[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000047

Length: 1,697

Sequence [FASTA format sequence]
CCTATGTTCG TAAATCGTTG ACTATACTCA ACAAACCACA AAGACATCGG CACCCTGTAC
CTACTATTTG GTGCCTGAGC AGGAATAGTG GGCACTGCCT TGAGCCTACT AATTCGCGCT
GAACTAGGTC AGCCCGGAAC CCTACTTGGC GATGATCAAA TCTATAATGT AATTGTTACA
GCTCATGCCT TTGTAATAAT CTTCTTTATA GTAATACCCA TTATGATTGG GGGTTTTGGT
AACTGACTCG TACCGCTAAT AATCGGAGCT CCCGATATGG CCTTTCCACG TATAAACAAC
ATAAGTTTCT GACTACTTCC ACCATCCTTC CTATTACTTC TGGCATCCTC AATAGTAGAA
GCCGGAGCGG GTACTGGATG AACTGTATAC CCACCTTTAG CTGGAAACTT AGCCCATGCA
GGGGCTTCAG TTGATTTAAC AATTTTCTCC CTACACCTTG CAGGTGTATC ATCAATCCTA
GGGGCTATTA ATTTCATTAC CACAATTATT AACATAAAAC CCCCCGCAAT GTCTCAATAC
CAAACACCCC TGTTTGTCTG ATCAGTACTA ATCACAGCCG TACTACTTCT ACTATCCCTG
CCAGTTCTAG CAGCTGGCAT TACTATACTA CTGACAGACC GCAACCTGAA CACAACCTTT
TTTGATCCAG CAGGTGGTGG AGACCCTATC CTTTATCAAC ACTTGTTCTG ATTTTTCGGA
CACCCAGAAG TATACATTCT CATCTTACCA GGATTCGGAA TAATCTCCCA CATTGTAACC
TACTATTCAG GTAAAAAAGA ACCATTTGGA TATATAGGCA TAGTATGAGC CATAATGTCC
ATTGGATTCT TAGGTTTTAT TGTATGGGCT CACCACATAT TCACCGTAGG AATAGACGTA
GATACCCGAG CATACTTTAC ATCTGCTACA ATAATCATTG CTATTCCCAC TGGAGTAAAA
GTATTTAGTT GATTAGCTAC CCTGCACGGC GGCAATATTA AATGATCACC CGCAATACTA
TGAGCTCTGG GCTTCATCTT CCTATTCACC GTAGGAGGTC TAACGGGCAT TGTACTAGCT
AATTCCTCCC TAGACATTGT ATTACATGAT ACATATTATG TAGTCGCACA CTTCCACTAT
GTCTTATCTA TAGGAGCAGT GTTCGCCATT ATAGGGGGCT TTGTTCACTG ATTCCCCCTA
TTCTCCGGGT ACACACTCAA CCAAGCATGA GCAAAAATTC ACTTTGTAAT CATATTCGTA
GGAGTAAATA TAACATTCTT TCCACAACAC TTTCTAGGAC TATCCGGAAT ACCTCGACGA
TACTCCGATT ATCCTGACGC ATACACAGCA TGAAATACTA TTTCCTCAAT AGGCTCATTC
ATCTCACTAA CAGCAGTGAT ATTAATAATC TTCATTATCT GAGAAGCATT CGCATCAAAA
CGAGAAGTAT CTGCAGTAGA ACTGACAAGC ACAAACCTAG AATGACTACA CGGATGTCCT
CCTCCCTATC ACACATTTGA AGAACCAACA TATATCAACC TAAAATAAGC ATAAGAAAGG
AAGGAATCGA ACCCTCTCCC ACTGGTTTCA AGCCAACGTC ATAACCACTA TGTCTTTCTC
GATAATCAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Homo sapiens]. 7430.0O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Mus musculus]. 7670.0O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Canis lupus familiaris]. 7790.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Bos taurus]. 7770.0O
Contig/Assembly ProteinLOC100301020PREDICTED: cytochrome c oxidase subunit I-like, partial [Bos taurus]. 1128e-25O
Contig/Assembly ProteinLOC100299681PREDICTED: cytochrome c oxidase subunit I-like [Bos taurus]. 95.51e-19O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCOX1cytochrome c oxidase subunit I [Sus scrofa]. 8000.0O


Assembly Members: 508      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010001E11AMP01_0001_E11.bBW955036 
AMP010001E12AMP01_0001_E12.bBW955037 
AMP010003A10AMP01_0003_A10.bBW955131 
AMP010004D12AMP01_0004_D12.bBW955239 
AMP010004F11AMP01_0004_F11.bBW955262 AK389610
AMP010004H05AMP01_0004_H05.bBW955275 
AMP010005D04AMP01_0005_D04.bBW955310 
AMP010006A12AMP01_0006_A12.bBW955367 
AMP010006E02AMP01_0006_E02.bBW955402 
AMP010008G11AMP01_0008_G11.bBW955566 
AMP010009B07AMP01_0009_B07.bBW955590 
AMP010009F07AMP01_0009_F07.bBW955633 
AMP010010D12AMP01_0010_D12.bBW955704 
AMP010011D03AMP01_0011_D03.bBW955777 
AMP010013B02AMP01_0013_B02.bBW955913 
AMP010013D06AMP01_0013_D06.bBW955936 
AMP010015A03AMP01_0015_A03.bBW956056 
AMP010016B04AMP01_0016_B04.bBW956144 
AMP010016B11AMP01_0016_B11.bBW956150 
AMP010016E05AMP01_0016_E05.bBW956176 
AMP010017G01AMP01_0017_G01.bBW956274 
AMP010022D04AMP01_0022_D04.bBW956646 
AMP010022H09AMP01_0022_H09.bBW956692 
AMP010023F07AMP01_0023_F07.bBW956740 
AMP010024H12AMP01_0024_H12.bBW956829 
AMP010026A07AMP01_0026_A07.bBW956915 
AMP010026C03AMP01_0026_C03.bBW956931 
AMP010028B05AMP01_0028_B05.bBW957085 
AMP010031E12AMP01_0031_E12.b  
AMP010031G08AMP01_0031_G08.bBW957232 
AMP010032G06AMP01_0032_G06.bBW957302 
AMP010033A04AMP01_0033_A04.bBW957323 
AMP010033D07AMP01_0033_D07.bBW957356 
AMP010034B12AMP01_0034_B12.bBW957425 
AMP010034C10AMP01_0034_C10.bBW957433 
AMP010034D05AMP01_0034_D05.bBW957440 
AMP010035E08AMP01_0035_E08.bBW957533 
AMP010035G10AMP01_0035_G10.bBW957558 AK389681
AMP010036B06AMP01_0036_B06.bBW957588 
AMP010036B11AMP01_0036_B11.bBW957593 
AMP010036G01AMP01_0036_G01.bBW957634 
AMP010037A02AMP01_0037_A02.bBW957651 
AMP010037B06AMP01_0037_B06.bBW957663 
AMP010037H11AMP01_0037_H11.bBW957707 
AMP010037H12AMP01_0037_H12.bBW957708 
AMP010038C03AMP01_0038_C03.bBW957726 
AMP010038G05AMP01_0038_G05.bBW957752 
AMP010039D08AMP01_0039_D08.bBW957794 
AMP010040D02AMP01_0040_D02.bBW957850 
AMP010040E07AMP01_0040_E07.b  
AMP010040H10AMP01_0040_H10.bBW957882 
AMP010042A08AMP01_0042_A08.bBW957967 
AMP010043D01AMP01_0043_D01.bBW958047 
AMP010043H12AMP01_0043_H12.bBW958072 
AMP010044B11AMP01_0044_B11.bBW958088 
AMP010044F02AMP01_0044_F02.b  
AMP010044G12AMP01_0044_G12.b  
AMP010045D04AMP01_0045_D04.bBW958173 
AMP010046A06AMP01_0046_A06.bBW958220 
AMP010046C04AMP01_0046_C04.bBW958238 
AMP010046F06AMP01_0046_F06.bFS639999 
AMP010047H08AMP01_0047_H08.bBW958357 
AMP010048D08AMP01_0048_D08.bBW958393 
AMP010048D11AMP01_0048_D11.bBW958396 
AMP010048H05AMP01_0048_H05.bBW958422 
AMP010050D01AMP01_0050_D01.bBW958531 
AMP010053F07AMP01_0053_F07.bBW958793 
AMP010054A11AMP01_0054_A11.bBW958827 
AMP010054B08AMP01_0054_B08.bBW958835 
AMP010054F06AMP01_0054_F06.bBW958875 
AMP010055F02AMP01_0055_F02.bBW958948 
AMP010055G03AMP01_0055_G03.bBW958957 
AMP010056B10AMP01_0056_B10.bBW958994 
AMP010056H04AMP01_0056_H04.b  
AMP010057D02AMP01_0057_D02.bBW959089 AK389740
AMP010059B08AMP01_0059_B08.bBW959241 
AMP010059G05AMP01_0059_G05.bBW959292 
AMP010060A10AMP01_0060_A10.bBW959315 
AMP010060C05AMP01_0060_C05.bBW959334 
AMP010060D06AMP01_0060_D06.bBW959346 
AMP010061D03AMP01_0061_D03.bBW959424 
AMP010061H03AMP01_0061_H03.bBW959463 
AMP010062E06AMP01_0062_E06.bBW959499 
AMP010062E10AMP01_0062_E10.bBW959502 
AMP010064F02AMP01_0064_F02.bBW959650 
AMP010065B11AMP01_0065_B11.bBW959699 
AMP010066A04AMP01_0066_A04.bBW959741 
AMP010067D03AMP01_0067_D03.bFS640001 
AMP010068C05AMP01_0068_C05.bBW959911 
AMP010068F01AMP01_0068_F01.bBW959941 
AMP010068F06AMP01_0068_F06.bBW959945 
AMP010068F07AMP01_0068_F07.bBW959946 
AMP010069A06AMP01_0069_A06.bBW959975 
AMP010069A07AMP01_0069_A07.bBW959976 
AMP010069C11AMP01_0069_C11.bBW960002 
AMP010069D10AMP01_0069_D10.bBW960012 
AMP010070C12AMP01_0070_C12.bBW960087 
AMP010071G06AMP01_0071_G06.b  
AMP010072H02AMP01_0072_H02.bBW960241 
AMP010072H03AMP01_0072_H03.bBW960242 
AMP010074A04AMP01_0074_A04.bBW960285 
AMP010075B01AMP01_0075_B01.b  
AMP010075F06AMP01_0075_F06.bBW960409 
AMP010075F10AMP01_0075_F10.bBW960412 
AMP010075G10AMP01_0075_G10.bBW960424 
AMP010075H12AMP01_0075_H12.bBW960436 
AMP010077D05AMP01_0077_D05.bBW960543 
AMP010079F11AMP01_0079_F11.bBW960723 
AMP010080A07AMP01_0080_A07.bBW960749 
AMP010080A11AMP01_0080_A11.bBW960752 
AMP010080C01AMP01_0080_C01.bBW960759 
AMP010082C03AMP01_0082_C03.bBW960910 
AMP010083E04AMP01_0083_E04.bBW961009 
AMP010083F02AMP01_0083_F02.bBW961017 
AMP010083F10AMP01_0083_F10.bBW961024 
AMP010084A08AMP01_0084_A08.bBW961055 
AMP010084D04AMP01_0084_D04.bBW961084 
AMP010084H01AMP01_0084_H01.bBW961126 
AMP010085B01AMP01_0085_B01.bBW961146 
AMP010085F10AMP01_0085_F10.bBW961198 
AMP010085G03AMP01_0085_G03.bBW961203 
AMP010085H10AMP01_0085_H10.bBW961219 
AMP010086G11AMP01_0086_G11.bBW961298 
AMP010087E06AMP01_0087_E06.bBW961357 
AMP010087E12AMP01_0087_E12.bBW961362 
AMP010087H04AMP01_0087_H04.bBW961387 
AMP010088A10AMP01_0088_A10.bBW961401 
AMP010088G03AMP01_0088_G03.bBW961460 
AMP010089A08AMP01_0089_A08.bBW961485 
AMP010090E09AMP01_0090_E09.bBW961609 
AMP010091A11AMP01_0091_A11.bBW961658 
AMP010091F11AMP01_0091_F11.bBW961710 
AMP010092F05AMP01_0092_F05.bBW961788 
AMP010093B03AMP01_0093_B03.bBW961830 
AMP010093B08AMP01_0093_B08.bBW961834 
AMP010093D06AMP01_0093_D06.bBW961852 
AMP010093D11AMP01_0093_D11.bBW961856 
AMP010093E01AMP01_0093_E01.bBW961858 
AMP010093G09AMP01_0093_G09.bBW961889 
AMP010094D02AMP01_0094_D02.bBW961937 
AMP010094E10AMP01_0094_E10.bBW961955 
AMP010094F02AMP01_0094_F02.bBW961958 
AMP010094G03AMP01_0094_G03.bBW961971 
AMP010094H09AMP01_0094_H09.bBW961985 
AMP010096B02AMP01_0096_B02.bBW962094 
AMP010096D07AMP01_0096_D07.bBW962123 
AMP010096E05AMP01_0096_E05.b  
AMP010097F02AMP01_0097_F02.bBW962229 
AMP010098D08AMP01_0098_D08.bBW962303 
AMP010100D07AMP01_0100_D07.bBW962474 
AMP010101B01AMP01_0101_B01.bBW962537 
AMP010101D07AMP01_0101_D07.bBW962566 
AMP010101G11AMP01_0101_G11.bBW962603 
AMP010102B11AMP01_0102_B11.bBW962635 
AMP010102D06AMP01_0102_D06.bBW962653 
BFLT10028G03BFLT1_0028_G03.bFS642306 
BKFL10004D01BKFL1_0004_D01.bFS648098 
BKFL10005D08BKFL1_0005_D08.bFS648153 
BKFL10006E06BKFL1_0006_E06.bFS648250 
BKFL10009E04BKFL1_0009_E04.bFS648501 
BKFL10009G01BKFL1_0009_G01.bFS648520 
BKFL10010A08BKFL1_0010_A08.bFS648551 
BKFL10027C05BKFL1_0027_C05.bFS649638 
BKFL10028A09BKFL1_0028_A09.bFS649706 
BKFL10028C04BKFL1_0028_C04.bFS649724 
BKFL10029B03BKFL1_0029_B03.bFS649800 
BKFL10030C04BKFL1_0030_C04.bFS649899 
BKFL10030C12BKFL1_0030_C12.bFS649906 
BKFL10031D12BKFL1_0031_D12.bFS650010 
BKFL10031F10BKFL1_0031_F10.bFS650032 
BKFL10032A03BKFL1_0032_A03.bFS650059 
BKFL10032E02BKFL1_0032_E02.bFS650098 
BKFL10032G09BKFL1_0032_G09.bFS650125 
BKFL10033B03BKFL1_0033_B03.bFS650155 
BKFL10033H04BKFL1_0033_H04.bFS650224 
BKFL10034C09BKFL1_0034_C09.bFS650264 
BKFL10034G04BKFL1_0034_G04.bFS650305 
BKFL10042B11BKFL1_0042_B11.bFS650986 
BKFL10045G02BKFL1_0045_G02.bFS651299 
BKFL10046G12BKFL1_0046_G12.bFS651402 
BKFL10050G06BKFL1_0050_G06.bFS651748 
BKFL10050H10BKFL1_0050_H10.bFS651764 AK390708
BKFL10050H12BKFL1_0050_H12.bFS651766 
BKFL10056G04BKFL1_0056_G04.bFS652277 
BKFL10057B06BKFL1_0057_B06.bFS652312 
BKFL10057D03BKFL1_0057_D03.bFS652333 
BKFL10059F03BKFL1_0059_F03.bFS652530 
BKFL10070C05BKFL1_0070_C05.bFS652588 
BKFL10073B10BKFL1_0073_B10.bFS652844 
BKFL10078D06BKFL1_0078_D06.bFS653306 
BKFL10079G08BKFL1_0079_G08.bFS653428 
BKFL10082B12BKFL1_0082_B12.bFS653644 
BKFL10084G03BKFL1_0084_G03.bFS653870 
BKFL10085A10BKFL1_0085_A10.bFS653901 
BKFL10086A03BKFL1_0086_A03.bFS653985 
BKFL10088E05BKFL1_0088_E05.bFS654208 
BKFL10096F01BKFL1_0096_F01.bFS654920 
BKFL10096G09BKFL1_0096_G09.bFS654937 
BKFL10098H10BKFL1_0098_H10.bFS655130 
BKFL10099H01BKFL1_0099_H01.bFS655212 
BKFL10100A03BKFL1_0100_A03.bFS655226 
BKFL10106B10BKFL1_0106_B10.bFS655769 
BKFL10106F03BKFL1_0106_F03.bFS655805 
BKFL10107C06BKFL1_0107_C06.bFS655867 
BKFL10119B03BKFL1_0119_B03.bFS656922 
BMWN10014D09BMWN1_0014_D09.bHX206462 
BMWN10017H12BMWN1_0017_H12.bHX206612 
BMWN10081D12BMWN1_0081_D12.b  
BMWN10087F02BMWN1_0087_F02.b  
CBLT10014C03CBLT1_0014_C03.bHX212779 
CBLT10019A02CBLT1_0019_A02.bHX213124 
CBLT10025G05CBLT1_0025_G05.bHX213627 
CBLT10061H01CBLT1_0061_H01.bHX216017 
CBLT10065E03CBLT1_0065_E03.bHX216303 
CBLT10068E12CBLT1_0068_E12.bHX216580 
CBLT10074F06CBLT1_0074_F06.bHX217088 
CBLT10089C04CBLT1_0089_C04.bHX218215 
CLNT10038D01CLNT1_0038_D01.bFS660021 
CLNT10065C11CLNT1_0065_C11.bFS662166 
DCI010013A04DCI01_0013_A04.bDB791420 
DCI010014G03DCI01_0014_G03.bDB791567 
DCI010015H08DCI01_0015_H08.bDB791672 
DCI010016E09DCI01_0016_E09.bDB791731 
DCI010016F11DCI01_0016_F11.bDB791744 
DCI010019B01DCI01_0019_B01.bDB791960 
DCI010019D04DCI01_0019_D04.bDB791984 
DCI010019E09DCI01_0019_E09.bDB792000 
DCI010020C03DCI01_0020_C03.bDB792062 
DCI010020D05DCI01_0020_D05.bDB792076 
DCI010023F06DCI01_0023_F06.bDB792369 
DCI010025B09DCI01_0025_B09.bDB792508 
DCI010026G02DCI01_0026_G02.bDB792648 
DCI010027F01DCI01_0027_F01.bDB792725 
DCI010028H01DCI01_0028_H01.bDB792822 
DCI010030B12DCI01_0030_B12.bDB792943 
DCI010031D07DCI01_0031_D07.bDB793048 
DCI010032B11DCI01_0032_B11.bDB793119 
DCI010033B01DCI01_0033_B01.bDB793201 
DCI010033D03DCI01_0033_D03.bDB793225 
DCI010034C08DCI01_0034_C08.bDB793313 
DCI010041E08DCI01_0041_E08.bDB793852 
DCI010041F05DCI01_0041_F05.bDB793860 
DCI010042E03DCI01_0042_E03.bDB793936 
DCI010043B06DCI01_0043_B06.bDB793997 
DCI010044C08DCI01_0044_C08.bDB794100 
DCI010044F02DCI01_0044_F02.bDB794129 
DCI010045F07DCI01_0045_F07.bDB794223 
DCI010057A06DCI01_0057_A06.bDB794602 
DCI010059E05DCI01_0059_E05.bDB794820 
DCI010061B04DCI01_0061_B04.bDB794966 
DCI010061E09DCI01_0061_E09.bDB795007 
DCI010061F04DCI01_0061_F04.bDB795014 
DCI010062C09DCI01_0062_C09.bDB795076 
DCI010063D11DCI01_0063_D11.bDB795181 
DCI010064C12DCI01_0064_C12.bDB795260 
DCI010065E01DCI01_0065_E01.bDB795361 
DCI010065E05DCI01_0065_E05.bDB795365 
DCI010065E11DCI01_0065_E11.bDB795371 
DCI010066C02DCI01_0066_C02.bDB795430 
DCI010067C07DCI01_0067_C07.bDB795526 
DCI010068B02DCI01_0068_B02.bDB795597 
DCI010068F04DCI01_0068_F04.bDB795645 
DCI010069A08DCI01_0069_A08.bDB795682 
DCI010069B01DCI01_0069_B01.bDB795686 
DCI010070B04DCI01_0070_B04.bDB795770 
DCI010070D01DCI01_0070_D01.bDB795789 
DCI010070H11DCI01_0070_H11.bDB795842 
DCI010071B02DCI01_0071_B02.bDB795857 
DCI010071D03DCI01_0071_D03.bDB795882 
DCI010071H11DCI01_0071_H11.bDB795931 
DCI010072B05DCI01_0072_B05.bDB795947 
DCI010072D09DCI01_0072_D09.bDB795973 
DCI010072E02DCI01_0072_E02.bDB795976 
DCI010072F05DCI01_0072_F05.bDB795990 
DCI010073B03DCI01_0073_B03.bDB796030 
DCI010073F01DCI01_0073_F01.bDB796075 
DCI010073G01DCI01_0073_G01.bDB796084 
DCI010074H04DCI01_0074_H04.bDB796189 
DCI010075H05DCI01_0075_H05.bDB796273 
DCI010076B01DCI01_0076_B01.bDB796292 
DCI010076D03DCI01_0076_D03.bDB796315 
DCI010076F09DCI01_0076_F09.bDB796343 
DCI010077A08DCI01_0077_A08.bDB796372 
DCI010077F04DCI01_0077_F04.bDB796420 
DCI010077F06DCI01_0077_F06.bDB796422 
DCI010077G01DCI01_0077_G01.bDB796429 
DCI010077G07DCI01_0077_G07.bDB796434 
DCI010077H07DCI01_0077_H07.bDB796445 
DCI010077H09DCI01_0077_H09.bDB796447 
DCI010078H06DCI01_0078_H06.bDB796537 
DCI010080D03DCI01_0080_D03.bDB796664 
DCI010080H09DCI01_0080_H09.bDB796712 
DCI010081G05DCI01_0081_G05.bDB796787 
DCI010082E08DCI01_0082_E08.bDB796856 
DCI010082F02DCI01_0082_F02.bDB796862 
DCI010082G12DCI01_0082_G12.bDB796883 
DCI010083B09DCI01_0083_B09.bDB796914 
DCI010083F02DCI01_0083_F02.bDB796946 
DCI010083G08DCI01_0083_G08.bDB796963 
DCI010083G09DCI01_0083_G09.bDB796964 
DCI010084E06DCI01_0084_E06.bDB797029 
DCI010084G02DCI01_0084_G02.bDB797048 
DCI010085E06DCI01_0085_E06.bDB797118 
DCI010087E01DCI01_0087_E01.bDB797294 
DCI010087E05DCI01_0087_E05.bDB797297 
DCI010087H04DCI01_0087_H04.bDB797329 
DCI010088F04DCI01_0088_F04.bDB797394 
DCI010090D05DCI01_0090_D05.bDB797549 
DCI010090G10DCI01_0090_G10.bDB797588 
DCI010093G03DCI01_0093_G03.bDB797853 
DCI010093G04DCI01_0093_G04.bDB797854 
DCI010094G04DCI01_0094_G04.bDB797943 
DCI010095H12DCI01_0095_H12.bDB798049 
DCI010097D05DCI01_0097_D05.bDB798171 
DCI010097F01DCI01_0097_F01.bDB798189 
DCI010097H10DCI01_0097_H10.bDB798221 
DCI010098B09DCI01_0098_B09.bDB798240 
DCI010098G04DCI01_0098_G04.bDB798293 
DCI010098G05DCI01_0098_G05.bDB798294 
DCI010099A07DCI01_0099_A07.bDB798320 
DCI010099G02DCI01_0099_G02.bDB798386 
DCI010100A01DCI01_0100_A01.bDB798409 
DCI010101E02DCI01_0101_E02.bDB798544 
DCI010101G02DCI01_0101_G02.bDB798565 
DCI010102D03DCI01_0102_D03.bDB798621 
DCI010104E09DCI01_0104_E09.bDB798814 
DCI010104F03DCI01_0104_F03.bDB798819 
DCI010106B10DCI01_0106_B10.bDB798953 
DCI010107B06DCI01_0107_B06.bDB799035 
DCI010108D05DCI01_0108_D05.bDB799129 
DCI010108G06DCI01_0108_G06.bDB799165 
DCI010109B09DCI01_0109_B09.bDB799198 
DCI010109H01DCI01_0109_H01.bDB799259 
DCI010110A04DCI01_0110_A04.bDB799274 
DCI010111C12DCI01_0111_C12.bDB799395 
DCI010113H12DCI01_0113_H12.bDB799628 
DCI010114C07DCI01_0114_C07.bDB799656 
DCI010114D02DCI01_0114_D02.bDB799663 
DCI010114D12DCI01_0114_D12.bDB799673 
DCI010114F10DCI01_0114_F10.bDB799695 
DCI010114G06DCI01_0114_G06.bDB799703 
DCI010115A02DCI01_0115_A02.bDB799723 
DCI010115B09DCI01_0115_B09.bDB799739 
DCI010115F12DCI01_0115_F12.bDB799788 
DCI010116H04DCI01_0116_H04.bDB799891 
DCI010117A08DCI01_0117_A08.bDB799907 
DCI010117C07DCI01_0117_C07.bDB799929 
DCI010117G06DCI01_0117_G06.bDB799975 
DCI010118E10DCI01_0118_E10.bDB800043 
HTMT10003G03HTMT1_0003_G03.b  
HTMT10010G06HTMT1_0010_G06.b  
HTMT10067H03HTMT1_0067_H03.b  
HTMT10099F09HTMT1_0099_F09.b  
HTMT10115G01HTMT1_0115_G01.b  
HTMT10119D07HTMT1_0119_D07.bHX224497 
HTMT10128H05HTMT1_0128_H05.bHX225070 
HTMT10129G11HTMT1_0129_G11.b  
HTMT10151B12HTMT1_0151_B12.b  
HTMT10152E10HTMT1_0152_E10.b  
ILNT10002D09ILNT1_0002_D09.bHX226860 
ILNT10002E08ILNT1_0002_E08.bHX226871 
MLTL10004E09MLTL1_0004_E09.bFS678774 
MLTL10005B02MLTL1_0005_B02.bFS678819 
MLTL10005D03MLTL1_0005_D03.bFS678842 
MLTL10006B08MLTL1_0006_B08.bFS678913 
MLTL10006D09MLTL1_0006_D09.bFS678935 
MLTL10008E10MLTL1_0008_E10.bFS679113 
MLTL10009H05MLTL1_0009_H05.bFS679222 
MLTL10010E03MLTL1_0010_E03.bFS679270 
MLTL10012A08MLTL1_0012_A08.bFS679405 
MLTL10013F11MLTL1_0013_F11.bFS679542 
MLTL10014B10MLTL1_0014_B10.bFS679582 
MLTL10014H07MLTL1_0014_H07.bFS679650 
MLTL10015D02MLTL1_0015_D02.bFS679688 
MLTL10015F03MLTL1_0015_F03.bFS679711 
MLTL10016B03MLTL1_0016_B03.bFS679752 
MLTL10016H04MLTL1_0016_H04.bFS679814 
MLTL10018D05MLTL1_0018_D05.bFS679950 
MLTL10018G02MLTL1_0018_G02.bFS679980 
MLTL10020E11MLTL1_0020_E11.bFS680145 
MLTL10022B04MLTL1_0022_B04.bFS680282 
MLTL10022C11MLTL1_0022_C11.bFS680301 
MLTL10024A07MLTL1_0024_A07.bFS680448 
MLTL10024F12MLTL1_0024_F12.bFS680511 
MLTL10025A12MLTL1_0025_A12.bFS680545 
MLTL10025D01MLTL1_0025_D01.bFS680570 
MLTL10025E02MLTL1_0025_E02.bFS680582 
MLTL10025H10MLTL1_0025_H10.bFS680625 
MLTL10026H04MLTL1_0026_H04.bFS680708 
MLTL10027A04MLTL1_0027_A04.bFS680718 
MLTL10028E03MLTL1_0028_E03.bFS680853 
MLTL10029E11MLTL1_0029_E11.bFS680949 
MLTL10029H08MLTL1_0029_H08.bFS680979 
MLTL10029H09MLTL1_0029_H09.bFS680980 
MLTL10030B01MLTL1_0030_B01.bFS680994 
MLTL10030B07MLTL1_0030_B07.bFS680999 
MLTL10030C03MLTL1_0030_C03.bFS681006 
MLTL10030D07MLTL1_0030_D07.bFS681022 
MLTL10030D12MLTL1_0030_D12.bFS681027 
MLTL10031B04MLTL1_0031_B04.bFS681083 
MLTL10031B06MLTL1_0031_B06.bFS681085 
MLTL10031E03MLTL1_0031_E03.bFS681110 
MLTL10034G12MLTL1_0034_G12.bFS681394 
MLTL10036A03MLTL1_0036_A03.bFS681494 
MLTL10036G05MLTL1_0036_G05.bFS681558 
MLTL10036G06MLTL1_0036_G06.bFS681559 
MLTL10036H12MLTL1_0036_H12.bFS681576 
MLTL10037F08MLTL1_0037_F08.bFS681638 
MLTL10038A10MLTL1_0038_A10.bFS681675 
MLTL10039E08MLTL1_0039_E08.bFS681807 
MLTL10040A08MLTL1_0040_A08.bFS681853 
MLTL10041E01MLTL1_0041_E01.bFS681983 
MLTL10042B10MLTL1_0042_B10.bFS682047 
MLTL10042H02MLTL1_0042_H02.bFS682102 
MLTL10043G09MLTL1_0043_G09.bFS682186 
MLTL10043G10MLTL1_0043_G10.bFS682187 
MLTL10043H01MLTL1_0043_H01.bFS682189 
MLTL10044C03MLTL1_0044_C03.bFS682224 
MLTL10044E01MLTL1_0044_E01.bFS682244 
MLTL10044G02MLTL1_0044_G02.bFS682267 
MLTL10045B03MLTL1_0045_B03.bFS682302 
MLTL10045C01MLTL1_0045_C01.bFS682312 
MLTL10045D12MLTL1_0045_D12.bFS682333 
MLTL10045E06MLTL1_0045_E06.bFS682339 
MLTL10045H09MLTL1_0045_H09.bFS682375 
MLTL10046B12MLTL1_0046_B12.bFS682401 
MLTL10046D11MLTL1_0046_D11.bFS682423 
MLTL10049C09MLTL1_0049_C09.bFS682670 
MLTL10050E02MLTL1_0050_E02.bFS682774 
MLTL10051F03MLTL1_0051_F03.bFS682873 
MLTL10052A03MLTL1_0052_A03.bFS682908 
MLTL10052A04MLTL1_0052_A04.bFS682909 
MLTL10052A08MLTL1_0052_A08.bFS682913 
MLTL10052B12MLTL1_0052_B12.bFS682929 
MLTL10052D01MLTL1_0052_D01.bFS682941 
MLTL10052E05MLTL1_0052_E05.bFS682955 
MLTL10053E11MLTL1_0053_E11.bFS683045 
MLTL10053H09MLTL1_0053_H09.bFS683077 
MLTL10053H12MLTL1_0053_H12.bFS683080 
MLTL10054F08MLTL1_0054_F08.bFS683142 
MLTL10055D09MLTL1_0055_D09.bFS683205 
MLTL10056C11MLTL1_0056_C11.bFS683282 
MLTL10056E09MLTL1_0056_E09.bFS683304 
MLTL10057D08MLTL1_0057_D08.bFS683379 
MLTL10057F08MLTL1_0057_F08.bFS683403 
MLTL10058D03MLTL1_0058_D03.bFS683468 
MLTL10058G09MLTL1_0058_G09.bFS683506 
MLTL10058H10MLTL1_0058_H10.bFS683518 
MLTL10059D03MLTL1_0059_D03.bFS683558 
MLTL10059F05MLTL1_0059_F05.bFS683583 
MLTL10070C11MLTL1_0070_C11.bFS683643 
MLTL10070G11MLTL1_0070_G11.bFS683690 
MLTL10071E05MLTL1_0071_E05.bFS683755 
MLTL10071F09MLTL1_0071_F09.bFS683769 
MLTL10073A03MLTL1_0073_A03.bFS683888 
MLTL10073A05MLTL1_0073_A05.bFS683890 
MLTL10073A07MLTL1_0073_A07.bFS683892 
MLTL10073B02MLTL1_0073_B02.bFS683899 
MLTL10073H09MLTL1_0073_H09.bFS683970 
MLTL10074D03MLTL1_0074_D03.bFS684011 
MLTL10075B10MLTL1_0075_B10.bFS684084 
MLTL10076B06MLTL1_0076_B06.bFS684173 
MLTL10076D10MLTL1_0076_D10.bFS684198 
MLTL10076H05MLTL1_0076_H05.bFS684237 
MLTL10077G02MLTL1_0077_G02.bFS684314 
MLTL10078A07MLTL1_0078_A07.bFS684340 
MLTL10078C04MLTL1_0078_C04.bFS684361 
MLTL10078E04MLTL1_0078_E04.bFS684383 
MLTL10078F12MLTL1_0078_F12.bFS684401 
MLTL10079A08MLTL1_0079_A08.bFS684429 
MLTL10079G10MLTL1_0079_G10.bFS684497 
MLTL10080C07MLTL1_0080_C07.bFS684538 
MLTL10081F07MLTL1_0081_F07.bFS684657 
MLTL10082C12MLTL1_0082_C12.bFS684717 
MLTL10082H09MLTL1_0082_H09.bFS684771 
MLTL10083A01MLTL1_0083_A01.bFS684775 
MLTL10083D11MLTL1_0083_D11.bFS684815 
MLTL10083F01MLTL1_0083_F01.bFS684828 
MLTL10083G08MLTL1_0083_G08.bFS684847 
MLTL10083G11MLTL1_0083_G11.bFS684850 
MLTL10084D10MLTL1_0084_D10.bFS684905 
MLTL10086A12MLTL1_0086_A12.b  
MLTL10086D10MLTL1_0086_D10.bFS685088 
MLTL10086E05MLTL1_0086_E05.bFS685095 
MLTL10086F06MLTL1_0086_F06.bFS685108 
MLTL10087D07MLTL1_0087_D07.bFS685174 
MLTL10087F08MLTL1_0087_F08.bFS685198 
MLTL10091C05MLTL1_0091_C05.bFS685532 
MLTL10091D07MLTL1_0091_D07.bFS685545 
MLTL10091E01MLTL1_0091_E01.bFS685551 
MLTL10092C10MLTL1_0092_C10.bFS685626 
MLTL10092E03MLTL1_0092_E03.bFS685642 
MLTL10095H08MLTL1_0095_H08.bFS685928 
MLTL10096A03MLTL1_0096_A03.bFS685934 
MLTL10097E10MLTL1_0097_E10.bFS686077 
MLTL10098E06MLTL1_0098_E06.bFS686161 
MLTL10099E04MLTL1_0099_E04.bFS686251 
MLTL10099F07MLTL1_0099_F07.bFS686266 
MLTL10099H10MLTL1_0099_H10.bFS686291 
MLTL10100E06MLTL1_0100_E06.bFS686345 
MLTL10100H06MLTL1_0100_H06.bFS686379 
OVRT10001D03OVRT1_0001_D03.bFS686448 
OVRT10074C04OVRT1_0074_C04.bFS692418 
OVRT10146E05OVRT1_0146_E05.bHX238530 
SPLT10020B12SPLT1_0020_B12.b  
SPLT10025B12SPLT1_0025_B12.bHX241121 
SPLT10078F12SPLT1_0078_F12.bHX245291 
SPLT10086B11SPLT1_0086_B11.bHX245882 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
1008A5400.675WSTCA/S
G2600.325TCG/S
1604A3700.925W-
T300.075
1626C400.190W-
T1700.810


Alignment:      TOP

20110601C-000047 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0030_B12.b : nttctatcctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_H10.b : nggggatatactaagtgatatcttngggctgctcccaxxxxxxxxxxxxxxxxxx
AMP01_0004_F11.b : ttattaggatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0010_D12.b : taaacgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C03.b : nnnaagtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0071_G06.b : aaaactaatgcgaatcctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_B10.b : nnnaaactaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D07.b : naacgtaactaagggctgctcgcgcgccgxxxxxxxxxxxxx
AMP01_0046_F06.b : aactcttagggaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_C03.b : nngggatatatatagagatacttaggcgctgctcccaxxxxxxxxxxxxxxxxxx
DCI01_0020_D05.b : nnnaagtaactatagggctgctcxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E01.b : aaaaagaaaagtctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H01.b : ctaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_D04.b : cacctttaccaatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_D05.b : nnggtttatnnaaanggatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E02.b : nnaaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0013_A04.b : nnnggatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H08.b : nnaaacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F06.b : ctgaaactantagggatacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_A12.b : nttaacgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_D03.b : accctagcgactaaagaggctgctcxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0027_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0030_D12.b : nnccctattaatattaagaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_H11.b : ngggatatactaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_E07.b : nncgtatatatatagggatatcttagggctgctcxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_C08.b : ttaatctaagggctaxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0078_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0036_G05.b : nncctatatnnnnaacgatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0009_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0029_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0070_H11.b : nnaaatacgatacatagggctgctcccgcgccgxxxxxxxxxxxxx
DCI01_0072_D09.b : nnnnnnccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0108_G06.b : nccttaaannnaancgatatctaagggctgctcxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0054_F06.b : nnnggagaaaanntaaaggatatctaagggctgctcccgcgccgxxxxxxxxxxxxx
MLTL1_0012_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0040_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
BKFL1_0027_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
AMP01_0068_F07.b : taacactntagaaatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0066_A04.b : agtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_A11.b : naaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D05.b : atataggcgtatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_A08.b : ataactaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0034_B12.b : nngggatatanntataacatatcttgggctgctcccgcaccgxxxxxxxxxxxxx
MLTL1_0015_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0016_F11.b : nttaacatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0004_D12.b : atttaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_D10.b : atctatagggatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G03.b : nnnggtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_G03.b :
AMP01_0094_F02.b : ggggttactacnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B01.b : nnnttttgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_H01.b : nnnttaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G09.b : nnnnttcgaatcataagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B04.b : nnnnnnccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_C02.b : nnnnnacgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_B01.b : nntttcgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0077_G07.b : nnnnaacgatacaatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_D04.b : nnnnccgtaatcatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0096_A03.b : nnctaaatnnnnnnncgatacctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_H06.b : nnnnaacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F04.b : nnnnncgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_E04.b : naaaccgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_H03.b : nnnggagaaaaantttaggatatcttgggctgctcgcccgccgxxxxxxxxxxxxx
MLTL1_0052_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0068_F04.b : nnnnnccgtaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_F02.b : ccccaacgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F04.b : ttttnccatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0113_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0091_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0057_D02.b : ataacctaacatgggggctxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
DCI01_0115_A02.b : nnnttctannnnnnnacgatatctaagggctgctcgcgcaccgxxxxxxxxxxxxx
AMP01_0062_E10.b : nnnggagaaaanntaagggacactatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_E05.b : nnnccctattnnnnnnnaatactatagggctactcgcccaccgxxxxxxxxxxxxx
AMP01_0094_D02.b : gcggtaaatccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0034_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0036_B11.b : nnccgatatantaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_D04.b : nnttttttttttttaggaatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G05.b : nnnnccgatactaangggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_E03.b : nnnccaacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_E06.b : nnnttacgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
AMP01_0036_G01.b : nnggggatanantaagggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F12.b : nnnnctaatnnnnaatcgaaccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C12.b : ntttttttcatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A08.b : nnnnaacgtactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B10.b : nnaagatanantaagggatacttangggctgctcxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G02.b : nnnaacgtaatcatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_E08.b : acccctttagttacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G03.b : nnnnaacgatactaagggctgctcccgcgccgxxxxxxxxxxxxx
BKFL1_0100_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
AMP01_0074_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0100_D07.b : ggggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_E10.b : agcgataactcattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E05.b : aaaannccgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_G02.b : nnnnaacataactaagggctgctcgcgcaccgxxxxxxxxxxxxx
AMP01_0035_G10.b : aaatctatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A08.b : nnnncgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F04.b : aaaaaaccatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_F07.b : nggtgtttnttataggaactcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_H09.b : nnaagaaannnnnaaacgaatctatagggctgctcccgcaccgxxxxxxxxxxxxx
DCI01_0083_F02.b : nnnnccgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_A08.b : nnnnccgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_D03.b : nntttacaatcctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H05.b : tattaccgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D03.b : ncctaaannnnaaacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H09.b : nnnttacgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_G01.b :
CBLT1_0068_E12.b :
AMP01_0037_H12.b : gaaacccgtagggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_E08.b :
CBLT1_0025_G05.b :
DCI01_0065_E05.b : aaaanccgaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H01.b : tttaacgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E11.b : gtattgataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_D02.b : nnggtgtatatatagggtattttgggggctgctcccaxxxxxxxxxxxxxxxxx
DCI01_0026_G02.b : naacgtaactaagggctgctcxxxxxxxxxxxxxxxxxxxx
AMP01_0044_F02.b : ccatttaggtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B08.b : gggaatactcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D06.b : ttaaacnnntaagaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_D08.b : gggataactcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_B06.b : nggtatactataagagatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H09.b : ggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_G10.b : nggatatcntataggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_D04.b : aaaaaccgaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F10.b : ntgataactttagcgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D05.b : nnggcgatatantnntgcgatacttgggctgctcccaxxxxxxxxxxxxxxxxx
DCI01_0098_G04.b : nnnnccgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_E05.b :
MLTL1_0018_D05.b : nnnccctaaannnnnnnncgatacaatagggctgctcxxxxxxxxxxxxxxxxxxx
AMP01_0043_D01.b : tttagctaacnttxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F03.b : ttttaccgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0034_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
MLTL1_0013_F11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
DCI01_0041_E08.b : nnnccgatacataagggctxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B02.b : gcgcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_H12.b : ttttaagtaatctaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : nggataatatatagccgatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0093_G09.b : ggggtaaatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : nccgaatactatagggatatcttxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
DCI01_0019_E09.b : nnnnnggatatcaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : nnnntacgtaatctaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : nnnnncgatactatagggctxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : nngggaaaaattaagggatatcttngggctgctcxxxxxxxxxxxx
MLTL1_0052_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0053_F07.b : nnnggagaaaantaaaccgaatcttagggctgctcccgcaccg
MLTL1_0052_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0009_E04.b : nnncccgaattnnnnnnggatatctaagggctactcxxxxxx
DCI01_0062_C09.b : nnnnnnccatactaaxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0071_D03.b : nnttttacatactaaxxxxxxxxxxxxxx
DCI01_0109_B09.b : nnnnnccgaacxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0033_D03.b : nnnaacatacataxxxxxxxxxxx
MLTL1_0030_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0083_F02.b : aaaaccgaatctaaxxxxxxxxxx
AMP01_0082_C03.b : ntaaattaatttaaxxxxxxxxxxxx
DCI01_0110_A04.b : aaaaaatcgaaaccataxxxxxxxxxx
MLTL1_0070_C11.b : nnttcttatnnnnaaacgaatctaaxxxxxxxx
MLTL1_0057_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0033_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0107_B06.b : nnaattaaaannnaaccgatactatagggctx
DCI01_0087_E01.b : nnnttttgatactaaxxxxxxx
AMP01_0092_F05.b : nnnccgtaatctaagggc
AMP01_0038_G05.b : nngggatacatatagagatatcttxxxxxx
BKFL1_0107_C06.b : nnnccccttnnnnnnngcgatactaaggg
AMP01_0069_A06.b : atactcctagggatacttaxxx
AMP01_0075_H12.b : ngataccntttaagatatcttxx
AMP01_0054_A11.b : nnggggataaantttagggatactatn
AMP01_0096_E05.b : gggataxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0096_D07.b : ggcgaaxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0078_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0033_D07.b : nnnccgatatnntnnatagata
DCI01_0067_C07.b : nnnnnccgta
DCI01_0025_B09.b : nnaacg
