
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000047

Length: 1,697

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Homo sapiens]. 7430.0O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Mus musculus]. 7670.0O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Canis lupus familiaris]. 7790.0O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Bos taurus]. 7770.0O
Contig/Assembly ProteinLOC100301020PREDICTED: cytochrome c oxidase subunit I-like, partial [Bos taurus]. 1128e-25O
Contig/Assembly ProteinLOC100299681PREDICTED: cytochrome c oxidase subunit I-like [Bos taurus]. 95.51e-19O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Sus scrofa]. 8000.0O

Assembly Members: 508      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010004F11AMP01_0004_F11.bBW955262 AK389610
AMP010035G10AMP01_0035_G10.bBW957558 AK389681
AMP010057D02AMP01_0057_D02.bBW959089 AK389740
BKFL10050H10BKFL1_0050_H10.bFS651764 AK390708


SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000047 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0030_B12.b : nttctatcctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_H10.b : nggggatatactaagtgatatcttngggctgctcccaxxxxxxxxxxxxxxxxxx
AMP01_0004_F11.b : ttattaggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0010_D12.b : taaacgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C03.b : nnnaagtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0071_G06.b : aaaactaatgcgaatcctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_B10.b : nnnaaactaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D07.b : naacgtaactaagggctgctcgcgcgccgxxxxxxxxxxxxx
AMP01_0046_F06.b : aactcttagggaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_C03.b : nngggatatatatagagatacttaggcgctgctcccaxxxxxxxxxxxxxxxxxx
DCI01_0020_D05.b : nnnaagtaactatagggctgctcxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E01.b : aaaaagaaaagtctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H01.b : ctaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_D04.b : cacctttaccaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_D05.b : nnggtttatnnaaanggatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E02.b : nnaaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0013_A04.b : nnnggatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H08.b : nnaaacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F06.b : ctgaaactantagggatacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_A12.b : nttaacgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_D03.b : accctagcgactaaagaggctgctcxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0027_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0030_D12.b : nnccctattaatattaagaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_H11.b : ngggatatactaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_E07.b : nncgtatatatatagggatatcttagggctgctcxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_C08.b : ttaatctaagggctaxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0078_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0036_G05.b : nncctatatnnnnaacgatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0009_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0029_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0070_H11.b : nnaaatacgatacatagggctgctcccgcgccgxxxxxxxxxxxxx
DCI01_0072_D09.b : nnnnnnccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0108_G06.b : nccttaaannnaancgatatctaagggctgctcxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0054_F06.b : nnnggagaaaanntaaaggatatctaagggctgctcccgcgccgxxxxxxxxxxxxx
MLTL1_0012_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0040_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
BKFL1_0027_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
AMP01_0068_F07.b : taacactntagaaatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0066_A04.b : agtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_A11.b : naaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D05.b : atataggcgtatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_A08.b : ataactaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0034_B12.b : nngggatatanntataacatatcttgggctgctcccgcaccgxxxxxxxxxxxxx
MLTL1_0015_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0016_F11.b : nttaacatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0004_D12.b : atttaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_D10.b : atctatagggatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G03.b : nnnggtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_G03.b :
AMP01_0094_F02.b : ggggttactacnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B01.b : nnnttttgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_H01.b : nnnttaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G09.b : nnnnttcgaatcataagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B04.b : nnnnnnccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_C02.b : nnnnnacgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_B01.b : nntttcgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0077_G07.b : nnnnaacgatacaatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_D04.b : nnnnccgtaatcatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0096_A03.b : nnctaaatnnnnnnncgatacctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_H06.b : nnnnaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F04.b : nnnnncgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_E04.b : naaaccgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_H03.b : nnnggagaaaaantttaggatatcttgggctgctcgcccgccgxxxxxxxxxxxxx
MLTL1_0052_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0068_F04.b : nnnnnccgtaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_F02.b : ccccaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F04.b : ttttnccatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0113_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0091_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0057_D02.b : ataacctaacatgggggctxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0115_A02.b : nnnttctannnnnnnacgatatctaagggctgctcgcgcaccgxxxxxxxxxxxxx
