
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000130

Length: 1,214

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Homo sapiens]. 556e-158O
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Homo sapiens]. 556e-158O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100505031PREDICTED: 40S ribosomal protein SA-like [Mus musculus]. 555e-158O
Contig/Assembly ProteinRpsa40S ribosomal protein SA [Mus musculus]. 555e-158O
Contig/Assembly ProteinLOC636901PREDICTED: 40S ribosomal protein SA-like isoform 1 [Mus musculus]. 527e-150O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 14 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 12 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 1 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 2 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC610641PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 1 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 13 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 9 [Canis familiaris]. 551e-157O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 11 [Canis familiaris]. 549e-156O
Contig/Assembly ProteinLOC612908PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 4 [Canis familiaris]. 543e-154O
Contig/Assembly ProteinLOC612908PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 5 [Canis familiaris]. 543e-154O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Bos taurus]. 555e-158O
Contig/Assembly ProteinLOC100337475PREDICTED: ribosomal protein SA-like [Bos taurus]. 2702e-72O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Sus scrofa]. 561e-160O

Assembly Members: 404      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
HTMT10097E03HTMT1_0097_E03.bFS671074 AK392740
ITT010076E06ITT01_0076_E06.bBW982772 AK398868
MLN010020C05MLN01_0020_C05.bCJ009136 AK394403
MLN010038G04MLN01_0038_G04.bCJ010643 AK398981
MLN010072E07MLN01_0072_E07.bCJ013386 AK398991
SKNB10078B02SKNB1_0078_B02.bDB804736 AK400937
UTR010051G01UTR01_0051_G01.bBP464399 AK240295
UTR010103E09UTR01_0103_E09.bCJ039427 AK398723


SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000130 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
MLN01_0038_G04.b :
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b :
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b :
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b :
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BKFL1_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_G04.b :
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b :
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b :
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b :
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : .....................................................TCTTAGA
---------+---------+---------+---------+---------+---------+ 7
BKFL1_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaTCTTAGA
MLN01_0038_G04.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b : nccgatacatacagccgataca
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b : ngggacatatatagggatatct
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b : naaaagtaatcttx
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 67
MLN01_0038_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACGCAGCTAGCTGCGAGAATTAATGTGA
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b : ggca
SPLT1_0079_D03.b :
MLN01_0020_C05.b : nnngcatat
SPL01_0020_D07.b : t
SMG01_0004_B12.b :
UTR01_0099_H10.b : nnn
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b : t
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b : tttggg
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b : nnnggctaggactataacx
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b : tttt
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b : ttcgatgngttta
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b : nnnnn
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b : g
ILNT1_0006_E04.b :
THY01_0097_F09.b : g
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b : ggggtgaacat
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b : nnnnggctaggactatgacxxxxxxxxxx
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b : nnnncc
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b : cg
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b : ggct
OVR01_0080_G09.b : aatttttct
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b : tttttt
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b : nn
LNG01_0086_F09.b : nnnn
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b : ttgggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b : ttgggtt
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b : nnna
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b : nnnnaagctagtaatatnacxxxx
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b : nnnttggc
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b : nnn
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 127
THY01_0032_H07.b : taggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0015_C02.b : nnnttaagatggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_D06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0063_A08.b : tttgggntgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0079_D03.b : nnnccgcggttagaggccxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_C05.b : nnnnttcgctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_D07.b : gggggcactattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
UTR01_0099_H10.b : ttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0072_D05.b : nnnggagagtacgaggccgtaxxxxxxxxxxxxxxxxx
ITT01_0095_D01.b : ngatatacaxxxxxxxxxxxxxxxxxxxxx
UTR01_0076_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0078_B02.b :
ITT01_0038_F12.b : naaaatgxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0003_B04.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_E06.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxx
ITT01_0004_G08.b : nnggataaacaxxxxxxxxxxxxxxxxxxxxx
CLNT1_0003_E04.b : ggacccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0107_H12.b : naaagatcaacaxxxxxxxxxxxxxxxxxxxx
UTR01_0051_G01.b : gctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0086_A08.b : nnnggagctagtagacgccntaxxxxxxxxxxxxxxxxx
OVRT1_0076_B11.b : naattccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_E07.b : ngggttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0058_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0069_H03.b :
UTR01_0018_A04.b : tggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_G07.b : tgggatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_D02.b : ngggtcctttnnnnggagtaagcagcxxxxxxxxxxxxxxx
PBL01_0050_C04.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_E09.b : nnggataggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_E01.b : ttatgactaacaxxxxxxxxxxxxxxxxxxxx