DCI01_0082_G12.b : nccattannnnaaac
DCI01_0033_B01.b : ntt
MLTL1_0029_E11.b : nnnnnnnnnnnn
MLTL1_0030_C03.b : nnnnnnnnnnnnnn
AMP01_0093_B03.b : ggcataact
MLTL1_0057_D08.b : nnccagtttnnnnnn
AMP01_0079_F11.b : tctatagg
DCI01_0061_E09.b : tt
AMP01_0101_D07.b : ggggax
DCI01_0114_D02.b : nnntttaaa
DCI01_0100_A01.b :
AMP01_0093_D11.b : cggc
AMP01_0037_A02.b : nggggatata
AMP01_0097_F02.b : cgcgt
MLTL1_0095_H08.b : nnnnnnnnnnnn
DCI01_0104_E09.b :
DCI01_0044_F02.b :
BKFL1_0032_G09.b : nnnnnnnnnnn
AMP01_0072_H02.b : nggggaaaa
AMP01_0085_B01.b :
AMP01_0094_G03.b : agg
DCI01_0077_G01.b :
DCI01_0101_G02.b :
MLTL1_0083_A01.b : nnn
MLTL1_0083_F01.b : nnn
MLTL1_0053_H12.b : nnn
BKFL1_0085_A10.b : nnn
MLTL1_0078_A07.b : nnn
DCI01_0084_E06.b :
DCI01_0076_F09.b :
AMP01_0060_A10.b :
MLTL1_0056_E09.b :
AMP01_0003_A10.b :
MLTL1_0036_A03.b :
BKFL1_0057_B06.b :
MLTL1_0024_A07.b :
MLTL1_0083_D11.b :
DCI01_0095_H12.b :
DCI01_0063_D11.b :
DCI01_0073_F01.b :
DCI01_0068_B02.b :
MLTL1_0053_H09.b :
DCI01_0065_E11.b :
DCI01_0072_E02.b :
DCI01_0114_F10.b :
DCI01_0114_D12.b :
MLTL1_0092_C10.b :
AMP01_0036_B06.b :
AMP01_0087_E12.b :
BKFL1_0010_A08.b :
MLTL1_0100_E06.b :
MLTL1_0076_D10.b :
MLTL1_0087_D07.b :
DCI01_0045_F07.b :
MLTL1_0041_E01.b :
DCI01_0075_H05.b :
AMP01_0080_C01.b :
AMP01_0087_E06.b :
DCI01_0073_B03.b :
AMP01_0056_H04.b :
MLTL1_0073_B02.b :
MLTL1_0087_F08.b :
DCI01_0074_H04.b :
DCI01_0083_B09.b :
DCI01_0016_E09.b :
MLTL1_0051_F03.b :
DCI01_0071_B02.b :
AMP01_0093_D06.b :
DCI01_0081_G05.b :
AMP01_0086_G11.b :
AMP01_0085_F10.b :
MLTL1_0092_E03.b :
MLTL1_0005_D03.b :
AMP01_0069_C11.b :
MLTL1_0091_E01.b :
DCI01_0093_G04.b :
DCI01_0073_G01.b :
DCI01_0097_H10.b :
MLTL1_0006_D09.b :
DCI01_0064_C12.b :
MLTL1_0079_A08.b :
MLTL1_0086_A12.b :
AMP01_0046_A06.b :
DCI01_0032_B11.b :
MLTL1_0042_B10.b :
MLTL1_0016_H04.b :
BKFL1_0034_G04.b :
DCI01_0118_E10.b :
MLTL1_0073_H09.b :
BKFL1_0031_D12.b :
MLTL1_0074_D03.b :
MLTL1_0010_E03.b :
DCI01_0117_G06.b :
BKFL1_0006_E06.b :
MLTL1_0058_H10.b :
DCI01_0115_B09.b :
DCI01_0099_A07.b :
MLTL1_0037_F08.b :
MLTL1_0049_C09.b :
MLTL1_0059_F05.b :
OVRT1_0001_D03.b :
MLTL1_0086_F06.b :
DCI01_0077_H07.b :
BKFL1_0057_D03.b :
MLTL1_0082_C12.b :
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0030_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0027_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0027_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0066_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_G03.b : ggtatactatagcgnacgxx
AMP01_0094_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0100_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0035_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0080_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_G01.b : ntttggcta
CBLT1_0068_E12.b : nnncctatttnttnttggc
AMP01_0037_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_E08.b : tttcgt
CBLT1_0025_G05.b : nnnng
DCI01_0065_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_E05.b : nnnncctatagctgtc
MLTL1_0018_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0013_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A08.b : nnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_D01.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : nnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B07.b : nnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0082_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_F08.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_H04.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_F05.b : tgctcgcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0107_C06.b : ctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_A11.b : gggctgctcccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : nnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0078_D06.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_D07.b : cttgggctgctcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_C07.b : atctaagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B09.b : taactaagggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G12.b : gatacttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_B01.b : ttcatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_C03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B03.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_D08.b : ccgatacataagggctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F11.b : ggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E09.b : ttnnccatactaangggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D02.b : aananacgatatcatagggctgctcgcgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A01.b : nnnttagtaccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D11.b : ataatcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A02.b : tatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_F02.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0095_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E09.b : nnnnccgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_F02.b : taatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H02.b : anttagcgaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_B01.b : naatcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G03.b : gcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G01.b : nnnttacgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_G02.b : nnaaaagaatctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0083_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0053_H12.b : ccttttaatataaaggatacntatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0085_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
MLTL1_0078_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
DCI01_0084_E06.b : nnnaatcgaatcatgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F09.b : nnttacgtaactatagggctgctcgcgcgccgxxxxxxxxxxxxxxxxx
AMP01_0060_A10.b : tatccccnttaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
AMP01_0003_A10.b : ttaacgaatctaaxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
BKFL1_0057_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0024_A07.b : ncctataannnnnnnggatactaaxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
DCI01_0095_H12.b : nnnaatagatacttxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : nnnntttgatactaaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : nntttagtaactatagggctxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : nnnnaacgtaatctaagggctxxxxxxxxxxxx
MLTL1_0053_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0065_E11.b : nnnnnaacgaaccatxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : nnntttacatacttxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : nnnggctccaaannaacgatactatxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0092_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0036_B06.b : nnnccgataatntaagggatatcttxxxxxxxxxxxxxxx
AMP01_0087_E12.b : nctaatttaaxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0100_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0076_D10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0087_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0045_F07.b : nnnttagatactaaxxxxxxxxxxxxx
MLTL1_0041_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0075_H05.b : nnnaacgtaatctaagggctxxxxxxxx
AMP01_0080_C01.b : ctataggcgatacttangggctxxxxxxx
AMP01_0087_E06.b : nnnggtatcttxxxxxxxxxxxxxx
DCI01_0073_B03.b : nnnnncgatactatagggctgctcxx
AMP01_0056_H04.b : nngggaaantntaagtgatatcttngggctxxxxx
MLTL1_0073_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0087_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0074_H04.b : nnnnccgtacaatxxxxxxxxxxxx
DCI01_0083_B09.b : nnnnnccgaatccataxxxxxxxxxxx
DCI01_0016_E09.b : nnnnccgtacttaxxxxxxxxxxx
MLTL1_0051_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0071_B02.b : nnnnnggatactatagggctgctcx
AMP01_0093_D06.b : ggggtaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : nnnnaacgtaacatgggggctxx
AMP01_0086_G11.b : acgtatcttangggctgc
AMP01_0085_F10.b : aaaccgtaatcttxxxxxxxx
MLTL1_0092_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0005_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0069_C11.b : aactcctagggtatcttaxxx
MLTL1_0091_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0093_G04.b : nnnnnccgatactaaggg
DCI01_0073_G01.b : nnnttacgatactaaxxxxxx
DCI01_0097_H10.b : nttaacg
MLTL1_0006_D09.b :
DCI01_0064_C12.b :
MLTL1_0079_A08.b :
MLTL1_0086_A12.b :
AMP01_0046_A06.b :
DCI01_0032_B11.b :
MLTL1_0042_B10.b :
MLTL1_0016_H04.b :
BKFL1_0034_G04.b :
DCI01_0118_E10.b :
MLTL1_0073_H09.b :
BKFL1_0031_D12.b :
MLTL1_0074_D03.b :
MLTL1_0010_E03.b :
DCI01_0117_G06.b :
BKFL1_0006_E06.b :
MLTL1_0058_H10.b :
DCI01_0115_B09.b :
DCI01_0099_A07.b :
MLTL1_0037_F08.b :
MLTL1_0049_C09.b :
MLTL1_0059_F05.b :
OVRT1_0001_D03.b :
MLTL1_0086_F06.b :
DCI01_0077_H07.b :
BKFL1_0057_D03.b :
MLTL1_0082_C12.b :
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : ....................................................CCTATGTT
---------+---------+---------+---------+---------+---------+ 8
DCI01_0030_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0040_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0100_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0031_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0046_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0038_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0093_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0084_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0108_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0099_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0013_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0006_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0061_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0027_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0030_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0040_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0044_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0015_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0078_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0029_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0014_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0108_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0054_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BKFL1_0027_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0068_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0066_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0091_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0077_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0117_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0075_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0034_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0016_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0069_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BFLT1_0028_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0069_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0109_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0061_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0066_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0076_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0031_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0078_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0068_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0082_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0061_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0076_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0091_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0057_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0052_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0115_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0062_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0086_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
MLTL1_0079_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0034_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0036_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0098_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0080_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0115_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0111_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0069_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0093_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
BKFL1_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0100_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0087_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0035_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0088_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0023_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0080_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTC
DCI01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0076_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
AMP01_0004_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0080_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
DCI01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTATGTT
HTMT1_0115_G01.b : gtaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGCC
CBLT1_0068_E12.b : tagtacgacgcantagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
AMP01_0037_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
ILNT1_0002_E08.b : ggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
CBLT1_0025_G05.b : gcaagtacacgccgtcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
DCI01_0065_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATGTT
DCI01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0040_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
DCI01_0026_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0093_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0060_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0037_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0075_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0005_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0075_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
AMP01_0034_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGTT
DCI01_0098_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccATGTT
OVRT1_0146_E05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTT
MLTL1_0018_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTT
AMP01_0043_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
DCI01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0013_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
DCI01_0041_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0096_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0059_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0001_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0042_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0052_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0062_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0014_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0083_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0082_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0070_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0107_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0038_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0107_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0098_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0078_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0061_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0095_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0085_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0003_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H09.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_C10.b : nnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_E06.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_D10.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_D07.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_E01.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_B02.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_F08.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0051_F03.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_G11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_E03.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_D03.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_E01.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G04.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H10.b : atatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0006_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0064_C12.b : nntttttcatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
MLTL1_0086_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxx
AMP01_0046_A06.b : aaccctaagagtatcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : nnncctaactaaxxxxxxxxx
MLTL1_0042_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0016_H04.b : nnnnnaagatactaaxxxxx
BKFL1_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0118_E10.b : aaaattcgtaccaxxxxxxx
MLTL1_0073_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0031_D12.b : nnnccctttnnttnataagaaaccataxx
MLTL1_0074_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0010_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0117_G06.b : aaaaacccatact
BKFL1_0006_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0058_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0115_B09.b : nncctaatannnnnacgatatct
DCI01_0099_A07.b : nnnaatcataac
MLTL1_0037_F08.b : nnnncattttnnnnnnnngga
MLTL1_0049_C09.b : nnnnnnnnnnnnnnnnn
MLTL1_0059_F05.b : nnnnnnnnnnnnnnnnnn
OVRT1_0001_D03.b :
MLTL1_0086_F06.b : nnnnnnnnnnnnnnnnn
DCI01_0077_H07.b : nnnnaac
BKFL1_0057_D03.b : nnnnnnnnnnnnnn
MLTL1_0082_C12.b : nnnnnnnnnnn
DCI01_0082_E08.b :
DCI01_0097_F01.b :
MLTL1_0036_G06.b :
MLTL1_0050_E02.b :
BKFL1_0119_B03.b :
DCI01_0117_C07.b :
BKFL1_0005_D08.b :
MLTL1_0005_B02.b :
DCI01_0090_G10.b :
MLTL1_0091_C05.b :
DCI01_0114_C07.b :
DCI01_0116_H04.b :
DCI01_0059_E05.b :
CLNT1_0038_D01.b :
MLTL1_0045_C01.b :
DCI01_0114_G06.b :
AMP01_0065_B11.b :
MLTL1_0008_E10.b :
BKFL1_0073_B10.b :
BKFL1_0079_G08.b :
DCI01_0070_B04.b :
DCI01_0077_F06.b :
MLTL1_0028_E03.b :
OVRT1_0074_C04.b :
MLTL1_0056_C11.b :
MLTL1_0053_E11.b :
BKFL1_0034_C09.b :
MLTL1_0018_G02.b :
MLTL1_0031_B04.b :
MLTL1_0042_H02.b :
MLTL1_0077_G02.b :
DCI01_0072_F05.b :
BKFL1_0029_B03.b :
MLTL1_0073_A05.b :
CLNT1_0065_C11.b :
DCI01_0057_A06.b :
MLTL1_0022_B04.b :
MLTL1_0031_E03.b :
BKFL1_0082_B12.b :
BKFL1_0106_B10.b :
BKFL1_0042_B11.b :
MLTL1_0071_F09.b :
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b :
AMP01_0062_E06.b :
MLTL1_0078_F12.b :
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
---------+---------+---------+---------+---------+---------+ 68
DCI01_0030_B12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0040_H10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0004_F11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0100_H06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0010_D12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0020_C03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0071_G06.b : CATAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0106_B10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0031_D07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGACACCCTGTACCTACTATT
AMP01_0046_F06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0038_C03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0020_D05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0093_E01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0084_H01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0045_D04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0108_D05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0101_E02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0099_F07.b : CGTAAATCGTTGACTATACACAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0013_A04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0015_H08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0068_F06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0006_A12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0061_D03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0027_A04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0030_D12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0037_H11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0040_E07.b : CGTAAATCGTTGACTATACTCCACAAACCACAAAGACCTCCGCACCCTGTACCTATTATT
DCI01_0044_C08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0015_D02.b : TGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0078_C04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0036_G05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0009_H05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0029_H08.b : CGTAAATCGTTGACTATACTCAACAAACCACGAAGACATCGGCACCCTGTACCTACTATT
DCI01_0070_H11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0072_D09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0014_H07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0108_G06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0030_B01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0054_F06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0012_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0040_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0027_C05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0068_F07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0066_A04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0091_A11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0077_D05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0117_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0075_B10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0034_B12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0015_F03.b : CGTAAATCGTTGACTATACTCAACAAACCACAACGACATCGGCACCCTGTACCTACTATT
DCI01_0016_F11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0082_H09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0004_D12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0069_D10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0088_G03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BFLT1_0028_G03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0094_F02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0069_B01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0109_H01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0083_G09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0061_B04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0066_C02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0076_B01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0031_B06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0077_G07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0084_D04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGTACCCTGTACCTACTATT
MLTL1_0096_A03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0078_H06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0077_F04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0083_E04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0061_H03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0052_B12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0068_F04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0082_F02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0061_F04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0076_H05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0113_H12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0091_D07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0057_D02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0052_E05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0115_A02.b : CGTAAATCGTTGACTATACTCAACGAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0062_E10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0086_E05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0094_D02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0079_G10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0034_C10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0036_B11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0022_D04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0098_G05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0042_E03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0085_E06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCAGCACCCTGTACCTACTATT
AMP01_0080_A11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0036_G01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0115_F12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0111_C12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0069_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0056_B10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0084_G02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0035_E08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0093_G03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0100_A03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0074_A04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0100_D07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0094_E10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0087_E05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0099_G02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0035_G10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0089_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0088_F04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0023_F07.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0080_H09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0083_F02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0077_A08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0076_D03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0004_H05.b : CGTAGATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0080_D03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0077_H09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
HTMT1_0115_G01.b : CTTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCTCCCTGTACCTACTATT
CBLT1_0068_E12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0037_H12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
ILNT1_0002_E08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
CBLT1_0025_G05.b : CGTAACTCTTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0065_E05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0028_H01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0001_E11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0040_D02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0026_G02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0044_F02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0093_B08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0060_D06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0098_D08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0037_B06.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0094_H09.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0075_G10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0005_D04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0075_F10.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0034_D05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0098_G04.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
OVRT1_0146_E05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0018_D05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0043_D01.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0104_F03.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0034_G12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0013_F11.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0041_E08.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0096_B02.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0043_H12.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0059_G05.b : CGTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0001_E12.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0093_G09.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0039_D08.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0052_A04.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0019_E09.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0065_E01.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0098_B09.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0042_A08.b : xxTAAATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0052_A08.b : xxxxxATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0053_F07.b : xxxxxATCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0052_D01.b : xxxxxxTCGTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0009_E04.b : xxxxxxxxxTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0062_C09.b : xxxxxxxxxTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0031_F10.b : xxxxxxxxxTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0071_D03.b : xxxxxxxxxTTGACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0109_B09.b : xxxxxxxxxxxxACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0014_B10.b : xxxxxxxxxxxxACTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0033_D03.b : xxxxxxxxxxxxxxTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0030_B07.b : xxxxxxxxxxxxxxTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0083_F02.b : xxxxxxxxxxxxxxTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0082_C03.b : xxxxxxxxxxxxxxTATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0110_A04.b : xxxxxxxxxxxxxxxATACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0070_C11.b : xxxxxxxxxxxxxaggTACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0057_F08.b : xxxxxxxxxxxxxxxxTACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0033_H04.b : xxxxxxxxxxxxxxxxTACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0107_B06.b : xxxxxxxxxxxxxxcggACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0087_E01.b : xxxxxxxxxxxxxxcggACTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0092_F05.b : xxxxxxxxxxxxxxxxxxCTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0038_G05.b : xxxxxxxxxxxxxxxxxxxTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0107_C06.b : xxxxxxxxxxxxxxxxxxxTCAACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0069_A06.b : xxxxxxxxxxxxxxxxxxxxxxACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0075_H12.b : xxxxxxxxxxxxxxxxxxxxxxACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0054_A11.b : xxxxxxxxxxxxxxxxxxxxxxACAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxCAAACCACAAAGACATCGGCACCCTGTACCTACTATT
MLTL1_0098_E06.b : xxxxxxxxxxxxxxxxxxxxxxxCAAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0096_D07.b : xxxxxxxxxxxxxxxxxxxxxxxCAAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0028_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxAACCACAAAGACATCGGCACCCTGTACCTACTATT
BKFL1_0078_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxAACCACAAAGACATCGGCACCCTGTACCTACTATT
AMP01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxACCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAAGACATCGGCACCCTGTACCTACTATT
DCI01_0082_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACATCGGCACCCTGTACCTACTATT
DCI01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0030_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
AMP01_0093_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
MLTL1_0057_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
AMP01_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCGGCACCCTGTACCTACTATT
DCI01_0061_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCACCCTGTACCTACTATT
AMP01_0101_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
DCI01_0114_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
DCI01_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCACCCTGTACCTACTATT
AMP01_0093_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
AMP01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
AMP01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
MLTL1_0095_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGCACCCTGTACCTACTATT
DCI01_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0044_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
BKFL1_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0072_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0085_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
AMP01_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCCTGTACCTACTATT
DCI01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTACCTACTATT
MLTL1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0083_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0053_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
BKFL1_0085_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
MLTL1_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
DCI01_0084_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
DCI01_0076_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTACTATT
AMP01_0060_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACTATT
MLTL1_0056_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACTATT
