[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000130

Length: 1,214

Sequence [FASTA format sequence]
TCTTAGAGGA GGATCCCTCC GCGCGAGCTT CCATAAGGAA CGCAGCTAGC TGCGAGAATT
AATGTGAATT GCAGGACACA TTGATCATCG ACACTTCGAA CGCACTTGCG GCCCCGGGTT
CCTCCCGGGG CTACGCCTGT CTGAGCGTCC TGCCTTTCCG CGCTGCCCAG ACCGGGGTCC
ATACGGCGTT GTTCTTGATT CCCGTCGTAA CTTAAAGGGA GACTTTCACA ATGTCCGGAG
CCCTCGATGT CCTGCAAATG AAAGAGGAGG ATGTCCTCAA GTTCCTTGCA GCAGGAACCC
ACCTTGGTGG CACCAACCTT GACTTCCAAA TGGAACAGTA CATCTACAAA AGGAAAAGTG
ATGGCATCTA CATCATAAAT CTGAAGAGAA CCTGGGAGAA ACTTCTGTTG GCGGCTCGTG
CCATCGTTGC CATTGAAAAC CCAGCCGATG TCAGTGTCAT ATCCTCCAGG AATACTGGCC
AGCGAGCTGT GCTGAAGTTT GCTGCTGCCA CTGGAGCCAC TCCTATTGCT GGCCGCTTCA
CTCCTGGAAC CTTCACTAAC CAGATCCAGG CAGCCTTCCG GGAGCCAAGA CTTCTGGTGG
TTACTGATCC CAGGGCTGAC CACCAGCCTC TCACAGAGGC CTCTTATGTT AACCTGCCTA
CCATTGCTCT GTGTAACACA GACTCACCTC TGCGTTATGT GGACATTGCC ATCCCGTGCA
ACAACAAGGG AGCTCACTCA GTGGGTCTGA TGTGGTGGAT GCTCGCCCGG GAAGTTCTGC
GCATGCGTGG CACCATCTCC CGGGAACACC CATGGGAAGT CATGCCTGAC CTCTACTTCT
ACAGAGATCC TGAAGAGATT GAAAAGGAAG AGCAGGCCGC AGCTGAGAAG GCTGTGACCA
AGGAGGAATT TCAGGGTGAA TGGACTGCGC CAGCTCCTGA GTTCACTGCC ACTCAACCTG
AGGTGGCAGA TTGGTCCGAA GGTGTGCAGG TGCCTTCTGT GCCCATCCAG CAATTCCCTA
CTGAAGATTG GAGTGCTCAG CCTACCACTG AAGATTGGTC TGCAGCTCCC ACTGCGCAGG
CCACTGAATG GGTAGGAACA ACCACTGAGT GGTCTTAAGT TCTTCCATGA ACTCTTATTT
TCTAAAAATA GAAGTGAGTT GGATGTAAAA TAAACATTTT CAAATTGAAA AAAAAAAAAA
AAAAAAAAAA AAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Homo sapiens]. 556e-158O
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Homo sapiens]. 556e-158O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100505031PREDICTED: 40S ribosomal protein SA-like [Mus musculus]. 555e-158O
Contig/Assembly ProteinRpsa40S ribosomal protein SA [Mus musculus]. 555e-158O
Contig/Assembly ProteinLOC636901PREDICTED: 40S ribosomal protein SA-like isoform 1 [Mus musculus]. 527e-150O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 14 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 12 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 1 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 2 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC610641PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 1 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 13 [Canis familiaris]. 559e-159O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 9 [Canis familiaris]. 551e-157O
Contig/Assembly ProteinLOC477029PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 11 [Canis familiaris]. 549e-156O
Contig/Assembly ProteinLOC612908PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 4 [Canis familiaris]. 543e-154O
Contig/Assembly ProteinLOC612908PREDICTED: similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (Colon carcinoma laminin-binding protein) (NEM/1CHD4) (Multidrug resistance-associated protein MGr1-Ag) isoform 5 [Canis familiaris]. 543e-154O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Bos taurus]. 555e-158O