UTR01_0047_B07.b : ggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0029_E04.b : nnngatgaacaxxxxxxxxxxxxxxxx
ITT01_0024_H10.b : nnnaagatgaacaxxxxxxxxxxxxxxxxxxxxxx
MLN01_0026_F01.b : nnngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_G11.b : tagcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_D11.b : ngaatccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_D04.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_B12.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0075_D08.b : xxxxxxxxxxxxxxxx
TES01_0112_C07.b :
LVRM1_0032_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_E02.b : ttttggacggtacgaggxxxxxxxxxxxxxxxxx
SMG01_0041_G12.b : tttattcgactxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_A09.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_A01.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxx
CBLT1_0067_E04.b : tttttagacagtagaggxxxxxxxxxxxxxxxxxx
CBLT1_0088_D12.b : ttttgcgaggtacgaggxxxxxxxxxxxxxxxxxx
CBLT1_0068_C09.b : ncccttttnnnnnccgacagtagaggxxxxxxxxxxxxxxxxx
SPLT1_0064_E04.b : nntttttttnnnggacggtagaggcagtagtattaaxxxxx
PBL01_0007_E02.b : agtgccnttcagatacagcagctggaxxxxxxxxxx
UTR01_0088_G09.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0030_H02.b : nnntttgacagtagacxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0029_G06.b : nnnngggcgagtagacxxxxxxxxxxxxxxxxxxx
ILNT1_0031_D09.b : nnnccgaggtacgaggcagtagtattaaxxxxxxx
HTMT1_0021_F07.b : ttttggacagtagaggccgtaxxxxxxxxxxxxxx
OVRT1_0116_C08.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0097_E07.b : nnnnaagcaggacacgxxxxxxxxxxxxxxxxxxx
MLN01_0011_G06.b : nnntttgtggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_E09.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0006_E04.b : ttttnggcgagtagaxxxxxxxxxxxxxxxxxxxxx
THY01_0097_F09.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0081_B06.b : nnnggggcagtagacgxxxxxxxxxxxxxxxxxxx
ILNT1_0087_D09.b : nnnngggcagtagacgccgtaxxxxxxxxxxxxxx
HTMT1_0062_H01.b : ttttaggacggtacgacgccgtaxxxxxxxxxxxxxx
MLN01_0096_A01.b : tttttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0073_B04.b : nnnggtgaagcagcggtxxxxxxxxxx
BMWN1_0088_D04.b : ttttccgacggtagaxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_H05.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxx
CBLT1_0092_F05.b : ttggacgtgagaggxxxxxxxxxxxxxxxxxxx
UTR01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_C03.b : nggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0022_F02.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
CLNT1_0035_A07.b : nnnnccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0069_E12.b : naagatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0021_B08.b : nnggatgaacaxxxxxxxxxxxxxxxxxxx
LNG01_0080_F01.b : nnttttgatggacttgnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0040_B07.b : nnnaagagagtagcggccgtxxxxxxxxxxxxxxx
ITT01_0052_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
SMG01_0026_G04.b : nnggcttttnnnnnnagacgtaacagcxxxxxxxxxx
MLN01_0044_G04.b : nnnggctagtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_E11.b : nnnnggatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0107_C10.b : ctttcgggntgatggacttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_E01.b : nnngggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0027_D03.b : nnnaacgcaggagaggccgtaxxxxxxxxxxxx
PTG01_0104_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0016_E01.b : nnggaaaagtagaggccgtaxxxxxxxxxxxxx
SMG01_0096_G03.b : nggccttttnnntttgagtxxxxxxxxxxxxxxxxxxxxxx
PBL01_0014_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0100_C01.b : ttttccgagagtagacgxxxxxxxxxxxxxxxx
UTR01_0011_D01.b : atttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0095_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0098_F10.b : nnnttgcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_A06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_H08.b : attagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_F09.b : ggtgcactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_D04.b : ggggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_G07.b : ttttacgaggtgagacgxxxxxxxxxxxxxxxx
UTR01_0019_B01.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_G11.b : gtgattagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0104_B10.b : nnnnccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0101_A06.b : nnggagcttttnnnnggatcaagcagcxxxxxxxxxxxxxxx
UTR01_0017_G10.b : gggttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_G11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_F05.b : gggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0105_D05.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B12.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0064_G10.b : ntttaggatggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_D12.b : nttttcgttcagcgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0097_E03.b : tttgatagtacgacgccgtaxxxxxxxxxxxxx
ITT01_0101_E02.b : nnttgatgaacxxxxxxxxxxxxxxxxxxx
BMWN1_0050_C02.b : nngggcgagagaacgaggxxxxxxxxxxxxxxxxxxx
UTR01_0034_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0070_E03.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0065_D04.b : agtgcttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0078_G06.b : cggcacttnnnnggacgtaagcagcxxxxxxxxxxxxxxx
SMG01_0052_C11.b : nccgcttntnttnggagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_B04.b : tttggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_G11.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_E09.b : cattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G12.b : nnttggcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G04.b : nnnaagcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0052_F11.b : nnggggacggtaagaggxxxxxxxxxxxxxxxxxx
SPL01_0043_G10.b : nntttgctaggaatatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0014_E05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0091_B08.b : nnnnggcttggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_H08.b : nnnggcgcggtacgaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_H10.b : gggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0026_H10.b : ttgggtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0054_F08.b : ttttaggcagagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_D05.b : nnnggatgaagcagcxxxxxxxxxxxxxxx
CLNT1_0127_D10.b : ngggctttnnnngnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_A08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0064_H04.b : naatgaaacaxxxxxxxxxxxxxxxxxxx
BMWN1_0049_D11.b : nnnaaagcaggtacacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_F05.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_B03.b : ttnnnnnnnggcttggtctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0036_H06.b : nnnaaacgacggtagaggccgtaxxxxxxxxxxxxx