AMP01_0003_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0010_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0100_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0076_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0087_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0051_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0006_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0064_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_B10.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0016_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_G04.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_H09.b : nnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0074_D03.b : nnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0010_E03.b : nnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_G06.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0006_E06.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_H10.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_B09.b : aagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A07.b : taagggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0037_F08.b : tactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_D03.b :
MLTL1_0086_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H07.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_E08.b : nnnaaacgtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F01.b : nntttcgatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G06.b : nnncctattnnnnnnccgatacattagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0050_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0119_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0117_C07.b : aaaanaccgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0005_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0005_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
DCI01_0090_G10.b : nnnnttacatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
DCI01_0114_C07.b : nnncctctaaaananccgatactatagggctgctcgcgcaccgxxxxxxxxxx
DCI01_0116_H04.b : nnnttctaaannnnnaagatatcatagggctxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_E05.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_D01.b :
MLTL1_0045_C01.b : nttctcaannnnnntagatactaaxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : nncccactaaananacgatactatagggctgctcccgcaccgxx
AMP01_0065_B11.b : atagcgtatcttaxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0073_B10.b : ncccgatannnnnaaaagatacntaaxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0070_B04.b : nnaaaaggatactatagggctgctcccgcgccgx
DCI01_0077_F06.b : nnnnncgtaacataagggctaxxxxxxxxx
MLTL1_0028_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0074_C04.b :
MLTL1_0056_C11.b : nnnnnnnnnnnnnnnnnnnnnn
MLTL1_0053_E11.b : nnnnnnnnnnnnnnnnnnnn
BKFL1_0034_C09.b : nnnnnnnnnnnnnnnnnnnnnn
MLTL1_0018_G02.b : nnnnnnnnnnnnnnnnnnnnn
MLTL1_0031_B04.b : nnnnnnnnnnnnnnnnnn
MLTL1_0042_H02.b : nnnnnnnnnnnnnn
MLTL1_0077_G02.b : nnnnnnnnnnnnnnnnnnn
DCI01_0072_F05.b : nnnn
BKFL1_0029_B03.b : nnnnnnnnnnnnnnn
MLTL1_0073_A05.b : nnnnnnnnnnnnnnn
CLNT1_0065_C11.b :
DCI01_0057_A06.b : gatga
MLTL1_0022_B04.b : nnccta
MLTL1_0031_E03.b : nnnnnnnn
BKFL1_0082_B12.b : nnnnnnnnn
BKFL1_0106_B10.b : nnnnnnnnnn
BKFL1_0042_B11.b : nnnnnnnnnn
MLTL1_0071_F09.b : nnngggtt
DCI01_0102_D03.b :
DCI01_0087_H04.b :
AMP01_0032_G06.b : nnnnnnn
AMP01_0062_E06.b : nnncc
MLTL1_0078_F12.b : nnnnnnnnnn
DCI01_0097_D05.b :
DCI01_0071_H11.b :
BKFL1_0030_C12.b :
BKFL1_0098_H10.b :
MLTL1_0083_G08.b :
AMP01_0013_D06.b :
DCI01_0094_G04.b :
BKFL1_0086_A03.b :
BKFL1_0032_A03.b :
AMP01_0072_H03.b :
BKFL1_0046_G12.b :
MLTL1_0058_G09.b :
MLTL1_0045_D12.b :
MLTL1_0045_B03.b :
BKFL1_0050_H10.b :
DCI01_0043_B06.b :
CBLT1_0014_C03.b :
BKFL1_0084_G03.b :
BKFL1_0088_E05.b :
BKFL1_0059_F03.b :
BKFL1_0050_H12.b :
AMP01_0015_A03.b :
MLTL1_0078_E04.b :
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
---------+---------+---------+---------+---------+---------+ 128
DCI01_0030_B12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0040_H10.b : TGGTGCCTGAGCAAGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0004_F11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0100_H06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0010_D12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0020_C03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0071_G06.b : TGGTGCCTGAGCATGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTACG
DCI01_0106_B10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0031_D07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0046_F06.b : TGGTGCCCGAACAAGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0038_C03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0020_D05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_E01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0084_H01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0045_D04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0108_D05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0101_E02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0099_F07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0013_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0015_H08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0068_F06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0006_A12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0061_D03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0027_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0030_D12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0037_H11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0040_E07.b : TGGTGCCTGAACAAGAATAATGGGCACTGCCTTGAACCTACTAATTCGCGCTGAACTAAG
DCI01_0044_C08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0015_D02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0078_C04.b : TGGTGCCTGAGCATGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0036_G05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0009_H05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0029_H08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0070_H11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0072_D09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0014_H07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0108_G06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0030_B01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0054_F06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0012_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0040_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0027_C05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0068_F07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0066_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0091_A11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGTTGAACTAGG
AMP01_0077_D05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0117_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0075_B10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0034_B12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0015_F03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0016_F11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0082_H09.b : TAGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0004_D12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0069_D10.b : TAGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0088_G03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BFLT1_0028_G03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0094_F02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0069_B01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0109_H01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0083_G09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0061_B04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0066_C02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0076_B01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0031_B06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0077_G07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0084_D04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0096_A03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0078_H06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0077_F04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0083_E04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAATTAGG
AMP01_0061_H03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0052_B12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0068_F04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0082_F02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0061_F04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0076_H05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0113_H12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0091_D07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0057_D02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0052_E05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0115_A02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0062_E10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0086_E05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0094_D02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0079_G10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0034_C10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0036_B11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0022_D04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0098_G05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0042_E03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0085_E06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0080_A11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0036_G01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0115_F12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0111_C12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0069_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0056_B10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0084_G02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0035_E08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0093_G03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0100_A03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAAG
AMP01_0074_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0100_D07.b : TGGTGCCTGGGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0094_E10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0087_E05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0099_G02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0035_G10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0089_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0088_F04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0023_F07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0080_H09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0083_F02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0077_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0076_D03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0004_H05.b : TGGCGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0080_D03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0077_H09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
HTMT1_0115_G01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
CBLT1_0068_E12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0037_H12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
ILNT1_0002_E08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
CBLT1_0025_G05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0065_E05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0028_H01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0001_E11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0040_D02.b : TGGTGCCTGAGCAAGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0026_G02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0044_F02.b : TGGTGCCTGAACAAGAATAGTGGGCACTGCCCTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_B08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0060_D06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0098_D08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0037_B06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0094_H09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0075_G10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0005_D04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0075_F10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0034_D05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0098_G04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
OVRT1_0146_E05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0018_D05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0043_D01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0104_F03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0034_G12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0013_F11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0041_E08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0096_B02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0043_H12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0059_G05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0001_E12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_G09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0039_D08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0052_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0019_E09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0065_E01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCACTGAACTAGG
DCI01_0098_B09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0042_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0052_A08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0053_F07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0052_D01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0009_E04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0062_C09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0031_F10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0071_D03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0109_B09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0014_B10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0033_D03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0030_B07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0083_F02.b : CGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0082_C03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0110_A04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0070_C11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0057_F08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0033_H04.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0107_B06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0087_E01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0092_F05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0038_G05.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0107_C06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0069_A06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0075_H12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0054_A11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0096_E05.b : TGGTGCCTGAGCACGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTATG
MLTL1_0098_E06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0096_D07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0028_A09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0078_D06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0033_D07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0067_C07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0025_B09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0082_G12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0033_B01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0029_E11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0030_C03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_B03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0057_D08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0079_F11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0061_E09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0101_D07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0114_D02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0100_A01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_D11.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0037_A02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0097_F02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0095_H08.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0104_E09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0044_F02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0032_G09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0072_H02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0085_B01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0094_G03.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0077_G01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0101_G02.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0083_A01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0083_F01.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0053_H12.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0085_A10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0078_A07.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0084_E06.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0076_F09.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0060_A10.b : TGGTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0056_E09.b : TGGTGCCTGAGCAGGACCAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0003_A10.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0036_A03.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0057_B06.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTTAACTAGG
MLTL1_0024_A07.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0083_D11.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0095_H12.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0063_D11.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0073_F01.b : xxxTGCCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0068_B02.b : xxxxxxCTGAACAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0053_H09.b : xxxxxxCTGAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0065_E11.b : xxxxxxCTGAACAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0072_E02.b : xxxxxxxTGAGCAGGAATAGTAGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0114_F10.b : xxxxxxxxxAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0114_D12.b : xxxxxxxxxAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0092_C10.b : xxxxxxxxxAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0036_B06.b : xxxxxxxxxAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0087_E12.b : xxxxxxxxxAGCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
BKFL1_0010_A08.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0100_E06.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0076_D10.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0087_D07.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0045_F07.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0041_E01.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0075_H05.b : xxxxxxxxxxxCAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0080_C01.b : xxxxxxxxxxxxAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0087_E06.b : xxxxxxxxxxxxAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0073_B03.b : xxxxxxxxxxxxAGGAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0056_H04.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0073_B02.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0087_F08.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0074_H04.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0083_B09.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0016_E09.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0051_F03.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0071_B02.b : xxxxxxxxxxxxxxxAATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0093_D06.b : xxxxxxxxxxxxxxxxATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0081_G05.b : xxxxxxxxxxxxxxxxATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0086_G11.b : xxxxxxxxxxxxxxxxATAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0085_F10.b : xxxxxxxxxxxxxxxxxTAGTGGGCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0005_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
AMP01_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0091_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0093_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxCACTGCCTTGAGCCTACTAATTCGCGCTGAACTAGG
DCI01_0097_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCTACTAATTCGCGCTGAACTAGG
MLTL1_0006_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACTAGG
DCI01_0064_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACTAGG
MLTL1_0079_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGG
MLTL1_0086_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0016_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0031_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0074_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_D03.b : nnnnncctctagctgtcngxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0090_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0091_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0116_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0059_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_D01.b : nggaaccgtttgcgga
MLTL1_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0073_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0028_E03.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C04.b : nt
MLTL1_0056_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_E11.b : nnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0018_G02.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F05.b : aatcatacttgggggctgctcgcccgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0029_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_C11.b :
DCI01_0057_A06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0022_B04.b : ttttnnnnntagatatctatgggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0082_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0106_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
BKFL1_0042_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
MLTL1_0071_F09.b : attttnnnccgaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_D03.b : tattttccgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H04.b : aaaannccgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E06.b : agaaaannttagcgacacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_F12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
DCI01_0097_D05.b : nnnnncgatatcaangggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H11.b : nnaaaatgatactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0030_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
BKFL1_0098_H10.b : nnnnttttagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
AMP01_0013_D06.b : nnnttactaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_G04.b : nnnnaacgatacttagggctgctcccgcgccgxxxxxxxx
BKFL1_0086_A03.b : nnggaattnnnnnnccgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
AMP01_0072_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
BKFL1_0046_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0058_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0045_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0045_B03.b : nnccctattnnnnnnnggatactaaxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0043_B06.b : gactatagggctgctcgcccgccg
CBLT1_0014_C03.b :
BKFL1_0084_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0088_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0059_F03.b : nnnnnnnnnnnnnnnnnnn
BKFL1_0050_H12.b : nnncctttttataaaa
AMP01_0015_A03.b : ncctat
MLTL1_0078_E04.b : nnnnnnnnn
AMP01_0006_E02.b :
DCI01_0083_G08.b :
AMP01_0085_G03.b :
BKFL1_0096_F01.b :
AMP01_0102_B11.b :
MLTL1_0025_A12.b :
DCI01_0019_B01.b :
AMP01_0090_E09.b :
MLTL1_0073_A03.b :
BKFL1_0033_B03.b :
BKFL1_0070_C05.b :
AMP01_0024_H12.b :
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
---------+---------+---------+---------+---------+---------+ 188
DCI01_0030_B12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0040_H10.b : TCAGCCCGGAACCCTACTTGGCGAAGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0004_F11.b : TCAGCCCGGAACCCTACTTGGCGATGGTCAAATCTATAATGTGATTGTTACAGCTCATGC
MLTL1_0100_H06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0010_D12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0020_C03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0071_G06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0106_B10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0031_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0046_F06.b : TCAGCCCCGAACCCTACTTGGCGAAGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0038_C03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0020_D05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_E01.b : TCGGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0084_H01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0045_D04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0108_D05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0101_E02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0099_F07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0013_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0015_H08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0068_F06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0006_A12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0061_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0027_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0030_D12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0037_H11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0040_E07.b : TCAGCCCCGAACCCTACTTGGCGAAGATCAAATCTATAATGGAATTGTTACCGCCCCTGC
DCI01_0044_C08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0015_D02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0078_C04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGCAATTGTTACAGCTCATGC
MLTL1_0036_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0009_H05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0029_H08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0070_H11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0072_D09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0014_H07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0108_G06.b : TCAGCCCGGAACCCTACTTGGCGATAATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0030_B01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0054_F06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0012_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0040_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0027_C05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0068_F07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0066_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0091_A11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0077_D05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0117_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0075_B10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0034_B12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0015_F03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0016_F11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0082_H09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0004_D12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0069_D10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0088_G03.b : TCGGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BFLT1_0028_G03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0094_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0069_B01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0109_H01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0083_G09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0061_B04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0066_C02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0076_B01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0031_B06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_G07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0084_D04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0096_A03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0078_H06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_F04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0083_E04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0061_H03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0052_B12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0068_F04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0082_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0061_F04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0076_H05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAAGGTAATTGTTACAGCTCATGC
DCI01_0113_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0091_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0057_D02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0052_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0115_A02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0062_E10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0086_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0094_D02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0079_G10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0034_C10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0036_B11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0022_D04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0098_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0042_E03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0085_E06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0080_A11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0036_G01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0115_F12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0111_C12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0069_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0056_B10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0084_G02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0035_E08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0093_G03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCCATAATGTAATTGTTACAGCTCATGC
BKFL1_0100_A03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0074_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0100_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0094_E10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0087_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0099_G02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0035_G10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0089_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0088_F04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0023_F07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0080_H09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0083_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0076_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0004_H05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0080_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_H09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
HTMT1_0115_G01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
CBLT1_0068_E12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0037_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
ILNT1_0002_E08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
CBLT1_0025_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0065_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0028_H01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0001_E11.b : TCGGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0040_D02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0026_G02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0044_F02.b : TCCGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_B08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0060_D06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0098_D08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0037_B06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0094_H09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0075_G10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0005_D04.b : TCGGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0075_F10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0034_D05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0098_G04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
OVRT1_0146_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0018_D05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAGTTGTTACAGCTCATGC
