctggt
TES01_0075_F08.b : ccccccaaaatgggaaaatggccccccccccgggaaaaaaaaagggcccccccccttttt
BFLT1_0113_G03.b : accacccacccaaggtgaaatgtgacctcgccatggtaaaaaatggccggctgccgttga
DCI01_0081_E05.b : gagcccagccacaaatggtgaaatgtgccctcgccatggtaaatacatgcctgctggctg
DCI01_0091_E11.b : gccaccnaccagatggtgaattggaccctcgcatggtaaatcatggcctgctcctgttga
AMP01_0035_H01.b : gacccncccaccggaatggggaaaggtgaccctcgccagggaaaaactggcccgccgtcc
CBLT1_0019_F11.b : gaaccagcccacccaaaggtgaaattggtacccccccccctgtaaaaacccgggccccgc
THY01_0070_G11.b :
SMG01_0069_D09.b : aaccaccaaaccagatggtgaatgggcccttcgccaggtaaatactggcctgctgcctgt
HTMT1_0126_H04.b : acagatggtgattggacctcgcatgtaaatactggctgctgctgttgtacgtgtgactgt
TES01_0091_A05.b : gccanccacccaatggggaaagggaccctccccagggtaaatacttgcccgctgcctgtt
BFLT1_0110_D05.b : AGCCAG*CCAACCAGATGGTGGAAAGTGACCCTCGCCtggtaaaacatggctggctgctg
BFLT1_0142_E11.b : tcctgggccacaaatatgccccccttgtaccccctcgcgggaaaaaacccctcccagaga
HTMT1_0063_G08.b : AGCCAG*CCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCCTGCTGC
UTR01_0014_E01.b : AGCCAG*CCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCCTGCTGC
BFLT1_0136_A10.b : AGCCAGCCCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCCTGCTGC
CBLT1_0045_E03.b : AGCCAG*CCAACCAGATGGTGAAATGTGACCCTCGCCATGGTAAATACATGGCCTGCTGC
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : CTGTTGTACCGTGGTGACGTGGTTCCCAAAGACGTCAATGCCGCCATCGCCACCATCAAG
---------+---------+---------+---------+---------+---------+ 1194
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b : tttaccccgggggggggacaggggggtttcccccaaaaaaaaacccccatagnnnnnnnn
AMP01_0094_B04.b : tttccgggttttttccccgggggggacgggggggtttcccaaaaaaacccccaaattgcg
OVR01_0031_F08.b : gaaaaaaaaaatggggccctggctttgcccgggttggtccccggggggggggaaaagggg
DCI01_0069_B04.b : ccataaacaagaacatcatttgggagggccccgggtcaggtggttatacccccctgtggc
BFLT1_0145_B06.b : gggggaaagggtcccaaaaagaattaagggccccccgccccctataaacaaggggacacc
ADR01_0076_E05.b : cgggtgactggtcccaagagtcatggcgcatcccccataagacaagcgtacaccatttgg
BFLT1_0091_C02.b : cctgtggaagggttccaagaagtcatggcgcctcgccccataaaacaaggtacctccggt
PCT01_0035_A07.b : gntgactgttccaaagagtcatgcgcatcgcacatcagaccagggacatcatttggaaag
TES01_0088_F11.b : tgatcccccccccccccgggaaaaaaaaaaactgcccccccgccccccttttttaccccc
SPLT1_0043_A04.b : taaccgggggaacggttttccaaaaaataaaagcccccctcccccctaaaaaaaaaggaa
TES01_0109_E01.b : cgccccgtttgtaccggggggaactgtgtctccaaaaacattaaagccccccttcccccc
OVRT1_0105_E01.b : tgttcccaaaacttaatgcgccttcccccataaaaacaagtaacaccatttgggaagggg
HTMT1_0027_D01.b : gtgaatggtttccaaagaagtaatgccccattcccacattaaacaaaggtactccagttg
HTMT1_0129_E10.b : tgttgacttgtttcaaaaagtcatgcggcctcccacatcagacaacgtacctccattggg
CBLT1_0095_D07.b : ccggggtacgtgttccaaagaattatagccccttgccacataaaacaacggacatcaatt
CBLT1_0048_D10.b : tttacccggggaacgggttcccaaaaaatcaatgccccttcccccccttaaaaacaagtg
BFLT1_0069_F07.b : accgggtgactggtttccaaaaaatcaaggccgcttccccccataaaacaaaggtacttc
HTMT1_0104_H08.b : ccgttgaacggtggggacttgtttccaaaaaagtaatggccgccttcccaccataaaaac
HTMT1_0150_B05.b : cgtggtgactggttccaaaactcatgcgcctcgcccctcaaacaaggtacatccgttggg
HTMT1_0121_F03.b : ttaaccgggggacgtggtccaaaaacattaatgcgccatctccccataaaaacaaggtac
TCH01_0073_B05.b : taccgtgggaagggtttccaagaagtcaagcggcatcccacctcaaaacaaggtacatca
CBLT1_0069_D11.b : tgtacctggtgacctgttcccaaagagttaatgccgcctcgccacataaaacaagcgtac
CBLT1_0044_H05.b : gtttacctggtgaactgttcccaagaagtcatgcgccttcgccacatagaccaacgtaca
HTMT1_0125_C04.b : gtgtaacgtggtgactgttcccaaagcttcatgccgcatcccccatcaagacagggtaca
HTMT1_0079_C02.b : gttgtacctggtgactggtttccaaagaattaatgcccccctcgccacattaaacaaggg
ADR01_0089_D12.b : CTGTGGTACCTGGGTGACGTGGGTCCCCAAAGAGTCAATGCggcctccgcaccatcaaaa
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b : gggaaaatggtttccaaaaaaataattgccccctccccccccc
TES01_0073_G04.b : gaaaaagtgttccaaaaaaaaaatggcccctccccccctttataaaaaaaggcacccccc
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : agggccggcccccctggtttaacccggggggaacgtggtttcccaaaaaaaataaaaggc
OVRT1_0124_F07.b : ataatggccccatccccctaagacaaggtacctcctttgtggaggggccccgggtctagg
OVRT1_0122_E02.b : cgggtgagtggttccaaaaacttatgccccctccccccttaaacaagctacacccctttt
SPL01_0009_F06.b : ccttggccccgggcttccctggtttttaccccggggggggaacgtggggtttcccacaaa
BFLT1_0150_D03.b : gttccaaaattaatgccgctccccctaaaacaagtacaacaattggggaggggccccggg
TES01_0005_H09.b : ctccctgtttttaccccggggggacctggtttcccaaagaaatttaattccccccctctc
OVRT1_0129_H10.b : tgttccaaaaagtaaaggccccccgcccattaaaaaaggtaaccccttttggagcgggcc
OVRT1_0127_D10.b : ggggaagtggttcccaaaaactaaagcccccctcccccttaaaaaaaaggaaaccccggt
BFLT1_0035_F04.b : gtgaactgttccaaaacattcatgccgctttccccccttaaaacaacggaactccatttg
OVRT1_0099_H03.b : aaccgggggactgttttccaaaaaataagagccccctccccccactaaaacaaaggtacc
OVRT1_0145_F01.b : tggtcccaaaaattaaggccctcgcccctcaaaaaaaagaaacccatttggaaggggccc
BFLT1_0002_D06.b : ggactggttcaaagaatcaatgcccatgccccttaaaaacaagaacatcagtttgggacg
BFLT1_0072_E06.b : gggactggttccaaaacttaatgcccctctccccattaaacaaggtacatcatttgggac
TES01_0013_A04.b : tgtacgtgntgacgtggtccnaagacgtcatgccgcatcgcacatcagacaagcgtacct
BFLT1_0054_F01.b : cgggtgaagtggttccaaagagttaatgcgccttcgccccttaaaacaagggtacctccg
BFLT1_0063_D01.b : ttaacctgtggaactggttcccaaaaagatcaagcgccctctccccattaaaaccaagga
BFLT1_0088_F02.b : acctggtgaacgtggtccaaaaattcaatgccgcctcgcccctctaaaacaaggaacttc
SPL01_0041_G06.b : gcctggcttgcctggtcgaaaaccggggggggaccgggggttcccccaaaaaacacgtca
ITT01_0064_B08.b : tgtacctggtgacatgtttcaaagaactcaagcgccatcgcacatcagaacaagctacat
BFLT1_0110_E03.b : tttttacccggggaaatggtttcaaaaaaattaatgcccccctcccccattagaaacagt
TCH01_0091_A05.b : tgtttgaacgtggtgacctggtccccaaaacgtcatgccgccttcgcaccataagaccaa
HTMT1_0057_H05.b : aagggggttattcacaccccactggtccccgggaaaaccaaaaaaacggggggggggtga
DCI01_0021_A01.b : actgttcccaaaaagatatgcccccctctccccttaggcaaactcctcctatttgtgaag
DCI01_0101_E01.b : gcgcctccccccccttaaaaaaaaggaaacaccaattttgggagggggcccccggcctcg
OVRM1_0212_F01.b :
DCI01_0027_H06.b : ttgacggcccccggtccaggggttattaccccccctggtccgggaaagccaaaaaagggg
OVRM1_0117_B10.b :
DCI01_0021_D08.b : aaaaaaggttacccctttggaggggcccccgcttcagtgggtatacaaccccccggctcc
CBLT1_0023_B03.b : gaatggttccaaaacattaaggcccctccccccccaaaaaagggtaacccccttgggaag
DCI01_0041_F03.b : atgcccctcgcccctcaaaaaaagtacctccattgggaggggcccccgtgttagggggga
CBLT1_0051_A12.b : acccggggtacagggttcccaaaaaattaatccccccttcccccccataaacaaagggta
HTMT1_0114_G06.b : tttcaaaaaataaagcgccatcccccttaaacaacgtaccccagttgggaggtgccccgg
CBLT1_0059_A01.b : taccgtggggacgtggttccaaaaaagtcaaagcccccctccccaccctaaaaaacagcg
HTMT1_0045_E11.b : acccgggggaacgggttccccaaaacgttaatggccccttcgccccattaaaaaccaagg
HTMT1_0015_B05.b : gtacggggtgacctggttcccaaaaacttcaaggccccttccccacatcaaaaacaaagg
OVR01_0056_B07.b : gcctgctgccctgttt
CBLT1_0040_F05.b : accgggggacctgttcccaaagagtaatgccccatcccccatcagacaacgtacctccat
HTMT1_0074_H08.b : tttaccgtggtgacgggtttccaaaaacgtcaggccgccctccccccttaaaaaccaagg
TCH01_0093_E02.b : ctggtgacgtggttccaaaaagtcaatgcgcttcgcacttcaaacaagcgaaaatccgtt
CBLT1_0059_D09.b : accgtggtgactgggtcccaaaacgtcatgccgcatccccccatctaaacaaggtacctc
HTMT1_0067_G02.b : gtgtaccgtgtggacatggttcccaagacatcaatgcggccttcccacatcaagaccagc
DCI01_0089_C10.b : gaatggttcccaaaaattcatggcccctcccccctttaaacaagggaacctccaattggg
BFLT1_0079_D11.b : gttgtacccgggggacggggtcccaaaaaagtcaatggcccctatcccaccttaagaaca
DCI01_0022_G05.b : aactcatgcccctgccccctaaacaaaggactccatttggaaggggccccggcttagatg
HTMT1_0044_A09.b : gttgtaccgtggtgactgggtcccaaaaacgcaatgccccctcgcccccattagaaacaa
OVR01_0048_G09.b : cctggctgccctggttggaaccggggggggaaccggggtttccccaaaaaaagtccaaat
OVRT1_0030_F07.b : ttaacccggggaactggttcccaaaaagtaattgcccatcgccccactaaaaaaaaggta
BFLT1_0125_D12.b : ttaaccggttgactggttcaaaaaacttaattgcgccttcccccataaaaacaaggtaac
DCI01_0002_F04.b : aaaaactcatgccccccccccacaaacaccacctccgttgggccgggcccccggtttagt
SPL01_0052_F08.b : ctggtgtat
DCI01_0024_E07.b : cccaaactcaagcgcatccacttcagacaagtacatccgtttggacagggccccgcctca
DCI01_0004_D12.b : gggggaccgggttcccaaaaactaaggccccccctcccccaaaaaaaacaagcgtatttt