AMP01_0062_E10.b : nnnggagaaaanntaagggacactatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_E05.b : nnnccctattnnnnnnnaatactatagggctactcgcccaccgxxxxxxxxxxxxx
AMP01_0094_D02.b : gcggtaaatccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0034_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0036_B11.b : nnccgatatantaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_D04.b : nnttttttttttttaggaatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G05.b : nnnnccgatactaangggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_E03.b : nnnccaacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_E06.b : nnnttacgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
AMP01_0036_G01.b : nnggggatanantaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F12.b : nnnnctaatnnnnaatcgaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C12.b : ntttttttcatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A08.b : nnnnaacgtactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B10.b : nnaagatanantaagggatacttangggctgctcxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G02.b : nnnaacgtaatcatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_E08.b : acccctttagttacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G03.b : nnnnaacgatactaagggctgctcccgcgccgxxxxxxxxxxxxx
BKFL1_0100_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
AMP01_0074_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0100_D07.b : ggggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_E10.b : agcgataactcattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E05.b : aaaannccgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_G02.b : nnnnaacataactaagggctgctcgcgcaccgxxxxxxxxxxxxx
AMP01_0035_G10.b : aaatctatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A08.b : nnnncgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F04.b : aaaaaaccatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_F07.b : nggtgtttnttataggaactcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_H09.b : nnaagaaannnnnaaacgaatctatagggctgctcccgcaccgxxxxxxxxxxxxx
DCI01_0083_F02.b : nnnnccgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_A08.b : nnnnccgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_D03.b : nntttacaatcctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H05.b : tattaccgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D03.b : ncctaaannnnaaacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H09.b : nnnttacgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_G01.b :
CBLT1_0068_E12.b :
AMP01_0037_H12.b : gaaacccgtagggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_E08.b :
CBLT1_0025_G05.b :
DCI01_0065_E05.b : aaaanccgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H01.b : tttaacgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E11.b : gtattgataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_D02.b : nnggtgtatatatagggtattttgggggctgctcccaxxxxxxxxxxxxxxxxx
DCI01_0026_G02.b : naacgtaactaagggctgctcxxxxxxxxxxxxxxxxxxxx
AMP01_0044_F02.b : ccatttaggtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B08.b : gggaatactcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D06.b : ttaaacnnntaagaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_D08.b : gggataactcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_B06.b : nggtatactataagagatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H09.b : ggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_G10.b : nggatatcntataggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_D04.b : aaaaaccgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F10.b : ntgataactttagcgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D05.b : nnggcgatatantnntgcgatacttgggctgctcccaxxxxxxxxxxxxxxxxx
DCI01_0098_G04.b : nnnnccgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_E05.b :
MLTL1_0018_D05.b : nnnccctaaannnnnnnncgatacaatagggctgctcxxxxxxxxxxxxxxxxxxx
AMP01_0043_D01.b : tttagctaacnttxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F03.b : ttttaccgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0034_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
MLTL1_0013_F11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
DCI01_0041_E08.b : nnnccgatacataagggctxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B02.b : gcgcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_H12.b : ttttaagtaatctaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : nggataatatatagccgatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0093_G09.b : ggggtaaatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : nccgaatactatagggatatcttxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
DCI01_0019_E09.b : nnnnnggatatcaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : nnnntacgtaatctaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : nnnnncgatactatagggctxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : nngggaaaaattaagggatatcttngggctgctcxxxxxxxxxxxx
MLTL1_0052_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0053_F07.b : nnnggagaaaantaaaccgaatcttagggctgctcccgcaccg
MLTL1_0052_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0009_E04.b : nnncccgaattnnnnnnggatatctaagggctactcxxxxxx
DCI01_0062_C09.b : nnnnnnccatactaaxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0071_D03.b : nnttttacatactaaxxxxxxxxxxxxxx
DCI01_0109_B09.b : nnnnnccgaacxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0033_D03.b : nnnaacatacataxxxxxxxxxxx
MLTL1_0030_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0083_F02.b : aaaaccgaatctaaxxxxxxxxxx
AMP01_0082_C03.b : ntaaattaatttaaxxxxxxxxxxxx
DCI01_0110_A04.b : aaaaaatcgaaaccataxxxxxxxxxx
MLTL1_0070_C11.b : nnttcttatnnnnaaacgaatctaaxxxxxxxx