AMP01_0043_D01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0104_F03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0034_G12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0013_F11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0041_E08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0096_B02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0043_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0059_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0001_E12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_G09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0039_D08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0052_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0019_E09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0065_E01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0098_B09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0042_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0052_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0053_F07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0052_D01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0009_E04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0062_C09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0031_F10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0071_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0109_B09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0014_B10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0033_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCCATAATGTAATTGTTACAGCTCATGC
MLTL1_0030_B07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0083_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0082_C03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0110_A04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0070_C11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0057_F08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0033_H04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0107_B06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0087_E01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0092_F05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0038_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0107_C06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0069_A06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTACAATGTAATTGTTACAGCTCATGC
AMP01_0075_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0054_A11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0096_E05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0098_E06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0096_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0028_A09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0078_D06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0033_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0067_C07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0025_B09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0082_G12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0033_B01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACGGCTCATGC
MLTL1_0029_E11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0030_C03.b : TCAGCCCGGAGCCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_B03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0057_D08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0079_F11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0061_E09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0101_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0114_D02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0100_A01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_D11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0037_A02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0097_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0095_H08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0104_E09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0044_F02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0032_G09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0072_H02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0085_B01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0094_G03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_G01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0101_G02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0083_A01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTCACAGCTCATGC
MLTL1_0083_F01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0053_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0085_A10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0078_A07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0084_E06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0076_F09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0060_A10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0056_E09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0003_A10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0036_A03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0057_B06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0024_A07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0083_D11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0095_H12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0063_D11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0073_F01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0068_B02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0053_H09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTATTTGTTACAGCTCATGC
DCI01_0065_E11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0072_E02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0114_F10.b : TCAGCCCGGAACCCTGCTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0114_D12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0092_C10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0036_B06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0087_E12.b : TCAGCCCGGAACCCTACTCGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0010_A08.b : TCAGTCCGGAACCCTACTTGGTGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0100_E06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0076_D10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0087_D07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0045_F07.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0041_E01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0075_H05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0080_C01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0087_E06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0073_B03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0056_H04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0073_B02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0087_F08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0074_H04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTCACAGCTCATGC
DCI01_0083_B09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATCGTTACAGCTCATGC
DCI01_0016_E09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0051_F03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0071_B02.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0093_D06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0081_G05.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0086_G11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0085_F10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0092_E03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0005_D03.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
AMP01_0069_C11.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0091_E01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0093_G04.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0073_G01.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0097_H10.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0006_D09.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0064_C12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0079_A08.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0086_A12.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAGTCTATAATGTACTTGTTACAGCTCATGC
AMP01_0046_A06.b : TCAGCCCGGAACCCTACTTGGCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0032_B11.b : xxxxxxxxxxxxxxTACTTGGCGATGATCAAATCTATAATGTAATTGTTGCAGCTCATGC
MLTL1_0042_B10.b : xxxxxxxxxxxxxxxxxxxxxCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0016_H04.b : xxxxxxxxxxxxxxxxxxxxxCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0118_E10.b : xxxxxxxxxxxxxxxxxxxxxCGATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0073_H09.b : xxxxxxxxxxxxxxxxxxxxxxxATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0031_D12.b : xxxxxxxxxxxxxxxxxxxxxxxATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0074_D03.b : xxxxxxxxxxxxxxxxxxxxxxxATGATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxTGATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0117_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
BKFL1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCACGC
DCI01_0115_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
DCI01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxATCAAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0049_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0059_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
OVRT1_0001_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATAATGTAATTGTTACAGCTCATGC
MLTL1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAATGTAATTGTTACAGCTCATGC
DCI01_0077_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAATGTAATTGTTACAGCTCATGC
BKFL1_0057_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATGTAATTGTTACAGCTCATGC
MLTL1_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAATTGTTACAGCTCATGC
DCI01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAATTGTTACAGCTCATGC
DCI01_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCTCATGC
MLTL1_0036_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCATGC
MLTL1_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCATGC
BKFL1_0119_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCATGC
DCI01_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATGC
BKFL1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
MLTL1_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0090_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
MLTL1_0091_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0114_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0116_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATGC
DCI01_0059_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
CLNT1_0038_D01.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgg
MLTL1_0045_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0073_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0079_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0070_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0028_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C04.b : ttttttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0056_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0042_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0029_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_C11.b : nttttccgttagcgnacgxxxxxxxxxxxxx
DCI01_0057_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0082_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0042_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0071_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0102_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0030_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0086_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C03.b :
BKFL1_0084_G03.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0088_E05.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0059_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H12.b : gatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_A03.b : annnnnttggaatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
AMP01_0006_E02.b : nnaatcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G08.b : nnnnccgtaactatagggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G03.b : nnccgtaatcttagggctgctcccncgccgxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
AMP01_0102_B11.b : ggcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0019_B01.b : ntttagtaactaaxxxxxxxxxxx
AMP01_0090_E09.b : ataccgtatcxxxxxxxxxxxxxx
MLTL1_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0033_B03.b : nnnnnnnnnnnnnnnnnn
BKFL1_0070_C05.b : nncctgtaannnnnnn
AMP01_0024_H12.b : nngggtttttatat
AMP01_0102_D06.b :
MLTL1_0044_G02.b :
BKFL1_0099_H01.b :
MLTL1_0046_B12.b :
BKFL1_0056_G04.b :
AMP01_0075_F06.b :
DCI01_0072_B05.b :
AMP01_0009_B07.b :
BKFL1_0009_G01.b :
MLTL1_0024_F12.b :
AMP01_0016_B11.b :
AMP01_0016_B04.b :
AMP01_0085_H10.b :
AMP01_0046_C04.b :
MLTL1_0081_F07.b :
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
---------+---------+---------+---------+---------+---------+ 247
DCI01_0030_B12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0040_H10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGG*TTTTGGTAACTGAC
AMP01_0004_F11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACCGAC
MLTL1_0100_H06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0010_D12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0020_C03.b : CTTTGTAGTAATCTTCTTTATAGTAACACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0071_G06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0106_B10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0031_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0046_F06.b : CTTTGTAATAATCTTCTTTATAGCAATACCCATTATGA*ATGGGGGTTTTGGTAACTGAC
AMP01_0038_C03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0020_D05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGAGTTTTGGTAACTGAC
AMP01_0093_E01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0084_H01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0045_D04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0108_D05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0101_E02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0099_F07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0013_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0015_H08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0068_F06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0006_A12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0061_D03.b : CTTTGTAATAATCTTCTTTATAGTAGTACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0027_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0030_D12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0037_H11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0040_E07.b : CTTTGTAATAATCTTCTTTATAGCAATACCCATTATGA*TTGGGGGTTTTGGTAACCCAC
DCI01_0044_C08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0015_D02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0078_C04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0036_G05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0009_H05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0029_H08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0070_H11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0072_D09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0014_H07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0108_G06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0030_B01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0054_F06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0012_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0040_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0027_C05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0068_F07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0066_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0091_A11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0077_D05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0117_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0075_B10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0034_B12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0015_F03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0016_F11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0082_H09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0004_D12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0069_D10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0088_G03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BFLT1_0028_G03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0094_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0069_B01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0109_H01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0083_G09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0061_B04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGCAACTGAC
DCI01_0066_C02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0076_B01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0031_B06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_G07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0084_D04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0096_A03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0078_H06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_F04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0083_E04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0061_H03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0052_B12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0068_F04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0082_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0061_F04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0076_H05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0113_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0091_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0057_D02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0052_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0115_A02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0062_E10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0086_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0094_D02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0079_G10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0034_C10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0036_B11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0022_D04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0098_G05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0042_E03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0085_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0080_A11.b : CTTTGTAGTAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0036_G01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0115_F12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0111_C12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGG*TTGGGGGTTTTGGTAACTGAC
DCI01_0069_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0056_B10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0084_G02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0035_E08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0093_G03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0100_A03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0074_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0100_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0094_E10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0087_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0099_G02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0035_G10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0089_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0088_F04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0023_F07.b : CTTTGTAATAATCTTCTTTATAGTAATACTCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0080_H09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0083_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0076_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0004_H05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0080_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_H09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACCGAC
HTMT1_0115_G01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
CBLT1_0068_E12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0037_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
ILNT1_0002_E08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
CBLT1_0025_G05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0065_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0028_H01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0001_E11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGAATTGGGGGTTTTGGTAACTGAC
AMP01_0040_D02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0026_G02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0044_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0093_B08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0060_D06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0098_D08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0037_B06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0094_H09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0075_G10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0005_D04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0075_F10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0034_D05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0098_G04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
OVRT1_0146_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0018_D05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0043_D01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0104_F03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTGTGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0034_G12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0013_F11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0041_E08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0096_B02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0043_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0059_G05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0001_E12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGNATTGGGGGTTTTGGTAACTGAC
AMP01_0093_G09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0039_D08.b : CTTTGTAATAATCTTCTTTGTAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0052_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0019_E09.b : CTTTGTAGTAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0065_E01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0098_B09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0042_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0052_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0053_F07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0052_D01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0009_E04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0062_C09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0031_F10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0071_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0109_B09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0014_B10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0033_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0030_B07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0083_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0082_C03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0110_A04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0070_C11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0057_F08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTCTTGGTAACTGAC
BKFL1_0033_H04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0107_B06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0087_E01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0092_F05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0038_G05.b : CTTTGTAATAATCTTCTTTATAGCAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0107_C06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0069_A06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0075_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0054_A11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0096_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0098_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0096_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0028_A09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTGACTGAC
BKFL1_0078_D06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0033_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0067_C07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0025_B09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0082_G12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0033_B01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0029_E11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0030_C03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0093_B03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0057_D08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0079_F11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0061_E09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0101_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0114_D02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0100_A01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0093_D11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0037_A02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0097_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0095_H08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0104_E09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0044_F02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0032_G09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0072_H02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0085_B01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0094_G03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_G01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0101_G02.b : CTTTGTAATAATCTTCTTTATTGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0083_A01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0083_F01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0053_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0085_A10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0078_A07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0084_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0076_F09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0060_A10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0056_E09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0003_A10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0036_A03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0057_B06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0024_A07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0083_D11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0095_H12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0063_D11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0073_F01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0068_B02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0053_H09.b : CCTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0065_E11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0072_E02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0114_F10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0114_D12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0092_C10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0036_B06.b : CTTTGTAATAATCTTCTTTATAGCAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0087_E12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0010_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0100_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0076_D10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0087_D07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0045_F07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0041_E01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0075_H05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0080_C01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0087_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0073_B03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0056_H04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0073_B02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0087_F08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0074_H04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0083_B09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0016_E09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0051_F03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TCGGGGGTTTTGGTAACTGAC
DCI01_0071_B02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0093_D06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0081_G05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTGACTGAC
AMP01_0086_G11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0085_F10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0092_E03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0005_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0069_C11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0091_E01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0093_G04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0073_G01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0097_H10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0006_D09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0064_C12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0079_A08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0086_A12.b : CTTTGTAATACTCATCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0046_A06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0032_B11.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0042_B10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0016_H04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0034_G04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0118_E10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0073_H09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0031_D12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0074_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0010_E03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0117_G06.b : CTTTGTAATAATCTTCTCTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0006_E06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0058_H10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0115_B09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0099_A07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0037_F08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0049_C09.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0059_F05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
OVRT1_0001_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0086_F06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_H07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0057_D03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0082_C12.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0082_E08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0097_F01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0036_G06.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0050_E02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0119_B03.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0117_C07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0005_D08.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*ATGGGGGTTTTGGTAACTGAC
MLTL1_0005_B02.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0090_G10.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0091_C05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0114_C07.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0116_H04.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0059_E05.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
CLNT1_0038_D01.b : CTTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0045_C01.b : xxTTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0114_G06.b : xxxTGTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
AMP01_0065_B11.b : xxxxxTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0008_E10.b : xxxxxTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0073_B10.b : xxxxxTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0079_G08.b : xxxxxTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0070_B04.b : xxxxxTAATAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0077_F06.b : xxxxxxxxTAATCTTCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0028_E03.b : xxxxxxxxxxxxxxxCTTTATAGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
OVRT1_0074_C04.b : xxxxxxxxxxxxxxxxxxxxxxGTAATACCCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0056_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0053_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0018_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0042_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
DCI01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGA*TTGGGGGTTTTGGTAACTGAC
BKFL1_0029_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*TTGGGGGTTTTGGTAACTGAC
MLTL1_0073_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*TTGGGGGTTTTGGTAACTGAC
CLNT1_0065_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGGGTTTTGGTAACTGAC
DCI01_0057_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0031_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0082_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0042_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0071_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0102_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