Contig/Assembly ProteinLOC100337475PREDICTED: ribosomal protein SA-like [Bos taurus]. 2702e-72O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPSA40S ribosomal protein SA [Sus scrofa]. 561e-160O


Assembly Members: 404      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010009H09ADR01_0009_H09.bDB782361 
ADR010078G07ADR01_0078_G07.bDB788470 
ADR010094C06ADR01_0094_C06.bDB789839 
AMP010010B11AMP01_0010_B11.bBW955683 
AMP010055D03AMP01_0055_D03.bBW958928 
AMP010068B10AMP01_0068_B10.bBW959905 
BFLT10021A10BFLT1_0021_A10.bFS641676 
BFLT10022C04BFLT1_0022_C04.bFS641775 
BFLT10061H10BFLT1_0061_H10.bFS644881 
BFLT10066D11BFLT1_0066_D11.bFS645252 
BKFL10078G06BKFL1_0078_G06.b  
BMWN10032B11BMWN1_0032_B11.bHX207541 
BMWN10049D11BMWN1_0049_D11.bHX208525 
BMWN10050C02BMWN1_0050_C02.bHX208585 
BMWN10054F08BMWN1_0054_F08.bHX208870 
BMWN10063G07BMWN1_0063_G07.bHX209421 
BMWN10064G10BMWN1_0064_G10.bHX209489 
BMWN10081E02BMWN1_0081_E02.bHX210557 
BMWN10088D04BMWN1_0088_D04.bHX210980 
BMWN10100C01BMWN1_0100_C01.bHX211708 
CBLT10030E10CBLT1_0030_E10.bHX213932 
CBLT10067E04CBLT1_0067_E04.bHX216482 
CBLT10068C09CBLT1_0068_C09.bHX216554 
CBLT10088D12CBLT1_0088_D12.bHX218146 
CBLT10092F05CBLT1_0092_F05.bHX218491 
CLNT10002E08CLNT1_0002_E08.bFS657207 
CLNT10003E04CLNT1_0003_E04.bFS657284 
CLNT10007D07CLNT1_0007_D07.bFS657593 
CLNT10015A07CLNT1_0015_A07.bFS658226 
CLNT10030E05CLNT1_0030_E05.bFS659414 
CLNT10035A07CLNT1_0035_A07.bFS659763 
CLNT10042F11CLNT1_0042_F11.bFS660380 
CLNT10049A07CLNT1_0049_A07.bFS660897 
CLNT10049H02CLNT1_0049_H02.bFS660969 
CLNT10081G08CLNT1_0081_G08.b  
CLNT10089G05CLNT1_0089_G05.bFS663507 
CLNT10104B10CLNT1_0104_B10.bHX219436 
CLNT10105D05CLNT1_0105_D05.bHX219533 
CLNT10107C05CLNT1_0107_C05.bHX219681 
CLNT10109C04CLNT1_0109_C04.bHX219833 
CLNT10127D10CLNT1_0127_D10.bHX221221 
CLNT10134D12CLNT1_0134_D12.bHX221767 
HTMT10021F07HTMT1_0021_F07.bFS665766 
HTMT10062H01HTMT1_0062_H01.bFS668651 
HTMT10097E03HTMT1_0097_E03.bFS671074 AK392740
ILNT10006E04ILNT1_0006_E04.bHX227188 
ILNT10010A12ILNT1_0010_A12.bHX227462 
ILNT10021D12ILNT1_0021_D12.bHX228330 
ILNT10027D03ILNT1_0027_D03.bHX228795 
ILNT10031D09ILNT1_0031_D09.bHX229121 
ILNT10036H06ILNT1_0036_H06.bHX229582 
ILNT10052F11ILNT1_0052_F11.bHX230859 
ILNT10072D05ILNT1_0072_D05.bHX232485 
ILNT10081B06ILNT1_0081_B06.bHX233183 
ILNT10086A08ILNT1_0086_A08.bHX233590 
ILNT10087D09ILNT1_0087_D09.bHX233705 
ILNT10097E07ILNT1_0097_E07.bHX234483 
ITT010001C10ITT01_0001_C10.bBW976067 
ITT010001C11ITT01_0001_C11.bBW976068 
ITT010001D01ITT01_0001_D01.bBW976070 
ITT010002C05ITT01_0002_C05.bBW976156 
ITT010004G08ITT01_0004_G08.bBW976387 
ITT010006E02ITT01_0006_E02.bBW976538 
ITT010008C05ITT01_0008_C05.bBW976702 
ITT010008D05ITT01_0008_D05.bBW976714 
ITT010011A01ITT01_0011_A01.bBW976955 