MLTL1_0057_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0033_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0107_B06.b : nnaattaaaannnaaccgatactatagggctx
DCI01_0087_E01.b : nnnttttgatactaaxxxxxxx
AMP01_0092_F05.b : nnnccgtaatctaagggc
AMP01_0038_G05.b : nngggatacatatagagatatcttxxxxxx
BKFL1_0107_C06.b : nnnccccttnnnnnnngcgatactaaggg
AMP01_0069_A06.b : atactcctagggatacttaxxx
AMP01_0075_H12.b : ngataccntttaagatatcttxx
AMP01_0054_A11.b : nnggggataaantttagggatactatn
AMP01_0096_E05.b : gggataxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0096_D07.b : ggcgaaxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0078_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0033_D07.b : nnnccgatatnntnnatagata
DCI01_0067_C07.b : nnnnnccgta
DCI01_0025_B09.b : nnaacg
DCI01_0082_G12.b : nccattannnnaaac
DCI01_0033_B01.b : ntt
MLTL1_0029_E11.b : nnnnnnnnnnnn
MLTL1_0030_C03.b : nnnnnnnnnnnnnn
AMP01_0093_B03.b : ggcataact
MLTL1_0057_D08.b : nnccagtttnnnnnn
AMP01_0079_F11.b : tctatagg
DCI01_0061_E09.b : tt
AMP01_0101_D07.b : ggggax
DCI01_0114_D02.b : nnntttaaa
DCI01_0100_A01.b :
AMP01_0093_D11.b : cggc
AMP01_0037_A02.b : nggggatata
AMP01_0097_F02.b : cgcgt
MLTL1_0095_H08.b : nnnnnnnnnnnn
DCI01_0104_E09.b :
DCI01_0044_F02.b :
BKFL1_0032_G09.b : nnnnnnnnnnn
AMP01_0072_H02.b : nggggaaaa
AMP01_0085_B01.b :
AMP01_0094_G03.b : agg
DCI01_0077_G01.b :
DCI01_0101_G02.b :
MLTL1_0083_A01.b : nnn
MLTL1_0083_F01.b : nnn
MLTL1_0053_H12.b : nnn
BKFL1_0085_A10.b : nnn
MLTL1_0078_A07.b : nnn
DCI01_0084_E06.b :
DCI01_0076_F09.b :
AMP01_0060_A10.b :
MLTL1_0056_E09.b :
AMP01_0003_A10.b :
MLTL1_0036_A03.b :
BKFL1_0057_B06.b :
MLTL1_0024_A07.b :
MLTL1_0083_D11.b :
DCI01_0095_H12.b :
DCI01_0063_D11.b :
DCI01_0073_F01.b :
DCI01_0068_B02.b :
MLTL1_0053_H09.b :
DCI01_0065_E11.b :
DCI01_0072_E02.b :
DCI01_0114_F10.b :
DCI01_0114_D12.b :
MLTL1_0092_C10.b :
AMP01_0036_B06.b :
AMP01_0087_E12.b :
BKFL1_0010_A08.b :
MLTL1_0100_E06.b :
MLTL1_0076_D10.b :
MLTL1_0087_D07.b :
DCI01_0045_F07.b :
MLTL1_0041_E01.b :
DCI01_0075_H05.b :
AMP01_0080_C01.b :
AMP01_0087_E06.b :
DCI01_0073_B03.b :
AMP01_0056_H04.b :
MLTL1_0073_B02.b :
MLTL1_0087_F08.b :
DCI01_0074_H04.b :
DCI01_0083_B09.b :
DCI01_0016_E09.b :
MLTL1_0051_F03.b :
DCI01_0071_B02.b :
AMP01_0093_D06.b :
DCI01_0081_G05.b :
AMP01_0086_G11.b :
AMP01_0085_F10.b :
MLTL1_0092_E03.b :
MLTL1_0005_D03.b :
AMP01_0069_C11.b :
MLTL1_0091_E01.b :
DCI01_0093_G04.b :
DCI01_0073_G01.b :
DCI01_0097_H10.b :
MLTL1_0006_D09.b :
DCI01_0064_C12.b :
MLTL1_0079_A08.b :
MLTL1_0086_A12.b :
AMP01_0046_A06.b :
DCI01_0032_B11.b :
MLTL1_0042_B10.b :
MLTL1_0016_H04.b :
BKFL1_0034_G04.b :
DCI01_0118_E10.b :
MLTL1_0073_H09.b :
BKFL1_0031_D12.b :
MLTL1_0074_D03.b :
MLTL1_0010_E03.b :
DCI01_0117_G06.b :
BKFL1_0006_E06.b :
MLTL1_0058_H10.b :
DCI01_0115_B09.b :
DCI01_0099_A07.b :
MLTL1_0037_F08.b :
MLTL1_0049_C09.b :
MLTL1_0059_F05.b :
OVRT1_0001_D03.b :
MLTL1_0086_F06.b :
DCI01_0077_H07.b :
BKFL1_0057_D03.b :
MLTL1_0082_C12.b :
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0030_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0027_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0027_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0066_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_G03.b : ggtatactatagcgnacgxx
AMP01_0094_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0100_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_G01.b : ntttggcta
CBLT1_0068_E12.b : nnncctatttnttnttggc
AMP01_0037_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_E08.b : tttcgt
CBLT1_0025_G05.b : nnnng
DCI01_0065_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_E05.b : nnnncctatagctgtc
MLTL1_0018_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0013_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A08.b : nnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_D01.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B07.b : nnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0082_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_F08.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_H04.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_F05.b : tgctcgcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0107_C06.b : ctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_A11.b : gggctgctcccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : nnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0078_D06.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_D07.b : cttgggctgctcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_C07.b : atctaagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B09.b : taactaagggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G12.b : gatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_B01.b : ttcatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_C03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B03.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_D08.b : ccgatacataagggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F11.b : ggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E09.b : ttnnccatactaangggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D02.b : aananacgatatcatagggctgctcgcgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A01.b : nnnttagtaccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D11.b : ataatcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A02.b : tatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_F02.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0095_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E09.b : nnnnccgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_F02.b : taatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H02.b : anttagcgaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_B01.b : naatcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G03.b : gcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G01.b : nnnttacgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_G02.b : nnaaaagaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0083_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0053_H12.b : ccttttaatataaaggatacntatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0085_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0078_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