AMP01_0032_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
AMP01_0062_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
MLTL1_0078_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
DCI01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTGGTAACTGAC
BKFL1_0030_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0098_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
MLTL1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
AMP01_0013_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
DCI01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0086_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0032_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
AMP01_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
BKFL1_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C03.b : tttgggacggtagaggccgtagtatttatxxxxxxxxxxx
BKFL1_0084_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0088_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0070_C05.b : ccgtaatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_H12.b : aggaatcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_D06.b : gggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0044_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0099_H01.b : gggttannnntaatagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_B12.b : nnaaaccctctatcttnnnnagtactcttxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0075_F06.b : acctttagagaatctaaxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : nnaaaccgatactaagggctgctcccgcgccgxxx
AMP01_0009_B07.b : nggtaatccatxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0024_F12.b : nnnccgctannnaaaaggtactatagggctgctcccgc
AMP01_0016_B11.b : nntttactaatc
AMP01_0016_B04.b : nccgataannnnntaggaatcta
AMP01_0085_H10.b : naaac
AMP01_0046_C04.b : cctt
MLTL1_0081_F07.b : nn
MLTL1_0058_D03.b :
MLTL1_0097_E10.b :
MLTL1_0083_G11.b :
MLTL1_0099_E04.b :
MLTL1_0025_D01.b :
AMP01_0013_B02.b :
AMP01_0055_F02.b :
AMP01_0084_A08.b :
BKFL1_0028_C04.b :
AMP01_0044_B11.b :
MLTL1_0059_D03.b :
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
---------+---------+---------+---------+---------+---------+ 307
DCI01_0030_B12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0040_H10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0004_F11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0100_H06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0010_D12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0020_C03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0071_G06.b : TCGTACCACTAATAATCCGAGCTCCCGATATGGCCTTTCCACATATAAACAACATAAGTT
DCI01_0106_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0031_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0046_F06.b : TCCTACCGCTAATAATCCGAACTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0038_C03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0020_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATACGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_E01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0084_H01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0045_D04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0108_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0101_E02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACGTAAGTT
MLTL1_0099_F07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0013_A04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0015_H08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0068_F06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0006_A12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0061_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0027_A04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0030_D12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0037_H11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0040_E07.b : TCCTACCGCTAATAATCCGAACCCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0044_C08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0015_D02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0078_C04.b : TCGTACCGCCAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0036_G05.b : TTGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0009_H05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0029_H08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0070_H11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0072_D09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0014_H07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0108_G06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACGTAAGTT
MLTL1_0030_B01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0054_F06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0012_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0040_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0027_C05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0068_F07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0066_A04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0091_A11.b : TCGTACCGCTAATAATCGGAGCTCCCGATGTGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0077_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0117_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0075_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0034_B12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGCATAAACAACATAAGTT
MLTL1_0015_F03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0016_F11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0082_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0004_D12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0069_D10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0088_G03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BFLT1_0028_G03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0094_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0069_B01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0109_H01.b : TCGTACCGCTAATAATCGGAGCTCCCGACATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0083_G09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0061_B04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0066_C02.b : TCGTACCGCTAATAATCGGAACTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0076_B01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0031_B06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_G07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0084_D04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0096_A03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0078_H06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_F04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0083_E04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0061_H03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0052_B12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0068_F04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0082_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0061_F04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0076_H05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0113_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0091_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0057_D02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0052_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCTTTTCCACGTATAAACAACATAAGTT
DCI01_0115_A02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0062_E10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0086_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0094_D02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0079_G10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0034_C10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0036_B11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0022_D04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0098_G05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0042_E03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0085_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0080_A11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0036_G01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0115_F12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0111_C12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0069_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0056_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0084_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0035_E08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0093_G03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0100_A03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0074_A04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0100_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0094_E10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0087_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0099_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0035_G10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0089_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0088_F04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0023_F07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0080_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0083_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0076_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0004_H05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0080_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
HTMT1_0115_G01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
CBLT1_0068_E12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0037_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
ILNT1_0002_E08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
CBLT1_0025_G05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0065_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0028_H01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0001_E11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0040_D02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0026_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0044_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_B08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0060_D06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0098_D08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0037_B06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0094_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0075_G10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0005_D04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0075_F10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0034_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0098_G04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
OVRT1_0146_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0018_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0043_D01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTT*CCACGTATAAACAACATAAGTT
DCI01_0104_F03.b : CCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0034_G12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0013_F11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0041_E08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0096_B02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0043_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0059_G05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0001_E12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_G09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0039_D08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0052_A04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0019_E09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0065_E01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0098_B09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0042_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0052_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0053_F07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0052_D01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0009_E04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0062_C09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0031_F10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0071_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0109_B09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0014_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0033_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0030_B07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0083_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0082_C03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0110_A04.b : TCGTACCGCTAATGATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0070_C11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0057_F08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0033_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0107_B06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0087_E01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0092_F05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0038_G05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0107_C06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0069_A06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0075_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0054_A11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0096_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0098_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0096_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0028_A09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0078_D06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0033_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0067_C07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0025_B09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0082_G12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAGCATAAGTT
DCI01_0033_B01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0029_E11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0030_C03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_B03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0057_D08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0079_F11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0061_E09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0101_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0114_D02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0100_A01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_D11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0037_A02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTAGAAACAACATAAGTT
AMP01_0097_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0095_H08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0104_E09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0044_F02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0032_G09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0072_H02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0085_B01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0094_G03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATGAGTT
DCI01_0077_G01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0101_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0083_A01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACGTAAGTT
MLTL1_0083_F01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0053_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0085_A10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0078_A07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0084_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0076_F09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0060_A10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0056_E09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0003_A10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0036_A03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0057_B06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0024_A07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0083_D11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCTCGTATAAACAACATAAGTT
DCI01_0095_H12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0063_D11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0073_F01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0068_B02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACATATAAACAACATAAGTT
MLTL1_0053_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0065_E11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACATATAAACAACATAAGTT
DCI01_0072_E02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0114_F10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0114_D12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0092_C10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0036_B06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0087_E12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0010_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0100_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0076_D10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0087_D07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0045_F07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0041_E01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0075_H05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACATATAAACAACATAAGTT
AMP01_0080_C01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0087_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0073_B03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0056_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0073_B02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0087_F08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0074_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0083_B09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0016_E09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0051_F03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0071_B02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0093_D06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0081_G05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0086_G11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0085_F10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0092_E03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0005_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0069_C11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0091_E01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0093_G04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0073_G01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0097_H10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0006_D09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0064_C12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0079_A08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0086_A12.b : TCATACCGCTAATAATCCGATCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0046_A06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0032_B11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0042_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTCCCACGTATAAACAACATAAGTT
MLTL1_0016_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0034_G04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0118_E10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0073_H09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0031_D12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0074_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0010_E03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0117_G06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0006_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0058_H10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0115_B09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0099_A07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0037_F08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0049_C09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0059_F05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
OVRT1_0001_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0086_F06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_H07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0057_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0082_C12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0082_E08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0097_F01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0036_G06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0050_E02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0119_B03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0117_C07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0005_D08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0005_B02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0090_G10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0091_C05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0114_C07.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0116_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0059_E05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
CLNT1_0038_D01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0045_C01.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0114_G06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0065_B11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0008_E10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0073_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0079_G08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0070_B04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0077_F06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0028_E03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
OVRT1_0074_C04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0056_C11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0053_E11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0034_C09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0018_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0031_B04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0042_H02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0077_G02.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGTCTTTCCACGTATAAACAACATAAGTT
DCI01_0072_F05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0029_B03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0073_A05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
CLNT1_0065_C11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0057_A06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0022_B04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0031_E03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0082_B12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0106_B10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0042_B11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0071_F09.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0102_D03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0087_H04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0032_G06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0062_E06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0078_F12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0097_D05.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCTCGTATAAACAACATAAGTT
DCI01_0071_H11.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCTCGTATAAACAACATAAGTT
BKFL1_0030_C12.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0098_H10.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0083_G08.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAATATAAGTT
AMP01_0013_D06.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0094_G04.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0086_A03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0032_A03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
AMP01_0072_H03.b : TCGTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0046_G12.b : xxxTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0058_G09.b : xxxTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
MLTL1_0045_D12.b : xxxTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTC
MLTL1_0045_B03.b : xxxTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0050_H10.b : xxxTACCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
DCI01_0043_B06.b : xxxxxCCGCTAATAATCGGAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
CBLT1_0014_C03.b : xxxxxxxxxxxxxxxxxxGAGCTCCCGATACGGTCTTTCCACGTATAAACAACATAAGTT
BKFL1_0084_G03.b : xxxxxxxxxxxxxxxxxxxAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0088_E05.b : xxxxxxxxxxxxxxxxxxxAGCTCCCGATATGGCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCACGTATAAACAACATAAGTT
BKFL1_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCACGTATAAACAACATAAGTT
AMP01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGTATAAACAACATAAGTT
MLTL1_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
AMP01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
DCI01_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATAAACAACATAAGTT
AMP01_0085_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATAAACAACATAAGTT
BKFL1_0096_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACATAAGTT
AMP01_0102_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATAAGTT
MLTL1_0025_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATAAGTT
DCI01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0070_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0044_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0099_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_G04.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_F12.b : accgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B11.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_H10.b : gtaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C04.b : agggaatcttgggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0081_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
MLTL1_0058_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0097_E10.b : nnnncattttttnnnnnccgaaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0099_E04.b : nnnnccctatannnnnnncgaaccntatagggctxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
AMP01_0013_B02.b : ntaataatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_F02.b : nggagataantatagggatatcttagggctxxxxxxxxxxxxxxx
AMP01_0084_A08.b : aaaacctaatctaaxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0044_B11.b : taatcttaxxxx
MLTL1_0059_D03.b : nnnn
MLTL1_0025_E02.b :
MLTL1_0045_E06.b :
MLTL1_0036_H12.b :
BKFL1_0096_G09.b :
MLTL1_0046_D11.b :
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
---------+---------+---------+---------+---------+---------+ 366
DCI01_0030_B12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0040_H10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TANAAGCCGGA
AMP01_0004_F11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0100_H06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0010_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0020_C03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0071_G06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATATCTACAAGCCGGA
DCI01_0106_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCACCCTCAATAG*TAGAAGCCGGA
DCI01_0031_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0046_F06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAAAAGCCGGA
AMP01_0038_C03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0020_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0093_E01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0084_H01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0045_D04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0108_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0101_E02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0099_F07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0013_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0015_H08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0068_F06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0006_A12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0061_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0027_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0030_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0037_H11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
AMP01_0040_E07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAAAAACCGGA
DCI01_0044_C08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0015_D02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0078_C04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TACAAGCCGGA
MLTL1_0036_G05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0009_H05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0029_H08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0070_H11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0072_D09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0014_H07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0108_G06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0030_B01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0054_F06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0012_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAACAG*TAGAAGCCGGA
MLTL1_0040_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0027_C05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0068_F07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0066_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0091_A11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0077_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0117_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0075_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0034_B12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0015_F03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0016_F11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0082_H09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0004_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0069_D10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0088_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BFLT1_0028_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0094_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0069_B01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCGATAG*TAGAAGCCGGA
DCI01_0109_H01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0083_G09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0061_B04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0066_C02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0076_B01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0031_B06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_G07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0084_D04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0096_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0078_H06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_F04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0083_E04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0061_H03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0052_B12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0068_F04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0082_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATTG*TAGAAGCCGGA
DCI01_0061_F04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0076_H05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
DCI01_0113_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0091_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0057_D02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0052_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0115_A02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0062_E10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0086_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0094_D02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0079_G10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0034_C10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0036_B11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0022_D04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0098_G05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0042_E03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0085_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0080_A11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0036_G01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0115_F12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0111_C12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0069_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0056_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0084_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAACAG*TAGAAGCCGGA
AMP01_0035_E08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0093_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0100_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0074_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0100_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0094_E10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0087_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCGATAG*TAGAAGCCGGA