HTMT1_0145_G01.b : tttaccgtggtaactggtcccaaaaaatcaatggcccctccccccttaaaaacaaggtac
DCI01_0104_H10.b : ggggggaggggtcccaaaaaataggggcccctccccccataaaaaaaaaaaacccccctt
BKFL1_0077_B04.b : aatggttccaaaagtaaagcccccctccccataaaaaaaggtacatcatttgggaggggc
DCI01_0080_A10.b : ccgggtgacggggtcccaaaaattaatgcccccttccccccctagaaaagggaaacccca
DCI01_0093_E05.b : gacatggtccaaaaactcatgcgccatccccataagacagggaactcaanttgggagggg
DCI01_0035_F12.b : taaagccccctctggtaataaatgggtgagaggttcttcaaataataaatgcgccccctc
OVRM1_0161_B02.b :
DCI01_0023_B02.b : attgggagggcccccgctcaggtggtaatccacccctgggtcggaaacggcaatccggga
CBLT1_0021_H01.b : gtttttaccggggaaaagggttcccaaaaaaataaaggcccccaccccccccaaaaaaac
CBLT1_0087_C11.b : tacacctggggacttggtttccaaaaacttaatggccccttccccccattaaaaacaagc
CBLT1_0026_A09.b : accgggtgaacgggttcccaaaaagttaattgccccattcccccctttaaaacaagggaa
LNG01_0095_F10.b : aaccgggtgaatgggttccaaaaaagtcaagccgccatccccccatcaaacaagctacaa
HTMT1_0151_C10.b : acgtgggacttggtccaaaaagtcatggcgcctccccacataaaacaagcgtacctcagt
AMP01_0086_A04.b : gactggttcccaagaaatcaagccccctcgccccctcaaacaagggaccatccctttggg
DCI01_0101_H08.b : tccaaaaattaatgcgcctcccctcaaaacaagaaacaccatttggagggggccccgggt
TCH01_0075_E04.b : ttgtacctgggggacgtggttccaagaactcatggcgccatcccccctcaaaaaaagcgt
AMP01_0099_G04.b : ggcttcccggttggaacgtgggggggacgtggttttcccaaaaaaacctcaaggcgcccc
DCI01_0069_C10.b : gtgtaaccgggtgacttgtttcccagaaactcaagtcgcccttgcccccatcagaaccaa
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : ctctttttcctttctatcctcttcctctcccctccatctctttccccctcattttcctct
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : cacctacaccaaacccaaaaggtgtgggaatattgttaaaccctctcccccagagtggaa
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : cccccttaaaaaaaacacacgccgtttttatgtggccccagtttaatggacttattaacc
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : atactgggcccctggcttgccctggttgtacccgggggtgaaaagggggtttcccaaaaa
BFLT1_0151_G01.b : aaaagtcaggcccctttcccatcaaaacaagaactccggttgggaagggccaccggttag
BFLT1_0152_D06.b : ggttcaaaaatttatgcgcccttgccacataaaacaaggtacatcagttggggaaggtgc
BFLT1_0087_F11.b : ctggttccaaaaactaaggcgcctttcccccttaaaacaaggtaccaccatttggaaagg
BFLT1_0110_F05.b : tgggtccaaaaactaagccgcattgccccataaaacaaggtacctccgttgtggagggcg
OVRT1_0125_D04.b : tttccaaaattaatgccccactccccctaaaaaaaaggaaactcattggggaaggggccc
SPL01_0098_G07.b : ggccggcctgcctgtttgtaacccgggggaacgtgggtttcccaaaaaaagttcaatggc
OVRT1_0002_G08.b : gaatggttccaaaaagtaatggcccctcccccataaaaaagcatctctcatttgggaagg
BFLT1_0070_A01.b : gagtggttccaaaaagtcatgccccctcccccataaaacaacgaacatcattttgggatg
PTG01_0052_G03.b : gttgaccgttgaacctgtgtcccaaaaataatggcgccctccccccttaaaaacaacgta
BFLT1_0095_C03.b : gaacaggtggacagggttcccaaaactcaaatgcggcctccccccattaaaaaaagggaa
ADR01_0047_D02.b : acctggtgactggttccaagactcaatgcgcctcgcccctcagaccagggtacatcagtt
BFLT1_0043_H05.b : accgggtgacaggttccaaaaaacttaaggcccctcgccccttaagaacagggaacatcc
BFLT1_0126_D04.b : cgggggaagtgtttcaaaaaatcatgccccctccccccataaaacaacgtacaacccttt
OVRT1_0030_E01.b : gtttaaccggggaaatggttccaaaaaagtaaaggccgcctcgcccccttaaaaccaagg
TCH01_0034_B04.b : tgtaaccgggtgaagtgttcccaaaacgtaatgccccatcgcacatcaaaaccaacgtac
BFLT1_0004_A07.b : tttaccggggtgacctggttcccaaaacctaatgccgcttctccccattagaacaaggga
OVRT1_0030_D04.b : tgtacntggtgacctggtccaaaaacgtcaatgcgccatcgcaccatcaaaacaaggtac
OVRM1_0113_A01.b :
TES01_0085_H12.b : gtggaccccctcccccccgggaaaaaataacatggccccccgcctccccgtttttttccc
TES01_0089_E10.b : gaaatggttcccaagaagtcatgccccaccccccctcaaaccagcgtacattcctttgga
TES01_0066_G05.b : ttttaccctggtggataggtcccccaaaactaatatccccccttcctccctttagaaaaa
PST01_0037_F01.b : gttgtaacgtggtgacgggttcccaaaaactcaatgccgcatcgcccccattcagaacag
TES01_0089_D11.b : ttgtgtacttggtgacgtgtttccaaaaacttcaaggcgcctcgccccctccaaacaaac
TES01_0080_E01.b : cttttttaccggggaaaagttttcccaaaaaaatatttgccccccctccccccttaaaaa
TES01_0084_A10.b : cctgtttaacccgggggaaatgtgttcccaaaaaactttattgcccccattccccccctt
TES01_0037_D01.b : cgtgtgacctgttcccaaaaaatcaaggcccctttcccctttaaaacaagggtacatccc
TES01_0111_A09.b : gcccggttttaaccctggtgaacggggtttcccaaaaaatttaatgccccccctcccccc
TES01_0045_H03.b : gtaccgggggaacctggttcccaaaaacataaatgcccccttcgccaccttcaagaacaa
TES01_0075_F08.b : caccgggggagagggtcccaaaaaaaatataggccccccccccccccccaaaaaaaaggc
BFLT1_0113_G03.b : acggggtgactggttccaaaaactaatgccgcttccccccaccaaaaccacgaaccaccg
DCI01_0081_E05.b : ttttacccgggggactggttcccaaaaagtcatgcccccatccccccttaaaaacaaggg
DCI01_0091_E11.b : accggggggactggttcccaaaaagtaatggccccttgcccccttaaaacaaaggtaact
AMP01_0035_H01.b : cttttcaccgggggaactgtttaccaaaaaggcattgccccccctcccccaacaaaaaaa
CBLT1_0019_F11.b : cccccgtttaacccgggggaactggtttcccaaaaaaataaagtgccccccttcccccct
THY01_0070_G11.b :
SMG01_0069_D09.b : tgtaccggttgaccggttcccaaaaatctaagccgccttcccccctcaaaacaaaggaca
HTMT1_0126_H04.b : tccaggactcatgcgcatccccctcagacaacgtacatcagtttggaggtgcccatggct
TES01_0091_A05.b : gaccctggtgaactgtttcccaaaacgtcaggccgccttgcccccttcaaaccaaggtac
BFLT1_0110_D05.b : ttgtaccgtggtgacttgtttccaaaaacgtcatgtccgcttcccaccatcaaaacaagg
BFLT1_0142_E11.b : aaacttttttttggtaaacaaaatttaccaatgtctttcctttttaccccccccacaccc
HTMT1_0063_G08.b : CTGTTGTACCGTGGTGACGTGGTTCCCAAAGACGTCAATGCCGCCATCGCCACCATCAAG
UTR01_0014_E01.b : CTGTTGTACCGTGGTGACGTGGTTCCCAAAGACGTCAATGCCGCCATCGCCACCATCAAG
BFLT1_0136_A10.b : CTGTTGTACCGTGGTGACGTGGTTCCCAAAGACGTCAATGCCGCCATCGCCACCATCAAG
CBLT1_0045_E03.b : CTGTTGTACCGTGGTGACGTGGTTCCCAAAGACGTCAATGCCGCCATCGCCACCATCAAG
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ACCAAGCGTACCATCCAGTTTGTGGACTGGTGCCCCACTGGCTTCAAGGTTGGCATTAAT
---------+---------+---------+---------+---------+---------+ 1254
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0094_B04.b : cccccccctctccccccccccactctaataaaaac
OVR01_0031_F08.b : gggttttcccccaaaaaaaaaaacgttcaaaaggggcccccgcccccccctttccccccc
DCI01_0069_B04.b : cgggaacgcaaaaagggggggttgggaacacacctcaacgggcccacaaattatattccg
BFLT1_0145_B06.b : cctttgtgggagggggccccccgggccagggtgtggttattatacaccccccctgggccc
ADR01_0076_E05.b : gacgggcccctggctcaagtggatnataccaaccccgtggcccggggaacggcaataacg
BFLT1_0091_C02.b : tgggagggggcccagggcttgggtggttaattacaaccccctgggccccggggaaccggc
PCT01_0035_A07.b : gggccatggttcaggtgcataatacacccccatgggtccgggaaaccgncaaaaacggga
TES01_0088_F11.b : gggggaaaaacggggtttccccacaaaaactctaaatagcccccccttttcccccccccc
SPLT1_0043_A04.b : cacccttttgggaaaggggcccccccgttttcaggggtggaataatataacccccccctt
TES01_0109_E01.b : ctcttaaaaaaaaaggctaacctcccatttgtgggagacaggggcccccccggggtttta
OVRT1_0105_E01.b : gccccggcgtaaggtggaatataccccccccccgtgttcccgggaaaccggcaaaaaccg
HTMT1_0027_D01.b : ggaatggggccccgggcttagagttgattattaaccccccccgtgggccggggaaaactg
HTMT1_0129_E10.b : actgtgcccatgctcaggtggatattaccccccctggggcccgtggaacggcaataacgg
CBLT1_0095_D07.b : tgggaagggcccacggcttcagttggttaatacaacccccatgggtccggtgaaaaggca
CBLT1_0048_D10.b : acctccatttggggaagggccccctgggtttaggttggattaattccacccccccggggg
BFLT1_0069_F07.b : cgttttggactggggcccccgggttcaggtgggattaattacacccccctggggcccgcg
HTMT1_0104_H08.b : gaaggtaacatccaattgtggaaagggcccccacggctttaggggggcattaataacacc
HTMT1_0150_B05.b : gacgggcccatgcctcaggtggataatacccccccactggtcccggggaactgccaaata
HTMT1_0121_F03.b : ctccagttggggacggtgcccccgggcttcagggtggataaataccacccccctggtgcc
TCH01_0073_B05.b : gtttgggatggggccaatggctcaaggtggatatatacaacccccaggggtcccggggaa
CBLT1_0069_D11.b : ctccaatttggggaaggggcccactggctttaagttgggcttaattacaccccccccttg
CBLT1_0044_H05.b : tccagttgtgactggtccccctgcctcaggtggcataataccgcccccccggggtcccgg
HTMT1_0125_C04.b : tcacgttgggactgggcccaaggcctaaggttgcttaatacaccccccagtgggcccggg
HTMT1_0079_C02.b : tacattcaatttggtgatggggccccctggcttaaagttggattaattacaccccccacg
ADR01_0089_D12.b : caaacggaccatccagttggggaacggggccccactggcttaaggttggaataattccac
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b : tttttggagggaggggccccccgttttcagaggggtataaaataaccccccccccttttc
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : cgccatccccccccctttaaaaaacaaagaggaaccccccccttttttgggaaaaggggg
OVRT1_0124_F07.b : tggataattacaaccccctgtggccgggggaaatgccaaaaacggggtggtttttgaaaa