ITT010011D05ITT01_0011_D05.bBW976994 
ITT010011G05ITT01_0011_G05.bBW977029 
ITT010015A03ITT01_0015_A03.bBW977316 
ITT010016D04ITT01_0016_D04.bFS671336 
ITT010020E06ITT01_0020_E06.bBW977809 
ITT010021B08ITT01_0021_B08.bBW977866 
ITT010022F02ITT01_0022_F02.bBW978001 
ITT010024H10ITT01_0024_H10.bBW978216 
ITT010029D07ITT01_0029_D07.bBW978613 
ITT010029E04ITT01_0029_E04.bBW978621 
ITT010029E12ITT01_0029_E12.bBW978629 
ITT010030B03ITT01_0030_B03.bBW978671 
ITT010033E01ITT01_0033_E01.bBW978974 
ITT010038C11ITT01_0038_C11.bBW979417 
ITT010038F12ITT01_0038_F12.bBW979452 
ITT010038G12ITT01_0038_G12.bBW979463 
ITT010039F04ITT01_0039_F04.bBW979532 
ITT010041G11ITT01_0041_G11.bBW979730 
ITT010043B09ITT01_0043_B09.bBW979850 
ITT010048A08ITT01_0048_A08.bBW980206 
ITT010049E06ITT01_0049_E06.bBW980342 
ITT010050D05ITT01_0050_D05.bBW980423 
ITT010052F06ITT01_0052_F06.bBW980630 
ITT010053E05ITT01_0053_E05.bBW980709 
ITT010055B12ITT01_0055_B12.bBW980867 
ITT010055E07ITT01_0055_E07.bBW980896 
ITT010060C07ITT01_0060_C07.bBW981324 
ITT010062A04ITT01_0062_A04.bBW981474 
ITT010063F12ITT01_0063_F12.bBW981626 
ITT010063H12ITT01_0063_H12.bBW981650 
ITT010064C09ITT01_0064_C09.bBW981681 
ITT010064F06ITT01_0064_F06.bBW981710 
ITT010064G01ITT01_0064_G01.bBW981715 
ITT010065H05ITT01_0065_H05.bBW981823 
ITT010066F06ITT01_0066_F06.bBW981894 
ITT010068F06ITT01_0068_F06.bBW982076 
ITT010069C12ITT01_0069_C12.bBW982140 
ITT010069E09ITT01_0069_E09.bBW982159 
ITT010070B05ITT01_0070_B05.bBW982209 
ITT010071A09ITT01_0071_A09.bBW982290 
ITT010071C09ITT01_0071_C09.bBW982314 
ITT010071F07ITT01_0071_F07.bBW982346 
ITT010073B04ITT01_0073_B04.bBW982471 
ITT010073G08ITT01_0073_G08.bBW982531 
ITT010076E06ITT01_0076_E06.bBW982772 AK398868
ITT010076E12ITT01_0076_E12.bBW982777 
ITT010081H05ITT01_0081_H05.bBW983241 
ITT010083A07ITT01_0083_A07.bBW983345 
ITT010084D06ITT01_0084_D06.bBW983462 
ITT010085F07ITT01_0085_F07.b  
ITT010088D10ITT01_0088_D10.bBW983815 
ITT010090F05ITT01_0090_F05.bBW984012 
ITT010093F06ITT01_0093_F06.bBW984278 
ITT010095B02ITT01_0095_B02.bBW984412 
ITT010095D01ITT01_0095_D01.bBW984434 
ITT010098C03ITT01_0098_C03.bBW984697 
ITT010098G07ITT01_0098_G07.bBW984747 
ITT010099G02ITT01_0099_G02.bBW984834 
ITT010101E02ITT01_0101_E02.bBW984993 
KDN010017A12KDN01_0017_A12.bFS672454 
KDN010034B09KDN01_0034_B09.bFS673773 
KDN010056G06KDN01_0056_G06.bFS674920 
KDN010078H04KDN01_0078_H04.bFS676677 
KDN010093G07KDN01_0093_G07.bFS677861 
LNG010003B04LNG01_0003_B04.bBP434216 
LNG010014E05LNG01_0014_E05.bBP437269 
LNG010015C11LNG01_0015_C11.bBP435791 
LNG010033F09LNG01_0033_F09.bBP438649 
LNG010042G05LNG01_0042_G05.bBP439310 
LNG010047D12LNG01_0047_D12.bBP436869 
LNG010062H03LNG01_0062_H03.bBP440160 
LNG010063F07LNG01_0063_F07.bBP438497 
LNG010063F08LNG01_0063_F08.bBP438580 
LNG010063H01LNG01_0063_H01.bBP439992 
LNG010072C05LNG01_0072_C05.bBP435322 
LNG010072D02LNG01_0072_D02.bBP436071 