DCI01_0099_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0035_G10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCGTCCTCAATAG*TAGAAGCCGGA
AMP01_0089_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0088_F04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0023_F07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0080_H09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0083_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0076_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0004_H05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0080_D03.b : TCTGACTACTTCCACCATCCTTCCTTTTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_H09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
HTMT1_0115_G01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
CBLT1_0068_E12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0037_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
ILNT1_0002_E08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
CBLT1_0025_G05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0065_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0028_H01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0001_E11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0040_D02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
DCI01_0026_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0044_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGTCGGA
AMP01_0093_B08.b : TCCTAATACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0060_D06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0098_D08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0037_B06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
AMP01_0094_H09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0075_G10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0005_D04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0075_F10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0034_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0098_G04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
OVRT1_0146_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0018_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0043_D01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
DCI01_0104_F03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0034_G12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0013_F11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0041_E08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0096_B02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCAGA
AMP01_0043_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0059_G05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0001_E12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGTATCCTCAATAG*TAGAAGCCGGA
AMP01_0093_G09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0039_D08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
MLTL1_0052_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0019_E09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0065_E01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0098_B09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0042_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0052_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAGTAG*TAGAAGCCGGA
AMP01_0053_F07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0052_D01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0009_E04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0062_C09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0031_F10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0071_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0109_B09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0014_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0033_D03.b : TCTGACTACTTCCACCATCCATCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0030_B07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0083_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0082_C03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0110_A04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0070_C11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*CAGAAGCCGGA
MLTL1_0057_F08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0033_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0107_B06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0087_E01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0092_F05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0038_G05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0107_C06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0069_A06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0075_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0054_A11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0096_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAAAAGCCGGA
MLTL1_0098_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0096_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0028_A09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0078_D06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0033_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0067_C07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0025_B09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0082_G12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0033_B01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0029_E11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0030_C03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0093_B03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0057_D08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0079_F11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0061_E09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0101_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0114_D02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0100_A01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0093_D11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0037_A02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
AMP01_0097_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0095_H08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0104_E09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0044_F02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0032_G09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0072_H02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0085_B01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0094_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_G01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0101_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0083_A01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0083_F01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0053_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0085_A10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0078_A07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0084_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0076_F09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0060_A10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0056_E09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0003_A10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0036_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0057_B06.b : TCTGACTACTTCCACCATCCTTCCTATTGCTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0024_A07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0083_D11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0095_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0063_D11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0073_F01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0068_B02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0053_H09.b : CCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0065_E11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0072_E02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0114_F10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0114_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0092_C10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0036_B06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0087_E12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0010_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0100_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0076_D10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATTG*TAGAAGCCGGA
MLTL1_0087_D07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0045_F07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0041_E01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0075_H05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0080_C01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0087_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0073_B03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0056_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0073_B02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0087_F08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0074_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0083_B09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0016_E09.b : TCTGACTACTTCCACCATCCTTCCGATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0051_F03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0071_B02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0093_D06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0081_G05.b : TCTGACTACTCCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0086_G11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0085_F10.b : TCTGGCTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0092_E03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0005_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0069_C11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0091_E01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0093_G04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0073_G01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0097_H10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0006_D09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0064_C12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0079_A08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0086_A12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCAGA
AMP01_0046_A06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0032_B11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0042_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0016_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0034_G04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0118_E10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0073_H09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0031_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0074_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0010_E03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0117_G06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TGGAAGCCGGA
BKFL1_0006_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0058_H10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0115_B09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAACAG*TAGAAGCCGGA
DCI01_0099_A07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAACAG*TAGAAGCCGGA
MLTL1_0037_F08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0049_C09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0059_F05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
OVRT1_0001_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0086_F06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_H07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0057_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0082_C12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0082_E08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0097_F01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0036_G06.b : TCTGACTACTTCCACCATCCTTCCTACTACTTCTGGCATCCTCAATAG*CAGAAGCCGGA
MLTL1_0050_E02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0119_B03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0117_C07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0005_D08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCCCAATAG*TAGAAGCCGGA
MLTL1_0005_B02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0090_G10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0091_C05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0114_C07.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0116_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0059_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
CLNT1_0038_D01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0045_C01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0114_G06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0065_B11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0008_E10.b : TCTGACTACTTCCACCACCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0073_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0079_G08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0070_B04.b : TCTGACTACTTCCACCATCCTCCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0077_F06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0028_E03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
OVRT1_0074_C04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0056_C11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAA*TAGAAGCCGGA
MLTL1_0053_E11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0034_C09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0018_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0031_B04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0042_H02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0077_G02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0072_F05.b : TCTGACTACCTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0029_B03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0073_A05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
CLNT1_0065_C11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0057_A06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0022_B04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0031_E03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0082_B12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0106_B10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0042_B11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0071_F09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0102_D03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0087_H04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0032_G06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0062_E06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0078_F12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0097_D05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0071_H11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0030_C12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0098_H10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0083_G08.b : TCTGACTACTTCCACCATCCTTCCTATTACTCCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0013_D06.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0094_G04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0086_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0032_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0072_H03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0046_G12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0058_G09.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCGATAG*TAGAAGCCGGA
MLTL1_0045_D12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0045_B03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0050_H10.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0043_B06.b : TCTG***ACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
CBLT1_0014_C03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0084_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0088_E05.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0059_F03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0050_H12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0015_A03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0078_E04.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0006_E02.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0083_G08.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0085_G03.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0096_F01.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0102_B11.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0025_A12.b : TCTGACTACTTCCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
DCI01_0019_B01.b : xxxxxxxxxxxxCACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
AMP01_0090_E09.b : xxxxxxxxxxxxxACCATCCTTCCTATTACTTCTGGCATCCTCAATAG*TAGAAGCCGGA
MLTL1_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTGGCAACCTCAATAG*TAGAAGCCGGA
BKFL1_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCATCCTCAATAG*TAGAAGCCGGA
BKFL1_0070_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCCTCAATAG*TAGAAGCCGGA
AMP01_0024_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCCTCAATAG*TAGAAGCCGGA
AMP01_0102_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAAGCCGGA
MLTL1_0044_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCGGA
BKFL1_0099_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCGGA
MLTL1_0046_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA
BKFL1_0056_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0024_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0097_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0099_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
MLTL1_0025_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0045_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0036_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
BKFL1_0096_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
MLTL1_0046_D11.b : nngggacatctctattanggatatcaaxxxxxxxxxxxxx
AMP01_0091_F11.b :
AMP01_0031_E12.b :
AMP01_0050_D01.b :
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
---------+---------+---------+---------+---------+---------+ 426
DCI01_0030_B12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0040_H10.b : GCGGGTACTGGATGAACTGTATACCCCCCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0004_F11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0100_H06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0010_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0020_C03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0071_G06.b : GCGAGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTACCCCATGCAGGGGCT
DCI01_0106_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0031_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0046_F06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0038_C03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0020_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_E01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0084_H01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0045_D04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0108_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0101_E02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0099_F07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCACGCAGGGGCT
DCI01_0013_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0015_H08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0068_F06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0006_A12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0061_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0027_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0030_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0037_H11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0040_E07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0044_C08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0015_D02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0078_C04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0036_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0009_H05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0029_H08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0070_H11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0072_D09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0014_H07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0108_G06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0030_B01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0054_F06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0012_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0040_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0027_C05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0068_F07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0066_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0091_A11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0077_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0117_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0075_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0034_B12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0015_F03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0016_F11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0082_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0004_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0069_D10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0088_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BFLT1_0028_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0094_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0069_B01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0109_H01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0083_G09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0061_B04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0066_C02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0076_B01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0031_B06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGAGGCT
DCI01_0077_G07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0084_D04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0096_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0078_H06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_F04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0083_E04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0061_H03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0052_B12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0068_F04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0082_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0061_F04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0076_H05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCACGGGCT
DCI01_0113_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0091_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0057_D02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0052_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0115_A02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0062_E10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0086_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0094_D02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0079_G10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0034_C10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0036_B11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0022_D04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0098_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0042_E03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0085_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0080_A11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0036_G01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0115_F12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0111_C12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0069_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0056_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0084_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0035_E08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0093_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0100_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0074_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0100_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0094_E10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0087_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0099_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0035_G10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0089_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0088_F04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0023_F07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0080_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0083_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0076_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0004_H05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0080_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
HTMT1_0115_G01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
CBLT1_0068_E12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0037_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
ILNT1_0002_E08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
CBLT1_0025_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0065_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0028_H01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0001_E11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0040_D02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0026_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0044_F02.b : GCGGGTACTGGATGAACTGTATACCCGCCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_B08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0060_D06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0098_D08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0037_B06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0094_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0075_G10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCCGGAAACTTAGCCCATGCAGGGGCT
AMP01_0005_D04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0075_F10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCCGGAAACTTAGCCCATGCAGGGGCT
AMP01_0034_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0098_G04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
OVRT1_0146_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0018_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0043_D01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0104_F03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0034_G12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0013_F11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0041_E08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0096_B02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0043_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0059_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0001_E12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_G09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0039_D08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0052_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0019_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0065_E01.b : GCGGGTACTGGATGAACTGCATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0098_B09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0042_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0052_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0053_F07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0052_D01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0009_E04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0062_C09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0031_F10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0071_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0109_B09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0014_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0033_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0030_B07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0083_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0082_C03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0110_A04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0070_C11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0057_F08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0033_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0107_B06.b : GCGGGCACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0087_E01.b : GCGGGCACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0092_F05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0038_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0107_C06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0069_A06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0075_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0054_A11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0096_E05.b : ACGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0098_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCC
AMP01_0096_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0028_A09.b : GCGGGTACTAGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0078_D06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0033_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0067_C07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0025_B09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0082_G12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0033_B01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0029_E11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0030_C03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0057_D08.b : GCGGGTACTGGATGAACTGTATACCCACCTCTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0079_F11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0061_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0101_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0114_D02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0100_A01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_D11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0037_A02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0097_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0095_H08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0104_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0044_F02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0032_G09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0072_H02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0085_B01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0094_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_G01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0101_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0083_A01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0083_F01.b : GCGGGTACTGGATGAACTGTATACCAACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0053_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0085_A10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0078_A07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0084_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0076_F09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0060_A10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0056_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0003_A10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0036_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0057_B06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0024_A07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0083_D11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0095_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0063_D11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0073_F01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0068_B02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0053_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0065_E11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0072_E02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0114_F10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0114_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0092_C10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0036_B06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0087_E12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0010_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0100_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0076_D10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0087_D07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0045_F07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0041_E01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0075_H05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0080_C01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0087_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0073_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0056_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0073_B02.b : GCGGGTACTGGATGAACTGTATACCCACCTT*AGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0087_F08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0074_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0083_B09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0016_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0051_F03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0071_B02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0093_D06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0081_G05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0086_G11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0085_F10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0092_E03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0005_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0069_C11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0091_E01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0093_G04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0073_G01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0097_H10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGTAACTTAGCCCATGCAGGGGCT