OVRT1_0122_E02.b : ggaagtggcccacggcttcagggggtatatacaaccccctgtggccccgggaaacagcca
SPL01_0009_F06.b : aaaactctcatattccccccccctttcccccccccccctccaaaaaaaccaaaaaccgcg
BFLT1_0150_D03.b : tcaggtggatattaaccccatgggctcccggaacagccaaaaacggggggttggtaaaac
TES01_0005_H09.b : ccccccttcaaaaaccaagcgtaacctctccattttggggaacggg
OVRT1_0129_H10.b : cccggcttagggggaatatacaccccccggggccccgggaaagcccaaaaaagggggggg
OVRT1_0127_D10.b : tggggaggggcccactggtttagggtgggttaatacacccccccgggctcccgggaaaac
BFLT1_0035_F04.b : gggaagttgcccccggtttcaagtggataattacaacccccatgtggcccggggaaactt
OVRT1_0099_H03.b : tccgtttggggaaggggccccctgggttcaaggtgggataaattcccccccccccgtggt
OVRT1_0145_F01.b : ccggcccagggtggattttacccccccctgggccccgggaacggaaaaaacggggtttgg
BFLT1_0002_D06.b : gggcccactgctaaggtggattataacacccccctgggtccgggggaaccggcaaaaaaa
BFLT1_0072_E06.b : gggccccacggttcaagtggattattccacccccatgggtcccggggaaactgcaaataa
TES01_0013_A04.b : cagtttgtgacggtgccccactgctcaggtggcttataccacccccatgtgncctgntgg
BFLT1_0054_F01.b : gtttgggaaggggcccatggctttaaggtggattaattacacacccccttgggccccggg
BFLT1_0063_D01.b : accatcgttggggaaggggccccctggcttaagtgggttaaatacccccccctgtggtcc
BFLT1_0088_F02.b : cgtttgggaagggggcccactggttcaggttgcataattacaccccccctggggcccggg
SPL01_0041_G06.b : aaagcgccccccccttcccccccccccactaaaaaaaaaacaaagggggaaaccaatctc
ITT01_0064_B08.b : caattggggacgggcccactgctcaagtggctaattcacccccattgggcccggtgaacc
BFLT1_0110_E03.b : aaacttcctttgggaaggggcccccgggttcaggtgggtttatttcccccccccctgtgt
TCH01_0091_A05.b : ggtaccaccatttgtggaagggtgcccctgggcttcaggtggctaaatacaacccccatg
HTMT1_0057_H05.b : gaaaaccccccctctaaaggggcccgcacaaatataaataaataacgtcttttttttggg
DCI01_0021_A01.b : gggccacgggcctatgtgggttaataacaccccccgcggtcccccgggaaatactcaaaa
DCI01_0101_E01.b : cgggtggttaaaataacccccccctgggtcccgcgtgaaacaaaaaaaaaaaagg
OVRM1_0212_F01.b :
DCI01_0027_H06.b : ggtgtgaaaacaccccccagagggcccggacaaatatattaaaccttttctttcgggggg
OVRM1_0117_B10.b :
DCI01_0021_D08.b : tgggaaaagccaaaaaaggggggggttggaaaacacacctctaggggcgccggaaaatta
CBLT1_0023_B03.b : gggcccagggccaaggggggttaaaatcccccccacggggtcccggggaaatggaaaaat
DCI01_0041_F03.b : tttaccccccctggtgcccggggaacgcccaaaaccgggggggtgtgaacacactcccga
CBLT1_0051_A12.b : accccctttttggaagggggcccccatggttcaaggggggatatattacacccccccctt
HTMT1_0114_G06.b : cttaggggcatatacaaccccctgggccggggaaactgcaaataaggggaggtttgaaac
CBLT1_0059_A01.b : taacatccagttttgggaacggtgccccactgggcttcaggtttggaataattaccgccc
HTMT1_0045_E11.b : aaccaccattttggggaagggggcccccacgggcttaagggtgggatatatccacccccc
HTMT1_0015_B05.b : taccaccaattggggaagggggccccccggcttcagggttggataaattcaaccccaact
OVR01_0056_B07.b :
CBLT1_0040_F05.b : ttgggaggggcccatggctcaggtgggttattccanccccacggggtccggggaaacgcc
HTMT1_0074_H08.b : aacatccattttggaagggggccccttggcttcaggggggatatattacagcccccctgt
TCH01_0093_E02.b : tgggaaggggcccatggcttaggtgggattatacccccccctggtgtcccggggaactgc
CBLT1_0059_D09.b : ccgttgggactgtgccccactggtttaggttggattaataccaccccccaggtgtcccgg
HTMT1_0067_G02.b : gtaacatccatttggggacggggccccactgcttcaaggttggaattattacaacccccc
DCI01_0089_C10.b : aacgggccccaaggttaaggtggattattccccccccccgtggccccggggaacgcccca
BFLT1_0079_D11.b : agggaacctccaattttgggaatgggggcccaatggtctaaggtggcaataaataaaaac
DCI01_0022_G05.b : gatatacaccccccgggcccgtggaactgcaaaaacgggagggggtgtaaaaccaccttt
HTMT1_0044_A09.b : cgtaacactccttttgggaaggggggccccgggcttcaaggtggaaaattacaacccccc
OVR01_0048_G09.b : ggcccccccttttccccccccccatccaaaaaacccaaaaggggaaaacacccattcccc
OVRT1_0030_F07.b : catcagttttgggacggggcccaagggcttcaggtgggattattaacgcccccactgggc
BFLT1_0125_D12.b : atcctttttggaaagtgccccctgggttcaaggtggaataatacccccccccttgggccc
DCI01_0002_F04.b : gaataatccccccccggggcccggggaacacccaacacggtggtgggaaaaacacccagc
SPL01_0052_F08.b :
DCI01_0024_E07.b : ggtggatatatcacccctgggtctgggaaatggcaaaaagggagttttgtgaaacacccc
DCI01_0004_D12.b : g
HTMT1_0145_G01.b : accgttttggaaggggcccacggcctcagggtgggttattaaaccccccccggggccccg
DCI01_0104_H10.b : tttggaaggggcccccccgctcccgggggggaaataaaccccccccccggggctgtgggg
BKFL1_0077_B04.b : cccgggttagggtgaaatatacccccctgggcccggggaacggcaaaaagggggggtgga
DCI01_0080_A10.b : attttggaagggggcccccggttcaagtgggttaattaaacccccccgtggtcccgg
DCI01_0093_E05.b : cccctgctcaggtggatattacaccccccctgttcggggaactggcaaaaaagggttggt
DCI01_0035_F12.b : ttccccctaaaaaagaggcacaccctctcttgttagtggaggcccacctctcctaatggg
OVRM1_0161_B02.b :
DCI01_0023_B02.b : gggtgaaaaccacccgagagggccgacaataaaattaagctttttgcggggggagaaaat
CBLT1_0021_H01.b : aaggggaccacccgtttgtggaggggggcccccggggcttaaggtgggataaaaaaaacc
CBLT1_0087_C11.b : gtacctcccattttggggaaggggccccacgggcttcagggtgggtataattaccacccc
CBLT1_0026_A09.b : cctccaattttggaaaggggcgccccgggcttaaggttgagtataaaacaacccccccgt
LNG01_0095_F10.b : ccaatttgggaacgggccccctgggttcaaggtgggttattacacccccactgtgtcccg
HTMT1_0151_C10.b : tgtgaacgggcccatggtttaagttgcattattccacccccctgggtcccgggaaactgc
AMP01_0086_A04.b : aacggggcccacgnttcggggggattaataccc
DCI01_0101_H08.b : taaggggtaatatcccccccctgggccggggaacggcaaaacggggtggggtggaacccc
TCH01_0075_E04.b : acaaccattttgggacgggggcccctggcttcagggtggataaataccaccccccccgtg
AMP01_0099_G04.b : ccttcccccccccccctcaaaaaaacacaaaggaacccacctcccccaagttttgggggg
DCI01_0069_C10.b : ggaaccctcctttggggaacggtgccccctcggctcaagggtggataatttccacccccc
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b : ccattcccctcctccctctcccccacttacttctctctc
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b : aaataaacaag
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : cccaccgggcgcggagaaacgtacataattttcaagagtcaaataccccacttttcaacg
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : aaagctacaattgctcccccctcttcgcccccacacctaaaaaaaacaaaaaccgggcta
BFLT1_0151_G01.b : gtggtaattacaccccctgtggccggggaactgcaaaaaacggggggtgggtaaaaccaa
BFLT1_0152_D06.b : cccgggcttcagggggataattcccccccccgggtcccggggaaacggcaaaaacacggg
BFLT1_0087_F11.b : ggccccgtgcttaaggtggataattcaacccccctgtggcccggggaaaacgcaataaac
BFLT1_0110_F05.b : cccacggctcagggggataaatacacccccccttggtccgggaaaactgccaaaaaaagg
OVRT1_0125_D04.b : agggctaaggttgaataaaaccccccccgtgggccgcggaaactggcaaaaagcgggggt
SPL01_0098_G07.b : cgccattcgcccaccctctaaaaaccaaggtgtacacttccagt
OVRT1_0002_G08.b : gccccgggttaaggttgataatacaccccccaggggcccggggaactgcaaaaaacgggg
BFLT1_0070_A01.b : ggccccatgcctcaaggtgcataattacacccccatgtggcccggggaactggcaaatta
PTG01_0052_G03.b : cccccttttgggaaggggcccccgggctaagggtggataatccaccccccctggggcccg
BFLT1_0095_C03.b : cccccattttggaagggggcccctgggttcaagtgtgaattaataacacccccccggtgg
ADR01_0047_D02.b : gtggactgggccccacggcctcaagttggataattacaacccccccttggtcccggggag
BFLT1_0043_H05.b : gttggggagggggccacgggttcaggtggcttataacacccccctgtggtcccggggaaa
BFLT1_0126_D04.b : gggacggggcccatgcgttaggttggattattacaccccccagggtcccggggaacctgc
OVRT1_0030_E01.b : tacaaccagtttgggaaggggccccacgggcttaaggtggtataaataaaccccccactg
TCH01_0034_B04.b : catcaattgtggacgtggcccatggcttaagtggcattataccgcccccattgggtcccg
BFLT1_0004_A07.b : ccttccatttgggaagggggcccctggcttcaggtgggttattaccacccccactgggtc
OVRT1_0030_D04.b : catcagttggggacggggccccagggctaaggttggattattacaaccccctggggtccc
OVRM1_0113_A01.b :
TES01_0085_H12.b : ccgggtggaaaccgggttttccccaaaaaaactctctaatggcccccccctttccgcccc
TES01_0089_E10.b : acgtggcccccggttcaagttggtttattacaccccccctgggtccccggggaaaccgcc
TES01_0066_G05.b : aggatctcttcctttttgggaatggttccccccgtgccttagggtgtgcttaattacaac
PST01_0037_F01.b : cgtaacatccagttggtggatggggcccccctggcttcaggttggcattaatacaacccc
TES01_0089_D11.b : gtaccatcaatttgtgggatgggggcccctggcttcaaggtggaataaatacaacccccc
TES01_0080_E01.b : aaaggatactcttccttttttgggaggggcgcccccggtctcagaggggtgattaaatta
TES01_0084_A10.b : taaagaaaaagcggtacaccccacttttgtggaaggtgggcccccacggggctccagggt
TES01_0037_D01.b : ctttgggaatggggccccacggctttaggttgggtttattacccccccccctggggcccc
TES01_0111_A09.b : ccttcaaaaaccaaggttaccatctccatttgtggaaagggggcccccccggggccttaa
TES01_0045_H03.b : gcgtacctcccgttttgggacggtggcccccttggc
TES01_0075_F08.b : ccaccctttttttgggggggggccccccccgccccaaagggagtaaataaacacaccccc