DCI01_0084_E06.b : nnnaatcgaatcatgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F09.b : nnttacgtaactatagggctgctcgcgcgccgxxxxxxxxxxxxxxxxx
AMP01_0060_A10.b : tatccccnttaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0003_A10.b : ttaacgaatctaaxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
BKFL1_0057_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0024_A07.b : ncctataannnnnnnggatactaaxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
DCI01_0095_H12.b : nnnaatagatacttxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : nnnntttgatactaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : nntttagtaactatagggctxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : nnnnaacgtaatctaagggctxxxxxxxxxxxx
MLTL1_0053_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0065_E11.b : nnnnnaacgaaccatxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : nnntttacatacttxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : nnnggctccaaannaacgatactatxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0092_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0036_B06.b : nnnccgataatntaagggatatcttxxxxxxxxxxxxxxx
AMP01_0087_E12.b : nctaatttaaxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0100_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0076_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0087_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0045_F07.b : nnnttagatactaaxxxxxxxxxxxxx
MLTL1_0041_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0075_H05.b : nnnaacgtaatctaagggctxxxxxxxx
AMP01_0080_C01.b : ctataggcgatacttangggctxxxxxxx
AMP01_0087_E06.b : nnnggtatcttxxxxxxxxxxxxxx
DCI01_0073_B03.b : nnnnncgatactatagggctgctcxx
AMP01_0056_H04.b : nngggaaantntaagtgatatcttngggctxxxxx
MLTL1_0073_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0087_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0074_H04.b : nnnnccgtacaatxxxxxxxxxxxx
DCI01_0083_B09.b : nnnnnccgaatccataxxxxxxxxxxx
DCI01_0016_E09.b : nnnnccgtacttaxxxxxxxxxxx
MLTL1_0051_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0071_B02.b : nnnnnggatactatagggctgctcx
AMP01_0093_D06.b : ggggtaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : nnnnaacgtaacatgggggctxx
AMP01_0086_G11.b : acgtatcttangggctgc
AMP01_0085_F10.b : aaaccgtaatcttxxxxxxxx
MLTL1_0092_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0005_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0069_C11.b : aactcctagggtatcttaxxx
MLTL1_0091_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0093_G04.b : nnnnnccgatactaaggg
DCI01_0073_G01.b : nnnttacgatactaaxxxxxx
DCI01_0097_H10.b : nttaacg
MLTL1_0006_D09.b :
DCI01_0064_C12.b :
MLTL1_0079_A08.b :
MLTL1_0086_A12.b :
AMP01_0046_A06.b :
DCI01_0032_B11.b :
MLTL1_0042_B10.b :
MLTL1_0016_H04.b :
BKFL1_0034_G04.b :
DCI01_0118_E10.b :
MLTL1_0073_H09.b :
BKFL1_0031_D12.b :
MLTL1_0074_D03.b :
MLTL1_0010_E03.b :
DCI01_0117_G06.b :
BKFL1_0006_E06.b :
MLTL1_0058_H10.b :
DCI01_0115_B09.b :
DCI01_0099_A07.b :
MLTL1_0037_F08.b :
MLTL1_0049_C09.b :
MLTL1_0059_F05.b :
OVRT1_0001_D03.b :
MLTL1_0086_F06.b :
DCI01_0077_H07.b :
BKFL1_0057_D03.b :
MLTL1_0082_C12.b :
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : ....................................................CCTATGTT
---------+---------+---------+---------+---------+---------+ 8
DCI01_0030_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0100_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0031_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0046_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0038_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0093_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0084_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0108_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0099_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0013_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0006_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0061_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0027_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0030_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0040_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0044_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0015_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0078_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0029_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0014_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0108_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0054_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BKFL1_0027_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0068_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0066_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0091_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0117_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0075_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0034_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0016_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0069_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BFLT1_0028_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0069_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0109_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0061_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0066_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0076_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0031_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