MLTL1_0006_D09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0064_C12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCCGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0079_A08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0086_A12.b : ACGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAACCCATGCACGGGCT
AMP01_0046_A06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0032_B11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0042_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0016_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0034_G04.b : GCGGGTACCGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0118_E10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0073_H09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0031_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0074_D03.b : GCGGGTACTGGATGGACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0010_E03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0117_G06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0006_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0058_H10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0115_B09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0099_A07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0037_F08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0049_C09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0059_F05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
OVRT1_0001_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0086_F06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_H07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0057_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0082_C12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0082_E08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0097_F01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0036_G06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0050_E02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0119_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0117_C07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0005_D08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0005_B02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0090_G10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0091_C05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0114_C07.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0116_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0059_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGAGGCT
CLNT1_0038_D01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGTTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0045_C01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0114_G06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0065_B11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0008_E10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0073_B10.b : GCGGGTACTGGATGAACTGTGTACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0079_G08.b : GCGGGTACTGGATGAACTGTGTACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0070_B04.b : GCGGGTACTGGATGAACTGTGTACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0077_F06.b : GCGGGTACTGGATGAACTGTATGCCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0028_E03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
OVRT1_0074_C04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0056_C11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0053_E11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0034_C09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0018_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0031_B04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0042_H02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0077_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0072_F05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0029_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0073_A05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
CLNT1_0065_C11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0057_A06.b : GTGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0022_B04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0031_E03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0082_B12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0106_B10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0042_B11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0071_F09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0102_D03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0087_H04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0032_G06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0062_E06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0078_F12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0097_D05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0071_H11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0030_C12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0098_H10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0083_G08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0013_D06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0094_G04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0086_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0032_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0072_H03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0046_G12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0058_G09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0045_D12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0045_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0050_H10.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0043_B06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
CBLT1_0014_C03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0084_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0088_E05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0059_F03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0050_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0015_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0078_E04.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0006_E02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0083_G08.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0085_G03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0096_F01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0102_B11.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0025_A12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAAGGGCT
DCI01_0019_B01.b : GCGGGTACTGGATGAACTGTATGCCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0090_E09.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0073_A03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0033_B03.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0070_C05.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0024_H12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0102_D06.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0044_G02.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0099_H01.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0046_B12.b : GCGGGTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0056_G04.b : xxxxxTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0075_F06.b : xxxxxTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
DCI01_0072_B05.b : xxxxxTACTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0009_B07.b : xxxxxxxCTGGATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
BKFL1_0009_G01.b : xxxxxxxxxxxATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
MLTL1_0024_F12.b : xxxxxxxxxxxATGAACTGTATACCCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0016_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0016_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCACCTTTAGCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0085_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAAACTTAGCCCATGCAGGGGCT
AMP01_0046_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAACTTAGCCCATGCAGGGGCT
MLTL1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCAGGGGCT
MLTL1_0058_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGGGGCT
MLTL1_0097_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0099_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
MLTL1_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
AMP01_0013_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
AMP01_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0059_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0096_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0046_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_F11.b : nnaaagtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0031_E12.b : ngggaatatatatagggtatcttxxxxxxxxxxxxxx
AMP01_0050_D01.b : nngg
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
---------+---------+---------+---------+---------+---------+ 485
DCI01_0030_B12.b : TCAGTTGATTTAACCATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTANGGGC
AMP01_0040_H10.b : TCAGTTGATTTAACAATTTTCCTCCCTACACCTTGCAGGTGTATCATCCATCCTAGGGGG
AMP01_0004_F11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAAGTGTATCATCAATCCTAGGGGC
MLTL1_0100_H06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0010_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0020_C03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0071_G06.b : ACACTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0106_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0031_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0046_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0038_C03.b : TCAGTTGATTTAACAATCTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0020_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_E01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0084_H01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0045_D04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0108_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0101_E02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0099_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0013_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0015_H08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0068_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0006_A12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0061_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0027_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0030_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0037_H11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0040_E07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0044_C08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0015_D02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0078_C04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0036_G05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0009_H05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0029_H08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0070_H11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0072_D09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0014_H07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0108_G06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0030_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0054_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0012_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0040_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0027_C05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0068_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0066_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0091_A11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0077_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTGCACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0117_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0075_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0034_B12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0015_F03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0016_F11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0082_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0004_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0069_D10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0088_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BFLT1_0028_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0094_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0069_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0109_H01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0083_G09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0061_B04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0066_C02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0076_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0031_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_G07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0084_D04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0096_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0078_H06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_F04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0083_E04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0061_H03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0052_B12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0068_F04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0082_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0061_F04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0076_H05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0113_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0091_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0057_D02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0052_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0115_A02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0062_E10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0086_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0094_D02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0079_G10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0034_C10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0036_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0022_D04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0098_G05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0042_E03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0085_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0080_A11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0036_G01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0115_F12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0111_C12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0069_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0056_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0084_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0035_E08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0093_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0100_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0074_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0100_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0094_E10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0087_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0099_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0035_G10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0089_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0088_F04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0023_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0080_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0083_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0076_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0004_H05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGTAGGTGTATCATCAATCCTAGGGGC
DCI01_0080_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
HTMT1_0115_G01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
CBLT1_0068_E12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0037_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
ILNT1_0002_E08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
CBLT1_0025_G05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0065_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0028_H01.b : TCAGTTGATTTAACATTTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0001_E11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0040_D02.b : TCAGTTGATTTAAC*ATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0026_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0044_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_B08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0060_D06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0098_D08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0037_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0094_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0075_G10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0005_D04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0075_F10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0034_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0098_G04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
OVRT1_0146_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0018_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0043_D01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0104_F03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0034_G12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0013_F11.b : TCAGCTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0041_E08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0096_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0043_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0059_G05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0001_E12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_G09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0039_D08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0052_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0019_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0065_E01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0098_B09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0042_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0052_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0053_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0052_D01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0009_E04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0062_C09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0031_F10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0071_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0109_B09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0014_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0033_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0030_B07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0083_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0082_C03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0110_A04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0070_C11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0057_F08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0033_H04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0107_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0087_E01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0092_F05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0038_G05.b : TCAGTTGAATTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0107_C06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0069_A06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0075_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0054_A11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0096_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCATGTGTATCATCAATCCTAGGGGC
MLTL1_0098_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0096_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0028_A09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0078_D06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0033_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0067_C07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0025_B09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0082_G12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0033_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0029_E11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0030_C03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0057_D08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0079_F11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0061_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0101_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0114_D02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0100_A01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_D11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0037_A02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0097_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0095_H08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0104_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0044_F02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0032_G09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0072_H02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0085_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0094_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_G01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0101_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0083_A01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0083_F01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0053_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0085_A10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0078_A07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0084_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0076_F09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0060_A10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0056_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0003_A10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0036_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0057_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0024_A07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0083_D11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0095_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0063_D11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCGTCAATCCTAGGGGC
DCI01_0073_F01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0068_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0053_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0065_E11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0072_E02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0114_F10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0114_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0092_C10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0036_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0087_E12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0010_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0100_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0076_D10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0087_D07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0045_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0041_E01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0075_H05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGCATCATCAATCCTAGGGGC
AMP01_0080_C01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0087_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0073_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0056_H04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0073_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0087_F08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0074_H04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0083_B09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0016_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0051_F03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0071_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0093_D06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0081_G05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0086_G11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0085_F10.b : TCAGTTGATTTAACAACTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0092_E03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0005_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCACCAATCCTAGGGGC
AMP01_0069_C11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0091_E01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0093_G04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0073_G01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0097_H10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0006_D09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0064_C12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0079_A08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0086_A12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTACGGGC
AMP01_0046_A06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0032_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0042_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0016_H04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0034_G04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0118_E10.b : TCAGTCGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0073_H09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0031_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0074_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0010_E03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGCGTATCATCAATCCTAGGGGC
DCI01_0117_G06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0006_E06.b : TCAGTCGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0058_H10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0115_B09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAGTCCTAGGGGC
DCI01_0099_A07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAGTCCTAGGGGC
MLTL1_0037_F08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0049_C09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0059_F05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
OVRT1_0001_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0086_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_H07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0057_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0082_C12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0082_E08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0097_F01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0036_G06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAACCCTAGGGGC
MLTL1_0050_E02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTCGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0119_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0117_C07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0005_D08.b : TCAGTTGATTTAATAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0005_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0090_G10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0091_C05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0114_C07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0116_H04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0059_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
CLNT1_0038_D01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0045_C01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0114_G06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0065_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0008_E10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTGGGGGC
BKFL1_0073_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0079_G08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0070_B04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0077_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0028_E03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
OVRT1_0074_C04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0056_C11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0053_E11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0034_C09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0018_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0031_B04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0042_H02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0077_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0072_F05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0029_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0073_A05.b : TCAGTTGATTTAACAATTTTC*TCCCTACGCCTTGCAGGTGTATCATCAATCCTAGGGGC
CLNT1_0065_C11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0057_A06.b : TCAGTTGATTTAACAATTTTC*TCCCCACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0022_B04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0031_E03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0082_B12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0106_B10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0042_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0071_F09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0102_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0087_H04.b : TCAGTTGATTTAACAATCTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0032_G06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0062_E06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0078_F12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0097_D05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0071_H11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0030_C12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0098_H10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0083_G08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0013_D06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0094_G04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0086_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0032_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0072_H03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0046_G12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0058_G09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0045_D12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0045_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0050_H10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0043_B06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
CBLT1_0014_C03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0084_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0088_E05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0059_F03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0050_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0015_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0078_E04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0006_E02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0083_G08.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGCGTATCATCAATCCTAGGGGC
AMP01_0085_G03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0096_F01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0102_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0025_A12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0019_B01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0090_E09.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0073_A03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0033_B03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0070_C05.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0024_H12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0102_D06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0044_G02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0099_H01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0046_B12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0056_G04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0075_F06.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