BFLT1_0113_G03.b : ttttggaaggggcccccgggctcaaggtggcaaatatccccccccttggtcccggggaac
DCI01_0081_E05.b : acatccccttttggaacggggcccccgggttcaggtgggattattcaaccccccgggggt
DCI01_0091_E11.b : tccctgttggagaaggggccccccgggttcagggtggcatttattccaccccccactgtg
AMP01_0035_H01.b :
CBLT1_0019_F11.b : taaaaaacaaaggtaacaccccatttttggggaggtgtcccccccggctctcaagggggg
THY01_0070_G11.b :
SMG01_0069_D09.b : tcccgtttggacggggccccctggctcaagttgattatttccccccccccggggccccgg
HTMT1_0126_H04.b : caggtgattataccacccccgtggcccggggaacgncaaaaaaggggatggatggaaaac
TES01_0091_A05.b : ctcccgttggggactgtgcccctggctcaagttgcattattacaaccccactggggtccg
BFLT1_0110_D05.b : ctacattcattttggggacggtccccctggcttcaagttgggttaatttccgcccccccg
BFLT1_0142_E11.b : aagggggaaagtttgccccccccaccgggaaaaaaacagggccccgctcccttttatacc
HTMT1_0063_G08.b : ACCAAGCGTACCATCCAGTTTGTGGACTGGTGCCCCACTGGCTTCAAGGTTGGCATTAAT
UTR01_0014_E01.b : ACCAAGCGTACCATCCAGTTTGTGGACTGGTGCCCCACTGGCTTCAAGGTTGGCATTAAT
BFLT1_0136_A10.b : ACCAAGCGTACCATCCAGTTTGTGGACTGGTGCCCCACTGGCTTCAAGGTTGGCATTAAT
CBLT1_0045_E03.b : ACCAAGCGTACCATCCAGTTTGTGGACTGGTGCCCCACTGGCTTCAAGGTTGGCATTAAT
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : TACCAGCCCCCCACTGTGGTCCCCGGTGGAGACCTGGCCAAAGTACAGCGGGCAGTGTGC
---------+---------+---------+---------+---------+---------+ 1314
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b : cccccccctcatttt
DCI01_0069_B04.b : ccttttttaggagggggaagatatac
BFLT1_0145_B06.b : ccggggaatacgtaaaatatgggggggtgtggggtgaaacacacacctcggggagggggg
ADR01_0076_E05.b : ggatgtgggtaaaaacaacctcgagcgggcccgacaaatacaaatcacgcctttctttgg
BFLT1_0091_C02.b : aaaaaacggggaggggttggaaaaacccccccttgaggtgggtcccggacaaatttacta
PCT01_0035_A07.b : ggtattgagaacccaccccctaaacgggcccgaacaaatttctaaatccaagccttttct
TES01_0088_F11.b : ttaataaaaaagatgtctacaccccccccttttgttggaaatgtgtggcgcccccccgct
SPLT1_0043_A04.b : ggtctccgcggggaaaaactccaaaaaaacggggggtgggggtgtgaaaacacacccccc
TES01_0109_E01.b : aggtgggggtatttatttcaccaccccccccagtgtgccccgcggggggaaacaactggt
OVRT1_0105_E01.b : ggggggtggtgagaaacaccccctctgaagcggggcccggaacatttacaaatataaacg
HTMT1_0027_D01.b : gcaaatacggggaggttgatctaaaaaccaaccctttaagacgggttccggaacaattta
HTMT1_0129_E10.b : gatgggggctaaaacaaccctctagccggccccgaaaattaacaaaaccacgctttttcg
CBLT1_0095_D07.b : aataacgggggtggaggcgaaaacaaccctcgaaggtggggccggaaaaattcactatat
CBLT1_0048_D10.b : tcccggggaaactggcaaataaacggggatgggttcttgaacaaccacaccttcttagag
BFLT1_0069_F07.b : ggaaacggacaaaaacaggggattgttgggaaaaaccaaccccttaagacgggccctgga
HTMT1_0104_H08.b : ccccctgtggtcccgggggaaaacgggcaatataaggggcggtgggtgggaagaacaccc
HTMT1_0150_B05.b : aggggattgggttgtgaaaacaacctccgagagcggccccgacaaaattaccaattacaa
HTMT1_0121_F03.b : cgggggaacaggcaaataaagcggggtggtttgggaaacaccaacctttggaagggggcc
TCH01_0073_B05.b : ctgccaaaaaaaggggggtgtggggaaaaact
CBLT1_0069_D11.b : gccccggggaaaacgggcaaaaaacgggggaagtggatgttaaaaaaccacaccttttga
CBLT1_0044_H05.b : ggaactgccaaataagcggaatgttagctaaaacccacccttctaggcgtgcccccggac
HTMT1_0125_C04.b : gaaactggcaaataagggagtgtgttgtaaaaaccccccctttgaagctggtccggaaaa
HTMT1_0079_C02.b : gggtcccgggggaaaccggccaaataaaggggaatgggtcgctaaaaaaaccaacccact
ADR01_0089_D12.b : ccccccctgtggtcctcgggggaaactgtacaaaaaacagggggagtgggtatgcta
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b : cccccggggagaacccccaaaaaaaagcgggggggtgtttgttgaacaacacaccccttc
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : ccccccaagggttttaaggggtggggacttatataccaaccccccccccctgtgtgcccc
OVRT1_0124_F07.b : ccaccccttgagggcggccccggaacaaattacaaattccaggcctttttcggggggggg
OVRT1_0122_E02.b : aataaggggagtggtttgaacaacaaacttttgaaggggcgcccgaaaaattatatttac
SPL01_0009_F06.b : aaaacccaattcccacatttttttggtggggagactggggggggggcccccccccccccc
BFLT1_0150_D03.b : cccctttaaggggccggacaaattaaattaaaacgccttcttttgtgggggggagaaatt
TES01_0005_H09.b :
OVRT1_0129_H10.b : gtgtgaaaaacccctttgaggggggggcgaaaaaatatatatgaaccggcttttcttgtg
OVRT1_0127_D10.b : ttccaaaataaggggggttgggtttgaaaaccccactctctgagagggggccccggcaac
BFLT1_0035_F04.b : gccaaaacaacgggattgattttaaaaaccaacctcctgaagcgggccccgacaaaattt
OVRT1_0099_H03.b : ccccgggaaaaccggccaataaaagggggagttggtgttgaaaaacccaaccctctaaga
OVRT1_0145_F01.b : gtggaaaccaaacactaaaccgtgcccggacagtttaaagtttccaggtctttccttttg
BFLT1_0002_D06.b : cgggaggtgctgcgaaaacccaaccttttaagctggctcccgacacaatttactaatatc
BFLT1_0072_E06.b : ggggagggggttaaaaacacacctcctaaaccggctccggacaaattaccaaataaacgc
TES01_0013_A04.b : aactggccagtaaacggcaggtcagtgacaacccaccatcctagctgggccctggacaaa
BFLT1_0054_F01.b : ggaacctgccaaaaacggggggtggggttgtgaaaacaaacccccctaaagcggggcccc
BFLT1_0063_D01.b : cggggaaacctgcaaaaaaaggggaggtggttggaaaaacccccccttgtaagtgtgttc
BFLT1_0088_F02.b : gaaactggcaataaaaggggagtgtatgttaaaacaccaacctttgaagcggggtccctg
SPL01_0041_G06.b : ccccagttttgttggggggaaaaccgggggggggccccccccacccgggggggggctctt
ITT01_0064_B08.b : ggccaataaccggaagggtgtgaacacccaccatctagctggtcccgaaaatttacctat
BFLT1_0110_E03.b : ccccgggagaaactgaaaatataggggatggttttgtaaaaacaccaccctttaaacggg
TCH01_0091_A05.b : ggggcccggggaaactggcaaaaaaaggggaaggggagcgggaaaccaaaactctagagc
HTMT1_0057_H05.b : gggggggagaagaaaatttttttcccggagagcgcccttaaaataaaagg
DCI01_0021_A01.b : aaggggtgtggtgttacac
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b : ggaaaaattttccggaggcctccaaaaaataggttttaagaaagaaaaatataatg
OVRM1_0117_B10.b :
DCI01_0021_D08.b : ta
CBLT1_0023_B03.b : aacggggggtgggtggagaaaaccaacacttaggcgcggcccccgacaaaatttacgatt
DCI01_0041_F03.b : agggggtcgcgaaaatatataaaacaagcctttttgggggggggagggagaaatttcgcc
CBLT1_0051_A12.b : gggccccccggagaaaatgccaaaaataaagggactgttttttctgaaaaaac
HTMT1_0114_G06.b : ccaaccctaaggtggcccgacaatttacaaaatcccggcttttcggttggggggggaaaa
CBLT1_0059_A01.b : cccccgttttgccccggtggaacaccggccaaattaaggggcgagtgtggtgctgaacaa
HTMT1_0045_E11.b : cccttgggtcccccggggaaaccggccaaaaaacgggggggggtgtttgtaaaaacacac
HTMT1_0015_B05.b : tgggccccggggaaaccggccaaataaaggggatgtgggtgtgagaaacacacacccttt
OVR01_0056_B07.b :
CBLT1_0040_F05.b : aatacccgggatggctttgaaaacccaccctgtaagcgggccctgaaccaattaccgatt
HTMT1_0074_H08.b : ggtccccggggaaaaccggcacaaacaagggagggggctgtgtaaaaccacaacccttgt
TCH01_0093_E02.b : caaataacgggagtggatgtgaaaaaccaacctcttaagcggggcctggacaatttacta
CBLT1_0059_D09.b : ggaaacggcccaaataagggggatggctggtaacaaaccaccccatctaagggtggcccc
HTMT1_0067_G02.b : tgggggcccgggggaaacggccaaaaaaagggggatggggtggtaaaaacacaaccctcc
DCI01_0089_C10.b : aaaccgggggtgtgttt
BFLT1_0079_D11.b : cccccttggtgtccccggtggaaactggccaaataacagggggatgggtggtgtgtacac
DCI01_0022_G05.b : gaacgggcccggacaattccaaatacacgctctttccttgggggggagggaaaatttaac
HTMT1_0044_A09.b : cttgggtccccggggaaactcccaaataaaggggcgtggggtggggaaaaaccacccatc
OVR01_0048_G09.b : catttgtttttgggggggaaaacagg
OVRT1_0030_F07.b : cccgggggaaactggcaaataaagggggagggttgttgaaaaaccaaccctctgaaagcg
BFLT1_0125_D12.b : cggggaaaatgccaaaaaacgggggggtgggttgaaacacccccccttgggaggcgggcc
DCI01_0002_F04.b : gagccggccccaaaataaaaaaaccactccttctcgcgggggagagagaaattctcccgc
SPL01_0052_F08.b :
DCI01_0024_E07.b : tggagggcccgacaattaatattacagcctttttcgggggggggaaaatttcccggcgcc
DCI01_0004_D12.b :
HTMT1_0145_G01.b : gggaaacggcacaattggggggtgtgtgtttaaaacaccccctccgaaggggggtccggg
DCI01_0104_H10.b : aaagggaaa
BKFL1_0077_B04.b : aaccacccccgaagggccgaaaattatattacgcttttctttgggggggaattaccccgg
DCI01_0080_A10.b :
DCI01_0093_E05.b : gttaaaccaacctctagcgggcccgcacaattaaaataacagcctttcttcttggggggg
DCI01_0035_F12.b : tttattattacccctc
OVRM1_0161_B02.b :
DCI01_0023_B02.b : tcccgcagcctcaaaagagggtttaagaaaaaaaataattctgtctttt
CBLT1_0021_H01.b : cccccctgtggttcccggggaaaaactcccaaaataaggggggggtgggtggtgggaaaa
CBLT1_0087_C11.b : ccatttgggttcccggggggaacactgccaaataaaagggggaaggtgttgtttgaaaca
CBLT1_0026_A09.b : gggctccccggggaaaaccgtcaaaaaaaagggggggtggggggtggtgaaaaaacccca
LNG01_0095_F10.b : gggaaactggcaaaaaaacgggagggtgtgtgaacaacacaaccttcctaagcgggtctc
HTMT1_0151_C10.b : caataacgggggtggatgtgaaacccaaccctttagagcgggcccggaccattttcatat
AMP01_0086_A04.b :
DCI01_0101_H08.b : ctctgagacgggctggcaatataatataaaggcttttt
TCH01_0075_E04.b : ggcccgggggaaaccggcaaaataagggggatggggatgcgaaaacccaac