ITT01_0001_C11.b : nnnnggagxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_F06.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
SPL01_0005_A04.b : cttatacgtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0055_B12.b : nnnggagtaacaxxxxxxxxxxxxxxxxxx
ITT01_0001_C10.b : nnnnggataaacaxxxxxxxxxxxxxxxxxx
CLNT1_0049_H02.b : nnnttgtatttnnnngnanccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0057_C08.b : nnngggttnn
ITT01_0063_F12.b : ntttagtgxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0055_E07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ILNT1_0021_D12.b : nnnccgacagtagaggccgtaxxxxxxxxxxxxx
MLN01_0004_F07.b : ccccnttcagtggctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0097_D08.b : nnnnggagtaacaxxxxxxxxxxxxxxxxx
THY01_0063_E03.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_C05.b : nnggtgaaacaxxxxxxxxxxxxxxxxxx
ITT01_0099_G02.b : gatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0064_C09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxx
ITT01_0066_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0071_C09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0030_B03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0053_E05.b : nnngggtgaacaxxxxxxxxxxxxxxxxxx
ITT01_0011_D05.b : ngggtgaacaxxxxxxxxxxxxxxxxxx
MLN01_0022_H07.b : ntttgtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_E12.b : nnnntgagtaacaxxxxxxxxxxxxxxxxxxx
ITT01_0020_E06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0041_G11.b : nnggatgaacaxxxxxxxxxxxxxxxxxx
UTR01_0084_B08.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_D01.b : nnnaagataaacaxxxxxxxxxxxxxxxxx
ITT01_0011_G05.b : nnnggtgtaacaxxxxxxxxxxxxxxxxxx
MLN01_0062_D07.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0063_A02.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0035_A03.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_G07.b : nnnnnttgataaacaxxxxxxxxxxxxxxxxx
ITT01_0063_H12.b : nnnaagatxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_F05.b : nnggattaacaxxxxxxxxxxxxxxxxx
MLN01_0078_B06.b : nnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_D05.b : nnnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0042_F11.b : aatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0075_F09.b : nnnnngggctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0094_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0021_A10.b : ggaatactttagctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_D07.b : ngggaccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_G05.b : nnntttcgtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0051_F09.b : nnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_H07.b : nntttgctaggacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0084_D04.b : nnnnnggatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0076_G02.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0090_G01.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_F04.b : nnggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_A06.b : nnnngggttgtgacttaacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_C11.b : nnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_E10.b : ngcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_F08.b : ntttcggggcattgtacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_H07.b : nnggttgataggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_E09.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0110_C09.b : nnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0092_A02.b : tttttggctggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0086_G04.b : nnnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0013_F06.b : nnncctaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0015_C11.b : tattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0080_G09.b : tttgctggggatttggacataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_F08.b : tttgcxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0003_C03.b : nnnnggttttnnnnttatgacxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_F10.b :
SMG01_0039_E04.b : nnnggggttctnnnnntgagtaagcagcggnaxxxxxxxxx
SKNB1_0003_A03.b :
MLN01_0081_H03.b : atcttttttnggcaatggatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0001_C03.b :
OVRM1_0168_B11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0009_H09.b : nnnnngatgaacaxxxxxxxxxxxxxxxxx
MLN01_0090_C12.b : tgcttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_H12.b : attttagaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0002_C01.b : gtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0052_D11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_E04.b : tgggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_E06.b : gggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_E08.b : gggggacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0015_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0044_A09.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_A01.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_B03.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_C07.b : tggtggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_A11.b : tgggtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B11.b : nttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_H06.b : gtggataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_D07.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0017_E12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0092_D07.b : ngttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_D12.b : nnnggttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_F09.b : ttcttgtnnnnggattggacttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_B05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_B07.b : ggggtgcacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_C01.b : gggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_F02.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0091_H04.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_G12.b : nnggccttttnttaatgatcaagcagcxxxxxxxxxxxxxxx
SKNB1_0056_H02.b : nnncc
SMG01_0057_H08.b : nggttttnnnnntagataaagcagcggtaxxxxxxxxxx
BFLT1_0022_C04.b : ggactacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_A07.b : ggggtttggaacgactatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_B11.b : taggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_D10.b : ctttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_F03.b : ttgtnggcatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0021_B01.b : nnaactattnnnnnagataaagcagcggtaxxxxxxxxx
UTR01_0055_G10.b : cctttttgtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_F09.b : ctttatgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0035_E05.b : ggggaacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0109_C04.b : nncccacttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0067_E02.b :