0078_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0068_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0082_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0061_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0076_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0091_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0057_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0052_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0115_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0062_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0086_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0079_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0034_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0036_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0098_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0080_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0115_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0111_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0069_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0093_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BKFL1_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0100_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0087_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0035_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0088_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0023_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0080_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTC
DCI01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0076_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0080_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
HTMT1_0115_G01.b : gtaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGCC
CBLT1_0068_E12.b : tagtacgacgcantagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
AMP01_0037_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
ILNT1_0002_E08.b : ggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
CBLT1_0025_G05.b : gcaagtacacgccgtcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
DCI01_0065_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
DCI01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0040_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
DCI01_0026_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0093_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0060_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0037_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0075_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0005_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0075_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0034_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
DCI01_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccATGTT
OVRT1_0146_E05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTT
MLTL1_0018_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTT
AMP01_0043_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
DCI01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0013_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
DCI01_0041_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0096_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0082_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0107_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0078_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0095_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0085_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0003_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H09.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_C10.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_E06.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_D10.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_D07.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_E01.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_B02.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_F08.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0051_F03.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_G11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_E03.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_D03.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_E01.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G04.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H10.b : atatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0006_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0064_C12.b : nntttttcatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
MLTL1_0086_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxx
AMP01_0046_A06.b : aaccctaagagtatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : nnncctaactaaxxxxxxxxx
MLTL1_0042_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0016_H04.b : nnnnnaagatactaaxxxxx
BKFL1_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0118_E10.b : aaaattcgtaccaxxxxxxx
MLTL1_0073_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0031_D12.b : nnnccctttnnttnataagaaaccataxx
MLTL1_0074_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0010_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0117_G06.b : aaaaacccatact
BKFL1_0006_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0058_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0115_B09.b : nncctaatannnnnacgatatct
DCI01_0099_A07.b : nnnaatcataac
MLTL1_0037_F08.b : nnnncattttnnnnnnnngga
MLTL1_0049_C09.b : nnnnnnnnnnnnnnnnn
MLTL1_0059_F05.b : nnnnnnnnnnnnnnnnnn
OVRT1_0001_D03.b :
MLTL1_0086_F06.b : nnnnnnnnnnnnnnnnn
DCI01_0077_H07.b : nnnnaac
BKFL1_0057_D03.b : nnnnnnnnnnnnnn
MLTL1_0082_C12.b : nnnnnnnnnnn
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 68