LNG010075D06LNG01_0075_D06.bBP436405 
LNG010075F09LNG01_0075_F09.bBP438678 
LNG010079D05LNG01_0079_D05.bBP436329 
LNG010080F01LNG01_0080_F01.bBP438011 
LNG010081G11LNG01_0081_G11.bBP439840 
LNG010084C10LNG01_0084_C10.bBP435756 
LNG010084D04LNG01_0084_D04.bBP436254 
LNG010086F09LNG01_0086_F09.bBP438687 
LNG010087A07LNG01_0087_A07.bBP433564 
LNG010091F03LNG01_0091_F03.bBP438182 
LNG010096B08LNG01_0096_B08.bBP434618 
LNG010102A12LNG01_0102_A12.b  
LNG010104C10LNG01_0104_C10.bBP435771 
LNG010107C10LNG01_0107_C10.bBP435774 
LNG010108E11LNG01_0108_E11.bBP437856 
LNG010109F08LNG01_0109_F08.bBP438621 
LNG010110C09LNG01_0110_C09.bBP435692 
LVRM10032E12LVRM1_0032_E12.bBP139791 
MLN010001G12MLN01_0001_G12.bCJ007795 
MLN010004F07MLN01_0004_F07.bCJ008007 
MLN010005A01MLN01_0005_A01.bCJ008028 
MLN010008B10MLN01_0008_B10.bCJ008287 
MLN010011G06MLN01_0011_G06.bCJ008584 
MLN010012H12MLN01_0012_H12.bCJ008678 
MLN010013F06MLN01_0013_F06.bCJ008736 
MLN010014A04MLN01_0014_A04.bCJ008764 
MLN010014C05MLN01_0014_C05.bCJ008787 
MLN010015C02MLN01_0015_C02.b  
MLN010020A12MLN01_0020_A12.bCJ009124 
MLN010020C05MLN01_0020_C05.bCJ009136 AK394403
MLN010022H07MLN01_0022_H07.bCJ009353 
MLN010026F01MLN01_0026_F01.bCJ009661 
MLN010027C06MLN01_0027_C06.bCJ009718 
MLN010029B12MLN01_0029_B12.bCJ009864 
MLN010030F04MLN01_0030_F04.bCJ009991 
MLN010032E03MLN01_0032_E03.bCJ010135 
MLN010033D12MLN01_0033_D12.bCJ010217 
MLN010033H07MLN01_0033_H07.bCJ010254 
MLN010035B05MLN01_0035_B05.bCJ010354 
MLN010036G07MLN01_0036_G07.b  
MLN010038A06MLN01_0038_A06.bCJ010578 
MLN010038C06MLN01_0038_C06.bCJ010597 
MLN010038G04MLN01_0038_G04.bCJ010643 AK398981
MLN010039H07MLN01_0039_H07.bCJ010742 
MLN010042B02MLN01_0042_B02.bCJ010931 
MLN010044G04MLN01_0044_G04.bCJ011142 
MLN010045B01MLN01_0045_B01.bCJ011167 
MLN010051F09MLN01_0051_F09.bCJ011632 
MLN010058G02MLN01_0058_G02.bBW963647 
MLN010060D10MLN01_0060_D10.bBW963659 
MLN010062A12MLN01_0062_A12.bCJ012483 
MLN010062D07MLN01_0062_D07.bCJ012510 
MLN010063A02MLN01_0063_A02.bCJ012563 
MLN010065D04MLN01_0065_D04.bCJ012762 
MLN010066E01MLN01_0066_E01.bCJ012861 
MLN010066E09MLN01_0066_E09.bCJ012866 
MLN010069B12MLN01_0069_B12.bCJ013095 
MLN010071D04MLN01_0071_D04.bCJ013285 
MLN010072C03MLN01_0072_C03.bCJ013361 
MLN010072C11MLN01_0072_C11.bCJ013369 
MLN010072E07MLN01_0072_E07.bCJ013386 AK398991
MLN010072H09MLN01_0072_H09.bCJ013420 
MLN010075D08MLN01_0075_D08.b  
MLN010078B06MLN01_0078_B06.bCJ013808 
MLN010080C04MLN01_0080_C04.bCJ013993 
MLN010080E10MLN01_0080_E10.bCJ014020 
MLN010081A06MLN01_0081_A06.bCJ014059 
MLN010081E05MLN01_0081_E05.bCJ014098 
MLN010081F09MLN01_0081_F09.bCJ014112 
MLN010081H03MLN01_0081_H03.bBW963796 
MLN010083B11MLN01_0083_B11.bCJ014246 
MLN010087G11MLN01_0087_G11.bCJ014639 
MLN010090C12MLN01_0090_C12.bCJ014837 
MLN010090G01MLN01_0090_G01.bCJ014870 
MLN010092A02MLN01_0092_A02.bCJ014979 
MLN010092D07MLN01_0092_D07.bCJ015018 