OVRT1_0098_C08.b : nnnnnccttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_H11.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_A11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0065_F12.b :
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0001_G12.b : nnnntagcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_C05.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_G02.b : catttggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0047_D12.b : ttagttgcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0050_D05.b : nnnggataaacaxxxxxxxxxxxxxxxxxx
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b : catttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0002_C04.b : nnnaacatcannnnnnggagacagcagcxxxxxxxxxxxxxx
MLN01_0012_H12.b : nnnnttttgctggaccttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b : ggacacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b : nnnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0081_E02.b :
MLN01_0020_A12.b : nnncccgctggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b : gattttataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0079_D05.b : cttttccgacggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b : nnnttggctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0094_A07.b :
LNG01_0062_H03.b : aaaatttttcggggcatgtacatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0074_A08.b :
ITT01_0070_B05.b : nnggatcaacaxxxxxxxxxxxxxxxxxx
SPL01_0099_B10.b : nntttgataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B06.b : nnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0056_F05.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0079_G12.b : naaagatgaacaxxxxxxxxxxxxxxxx
MLN01_0096_B01.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0038_C11.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxx
SKNB1_0070_C05.b : nnnnggg
PBL01_0067_A12.b : nnaagataaacaxxxxxxxxxxxxxxxxx
ITT01_0011_A01.b : naagatgaacaxxxxxxxxxxxxxxxxx
LNG01_0072_C05.b : nnnngggctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_D10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
MLN01_0103_A03.b : ttttngctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0096_B08.b : nnttttgctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0063_E09.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_F04.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_F07.b : nnggatgaacaxxxxxxxxxxxxxxxxx
LNG01_0102_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_B01.b : nntttacgtcagcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0039_F04.b : nnnggtgaaacaxxxxxxxxxxxxxxxxx
ITT01_0093_F06.b : ntatgatacaxxxxxxxxxxxxxxxxx
ITT01_0049_E06.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0083_A07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
PBL01_0066_H03.b : nnnnggagtaacaxxxxxxxxxxxxxxxx
ITT01_0029_D07.b : nnggatgaacaxxxxxxxxxxxxxxxxx
ITT01_0006_E02.b : nnttgatgaacaxxxxxxxxxxxxxxxxxx
MLN01_0096_F12.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0068_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0062_A04.b : nnnnggtgatacaxxxxxxxxxxxxxxxxxx
ITT01_0064_G01.b : nnnggtgaaacaxxxxxxxxxxxxxxxxx
PBL01_0067_D02.b : nnnggatacacaxxxxxxxxxxxxxxxxx
ITT01_0038_G12.b : nnaagataaacaxxxxxxxxxxxxxxxx
MLN01_0072_C03.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0043_B09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0098_G07.b : nnnggatacacaxxxxxxxxxxxxxxxxx
ITT01_0095_B02.b : nggatgaacaxxxxxxxxxxxxxxxxx
UTR01_0098_D05.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0015_A03.b : nngggataaacxxxxxxxxxxxxxxxxxx
ITT01_0002_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0069_C12.b : nnggtcaaacaxxxxxxxxxxxxxxxxx
LNG01_0075_D06.b : ttttnnggttggtacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0065_H05.b : ntttgatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0073_G08.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
ITT01_0060_C07.b : nnnggtgxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B05.b : nnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_H05.b : nnnngatgaacaxxxxxxxxxxxxxxxxx
LNG01_0072_D02.b : nnnnnggctgtacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_E02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0030_E05.b : nnnnccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0038_H02.b : nnggggcttttnnnnngggtcxxxxxxxxxxxxxxxxxxxx
MLN01_0027_C06.b : nnggcttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0008_B10.b : nnnnttaatggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_F09.b : ngctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0005_A01.b : nntttaggcatggactatgacagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_C06.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_B02.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_C04.b : ngctgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_E03.b : nnnggcttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_H09.b : nnnnggcatggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_B02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_F08.b : ntttnnggttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_A06.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_A07.b : ngggcttttnnngggaaccctcagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_H01.b : nttttttgattgtacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_E05.b : ngggtaggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_A07.b : nccggttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0029_B12.b : nnttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0081_G11.b : nnnnaagctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_A04.b : nntttagctggtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_C06.b : ggggaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_C05.b : tggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0036_G07.b : ggggtgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_E09.b : ggggggaaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0032_E03.b : nnccctaggnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0028_F07.b :
CBLT1_0030_E10.b : ttttacgagagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b : nnggatgaacaxxxxxxxxxxxxxxxx
ITT01_0071_A09.b : nnnggagtaacaxxxxxxxxxxxxxxxx
SKNB1_0051_F08.b : nnnnnttaacgctggctctgggaaaaaa
UTR01_0007_A05.b : ctttttgatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0077_A11.b :
ITT01_0090_F05.b : nnnggataaacaxxxxxxxxxx
ITT01_0048_A08.b : nnnggatgaacaxxxxxxxxxxxxxxx
SKNB1_0029_A11.b : nnggc
LNG01_0104_C10.b : nnttttgctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0092_B11.b : nnnggatgaacaxxxxxxxxxxxxx
TCH01_0011_A05.b : nnnnggctaggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0094_A03.b : ttttggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0094_C01.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0010_A12.b : nnnnggcgagtagaggccgtaxxxxxxxxxx