AMP01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0082_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACATCGGCACCCTGTACCTACTATT
DCI01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
AMP01_0093_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0057_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
AMP01_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
DCI01_0061_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCACCCTGTACCTACTATT
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
DCI01_0114_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
DCI01_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
AMP01_0093_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
AMP01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
AMP01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
MLTL1_0095_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
DCI01_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
BKFL1_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0072_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0085_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTACCTACTATT
MLTL1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0053_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
BKFL1_0085_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
DCI01_0084_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
DCI01_0076_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
AMP01_0060_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACTATT
MLTL1_0056_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACTATT
AMP01_0003_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0051_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0006_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_B10.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0016_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_G04.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_H09.b : nnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0074_D03.b : nnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0010_E03.b : nnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_G06.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0006_E06.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_H10.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_B09.b : aagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A07.b : taagggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0037_F08.b : tactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_D03.b :
MLTL1_0086_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H07.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_E08.b : nnnaaacgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F01.b : nntttcgatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G06.b : nnncctattnnnnnnccgatacattagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0050_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0119_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0117_C07.b : aaaanaccgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0005_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0005_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
DCI01_0090_G10.b : nnnnttacatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
DCI01_0114_C07.b : nnncctctaaaananccgatactatagggctgctcgcgcaccgxxxxxxxxxx
DCI01_0116_H04.b : nnnttctaaannnnnaagatatcatagggctxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_E05.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_D01.b :
MLTL1_0045_C01.b : nttctcaannnnnntagatactaaxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : nncccactaaananacgatactatagggctgctcccgcaccgxx
AMP01_0065_B11.b : atagcgtatcttaxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0073_B10.b : ncccgatannnnnaaaagatacntaaxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0070_B04.b : nnaaaaggatactatagggctgctcccgcgccgx
DCI01_0077_F06.b : nnnnncgtaacataagggctaxxxxxxxxx
MLTL1_0028_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0074_C04.b :
MLTL1_0056_C11.b : nnnnnnnnnnnnnnnnnnnnnn
MLTL1_0053_E11.b : nnnnnnnnnnnnnnnnnnnn
BKFL1_0034_C09.b : nnnnnnnnnnnnnnnnnnnnnn
MLTL1_0018_G02.b : nnnnnnnnnnnnnnnnnnnnn
MLTL1_0031_B04.b : nnnnnnnnnnnnnnnnnn
MLTL1_0042_H02.b : nnnnnnnnnnnnnn
MLTL1_0077_G02.b : nnnnnnnnnnnnnnnnnnn
DCI01_0072_F05.b : nnnn
BKFL1_0029_B03.b : nnnnnnnnnnnnnnn
MLTL1_0073_A05.b : nnnnnnnnnnnnnnn
CLNT1_0065_C11.b :
DCI01_0057_A06.b : gatga
MLTL1_0022_B04.b : nnccta
MLTL1_0031_E03.b : nnnnnnnn
BKFL1_0082_B12.b : nnnnnnnnn
BKFL1_0106_B10.b : nnnnnnnnnn
BKFL1_0042_B11.b : nnnnnnnnnn
MLTL1_0071_F09.b : nnngggtt
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b : nnnnnnn
AMP01_0062_E06.b : nnncc
MLTL1_0078_F12.b : nnnnnnnnnn
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 128
DCI01_0097_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0006_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACTAGG
DCI01_0064_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACTAGG
MLTL1_0079_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGG
MLTL1_0086_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0016_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0074_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_D03.b : nnnnncctctagctgtcngxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_D01.b : nggaaccgtttgcgga
MLTL1_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0073_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0028_E03.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C04.b : nt
MLTL1_0056_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_E11.b : nnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0018_G02.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F05.b : aatcatacttgggggctgctcgcccgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0029_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_C11.b :