DCI01_0072_B05.b : TCAGTTGATTCAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0009_B07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0009_G01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0024_F12.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0016_B11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0016_B04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0085_H10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0046_C04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGAGGC
MLTL1_0081_F07.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0058_D03.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0097_E10.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0083_G11.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0099_E04.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0025_D01.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGTAGGTGTATCATCAATCCTAGGGGC
AMP01_0013_B02.b : TCAGTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0055_F02.b : xxxxTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0084_A08.b : xxxxTTGATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
BKFL1_0028_C04.b : xxxxxxxATTTAACAATTTTC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
AMP01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxC*TCCCTACACCTTGCAGGTGTATCATCAATCCTAGGGGC
MLTL1_0059_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCTAGGGGC
MLTL1_0025_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
BKFL1_0096_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLTL1_0046_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0031_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_D01.b : ggtaaatatagggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B08.b :
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
---------+---------+---------+---------+---------+---------+ 542
DCI01_0030_B12.b : TATTTATTTCATTACCCC*CATTAATAACATTAAAACCCCC*GCAATGTCCCA*TAA*CA
AMP01_0040_H10.b : CTATAATTTCCTTACCACCATTTATTAAAATAAAACCCCCCCGCAATGTCTCAATACCCA
AMP01_0004_F11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0100_H06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0010_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0020_C03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0071_G06.b : TATTACTTTCCTTGCCAC*CTTTATTAACATAACACCCCTC*GCTATGTCTCAATAC*CN
DCI01_0106_B10.b : TATTAATTTCATTACCAC*AATTATTAAACATAAACCCCCC*GCA*TGTCTCAATAC*CA
DCI01_0031_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0046_F06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0038_C03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0020_D05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_E01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0084_H01.b : TATTAATTTCATTACCCA*CATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0045_D04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0108_D05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0101_E02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0099_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0013_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0015_H08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*AA
AMP01_0068_F06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0006_A12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0061_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0027_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0030_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0037_H11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0040_E07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0044_C08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0015_D02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0078_C04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0036_G05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0009_H05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0029_H08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0070_H11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0072_D09.b : TATT*ATTTCATTACCCA*CATTATTAACATAAA*CCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0014_H07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0108_G06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0030_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0054_F06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0012_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0040_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0027_C05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0068_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0066_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0091_A11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACTCCCC*GCAATGTCTCAATAC*CA
AMP01_0077_D05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0117_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0075_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0034_B12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0015_F03.b : TATTAATCTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0016_F11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0082_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0004_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0069_D10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0088_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BFLT1_0028_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0094_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0069_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0109_H01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0083_G09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0061_B04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0066_C02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0076_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0031_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_G07.b : TAT*AATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0084_D04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0096_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0078_H06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_F04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0083_E04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0061_H03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0052_B12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0068_F04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0082_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0061_F04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0076_H05.b : TATTAATTTCATTACCAC*AAATATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0113_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0091_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0057_D02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0052_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0115_A02.b : TATTAATTTCATTACCAC*AATTATTAACGTAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0062_E10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0086_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0094_D02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0079_G10.b : TATTAATTTCATTACCAC*AATTATTAACGTAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0034_C10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0036_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0022_D04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0098_G05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0042_E03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0085_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0080_A11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0036_G01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0115_F12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0111_C12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0069_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0056_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0084_G02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0035_E08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0093_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0100_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0074_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0100_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0094_E10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0087_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0099_G02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0035_G10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0089_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0088_F04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0023_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCGATGTCTCAATAC*CA
DCI01_0080_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0083_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0076_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0004_H05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0080_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
HTMT1_0115_G01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAanta
CBLT1_0068_E12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0037_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
ILNT1_0002_E08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
CBLT1_0025_G05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0065_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0028_H01.b : TA*TATTTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCA*TGTCTCAATAC*AA
AMP01_0001_E11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0040_D02.b : TATTAATTTTCCTACCAC*AATTATAANCATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0026_G02.b : TATTTATTTCATTACAAC*AATTATTAACATAAAAC*CCCC*GCAATGTCTCAATA**CA
AMP01_0044_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_B08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0060_D06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0098_D08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0037_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0094_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0075_G10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0005_D04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0075_F10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0034_D05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0098_G04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
OVRT1_0146_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0018_D05.b : TATTACTTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0043_D01.b : TATTAATTTCATTACCAC*AATTATTAACATACA*CCCCCC*GCAATGTCTCAATAC*CA
DCI01_0104_F03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*TGCATGTCTCNATAC*CA
MLTL1_0034_G12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0013_F11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0041_E08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCT*GCAATGTCTCAATAC*CA
AMP01_0096_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0043_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAACACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0059_G05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0001_E12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_G09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0039_D08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0052_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0019_E09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0065_E01.b : TATTAATTTCATTACCAC*AATTACTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0098_B09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0042_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0052_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGCCTCAATAC*CA
AMP01_0053_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0052_D01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0009_E04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0062_C09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0031_F10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0071_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0109_B09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0014_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0033_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0030_B07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0083_F02.b : TATTAACTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0082_C03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0110_A04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0070_C11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0057_F08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0033_H04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0107_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0087_E01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0092_F05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0038_G05.b : TATTAATTTTCTTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCCATAC*AA
BKFL1_0107_C06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0069_A06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0075_H12.b : CATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0054_A11.b : CATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0096_E05.b : TATTAATTTCATTACCAC*AATTATTAACGTAAGACCCCCC*GCAATGTCTCGATAC*CA
MLTL1_0098_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0096_D07.b : TATTAATTTCATTACCAC*AATTATTAACGTAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0028_A09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0078_D06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0033_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0067_C07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0025_B09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC**A
DCI01_0082_G12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0033_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAA*CCCCC*GCAATGTCTCAATAC*CA
MLTL1_0029_E11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0030_C03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0057_D08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0079_F11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0061_E09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAGCCCCCC*GCAATGTCTCAATAC*CA
AMP01_0101_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0114_D02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0100_A01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_D11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0037_A02.b : TATTAATTTCATTACCCA*CATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0097_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0095_H08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0104_E09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0044_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0032_G09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0072_H02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0085_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0094_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_G01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0101_G02.b : TATTAATTTCATTACCAN*CATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0083_A01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0083_F01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0053_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0085_A10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0078_A07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0084_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0076_F09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0060_A10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0056_E09.b : TATTAATTTCATCACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0003_A10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0036_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0057_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0024_A07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0083_D11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCTC*GCAATGTCTCAATAC*CA
DCI01_0095_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0063_D11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0073_F01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0068_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0053_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0065_E11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0072_E02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0114_F10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0114_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0092_C10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0036_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0087_E12.b : TACTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0010_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0100_E06.b : TATTAATTTCATTACCAC*AATCATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0076_D10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0087_D07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0045_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0041_E01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0075_H05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0080_C01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0087_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0073_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0056_H04.b : TATTAATTTCATCACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0073_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0087_F08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0074_H04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0083_B09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0016_E09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0051_F03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0071_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0093_D06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0081_G05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0086_G11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0085_F10.b : TACTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0092_E03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0005_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0069_C11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0091_E01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0093_G04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0073_G01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0097_H10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAGCCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0006_D09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0064_C12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0079_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0086_A12.b : TATTAATTTCATTACCAC*TATTATTAACATAACACCCCAC*GCACTGTCTCAATAC*CG
AMP01_0046_A06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0032_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0042_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0016_H04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0034_G04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0118_E10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0073_H09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0031_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0074_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0010_E03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0117_G06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0006_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0058_H10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0115_B09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0099_A07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0037_F08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0049_C09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0059_F05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
OVRT1_0001_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0086_F06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_H07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0057_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0082_C12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0082_E08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0097_F01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0036_G06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0050_E02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0119_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0117_C07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0005_D08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0005_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0090_G10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0091_C05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0114_C07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0116_H04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0059_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
CLNT1_0038_D01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0045_C01.b : TATTAATTTCACTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0114_G06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAA*CCCCC*GCAATGTCTCAATAC*CA
AMP01_0065_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0008_E10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0073_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0079_G08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0070_B04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0077_F06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0028_E03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
OVRT1_0074_C04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0056_C11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0053_E11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0034_C09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0018_G02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0031_B04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0042_H02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0077_G02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0072_F05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0029_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0073_A05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
CLNT1_0065_C11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0057_A06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0022_B04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0031_E03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0082_B12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0106_B10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0042_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0071_F09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0102_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0087_H04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0032_G06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0062_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0078_F12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0097_D05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0071_H11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0030_C12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0098_H10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0083_G08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0013_D06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0094_G04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0086_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0032_A03.b : TATTAATTTCATTACCGC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0072_H03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0046_G12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0058_G09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0045_D12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0045_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0050_H10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0043_B06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCCCAATAC*CA
CBLT1_0014_C03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0084_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0088_E05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0059_F03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0050_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0015_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0078_E04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0006_E02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0083_G08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0085_G03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0096_F01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0102_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0025_A12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0019_B01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0090_E09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0073_A03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0033_B03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0070_C05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAGCCCCCC*GCAATGTCTCAATAC*CA
AMP01_0024_H12.b : CATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0102_D06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0044_G02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0099_H01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0046_B12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0056_G04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0075_F06.b : CATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
DCI01_0072_B05.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0009_B07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0009_G01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCTATGTCTCAATAC*CA
MLTL1_0024_F12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0016_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0016_B04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0085_H10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0046_C04.b : TATTAATTTCCTTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0081_F07.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0058_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0097_E10.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0083_G11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0099_E04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCGATGTCTCAATAC*CA
MLTL1_0025_D01.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0013_B02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0055_F02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0084_A08.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0028_C04.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0044_B11.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0059_D03.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0025_E02.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0045_E06.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0036_H12.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
BKFL1_0096_G09.b : TATTAATTTCATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
MLTL1_0046_D11.b : xxxxxxxxxxATTACCAC*AATTATTAACATAAAACCCCCC*GCAATGTCTCAATAC*CA
AMP01_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATGTCTCAATAC*CA
AMP01_0031_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B08.b : nnn
MLTL1_0029_H09.b :
DCI01_0070_D01.b :
AMP01_0026_C03.b :
AMP01_0059_B08.b :
AMP01_0033_A04.b :
CBLT1_0061_H01.b :
AMP01_0060_C05.b :
AMP01_0088_A10.b :
AMP01_0070_C12.b :
DCI01_0034_C08.b :
MLTL1_0025_H10.b :
CBLT1_0089_C04.b :
ILNT1_0002_D09.b :
MLTL1_0044_E01.b :
MLTL1_0045_H09.b :
DCI01_0023_F06.b :
AMP01_0101_G11.b :
AMP01_0064_F02.b :
MLTL1_0043_H01.b :
BKFL1_0106_F03.b :
AMP01_0028_B05.b :
AMP01_0048_D11.b :
MLTL1_0070_G11.b :
BKFL1_0050_G06.b :
MLTL1_0043_G10.b :
MLTL1_0020_E11.b :
AMP01_0009_F07.b :
MLTL1_0004_E09.b :
MLTL1_0044_C03.b :
MLTL1_0080_C07.b :
MLTL1_0052_A03.b :
MLTL1_0030_D07.b :
MLTL1_0038_A10.b :
DCI01_0027_F01.b :
MLTL1_0055_D09.b :
MLTL1_0086_D10.b :
MLTL1_0054_F08.b :
MLTL1_0016_B03.b :
MLTL1_0043_G09.b :
MLTL1_0071_E05.b :
CBLT1_0019_A02.b :
MLTL1_0026_H04.b :
MLTL1_0022_C11.b :
AMP01_0083_F10.b :
AMP01_0101_B01.b :
MLTL1_0099_H10.b :
AMP01_0067_D03.b :
DCI01_0019_D04.b :
AMP01_0080_A07.b :
CBLT1_0074_F06.b :
DCI01_0014_G03.b :
MLTL1_0073_A07.b :
CBLT1_0065_E03.b :
AMP01_0011_D03.b :
DCI01_0041_F05.b :
AMP01_0017_G01.b :
AMP01_0087_H04.b :
MLTL1_0006_B08.b :
AMP01_0055_G03.b :
AMP01_0044_G12.b :
AMP01_0047_H08.b :
MLTL1_0039_E08.b :
AMP01_0048_H05.b :
MLTL1_0076_B06.b :
AMP01_0075_B01.b :
AMP01_0008_G11.b :
MLTL1_0084_D10.b :
AMP01_0022_H09.b :
BKFL1_0004_D01.b :
BMWN1_0014_D09.b :
DCI01_0090_D05.b :
BKFL1_0032_E02.b :
BKFL1_0045_G02.b :
BKFL1_0030_C04.b :
HTMT1_0128_H05.b :
SPLT1_0078_F12.b :
SPLT1_0086_B11.b :
AMP01_0048_D08.b :
AMP01_0016_E05.b :
AMP01_0031_G08.b :
AMP01_0069_A07.b :
AMP01_0068_C05.b :
SPLT1_0025_B12.b :
BMWN1_0017_H12.b :
HTMT1_0119_D07.b :
AMP01_0026_A07.b :
AMP01_0068_F01.b :
HTMT1_0010_G06.b :
HTMT1_0099_F09.b :
BMWN1_0087_F02.b :
BMWN1_0081_D12.b :
SPLT1_0020_B12.b :
HTMT1_0151_B12.b :
HTMT1_0152_E10.b :
HTMT1_0129_G11.b :
HTMT1_0067_H03.b :
HTMT1_0003_G03.b :
20110601C-000047 : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
---------+---------+---------+---------+---------+---------+ 600
DCI01_0030_B12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCCCAGgcggaactacttctaataacccg
AMP01_0040_H10.b : ACCAC*CCCTGTTTTGTCTGATCAATAATAATCACAGCCcgtactaacttctactatccc
AMP01_0004_F11.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACAACTTCTACTATCCCTG
MLTL1_0100_H06.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0010_D12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0020_C03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0071_G06.b : AACAC*CGCTGTAT*GTCTGATCAATACTAGTCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0106_B10.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0031_D07.b : AACAC*CCCTGGTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0046_F06.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCCCAGCCGTACTACTTCTACTATCCCTG
AMP01_0038_C03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0020_D05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0093_E01.b : AACAC*CCCTGTTTTGCCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0084_H01.b : AA*AC*CCCTGTTT*GTCTGATTAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0045_D04.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0108_D05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0101_E02.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0099_F07.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0013_A04.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0015_H08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCCT
AMP01_0068_F06.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0006_A12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0061_D03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0027_A04.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTANTCCTG
MLTL1_0030_D12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0037_H11.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0040_E07.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTGCTATCCCTG
DCI01_0044_C08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0015_D02.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0078_C04.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0036_G05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0009_H05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0029_H08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0070_H11.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0072_D09.b : NNACA*CCCTGTT**GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0014_H07.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0108_G06.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0030_B01.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0054_F06.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0012_A08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0040_A08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
BKFL1_0027_C05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0068_F07.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0066_A04.b : AACAC*CCCTGTTTTGTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0091_A11.b : AACAC*CCCTGCTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0077_D05.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0117_A08.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0075_B10.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0034_B12.b : AACAT*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
MLTL1_0015_F03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0016_F11.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCCT
MLTL1_0082_H09.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0004_D12.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0069_D10.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0088_G03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
BFLT1_0028_G03.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
AMP01_0094_F02.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0069_B01.b : AACAC*CCCTGTTT*GTCTGATCAGTACTAATCACAGCCGTACTACTTCTACTATCCCTG
DCI01_0109_H01.b</