OVRM1_0043_G05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_E11.b : nnggtttnnnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0059_D09.b : nnnggctaggacttanacagtttgtcacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0081_G08.b : nnnggttcttnnnnnnnacgtcgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_F07.b : nngggctttttcgncgattggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_D10.b : ttaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxx
UTR01_0035_B08.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0016_D04.b : nnnggatacacax
PBL01_0085_C09.b : nnnggtg
SPL01_0103_A08.b : nnnnggctagtac
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 183
BKFL1_0078_G06.b : GGGCTACGCCTGTCTGAGCGTCGCT*Catgaaaaatggacataactgtttcctaagacat
THY01_0032_H07.b : xxxxxxxxxxxxxxxxxxxxtCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0015_C02.b : xxxxxxxxxxxxxxxxxxxxxCTTTCCTTTCCGCG*CTGCCCATA*CCGGG*G*TTCACA
ITT01_0084_D06.b : xxxxxxxxxxxxxxxxxxxxxCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0063_A08.b : xxxxxxxxxxxxxxxxxxtggCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0020_C05.b : xxxxxxxxxxxxxxxxxxxtaCTGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0020_D07.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATG
SMG01_0004_B12.b : xxxxxxxxxxxxxxxxxxxxxcTTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0099_H10.b : xxxxxxxxxxxxxxxxxxxcttTTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0072_D05.b : xxxxxxxxxxxxxxxxxxxxxgCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0095_D01.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0076_C12.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0078_B02.b : naaacctaacgtggcacggcCTTTCTTTCCGCG*CTGCC*AGA*CCGGG*G*TCCAC*
ITT01_0038_F12.b : xxxxxxxxxxxxxxxxxxxxxcCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0003_B04.b : xxxxxxxxxxxxxxxxxxxxxxTGGCTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0076_E06.b : xxxxxxxxxxxxxxxxxxxxxcTGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0004_G08.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0003_E04.b : xxxxxxxxxxxxxxxxxxxxxtCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0107_H12.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0051_G01.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0086_A08.b : xxxxxxxxxxxxxxxxxxxxxgCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
OVRT1_0076_B11.b : xxxxxxxxxxxxxxxxxxxcatTGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_E07.b : xxxxxxxxxxxxxxxxxxxgctTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0058_G02.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
TES01_0069_H03.b : ntttactgcggttgctatGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0018_A04.b : xxxxxxxxxxxxxxxxxxxxxxcTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0039_G07.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0076_D02.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0050_C04.b : xxxxxxxxxxxxxxxxxxxxxxgGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0103_E09.b : xxxxxxxxxxxxxxxxxxxxxxxGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0047_B07.b : xxxxxxxxxxxxxxxxxxxctggGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0029_E04.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0024_H10.b : xxxxxxxxxxxxxxxxxxxxxxcTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0026_F01.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCGTA
THY01_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0066_D11.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0071_D04.b : xxxxxxxxxxxxxxxxxxxxxxxGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0069_B12.b : xxxxxxxxxxxxxxxxxxxxxxcTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0075_D08.b : xxxxxxxxxxxxxxxxcctgtactGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0112_C07.b : ttctgcagtggctctgGCCTTTC*GCG*CTGCCCAGA*CCGGG*G*TCC*CA
LVRM1_0032_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0081_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0041_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0041_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0024_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0014_D11.b : xxxxxxxxxxxxxxxxxxxxxxtcCTTTTTCCGCGCCTGCCCAGAACCGGG*G*TCCATA
CBLT1_0067_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0088_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0068_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0064_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCCTC*CA**CAAAGACCGGG*G*TCCACA
PBL01_0007_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0030_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0029_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxgCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
HTMT1_0021_F07.b : xxxxxxxxxxxxxxxxxxxxxxxtGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
OVRT1_0116_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0097_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCACA*CCGGG*G*TCCACA
MLN01_0011_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0048_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0006_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0097_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0081_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0087_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
HTMT1_0062_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0096_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0073_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0088_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0065_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxgCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0098_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0035_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0069_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0021_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0080_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPLT1_0040_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0052_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0026_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0044_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0108_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
LNG01_0107_C10.b : xxxxxxxxxxxxxxxxxxxxxxggTCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0066_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0027_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PTG01_0104_H02.b : nnnnnnnnnnnnnnnnnxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*GNTCCATA
SPLT1_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGTCCAGA*CCGGG*G*TCCATA