AMP01_0099_G04.b : ggaagggggggggcccccccccccgcggggggccttc
DCI01_0069_C10.b : cctggtccccgtggagaactgcccaaaaaaacgggg
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : cctaatcctatcgtggcgatttctaaacacaaaaattatagtcaattccgctgctcccca
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : accccatcccaaagtttgttgggggggactcgggggggggcccccccccccatggtgggg
BFLT1_0151_G01.b : cctttaaggggcccccgaaaattaatattacaacgcctttttttgggggggggaaaaaat
BFLT1_0152_D06.b : tggttggtaaaaacacaactttgaggggcccccgaaaaaattacataataacggcctttc
BFLT1_0087_F11.b : gggatgtggtgttaaaaaacaccccctctaagatggtccccggacaaattacacttgttc
BFLT1_0110_F05.b : gggggtgttgtaaacacccaccctttgagcggggcccgaaaaaatttaacaaaatacaac
OVRT1_0125_D04.b : tggtgttgacaacacaccttctggacgggcctccgaacaatataaattatacaagcgcct
SPL01_0098_G07.b :
OVRT1_0002_G08.b : ggtgtgttaaaaacacacttttaacgtgctccgaacaattaataaatccggcctttttgg
BFLT1_0070_A01.b : acggaagggggtgtaaaaacccaaccttctaagggggtccctggaccaatttacaatttc
PTG01_0052_G03.b : gggaaactgccaaaaaagggggtgggggttgaaaaacacaccctcctaaagggggccccc
BFLT1_0095_C03.b : cccccggggacacaggcaaaacaagcggagggtgttgtaaaaaaaccaacctcgtaaggg
ADR01_0047_D02.b : aactggccaataaaaggggagtgttggcgtaaaaacccaacccctcgaaggcgtggctcc
BFLT1_0043_H05.b : ctgcaaaaaacgggggggtgtggtgaaaacccacccatctagactgggccccggaacata
BFLT1_0126_D04.b : aaataaggggagtgttgggaacaacccccctctaaggggggtccgaacaatttaatatat
OVRT1_0030_E01.b : gtgcccccggggaaacggccaaaaataaggggagggtatggctaaaaccaacaccctttt
TCH01_0034_B04.b : gtgaaacggcaaaataacgggaagtggtggtgaaaaccaaacatcctaagcgt
BFLT1_0004_A07.b : ccggggaaacctgcaaaataaacggggagtggatgttaaaaaccaacccctctaaacggg
OVRT1_0030_D04.b : ggggaaccggccaaaaaaaggggggggctctgaaaacacaaccctcggagcgggtccccg
OVRM1_0113_A01.b :
TES01_0085_H12.b : actttttaagaaaccaaaggctgaaccactccccaatttttgtgggaacgaggggggtcc
TES01_0089_E10.b : aaaaaaacgggaagtggtggtaaaacacaaaccccctaagatggggccccggacaaattt
TES01_0066_G05.b : cacccccctggggtccgtggggaaatccttacaaaataacctggtctgtttatgttgtaa
PST01_0037_F01.b : ccccgtgggtccccggggaaactggccaaaataaccggccaagggtcttcttaaaaaccc
TES01_0089_D11.b : ctgtggcccgtgggaaaaccggcccattaaccgggggagtggttgtgtaaaacccacccc
TES01_0080_E01.b : ccacccccccttttttcccgcggggaaaacttcctaaaaatacggcggtgtggggtgtag
TES01_0084_A10.b : tgggtattaatatacacaccccccccctgtgggtccccgcgggtggaaactgtcacaaaa
TES01_0037_D01.b : ggggaaaccgccaaaataacgggggtgggttgttaaaaacaccaccctctcaaaccgggt
TES01_0111_A09.b : gggttggcctttatattacaacccccccccccttggggtccccgggggaagaacacctcc
TES01_0045_H03.b :
TES01_0075_F08.b : cttttttccccccgggaaaaacttcaaaaaataaggggggtgtggttgttggataaacac
BFLT1_0113_G03.b : tgccaaatacgggggttgtttgtaaacaccaaacctcctagactggcctccgaacaaata
DCI01_0081_E05.b : ccgggggaactggcaaaataacggggggggatgtgtaacccacccccttgaactgcgccc
DCI01_0091_E11.b : gcccgggggaaaccgccaaaatacacggggtgtggtgtgaacaaccccacccttctggg
AMP01_0035_H01.b :
CBLT1_0019_F11.b : gaaatataaacaccccccccccctggggcccccggggggaaaccggcccaaaaataaacc
THY01_0070_G11.b :
SMG01_0069_D09.b : gaaaacggccaaaaacgcggatgggttttgtgaaaacccaccctccgaagcgggtcccct
HTMT1_0126_H04.b : caccctctaaagcggccccgaaaatttacctattcaccgctttttggttggggggggaaa
TES01_0091_A05.b : gtggaactggccaaatcaccggcaggggctgctggcaacccccaccatcctaagctgtgc
BFLT1_0110_D05.b : tgggccccggggaaaccgggcaaaataagcggaggtggtgtttaaaaacaaacccttctt
BFLT1_0142_E11.b : cggggggacaccgtgttctacaaaaaagtacatggccccctcctcccactaaaaaaaaaa
HTMT1_0063_G08.b : TACCAGCCCCCCACTGTGGTCCCCGGTGGAGACCTGGCCAAAGTACAGCGGGCAGTGTGC
UTR01_0014_E01.b : TACCAGCCCCCCACTGTGGTCCCCGGTGGAGACCTGGCCAAAGTACAGCGGGCAGTGTGC
BFLT1_0136_A10.b : TACCAGCCCCCCACTGTGGTCCCCGGTGGAGACCTGGCCAAAGTACAGCGGGCAGTGTGC
CBLT1_0045_E03.b : TACCAGCCCCCCACTGTGGTCCCCGGTGGAGACCTGGCCAAAGTACAGCGGGCAGTGTGC
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ATGCTGAGCAACACCACAGCCATCGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGAC
---------+---------+---------+---------+---------+---------+ 1374
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b : ggcgcgaaaatttttttgtttagacgcggttctttggtgggtggagggggggagaggatt
ADR01_0076_E05.b : ggggggagaaaattaccggcccccccacaaagtggtttgtgggaagaaaaaaaaaaaccc
BFLT1_0091_C02.b : tttcaacaggccttttccggcgggggggggggaagagattttccccgggagcccccctaa
PCT01_0035_A07.b : ggcggggaggcgggaaaatttaacccgaacgccccaaaaaaaagggggtttttaaaaaaa
TES01_0088_F11.b : cctctctccgagagggggcaatattaaatcacacccccccccccctcttggttgcccctc
SPLT1_0043_A04.b : tctggagagggggcggccggaacaattttttcatatattccacacccctttttttttgct
TES01_0109_E01.b : caaaaaaatacaccggcgcatgtgtgctatctacacaaaa
OVRT1_0105_E01.b : cgtttttctgcctcgggggggggagaaaatttttaccccaagcccctcaaaaaaaaagat
HTMT1_0027_D01.b : acttataccaacgcttttttcggtatggggagaggaaaaaaatttttgaccggaaggccc
HTMT1_0129_E10.b : gcgggtgggcggaaagaatctaccggaaacccctaaaaaaggggggtttttgaggaaaaa
CBLT1_0095_D07.b : ccaggctcttctggaggggggggggaaaagaattggcccgaagagcctaaaaaaaagagt
CBLT1_0048_D10.b : tgggctctcggaccatttttaacttgttgcccccgccctttttctgtatgggggaggccg
BFLT1_0069_F07.b : aaaatttaataataaccaagggctttttcgggtgtggggaggggaaaaagattctagccg
HTMT1_0104_H08.b : ccccttggaggagcggggcctcgggaaaattttaactattaacaccgcgcctttttccgg
HTMT1_0150_B05.b : ggccttttcggccggggagcggggaagaattttgccgcgaacgcctcaaaaaaaagttgg
HTMT1_0121_F03.b : cgcgaaaaatttacaaaatcaacagccttttctcggttgggggggagaagaaaattttag
TCH01_0073_B05.b :
CBLT1_0069_D11.b : gaccgggt
CBLT1_0044_H05.b : aaatttaccattaccaacgccttttccgaacggtggggaggaaagaaatttagcccggaa
HTMT1_0125_C04.b : tttaaattattacaagcttttccgtgcggggggggggaagaatttcacccggaagtccct
HTMT1_0079_C02.b : ctaaagggggtccccgggaacaaatttactattttcacaccgcctctttcctgtctgggg
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b : tagaagggggggtctcgccgccaatattttttctttttttttccaccgccctttttttta
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b : ccgggggagaaacactggccaaa
OVRT1_0124_F07.b : ggaggagaaatttagcgcggagcccctaaaaaaaggttgtatttaaaagaaagagaaaaa
OVRT1_0122_E02.b : caagttctttttctggtggggggggagaaaaatttttgccggaatgtccccaaaaaagag
SPL01_0009_F06.b : cgttggggtctctctcttttctaagaaggggg
BFLT1_0150_D03.b : tccgcgcccccaaaaaagtggttttgaagaaaaaaaaaaaannnnnnnnnnnnttgttnn
TES01_0005_H09.b :
OVRT1_0129_H10.b : gggggggggaggattttgcccgggggctccacaaaaaaagtggttttataaagagaaaaa
OVRT1_0127_D10.b : aattaccattatccccgccctttccccgcctggggaggggaaaggaatttctgggccgcg
BFLT1_0035_F04.b : accaataccaaggcccttttccgaatggggaggcggaaaaaaatttaacccgaaaagtcc
OVRT1_0099_H03.b : gggggcgccgggaaacatttttcttgttttccccgc
OVRT1_0145_F01.b : gtgggggggaaggaataagcccgatgccccaaaacaaggggggtttgtgggaaaaaaaaa
BFLT1_0002_D06.b : cacggccttttcggatggggagggggaaaagaaatttagacccggagaggccctaaaata
BFLT1_0072_E06.b : cttttctgccggggggggggaagaattttacccggaaagcccctaatacaaggtggtttt
TES01_0013_A04.b : ttacgatttccaacgcttttcctgcctgggaggcgagaagaaatttaggcgggaagtccc
BFLT1_0054_F01.b : gaacacaatttaaaatatacaaagagctttttttgggcgggtgggggggggggaaaattt
BFLT1_0063_D01.b : ccgaaaaattttaaaaattaccacggcttttctctgtaggggaggagggaaagaaatttt
BFLT1_0088_F02.b : aacaaattaacatatatcaaggctttttctggagtgggggggtgaaaagaattttagccc
SPL01_0041_G06.b : ttttaa
ITT01_0064_B08.b : acacgcctttctgttgggggcggaaaaattcaccgacggctcaaaaagtgggtttgagga
BFLT1_0110_E03.b : gccccggaaacaatttaaagtatccaagcgcctctttcgtcgtggggggggggaaaaaat
TCH01_0091_A05.b : ggggcccccgaacaaattactaatatccaaacctttttt
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b : gcacagggccttttttggggtgtggaggggagaagaattttcccggggaaggcgctctaa
DCI01_0041_F03.b : c
CBLT1_0051_A12.b :
HTMT1_0114_G06.b : attttcccggaatcccctaaaaaagagggtgtttaagaagaagaaaaaaaaaggccccga
CBLT1_0059_A01.b : accccaacctcccgtaaggcggggcccccgggacccatttttactcttgtatcccaggcg
HTMT1_0045_E11.b : ccccttctgtaagaccgtggcccctggaacaaaatt
HTMT1_0015_B05.b : aagaggtggtcccggaacaatttaaacgtttaccaagggcctttttctgtgaggggggaa
OVR01_0056_B07.b :
CBLT1_0040_F05.b : accacgggctttctcgggggggggggggaaaaatattcagccgagaatcccctaaagata
HTMT1_0074_H08.b : agagccgggccctccgaaccaaatttaacgtaatggcacacggccttttatgga
TCH01_0093_E02.b : ataccaaggccttttcttgtaggggaggaagat
CBLT1_0059_D09.b : ggaaccaatttcacctgttttcaaggggccttttcagggacgggagagggggggagaaaa