MLN010093A08MLN01_0093_A08.bCJ015077 
MLN010096A01MLN01_0096_A01.bCJ015336 
MLN010096B01MLN01_0096_B01.bBW963874 
MLN010096F12MLN01_0096_F12.bCJ015382 
MLN010097B02MLN01_0097_B02.bCJ015415 
MLN010103A03MLN01_0103_A03.bCJ015940 
OVR010080G09OVR01_0080_G09.b  
OVR010094C01OVR01_0094_C01.bBW967677 
OVRM10043G05OVRM1_0043_G05.bBP460736 
OVRM10168B11OVRM1_0168_B11.bBP456405 
OVRT10023B10OVRT1_0023_B10.bFS688261 
OVRT10061B01OVRT1_0061_B01.bFS691366 
OVRT10076B11OVRT1_0076_B11.bFS692581 
OVRT10098C08OVRT1_0098_C08.bFS694393 
OVRT10098E02OVRT1_0098_E02.bFS694409 
OVRT10116C08OVRT1_0116_C08.bHX236099 
OVRT10151G11OVRT1_0151_G11.bHX238972 
PBL010007E02PBL01_0007_E02.bBW968884 
PBL010014D08PBL01_0014_D08.b  
PBL010050C04PBL01_0050_C04.bBW971036 
PBL010053C05PBL01_0053_C05.bBW971187 
PBL010064H04PBL01_0064_H04.bBW971963 
PBL010065F05PBL01_0065_F05.bBW972028 
PBL010065H05PBL01_0065_H05.bBW972047 
PBL010066H03PBL01_0066_H03.bBW972131 
PBL010067A12PBL01_0067_A12.bBP462352 
PBL010067D02PBL01_0067_D02.bBW972168 
PBL010069E12PBL01_0069_E12.bBW972347 
PBL010079G12PBL01_0079_G12.bBW973221 
PBL010085C09PBL01_0085_C09.bBW973708 
PBL010092B11PBL01_0092_B11.bBW974292 
PBL010097D08PBL01_0097_D08.bBW974692 
PBL010107H12PBL01_0107_H12.bBW975656 
PST010010C01PST01_0010_C01.bFS697762 
PST010045F05PST01_0045_F05.bFS700392 
PST010081E02PST01_0081_E02.bFS703242 
PST010086B12PST01_0086_B12.bFS703632 
PST010093E11PST01_0093_E11.bFS704209 
PST010094A07PST01_0094_A07.bFS704242 
PST010098B05PST01_0098_B05.bFS704536 
PTG010104H02PTG01_0104_H02.bFS712888 
SKNB10001C03SKNB1_0001_C03.bDB800095 
SKNB10003A03SKNB1_0003_A03.bDB800204 
SKNB10028F07SKNB1_0028_F07.bDB801521 
SKNB10029A11SKNB1_0029_A11.b  
SKNB10046B11SKNB1_0046_B11.bDB802600 
SKNB10051F08SKNB1_0051_F08.bFS713423 
SKNB10052E04SKNB1_0052_E04.bDB803051 
SKNB10056H02SKNB1_0056_H02.bDB803367 
SKNB10057C08SKNB1_0057_C08.bDB803394 
SKNB10067E02SKNB1_0067_E02.bDB804059 
SKNB10070C05SKNB1_0070_C05.bDB804241 
SKNB10074A08SKNB1_0074_A08.bDB804498 
SKNB10077A11SKNB1_0077_A11.bFS713447 
SKNB10078B02SKNB1_0078_B02.bDB804736 AK400937
SKNB10098H10SKNB1_0098_H10.bDB805927 
SKNB10100D11SKNB1_0100_D11.bDB806028 
SMG010002C04SMG01_0002_C04.bFS713589 
SMG010003C03SMG01_0003_C03.bFS713672 
SMG010004B12SMG01_0004_B12.bFS713760 
SMG010014D11SMG01_0014_D11.bFS714469 
SMG010021B01SMG01_0021_B01.bFS715061 
SMG010026G04SMG01_0026_G04.bFS715580 
SMG010035G12SMG01_0035_G12.bFS716379 
SMG010038H02SMG01_0038_H02.bFS716643 
SMG010039E04SMG01_0039_E04.bFS716699 
SMG010041G12SMG01_0041_G12.bFS716893 
SMG010052C11SMG01_0052_C11.bFS717787 
SMG010057H08SMG01_0057_H08.bFS718241 
SMG010071F07SMG01_0071_F07.bFS719422 
SMG010076D02SMG01_0076_D02.bFS719832 
SMG010078G06SMG01_0078_G06.bFS720042 
SMG010095A04SMG01_0095_A04.bFS721428 
SMG010096G03SMG01_0096_G03.bFS721571 
SMG010097D11SMG01_0097_D11.bFS721630 
SMG010101A06SMG01_0101_A06.bFS721880 