SMG01_0096_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0014_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0100_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0011_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0095_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnCCTTTCCCCG*CTGCCCAGA*CCGGGNGNTCCATA
UTR01_0098_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0025_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0023_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0026_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0028_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0063_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0087_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0104_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0101_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0038_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0020_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0105_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0090_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0064_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0134_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
HTMT1_0097_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxcCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0050_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0065_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0052_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0076_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVRT1_0151_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0060_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0087_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0087_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0052_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0043_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0014_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0091_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPLT1_0050_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0026_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0054_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0008_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0127_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0093_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0064_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0049_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0082_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0036_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0001_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0064_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0008_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0055_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0001_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0049_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxaGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0057_C08.b : nntnnaatacgtttgcacggcttgtGCTTTCCGCG*CTGCCCGA**CCGGG*G*TCCATA
ITT01_0063_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0055_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0021_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0004_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0097_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
THY01_0063_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0053_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0064_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0066_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0071_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0030_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0053_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0011_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCTGA*CCGGG*G*TCCATA
MLN01_0022_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0076_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0020_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0041_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0084_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0011_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0062_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0063_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ADR01_0078_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0063_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0065_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0078_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0099_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0042_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0075_F09.b : xxxxxxxxxxxxxxxxxxxxxxxacGCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ADR01_0094_C06.b : nnxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0021_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0007_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0089_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
MLN01_0051_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0033_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0076_G02.b : xxxxxxxxxxxxxxxxxxxxxxxctGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0090_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0030_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0038_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0080_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0063_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0039_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0066_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0110_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0092_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0086_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0013_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0015_C11.b : xxxxxxxxxxxxxxxxxxaaaaaaaCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVR01_0080_G09.b : xxxxxxxxxxxxxxxxxxxxxxxactGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
THY01_0109_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCCTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0003_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0070_F10.b : tttccacgttggctctgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCATA
SMG01_0039_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0003_A03.b : nnnnnnaaaactcacggtggcccggCCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCAC*
MLN01_0081_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0001_C03.b : tttttacacacagtggccacgGCTTTCGCG*CTGC*CAGA*CCGGG*G*TC*ACA