HTMT1_0067_G02.b : gaagctgggctccggaaacaattacaaagttacaacgtctttttcggtcctggggagggg
DCI01_0089_C10.b :
BFLT1_0079_D11.b : aaccacaccttcttataagcgggggcccctggacacaatttttcctggttttccaacagg
DCI01_0022_G05.b : cccagcccttaaaaagaggtgtttaga
HTMT1_0044_A09.b : ggaggcgggggcccgaaaaaatttaaaattattccaacgcctttttccttttgggggggg
OVR01_0048_G09.b :
OVRT1_0030_F07.b : ggtcccccgcaaaaatttacatatattcaccggcccctttcttgtttggggagaggggga
BFLT1_0125_D12.b : cccgaacaaaataaaaaaaattcaccgccttttttcgggtgggggggggggaaagaatat
DCI01_0002_F04.b : ccccctcaaataagggtgttttaaagaaagagaaaaaaggccgccgcctctanaggccac
SPL01_0052_F08.b :
DCI01_0024_E07.b : cccaaaaaaggggtgttagagaaaaaaaatttgtttcttt
DCI01_0004_D12.b :
HTMT1_0145_G01.b : ccaaattacaaatattccacgccttttctcgtggggggggggggaaagaattctcggcgg
DCI01_0104_H10.b :
BKFL1_0077_B04.b : cctcaaaggtgtttggagggnntnnnnnnggcgcnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0080_A10.b :
DCI01_0093_E05.b : aagaattacccgggccccccaaaaag
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b : aacaaaacccccttgagaagggggggtcc
CBLT1_0087_C11.b : caccaacccctctggagaggggggcccccggaacacaaatttaacatggtatccct
CBLT1_0026_A09.b : ccctcttaaaggcgggctctccgggaacaatatttacctgatattcccacggcccttttt
LNG01_0095_F10.b : ccgaaacaatttcttatgttccccgcctttttccgtaaggggagaggtgaagaatttttt
HTMT1_0151_C10.b : taccaccccttttccgtcggggggggggagaaaaatttagaccggagacccccaaaaaaa
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b : cagaaaacactagggtgttttgtgcgggcaaaatcataaactctccctccacatattc
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b : gctttttttttcaagagagggggtt
BFLT1_0151_G01.b : ttccccgagggccccacaaaaaaagggttttttaaaaaaggaaaaaaaaaaacgcggcct
BFLT1_0152_D06.b : ttgtttgggggagaaaagaattttccccgagcccccccaaaaaaggttgttttttaagaa
BFLT1_0087_F11.b : caaggccttttcgggccgggggggggggaaaaaattttcgacccgaaag
BFLT1_0110_F05.b : ccttttttggtgggggggaggggaaaaaattttggcgcgaaggccccccaaaaaaaagtt
OVRT1_0125_D04.b : tcccgcggggggaggggaaaaaatttttgcgcggagacgccttagaataaaagggttgtt
SPL01_0098_G07.b :
OVRT1_0002_G08.b : gatgggaggggaagaattttgcccgaaactcccaaaaaaaaaggggtttttaagagaaag
BFLT1_0070_A01.b : caacgcctttttgtgcgggggagggggaaaaaattttaaccggaaaagtcctcaaaaata
PTG01_0052_G03.b : gacacaattaccgatatacccacccttttctcgccggtggggggggaagaaattttgccc
BFLT1_0095_C03.b : gggctcccggaacaaattaccagattacacaggctctttctcgtattgggggggtgagag
ADR01_0047_D02.b : gggaacaatttaaccaattgccaaggcttttttctgacgcgggggaggaaaaaaaanttt
BFLT1_0043_H05.b : taactataatccagggcctttttctgttgggggagaaggggaaaaattttaaaccgggag
BFLT1_0126_D04.b : acacccttttcggtggggggggagggagaatttttacccgagagcccccaaaataaaggg
OVRT1_0030_E01.b : aaggggggccccgggacaaattttatctgtttgcaaaggtttttttacggga
TCH01_0034_B04.b :
BFLT1_0004_A07.b : gctccggacaattttacttattcccagggccttttctgggggggggagggggaagaaatt
OVRT1_0030_D04.b : acaaattttccaaatgcaacggcttttctgtcggggaggggggagagaattttaccccgg
OVRM1_0113_A01.b :
TES01_0085_H12.b : cccaccgtggttgtttctagaggtgtggg
TES01_0089_E10.b : tactatatccaaccgcctttttctgtaccgggaagggggaaagaaaatt
TES01_0066_G05.b : caacaccaccctccttaagatctggtacctcttgcaccatttaccctatgatttctatcg
PST01_0037_F01.b : cacaccctccttaaaccggggcctccctgacccaaattttactgtgttatccacgcggcc
TES01_0089_D11.b : cccttaagaccgggcccccggaaccaatttaactaatttccaacggcctttttcttttac
TES01_0080_E01.b : aaacaaccaacatctctttaaaacgtggccttctcgccccaatttttactcttattccac
TES01_0084_A10.b : aaaacgcgggcagtggtggatgttttaaaacaccaccaccctccttcttaagacctgtgg
TES01_0037_D01.b : ccccgtaccaaattttccttattttcccggccctttttc
TES01_0111_A09.b : ccaaataataaccgg
TES01_0045_H03.b :
TES01_0075_F08.b : cccccccccgaagagggggccccccgcgccacnaataatttttgtttatacaaccccctc
BFLT1_0113_G03.b : actataatccacgcgtttttctggggggggagagaaaaagaatttttaccgaaaagcccc
DCI01_0081_E05.b : tggaaaaattacccattacaacggctttttttcttggggggagggaagaatttagcccga
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b : ggggggggtgttttttttaaaaacacccaaaccctcttgaaaggcgcgggcccccctcaa
THY01_0070_G11.b :
SMG01_0069_D09.b : ccccaatttaccattttccccgcctcttttcgggagcgggaggggaggaaaaagattttt
HTMT1_0126_H04.b : aaattcgccccgaaggccccaaaaaaaaggtggttttagaaaaaaaaagaaataaaagcg
TES01_0091_A05.b : tcccggaccaanttgaccgagtttgaaacgggcttttcctggtacgggggaggcggagaa
BFLT1_0110_D05.b : aagcgggcccctggaacaattttacctttaaacaacggcctttttcgtgacggtggaggg
BFLT1_0142_E11.b : ggtatcctccctttttgtgggggggggccccccggcgctgagggggggattatataaccc
HTMT1_0063_G08.b : ATGCTGAGCAACACCACAGCCATCGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGAC
UTR01_0014_E01.b : ATGCTGAGCAACACCACAGCCATCGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGAC
BFLT1_0136_A10.b : ATGCTGAGCAACACCACAGCCATCGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGAC
CBLT1_0045_E03.b : ATGCTGAGCAACACCACAGCCATCGCTGAGGCCTGGGCTCGCCTGGACCACAAGTTTGAC
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : CTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGCATGGAGGAAGGA
---------+---------+---------+---------+---------+---------+ 1434
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b : ctcccgcn
ADR01_0076_E05.b : ccccccacnnggggggggnnnnnnnnnaaaaaatgcnnnnnnnnnnnttatccccccact
BFLT1_0091_C02.b : ataaaaaggggggtt
PCT01_0035_A07.b : aaaaaaaaaacacagcctcgagcttttaaaggggctttggacctacccaacccccttttt
TES01_0088_F11.b : tctggggaaactactcttcgcccaaaataa
SPLT1_0043_A04.b : cggggggagggggaaagaattatttttcggccgagaggagcccctctaaaaaaaaaaaag
TES01_0109_E01.b :
OVRT1_0105_E01.b : tgtgttttaaaaaaaaaaagaaaaat
HTMT1_0027_D01.b : taaaataaaagggggtttctttgaggagaaaggcaataatgtcgggccttgaaaatttat
HTMT1_0129_E10.b : aaaaaataaaaaggtctagacattaaaaggtcctttttgaaacaaagaaaaatctctttt
CBLT1_0095_D07.b : ggttcttaaaaagaaaagaaaaaaataacggcctggaactttataaggggcttttttggc
CBLT1_0048_D10.b : gaaagaaatttttggcccggagaaggcctccttaaaataaaaagggggtcactttagaaa
BFLT1_0069_F07.b : gaaaagcgccttaaaataaaagttgtgttttttgggaggagaaagcgaaacattttaaag
HTMT1_0104_H08.b : tgtgggggagagggaaaaaatatttggccgcgggagagcccccaagaaaagaagggtgtg
HTMT1_0150_B05.b : gttttaaaagaaaaaaagaaaaaataaaaggctcggaaccttaataaggggttttggacc
HTMT1_0121_F03.b : gcccgaggggccctaaaaaaaaaagggtggttcttagaaagaaaaagagaaaaaaaaaaa
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b : actccctaaaaaaaaagtgtggttttggagggagaagcggataattattccgggtcctgg
HTMT1_0125_C04.b : aaaataaaagtggtttttaaagaaagaagaaaaaaaaacgccgcagattttataaggggg
HTMT1_0079_C02.b : agggcgggggaagaattttttgaccgcagaagttccctaa
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b : tttaggag
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b : aaacaggcctcgacttttatagggtgttgtgggataacgtaaanaattcttgggaacaga
OVRT1_0122_E02.b : gtggttttttggggagaagagcaaatatggtgggcgtctgacttttaaagaggtgtttgt
SPL01_0009_F06.b :
BFLT1_0150_D03.b : nnnnnnnnnttcttccttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_H09.b :
OVRT1_0129_H10.b : aaaaaaacctgcgcttttattt
OVRT1_0127_D10.b : ggtcccctcaaaaaaaaagaggtgttttattaagaaaaaaaaaa
BFLT1_0035_F04.b : cttagataaaaagtgtgtttcttagaggagaaagcgaatataaaattaagct
OVRT1_0099_H03.b :
OVRT1_0145_F01.b : aaatctttcttttttt
BFLT1_0002_D06.b : taaaggtggttttttggaggaaagaaggaaataaagcccggggttgagaaatttttaaa
BFLT1_0072_E06.b : ttaagagaaaagagaataaaagcggggtttagacttttataaagggcaaattaaacacac
TES01_0013_A04.b : taaaataaaatgtggtctttaaaagaaaaaaaaa
BFLT1_0054_F01.b : ttccgcggagagctccctaaaaaagt
BFLT1_0063_D01.b : aacccggaaagccccttaaataaaaagggg
BFLT1_0088_F02.b : aaaatgttcccataaataaaaggtgggattttaagaagaaaaaaggaacaaa
SPL01_0041_G06.b :
ITT01_0064_B08.b : gaggaaaaaaagcgccctttttnnnnttttnnnnnnnnnnnnnnnntttntnaaaacccg
BFLT1_0110_E03.b : ttttgcccggagaagccccctaaataaaaatggtttcttttaaagaagaaaagaaaaatt
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b : aaaaaaaattgtgttctttaaagaggaaaagagaacatttgtccgcggctcctggaaact
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b : acttaagagggctttgggaaaatnnnnnttttttttttttaaaaaaaaaattatatatcn
CBLT1_0059_A01.b : gccttcttcaggaacggtggaaggcgagggagaagaaattttcttaggcccgn
HTMT1_0045_E11.b :
HTMT1_0015_B05.b : gggggagaagaattttgaggccggaaaacgcccctaaaaaaaaagaggtgggtgatttta
OVR01_0056_B07.b :