SPL010005A04SPL01_0005_A04.bBP156755 
SPL010011D07SPL01_0011_D07.bBP157852 
SPL010015E05SPL01_0015_E05.bBP158148 
SPL010019C06SPL01_0019_C06.bBP157484 
SPL010020D07SPL01_0020_D07.bBP157860 
SPL010026D12SPL01_0026_D12.bBP158007 
SPL010043G10SPL01_0043_G10.bCJ016921 
SPL010048F04SPL01_0048_F04.bCJ017360 
SPL010059D09SPL01_0059_D09.bCJ018324 
SPL010076B04SPL01_0076_B04.bCJ019829 
SPL010083H11SPL01_0083_H11.bCJ020546 
SPL010086G04SPL01_0086_G04.bCJ020792 
SPL010096E11SPL01_0096_E11.bCJ021674 
SPL010099B10SPL01_0099_B10.bCJ021907 
SPL010103A08SPL01_0103_A08.bCJ022229 
SPLT10016E01SPLT1_0016_E01.b  
SPLT10029G06SPLT1_0029_G06.bHX241470 
SPLT10030H02SPLT1_0030_H02.bHX241544 
SPLT10040B07SPLT1_0040_B07.bHX242283 
SPLT10050H08SPLT1_0050_H08.bHX243110 
SPLT10064E04SPLT1_0064_E04.b  
SPLT10079D03SPLT1_0079_D03.bHX245348 
TCH010011A05TCH01_0011_A05.bCJ023235 
TCH010035A03TCH01_0035_A03.bCJ025007 
TCH010056F05TCH01_0056_F05.bCJ026422 
TCH010063E09TCH01_0063_E09.bCJ026939 
TCH010076G02TCH01_0076_G02.bCJ027938 
TCH010094A03TCH01_0094_A03.bCJ029270 
TES010065F12TES01_0065_F12.bCJ034203 
TES010069H03TES01_0069_H03.bCJ034483 
TES010070F10TES01_0070_F10.bCJ034537 
TES010112C07TES01_0112_C07.bCJ037387 
THY010026H10THY01_0026_H10.bBP169083 
THY010032H07THY01_0032_H07.bBP168765 
THY010052D11THY01_0052_D11.bBP164152 
THY010063E03THY01_0063_E03.bBP164596 
THY010064E11THY01_0064_E11.bBP165422 
THY010094G11THY01_0094_G11.bBP167955 
THY010097F09THY01_0097_F09.bBP166485 
THY010109F08THY01_0109_F08.bBP166392 
UTR010002C01UTR01_0002_C01.bBP170419 
UTR010007A05UTR01_0007_A05.bBP169535 
UTR010008H12UTR01_0008_H12.bBP173588 
UTR010010E08UTR01_0010_E08.bBP171815 
UTR010011D01UTR01_0011_D01.bBP170968 
UTR010012E06UTR01_0012_E06.bBP171726 
UTR010013E04UTR01_0013_E04.bBP171641 
UTR010015A11UTR01_0015_A11.bBP169812 
UTR010016B07UTR01_0016_B07.bBP170168 
UTR010017E12UTR01_0017_E12.bBP171997 
UTR010017G10UTR01_0017_G10.bBP172977 
UTR010018A04UTR01_0018_A04.bBP169501 
UTR010019B01UTR01_0019_B01.bBP169902 
UTR010020C01UTR01_0020_C01.bBP170437 
UTR010020F05UTR01_0020_F05.bBP172222 
UTR010023E04UTR01_0023_E04.bBP171651 
UTR010023H08UTR01_0023_H08.bBP173427 
UTR010024A01UTR01_0024_A01.bBP169385 
UTR010024B03UTR01_0024_B03.bBP169993 
UTR010024C07UTR01_0024_C07.bBP170712 
UTR010025A06UTR01_0025_A06.bBP169594 
UTR010025H04UTR01_0025_H04.bBP173252 
UTR010026A01UTR01_0026_A01.bBP169387 
UTR010026F09UTR01_0026_F09.bBP172402 
UTR010028D04UTR01_0028_D04.bBP171124 
UTR010034A05UTR01_0034_A05.bBP169559 
UTR010035B08UTR01_0035_B08.bBP170229 
UTR010035E05UTR01_0035_E05.bBP171705 
UTR010038G11UTR01_0038_G11.bBP173038 
UTR010039E09UTR01_0039_E09.bBP171886 
UTR010039G07UTR01_0039_G07.bBP172861 
UTR010040H07UTR01_0040_H07.bBP173400 
UTR010041A09UTR01_0041_A09.bBP169743 
UTR010041B05UTR01_0041_B05.bBP170098 
UTR010041C07UTR01_0041_C07.bBP170727 
UTR010044A09UTR01_0044_A09.bBP169746 