DCI01_0057_A06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0022_B04.b : ttttnnnnntagatatctatgggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0082_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0106_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0042_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
MLTL1_0071_F09.b : attttnnnccgaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_D03.b : tattttccgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H04.b : aaaannccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E06.b : agaaaannttagcgacacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_F12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
DCI01_0097_D05.b : nnnnncgatatcaangggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H11.b : nnaaaatgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0030_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
BKFL1_0098_H10.b : nnnnttttagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
AMP01_0013_D06.b : nnnttactaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_G04.b : nnnnaacgatacttagggctgctcccgcgccgxxxxxxxx
BKFL1_0086_A03.b : nnggaattnnnnnnccgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
AMP01_0072_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
BKFL1_0046_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0058_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0045_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0045_B03.b : nnccctattnnnnnnnggatactaaxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0043_B06.b : gactatagggctgctcgcccgccg
CBLT1_0014_C03.b :
BKFL1_0084_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0088_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0059_F03.b : nnnnnnnnnnnnnnnnnnn
BKFL1_0050_H12.b : nnncctttttataaaa
AMP01_0015_A03.b : ncctat
MLTL1_0078_E04.b : nnnnnnnnn
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 188
DCI01_0117_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCACGC
DCI01_0115_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0049_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0059_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
OVRT1_0001_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAATGTAATTGTTACAGCTCATGC
BKFL1_0057_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATGTAATTGTTACAGCTCATGC
MLTL1_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAATTGTTACAGCTCATGC
DCI01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAATTGTTACAGCTCATGC
DCI01_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCTCATGC
MLTL1_0036_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCATGC
MLTL1_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCATGC
BKFL1_0119_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCATGC
DCI01_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATGC
BKFL1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
MLTL1_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0090_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
MLTL1_0091_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0114_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0116_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0059_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
CLNT1_0038_D01.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgg
MLTL1_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0073_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0028_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C04.b : ttttttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0029_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_C11.b : nttttccgttagcgnacgxxxxxxxxxxxxx
DCI01_0057_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0082_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0042_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0071_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0030_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0086_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C03.b :
BKFL1_0084_G03.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0088_E05.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0059_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H12.b : gatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_A03.b : annnnnttggaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
AMP01_0006_E02.b : nnaatcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G08.b : nnnnccgtaactatagggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G03.b : nnccgtaatcttagggctgctcccncgccgxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
AMP01_0102_B11.b : ggcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0019_B01.b : ntttagtaactaaxxxxxxxxxxx
AMP01_0090_E09.b : ataccgtatcxxxxxxxxxxxxxx
MLTL1_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0033_B03.b : nnnnnnnnnnnnnnnnnn
BKFL1_0070_C05.b : nncctgtaannnnnnn
AMP01_0024_H12.b : nngggtttttatat
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 247
MLTL1_0056_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0053_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0042_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0029_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0073_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*TTGGGGGTTTTGGTAACTGAC
CLNT1_0065_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGGGTTTTGGTAACTGAC
DCI01_0057_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0031_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0082_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0042_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0071_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0102_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
AMP01_0032_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
AMP01_0062_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0078_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0030_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