OVRM1_0168_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ADR01_0009_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0090_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0008_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0002_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0052_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0013_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0012_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0010_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0015_E05.b : nnnnnnnnnnnnnnnnxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0044_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0026_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0024_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0024_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0015_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0011_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0017_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0092_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0033_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0086_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0041_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0016_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0020_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0091_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0035_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0056_H02.b : gtgtnnnnntaatacacgtttgcatgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
SMG01_0057_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0087_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0055_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0083_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0047_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0091_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SMG01_0021_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0055_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0035_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0109_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SKNB1_0067_E02.b : nntttcacacgtggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCC*TA
OVRT1_0098_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0083_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
UTR01_0048_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0065_F12.b : ttttttcctgcagttgctatgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0071_F07.b : nnnnnnnnnnnnnnnnnnxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0001_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0107_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0048_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0047_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0050_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0086_B12.b : nnncctgaggttgctctgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TC*ATA
SKNB1_0046_B11.b : nnnnttagcggtggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCC*TA
THY01_0064_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0002_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0012_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PST01_0045_F05.b : nnggtgacgttggcactgGCTTTCGCG*CTGCCCAGG*CCGGG*G*TCC*TA
SKNB1_0098_H10.b : aagggtggctatgGCTTTCGCG*CTGCCCGA**CCGGG*G*TCC*TA
CLNT1_0002_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0098_B05.b : nnnccgactgttgctctgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TCCACA
KDN01_0056_G06.b : nnttggcgttggctctgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
OVRT1_0023_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0081_E02.b : ncctacgttggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCATA
MLN01_0020_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
KDN01_0078_H04.b : ttttactgcagtggctatgGCTTCCGCG*CTGC*CAGA*CCGGG*G*TC*ATA
KDN01_0093_G07.b : nnnncctgcgttggctatgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCC*TA
LNG01_0042_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
LNG01_0079_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0093_E11.b : nnnncctgcgtttgctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCAC*
SKNB1_0052_E04.b : aaaantcaactgtggctgGCTTTCGCG*C*GCCCAGA*CCGGG*G*TCC*TA
KDN01_0034_B09.b : ttttttgctgcggtggctatggCCTTTCGCG*CTGCC*AGA*CCGGG*G*TCC*TA
LNG01_0084_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
PST01_0094_A07.b : nntttcctactgttgctatggCCTTTCGCG*CTGCCCAGA*CCGGG*G*TCC*TA
LNG01_0062_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxaCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SKNB1_0074_A08.b : nnnnnctgactgtggctacgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TC*ATA
ITT01_0070_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0099_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
TCH01_0056_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0079_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0096_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0038_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0070_C05.b : ggtttnnnnnnnccaccgtggctatgGCTTTCGCG*CTGCCCG**ACCGGG*G*TCC*CA
PBL01_0067_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0011_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0072_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0088_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0103_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0096_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
TCH01_0063_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPL01_0048_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0071_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0102_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCGCCTGCCAAGACCGGGG*G*TCCATA
OVRT1_0061_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0093_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0049_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0083_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0066_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0029_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCATA*CCGGG*G*TCCACA
MLN01_0096_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGG*CCGGG*G*TCCATA
ITT01_0062_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
ITT01_0064_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0067_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0038_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0043_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0098_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0095_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0098_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCTGA*CCGGG*G*TCCACA