UTR010044H06UTR01_0044_H06.bBP173357 
UTR010047B07UTR01_0047_B07.bBP170196 
UTR010047D10UTR01_0047_D10.bBP171404 
UTR010048A11UTR01_0048_A11.bBP169840 
UTR010048E09UTR01_0048_E09.bBP171894 
UTR010048G02UTR01_0048_G02.bBP172645 
UTR010050D08UTR01_0050_D08.bBP463709 
UTR010051G01UTR01_0051_G01.bBP464399 AK240295
UTR010055G10UTR01_0055_G10.bBP464620 
UTR010058H10UTR01_0058_H10.bBP464913 
UTR010060E09UTR01_0060_E09.bBP464022 
UTR010063A08UTR01_0063_A08.bBP462848 
UTR010070E03UTR01_0070_E03.bBP463893 
UTR010072A06UTR01_0072_A06.bBP462803 
UTR010076C12UTR01_0076_C12.bBP463533 
UTR010082B03UTR01_0082_B03.bCJ037538 
UTR010084B08UTR01_0084_B08.bCJ037726 
UTR010087G04UTR01_0087_G04.bCJ038060 
UTR010087G12UTR01_0087_G12.bCJ038067 
UTR010088G09UTR01_0088_G09.bCJ038158 
UTR010089E03UTR01_0089_E03.bCJ038222 
UTR010090B06UTR01_0090_B06.bCJ038283 
UTR010090B11UTR01_0090_B11.bCJ038288 
UTR010090B12UTR01_0090_B12.bCJ038289 
UTR010090F02UTR01_0090_F02.bCJ038326 
UTR010091B08UTR01_0091_B08.bCJ038380 
UTR010091H04UTR01_0091_H04.bCJ038441 
UTR010092F05UTR01_0092_F05.bCJ038508 
UTR010093H04UTR01_0093_H04.bCJ038621 
UTR010098D05UTR01_0098_D05.bCJ038949 
UTR010098F10UTR01_0098_F10.bCJ038977 
UTR010099D05UTR01_0099_D05.bCJ039043 
UTR010099H10UTR01_0099_H10.bCJ039096 
UTR010103E09UTR01_0103_E09.bCJ039427 AK398723

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
254A15630.410WSCTA/L
G22900.590CTG/L
896A9100.360WSGTA/V
G16200.640GTG/V


Alignment:      TOP

20110601C-000130 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
MLN01_0038_G04.b :
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b :
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b :
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b :
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BKFL1_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_G04.b :
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b :
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b :
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b :
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : .....................................................TCTTAGA
---------+---------+---------+---------+---------+---------+ 7
BKFL1_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaTCTTAGA
MLN01_0038_G04.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b :
SPLT1_0079_D03.b :
MLN01_0020_C05.b :
SPL01_0020_D07.b :
SMG01_0004_B12.b :
UTR01_0099_H10.b :
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b :
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b :
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b :
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b :
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b :
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b :
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b :
ILNT1_0006_E04.b :
THY01_0097_F09.b :
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b :