CBLT1_0040_F05.b : aggtgttgtttttaaggagaaaaggaaattatagccagggcttcggactttataaagagg
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b : tatttaggccctggaaaggtccctttaaaataaaaagggtgtgttattt
HTMT1_0067_G02.b : ggaaagaaatttaaggcggaaaggcccctcaaaaaaaaaagggtggtcttttgggaggga
DCI01_0089_C10.b :
BFLT1_0079_D11.b : cgtctttttggggaaggggn
DCI01_0022_G05.b :
HTMT1_0044_A09.b : ggggagagaatttttgccggggaagtgccttaaaaaaaaaattggtttttttaaaaaa
OVR01_0048_G09.b :
OVRT1_0030_F07.b : aaggaatttagacccggaaaaggcccctaaaaaaaaagagggtgtatcttta
BFLT1_0125_D12.b : ttcc
DCI01_0002_F04.b : ttctatctctctccacctca
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b : gaggccccccaaaatcaagagtgggttctttaaagaaaaaaagaaaaaaaaaaacagcct
DCI01_0104_H10.b :
BKFL1_0077_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b : tctagaaaggtgagagacaagaaa
LNG01_0095_F10.b : aaccccaaaatccccctaaaataaaaggtgtgttttcttaagaaaaaaacaaaaaataaa
HTMT1_0151_C10.b : aagggtgggttcttttggggaaaggcaaatttttgcccgcgcttgaaactttcaaaaggg
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b : ttaaggggtttggnnnnntgacaanantgtgagtaagaaggagcc
BFLT1_0152_D06.b : aaaaaaaaaaaaaagcgggcgcctcaaangggggtgnnttaccttnnnnnnttttttttg
BFLT1_0087_F11.b :
BFLT1_0110_F05.b : gggtgtttaaaagaaggaaaaaaaaaataaaaaggtctcgatatttta
OVRT1_0125_D04.b : ttgaagagaaaacgaaaataaaaagaggttggacttttagagggttaattgaaaatcagg
SPL01_0098_G07.b :
OVRT1_0002_G08.b : gaaaaaaaccaggctgaaacttttaaagggcttttgggncttagtnnatctcattcttat
BFLT1_0070_A01.b : aaatgggtcttttaa
PTG01_0052_G03.b : gggaaggtccctaaatataaaggtggtgttcttaaaagagaaaaacaaacataacaaggg
BFLT1_0095_C03.b : aaatttctacccgggaaaggcccaagaaa
ADR01_0047_D02.b : tnnncccnncnnccccctctaaaaataaatagtgnggttgt
BFLT1_0043_H05.b : agccctaaaaataaaaagggtggtctttagaaggaaagggagaaattttattctgggg
BFLT1_0126_D04.b : gttttttaaaaaaaaaaaaaaaaaacacggccggaacttttaaggggggtttgggnnang
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b : ttagcccggaaatgcccttaaaaataaaagggggttttcttaaaagaaaaaagaaaata
OVRT1_0030_D04.b : aaggccctaaaaaaaaaaaggggttcttagaaaaaaaaagaataaaaaacaggctttgaa
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b : gcccatttctcacttcattttgtacattgagttaatattttcttatgctccaatcattgt
PST01_0037_F01.b : tttttctggaacggggtaggccttggaaagaaa
TES01_0089_D11.b : ggtagaggggat
TES01_0080_E01.b : cccttcctttctc
TES01_0084_A10.b : ctccccgttcacaaatattttttccttgatatcttctcccctgc
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b : ttcttttttcttaggg
BFLT1_0113_G03.b : caaaaaaaaagtggtgttttagaaaaaaaaaaaaaaaataaacggggctgcgacttttca
DCI01_0081_E05.b : cggcccctaaa
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b : acaaattttttttcttctttgttaccccaccccct
THY01_0070_G11.b :
SMG01_0069_D09.b : acgccggaaatccccctaaaataaaagaggggggttttcttaaaggagaaaagggaactt
HTMT1_0126_H04.b : cttgccccttttaagggggttttgtggccacacccacccccccttctgtgtttggtnaaa
TES01_0091_A05.b : agaaatttttaacccgaggaaaggtccctataagaaaaaaaaggttggtttt
BFLT1_0110_D05.b : gggaagggagattttcgccccaggaagggccccaaaaaacaaaaggggtggttttttggg
BFLT1_0142_E11.b : cccccctctggtgtgccccgggggaaaacttgcaaaaataaggggcggtggtgtttgtga
HTMT1_0063_G08.b : CTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGCATGGAGGAAGGA
UTR01_0014_E01.b : CTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGCATGGAGGAAGGA
BFLT1_0136_A10.b : CTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGCATGGAGGAAGGA
CBLT1_0045_E03.b : CTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGCATGGAGGAAGGA
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : GAGTTTTCTGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTACGAGGAGGTTGGT
---------+---------+---------+---------+---------+---------+ 1494
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b : tttattt
BFLT1_0091_C02.b :
PCT01_0035_A07.b : ttttnnnngacgaanaaaagttagaacctcttctccctcccccnnnntnnnnntcccccn
TES01_0088_F11.b :
SPLT1_0043_A04.b : tggtgtttttttaaaaaagaaaaaaaaaaaa
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b : aaag
HTMT1_0129_E10.b : tgttctaaaaaaaaacctgttttctatagttccccccgannnnnnnnnnnnnnnnnnnnn
CBLT1_0095_D07.b : accaacacgcacccccactttgtggccttaaaaaaaaaaacccctttataatattttaat
CBLT1_0048_D10.b :
BFLT1_0069_F07.b : gccttggacattttaaaagagtg
HTMT1_0104_H08.b : tcttgaaggagagaaagaggaaaacatataacaacgcttcaaatttt
HTMT1_0150_B05.b : aaacacacccccctttttttttttcaaaaaaacccnnaaacaacaatcttctactccaca
HTMT1_0121_F03.b : cggcgcgagaatttctataagggggcttttgggcccacaaaacgccaccctcacctcttt
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b : aatttttaa
HTMT1_0125_C04.b : tgtttgtaaaaaaaaannannnntttttctgttttaaaaaaatgctcgatattgttgcct
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b : aag
OVRT1_0122_E02.b : gccccacttccaatactcttttggtgc
SPL01_0009_F06.b :
BFLT1_0150_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b : c
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b : gccgcatctactagattaccctacaacccnnnnnnnna
BFLT1_0110_E03.b : taaactttcttg
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b : tataaaatggcggattttatagaacctaa
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b : aaaa
OVR01_0056_B07.b :
CBLT1_0040_F05.b : tctattgtggaaacaatcgagtaaacgtcaaattctggttttcttaaaaaaaaaaaaaaa
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b : aagggacatttttcgcgggtttttagaatatt
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b : ttgagaattttttaaattgt
DCI01_0104_H10.b :
BKFL1_0077_B04.b : nnnnnnnnnnnnnnnnn
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b : taaaggctttcagatatttttataaagggcgttttagtagaatcaacaaantatacatat
HTMT1_0151_C10.b : ggtgttttggcccccaaaccaaagcccactttggtaaataaa
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b : tttttttttttcgaaaaaaccgttatactcttaannnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b : ccacccctctg
SPL01_0098_G07.b :
OVRT1_0002_G08.b : ataagagacgc
BFLT1_0070_A01.b :
PTG01_0052_G03.b : ctccagaactttaaaaggggcttttgtgcccaccaaccccaccccacccctt
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b : gagtnnaattttttttttataaaaaaaaannnccccaaataaatatattgataaannnnn
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b : tt
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b : cttcataaaaaactaaaagagtgttgtgattctactatatcacagaaaa
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b : gagggcgcttttccgacaaaaattaagcccccccttgtttgttaaaaa
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b : ttttggcggggttctagaaattctttataaaagggccttttttgggaaaattataggttt
HTMT1_0126_H04.b : aaaaattttnnnntaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0091_A05.b :
BFLT1_0110_D05.b : gggaaaaaggcgcactttttccaagggccttggaaccttttataaagggggctttttgtc
BFLT1_0142_E11.b : caaaaccccactcatctgaaagctgggcctccttacaaaatatttttcttttttctcacc
HTMT1_0063_G08.b : GAGTTTTCTGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTACGAGGAGGTTGGT
UTR01_0014_E01.b : GAGTTTTCTGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTACGAGGAGGTTGGT
BFLT1_0136_A10.b : GAGTTTTCTGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTACGAGGAGGTTGGT
CBLT1_0045_E03.b : GAGTTTTCTGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTACGAGGAGGTTGGT
CBLT1_0059_G06.b : ttttaagagagtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_E10.b :
20110601C-000042 : GTGGATTCTGTTGAAGGAGAGGGAGAGGAAGAAGGCGAGGAATACTAAAGTTAAAATGTC
---------+---------+---------+---------+---------+---------+ 1554
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b : nnnnnnnt
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0095_D07.b : tgttgccctcgaacnnnnnttaagaagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b : ccaccnnnnnnnnnnnnnt
HTMT1_0121_F03.b : tgtcctaaaaaaaaaaagcctctaagt
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b : gccgnnnnnnnnnnnnnnnnnnnnnnnnnnt
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b : nnnnnnnnnnnnnnnnnn
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b : nnttttnnccccntttttttaccgtcgccccacaccannnnnnnnnnnng
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b : taatttttttataaaaaaagtgnngnnnnnnncncnnnnnnnnnnnntttggtgtagtac