MLTL1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
AMP01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
DCI01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0086_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
AMP01_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C03.b : tttgggacggtagaggccgtagtatttatxxxxxxxxxxx
BKFL1_0084_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0088_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0070_C05.b : ccgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_H12.b : aggaatcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_D06.b : gggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0044_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0099_H01.b : gggttannnntaatagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_B12.b : nnaaaccctctatcttnnnnagtactcttxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0075_F06.b : acctttagagaatctaaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : nnaaaccgatactaagggctgctcccgcgccgxxx
AMP01_0009_B07.b : nggtaatccatxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0024_F12.b : nnnccgctannnaaaaggtactatagggctgctcccgc
AMP01_0016_B11.b : nntttactaatc
AMP01_0016_B04.b : nccgataannnnntaggaatcta
AMP01_0085_H10.b : naaac
AMP01_0046_C04.b : cctt
MLTL1_0081_F07.b : nn
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 307
BKFL1_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCACGTATAAACAACATAAGTT
AMP01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGTATAAACAACATAAGTT
MLTL1_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
AMP01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
DCI01_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
AMP01_0085_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATAAACAACATAAGTT
BKFL1_0096_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACATAAGTT
AMP01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATAAGTT
MLTL1_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATAAGTT
DCI01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0070_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0044_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0099_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_G04.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_F12.b : accgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B11.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_H10.b : gtaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C04.b : agggaatcttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0081_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
MLTL1_0058_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0097_E10.b : nnnncattttttnnnnnccgaaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0099_E04.b : nnnnccctatannnnnnncgaaccntatagggctxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
AMP01_0013_B02.b : ntaataatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_F02.b : nggagataantatagggatatcttagggctxxxxxxxxxxxxxxx
AMP01_0084_A08.b : aaaacctaatctaaxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0044_B11.b : taatcttaxxxx
MLTL1_0059_D03.b : nnnn
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 366
MLTL1_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTGGCAACCTCAATAG*TAGAAGCCGGA
BKFL1_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0070_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCCTCAATAG*TAGAAGCCGGA
AMP01_0024_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCCTCAATAG*TAGAAGCCGGA
AMP01_0102_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAAGCCGGA
MLTL1_0044_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCGGA
BKFL1_0099_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCGGA
MLTL1_0046_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA
BKFL1_0056_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0097_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
MLTL1_0025_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0045_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0036_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
BKFL1_0096_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0046_D11.b : nngggacatctctattanggatatcaaxxxxxxxxxxxxx
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 426
AMP01_0016_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0016_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0085_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0046_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAACTTAGCCCATGCAGGGGCT
MLTL1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCAGGGGCT
MLTL1_0058_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGGGGCT
MLTL1_0097_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0099_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
AMP01_0013_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
AMP01_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_F11.b : nnaaagtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0031_E12.b : ngggaatatatatagggtatcttxxxxxxxxxxxxxx
AMP01_0050_D01.b : nngg
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 485
MLTL1_0059_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCTAGGGGC
MLTL1_0025_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
BKFL1_0096_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0046_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0031_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_D01.b : ggtaaatatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 542
AMP01_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATGTCTCAATAC*CA
AMP01_0031_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B08.b : nnn
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
---------+---------+---------+---------+---------+---------+ 600
DCI01_0030_B12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCCCAGgcggaactacttctaataacccg
AMP01_0068_F06.b : AACA