ITT01_0002_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0069_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0075_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxaCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0065_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0073_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0060_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0035_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0072_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVRT1_0098_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0030_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0038_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0027_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0008_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0081_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0005_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0038_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0042_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0080_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0089_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0072_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0097_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0109_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0081_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0015_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0063_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0049_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0029_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0081_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0019_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0014_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0036_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCACG*CTGCCCAGACCGGGG*A*TCCATA
UTR01_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0032_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0028_F07.b : nnnnggtcactgtggctgctCTTTCGCG*CTGCCCGA**CCGGG*G*TCC*CA
CBLT1_0030_E10.b : xxxxxxxxxxxgtccgcttacccctttTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
KDN01_0017_A12.b : ttttnnnnaactacgttggctctggcTTTTCCCG*CTGCC*AGA*CCGGG*G*TCCATA
PST01_0010_C01.b : tatttntnnncctgcgttggctacggcTTTTTTCC*CGCTGCCCGACCGGG*G*TCC*TA
ITT01_0069_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0071_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0051_F08.b : aaaaaaaaaaaaaaaaaaaaaacttttTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0007_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0077_A11.b : nnnnnttagctgtggctctgggTTTCGCG*CTGCCC*GA*CCGGG*A*TC*ATA
ITT01_0090_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0048_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0029_A11.b : tcnnnnnnnnccttacgttgtgcactggTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
LNG01_0104_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
PBL01_0092_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0011_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
TCH01_0094_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVR01_0094_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0010_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
OVRM1_0043_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0096_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPL01_0059_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0081_G08.b : xxxxxxxxxxxxxxxxxxxatcgttcagtgCCGCG*CTGNNNAGA*NCGGG*G*NCCATA
LNG01_0063_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0060_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0035_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0016_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA*CCGGG*G*TCCCTA
PBL01_0085_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGG*G*TCCATA
SPL01_0103_A08.b : ttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0097_D11.b : ncccttattnnnnngggatcaagcagcggnaxxxxxx
ITT01_0029_E12.b : nnnggtgaagcagcx
MLN01_0045_B01.b : nnnn
UTR01_0050_D08.b : catxxxx
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : nnnnnnnnnnnnnnnnnnnnnnnntttgtccacgctgcccccactggaggtcctcacaga
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 242
BKFL1_0078_G06.b : gcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0097_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0029_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCACAATGTCCGGAGCC
MLN01_0045_B01.b : nggcatgtactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_H07.b : tgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : aggtgttcttgagtcccatctgtcccttggaaggagacgcttcctcctgggagggccacg
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 301
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxtgGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0041_C07.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_E04.b : gxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : tgtatggcctgcacatgaacagacgaagatggcctcacagttccttgcatgaggagccca
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 359
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0041_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACATCTACAAAAGGAAAAGT
UTR01_0023_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
SKNB1_0100_D11.b :
SPL01_0026_D12.b : gctttttgggtggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_A12.b : nnntggctaggactatgacagtttgtacxxxxxx
ITT01_0085_F07.b : ccgttgatcggcacccatcttgacttccaaatgacacagtagtgctccccccggataagt
UTR01_0025_H04.b : gggtggacxxxxxxxxxx
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 419
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0100_D11.b : nnnncctcacgctggctcggctgagagacctgggagAACTTCTGTTGGCGGCTCGT
SPL01_0026_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTTGGCGGCTCGT
MLN01_0062_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTTGGCGGCTCGT
ITT01_0085_F07.b : gatggcctctacatggcaaatcgtatgagaagctgttagagtcttcgggtggctgaTCGT
UTR01_0025_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0061_H10.b : aattccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 478
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0032_B11.b :
---------+---------+---------+---------+---------+---------+ 537
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0032_B11.b : ttttttcgagagt
---------+---------+---------+---------+---------+---------+ 596
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACTTCTG
---------+---------+---------+---------+---------+---------+ 654
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
---------+---------+---------+---------+---------+---------+ 713
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0080_G09.b : CGCCTACCATTGCTCctgggaaacaaactcccctctgcgttatggggaaattgcccttcc
---------+---------+---------+---------+---------+---------+ 773
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0027_D03.b : CCGgggaaaaaacaaggaagctcaatcaatggggccgaaagggttgaaggctcccccgga