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b : nnnnnnnnnnnnnnn
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b : aacctttcaatttttgtt
HTMT1_0126_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0091_A05.b :
BFLT1_0110_D05.b : cacactcaccccacccccccct
BFLT1_0142_E11.b : gcctttttttctctggttgtggggagggcagaaaaagaaatttctaggcccggatagatg
HTMT1_0063_G08.b : GTGGATTCTGTTGAAGGAGAGGGAGAGGAAGAAAGCGAGGAATACTAAAGTTAAAATGTC
UTR01_0014_E01.b : GTGGATTCTGTTGAAGGAGAGGGAGAaggaagaagcgcgatgcatacaatcgacagaatg
BFLT1_0136_A10.b : GTGGATTCTGTTGAAGGAGAGGGAGAGGAAGAAGGCGAGGAATACTAAAGTTAAAATGTC
CBLT1_0045_E03.b : GTGGATTCTGTTGAAGGAGAGGGAGAGGAAGAAGGCGAGGAATACTAAAGTTAAAATGTC
CBLT1_0059_G06.b : xxxxxxxxxGTTGAAGGAGAGGGAGAGGAAGAAGGCGAGGAATACTAAAGTTAAAATGTC
HTMT1_0105_E10.b : ntttggcaggtagaggxxxxxxxxxxxxx
20110601C-000042 : ACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAAACATTGAAAAGTTGTGGTC
---------+---------+---------+---------+---------+---------+ 1614
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b : nnnnnnnnnnnnnnnnn
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b : acatatataa
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b : cgccctctagaaaataaagaagaggtggtgtcttttagagaaaagaagaaaaatataa
HTMT1_0063_G08.b : ACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAACATTTTGAAAGT*GTGGTC
UTR01_0014_E01.b : ttgctgaatagaaagctttagcgcgagtctcatttggttttctatcttgttaacatgtcc
BFLT1_0136_A10.b : ACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAAACATTGAAAAGTTGTGGTC
CBLT1_0045_E03.b : ACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAAACATTGAAAAGTTGTGGTC
CBLT1_0059_G06.b : ACAAAGGTGCTGCTTTTACAGGGAAGCTTATTCTGTTTTAAACATTGAAAAGTTGTGGTC
HTMT1_0105_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCTGTTTTAAACATTGAAAAGTTGTGGTC
20110601C-000042 : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACAATTACTGACCTATGCTT
---------+---------+---------+---------+---------+---------+ 1674
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACNATTACTGACCTATGCTT
UTR01_0014_E01.b : tctgatccagtacatg
BFLT1_0136_A10.b : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACAATTACTGACCTATGCTT
CBLT1_0045_E03.b : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACAATTACTGACCTATGCTT
CBLT1_0059_G06.b : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACAATTACTGACCTATGCTT
HTMT1_0105_E10.b : TGATCAGTTAATTTGTATGTAGCAGTGAATACTCTCATATACAATTACTGACCTATGCTT
20110601C-000042 : TAAAACACGACGCTTTGTTACAGACCCAAGTTATTCATTTCTCTGGGTTTGAATAAAGTA
---------+---------+---------+---------+---------+---------+ 1734
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b : TNAAACACGACGCTTTGTTA*AGACCCAAAGTTATCATTTCTCTGGGTTTGAATAAAGTA
UTR01_0014_E01.b :
BFLT1_0136_A10.b : TAAAACACGACGCTTTGTTACAGACCCAAGTTATTCATTTCTCTGGGTTTGAATAAAGTA
CBLT1_0045_E03.b : TAAAACACGACGCTTTGTTACAGACCCAAGTTATTCATTTCTCTGGGTTTGAATAAAGTA
CBLT1_0059_G06.b : TAAAACACGACGCTTTGTTACAGACCCAAGTTATTCATTTCTCTGGGTTTGAATAAAGTA
HTMT1_0105_E10.b : TAAAACACGACGCTTTGTTACAGACCCAAGTTATTCATTTCTCTGGGTTTGAATAAAGTA
20110601C-000042 : TTCCCTGTCTTAAACAAAAAAAAAAAAAAAA.............................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b : TTCCCTGTCTTaaaaaaaaaaaaaaaaaaaa
UTR01_0014_E01.b :
BFLT1_0136_A10.b : TTCCCTGTCTTAAATGAAAAAAAaaaaaaacataaaccggxxxxxxxxxxxxxxxxxxxx
CBLT1_0045_E03.b : TTCCCTGTCTTANNTGaaaaaaaaaaaaaaaaaaaaaaanaaaannaaaaaaaaaaaaaa
CBLT1_0059_G06.b : TTCCCTGTCTTAAAtgaaaaaaa
HTMT1_0105_E10.b : TTCCCTGTCTTAAACAAAAAAAAAAAAAAAA
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b : xxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0045_E03.b : aaaaaaaaaaaaaannnnnngggcccgcggcccggaatccccttttggggggttaatttg
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b : gctccaaaccagaaaaaaactttgtggtgtgggacaaccccaactgatgggtggaaaaaa
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b : tgctttttttggaaaattgggaagcattgtttttttggaaccaataaccgcaaaaaaaat
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b : taacaacacatttttttctttttttttgggggggggggggggggaggttttttcccttaa
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :
HTMT1_0125_C04.b :
HTMT1_0079_C02.b :
ADR01_0089_D12.b :
OVRM1_0046_A09.b :
OVRM1_0225_E05.b :
OVRM1_0006_B12.b :
SPL01_0043_D02.b :
TES01_0073_G04.b :
OVRM1_0179_A06.b :
OVRM1_0053_H01.b :
OVRM1_0184_H02.b :
OVRM1_0118_C12.b :
OVRM1_0190_C10.b :
OVRM1_0021_H08.b :
OVRM1_0070_F09.b :
TES01_0086_C11.b :
OVRT1_0124_F07.b :
OVRT1_0122_E02.b :
SPL01_0009_F06.b :
BFLT1_0150_D03.b :
TES01_0005_H09.b :
OVRT1_0129_H10.b :
OVRT1_0127_D10.b :
BFLT1_0035_F04.b :
OVRT1_0099_H03.b :
OVRT1_0145_F01.b :
BFLT1_0002_D06.b :
BFLT1_0072_E06.b :
TES01_0013_A04.b :
BFLT1_0054_F01.b :
BFLT1_0063_D01.b :
BFLT1_0088_F02.b :
SPL01_0041_G06.b :
ITT01_0064_B08.b :
BFLT1_0110_E03.b :
TCH01_0091_A05.b :
HTMT1_0057_H05.b :
DCI01_0021_A01.b :
DCI01_0101_E01.b :
OVRM1_0212_F01.b :
DCI01_0027_H06.b :
OVRM1_0117_B10.b :
DCI01_0021_D08.b :
CBLT1_0023_B03.b :
DCI01_0041_F03.b :
CBLT1_0051_A12.b :
HTMT1_0114_G06.b :
CBLT1_0059_A01.b :
HTMT1_0045_E11.b :
HTMT1_0015_B05.b :
OVR01_0056_B07.b :
CBLT1_0040_F05.b :
HTMT1_0074_H08.b :
TCH01_0093_E02.b :
CBLT1_0059_D09.b :
HTMT1_0067_G02.b :
DCI01_0089_C10.b :
BFLT1_0079_D11.b :
DCI01_0022_G05.b :
HTMT1_0044_A09.b :
OVR01_0048_G09.b :
OVRT1_0030_F07.b :
BFLT1_0125_D12.b :
DCI01_0002_F04.b :
SPL01_0052_F08.b :
DCI01_0024_E07.b :
DCI01_0004_D12.b :
HTMT1_0145_G01.b :
DCI01_0104_H10.b :
BKFL1_0077_B04.b :
DCI01_0080_A10.b :
DCI01_0093_E05.b :
DCI01_0035_F12.b :
OVRM1_0161_B02.b :
DCI01_0023_B02.b :
CBLT1_0021_H01.b :
CBLT1_0087_C11.b :
CBLT1_0026_A09.b :
LNG01_0095_F10.b :
HTMT1_0151_C10.b :
AMP01_0086_A04.b :
DCI01_0101_H08.b :
TCH01_0075_E04.b :
AMP01_0099_G04.b :
DCI01_0069_C10.b :
OVRM1_0156_C03.b :
OVRM1_0216_D03.b :
OVRM1_0176_E11.b :
OVR01_0034_C02.b :
OVR01_0073_G11.b :
OVRM1_0222_B12.b :
OVRM1_0164_D01.b :
ADR01_0061_E07.b :
OVRM1_0046_C08.b :
OVRM1_0060_G11.b :
OVRM1_0165_C09.b :
SPL01_0060_E03.b :
OVRM1_0210_E08.b :
OVRM1_0099_B04.b :
OVRM1_0215_B03.b :
OVRM1_0084_E07.b :
OVRM1_0130_F09.b :
OVRM1_0069_F08.b :
LNG01_0071_A01.b :
OVRM1_0101_B12.b :
OVRM1_0202_H05.b :
OVRM1_0107_E11.b :
OVRM1_0186_E12.b :
OVRM1_0077_H12.b :
OVR01_0038_E05.b :
BFLT1_0151_G01.b :
BFLT1_0152_D06.b :
BFLT1_0087_F11.b :
BFLT1_0110_F05.b :
OVRT1_0125_D04.b :
SPL01_0098_G07.b :
OVRT1_0002_G08.b :
BFLT1_0070_A01.b :
PTG01_0052_G03.b :
BFLT1_0095_C03.b :
ADR01_0047_D02.b :
BFLT1_0043_H05.b :
BFLT1_0126_D04.b :
OVRT1_0030_E01.b :
TCH01_0034_B04.b :
BFLT1_0004_A07.b :
OVRT1_0030_D04.b :
OVRM1_0113_A01.b :
TES01_0085_H12.b :
TES01_0089_E10.b :
TES01_0066_G05.b :
PST01_0037_F01.b :
TES01_0089_D11.b :
TES01_0080_E01.b :
TES01_0084_A10.b :
TES01_0037_D01.b :
TES01_0111_A09.b :
TES01_0045_H03.b :
TES01_0075_F08.b :
BFLT1_0113_G03.b :
DCI01_0081_E05.b :
DCI01_0091_E11.b :
AMP01_0035_H01.b :
CBLT1_0019_F11.b :
THY01_0070_G11.b :
SMG01_0069_D09.b :
HTMT1_0126_H04.b :
TES01_0091_A05.b :
BFLT1_0110_D05.b :
BFLT1_0142_E11.b :
HTMT1_0063_G08.b :
UTR01_0014_E01.b :
BFLT1_0136_A10.b :
CBLT1_0045_E03.b : aaacccccccccccggggagaggttttttatatggtctctcatttctccacaaaaaacgt
CBLT1_0059_G06.b :
HTMT1_0105_E10.b :
20110601C-000042 : ............................................................
---------+---------+---------+---------+---------+---------+ 1765
AMP01_0004_H06.b :
AMP01_0004_G12.b :
AMP01_0097_D05.b :
AMP01_0094_B04.b :
OVR01_0031_F08.b :
DCI01_0069_B04.b :
BFLT1_0145_B06.b :
ADR01_0076_E05.b :
BFLT1_0091_C02.b :
PCT01_0035_A07.b :
TES01_0088_F11.b :
SPLT1_0043_A04.b :
TES01_0109_E01.b :
OVRT1_0105_E01.b :
HTMT1_0027_D01.b :
HTMT1_0129_E10.b :
CBLT1_0095_D07.b :
CBLT1_0048_D10.b :
BFLT1_0069_F07.b :
HTMT1_0104_H08.b :
HTMT1_0150_B05.b :
HTMT1_0121_F03.b :
TCH01_0073_B05.b :
CBLT1_0069_D11.b :
CBLT1_0044_H05.b :