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b :
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b :
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b :
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b :
OVR01_0080_G09.b :
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b :
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b :
LNG01_0086_F09.b :
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b : nccgatacatacagccgataca
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b : ngggacatatatagggatatct
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b : naaaagtaatcttx
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b :
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b :
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b :
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b :
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b :
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : GGAGGATCCCTCCGCGCGAGCTTCCATAAGGAACGCAGCTAGCTGCGAGAATTAATGTGA
---------+---------+---------+---------+---------+---------+ 67
BKFL1_0078_G06.b : GGAGGATCCCTCCGCGCGAGCTTCCATAAGCAACGCGTCTGGCTGCGAGAATTAATGTGA
MLN01_0038_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACGCAGCTAGCTGCGAGAATTAATGTGA
THY01_0032_H07.b :
MLN01_0015_C02.b :
ITT01_0084_D06.b :
UTR01_0063_A08.b : ggca
SPLT1_0079_D03.b :
MLN01_0020_C05.b : nnngcatat
SPL01_0020_D07.b : t
SMG01_0004_B12.b :
UTR01_0099_H10.b : nnn
ILNT1_0072_D05.b :
ITT01_0095_D01.b :
UTR01_0076_C12.b : t
SKNB1_0078_B02.b :
ITT01_0038_F12.b :
LNG01_0003_B04.b :
ITT01_0076_E06.b :
ITT01_0004_G08.b :
CLNT1_0003_E04.b :
PBL01_0107_H12.b :
UTR01_0051_G01.b : tttggg
ILNT1_0086_A08.b :
OVRT1_0076_B11.b :
MLN01_0072_E07.b :
MLN01_0058_G02.b : nnnggctaggactataacx
TES01_0069_H03.b :
UTR01_0018_A04.b :
UTR01_0039_G07.b :
SMG01_0076_D02.b :
PBL01_0050_C04.b :
UTR01_0103_E09.b :
ITT01_0033_E01.b :
UTR01_0047_B07.b : tttt
ITT01_0029_E04.b :
ITT01_0024_H10.b :
MLN01_0026_F01.b :
THY01_0094_G11.b : ttcgatgngttta
BFLT1_0066_D11.b :
MLN01_0071_D04.b :
MLN01_0069_B12.b :
MLN01_0075_D08.b :
TES01_0112_C07.b :
LVRM1_0032_E12.b :
BMWN1_0081_E02.b :
SMG01_0041_G12.b :
UTR01_0041_A09.b :
UTR01_0024_A01.b :
SMG01_0014_D11.b : nnnnn
CBLT1_0067_E04.b :
CBLT1_0088_D12.b :
CBLT1_0068_C09.b :
SPLT1_0064_E04.b :
PBL01_0007_E02.b :
UTR01_0088_G09.b :
SPLT1_0030_H02.b :
SPLT1_0029_G06.b :
ILNT1_0031_D09.b :
HTMT1_0021_F07.b :
OVRT1_0116_C08.b :
ILNT1_0097_E07.b :
MLN01_0011_G06.b :
UTR01_0048_E09.b : g
ILNT1_0006_E04.b :
THY01_0097_F09.b : g
ILNT1_0081_B06.b :
ILNT1_0087_D09.b :
HTMT1_0062_H01.b :
MLN01_0096_A01.b :
ITT01_0073_B04.b :
BMWN1_0088_D04.b :
PBL01_0065_H05.b :
CBLT1_0092_F05.b :
UTR01_0072_A06.b :
ITT01_0098_C03.b :
ITT01_0022_F02.b :
CLNT1_0035_A07.b :
PBL01_0069_E12.b :
ITT01_0021_B08.b :
LNG01_0080_F01.b :
SPLT1_0040_B07.b :
ITT01_0052_F06.b :
SMG01_0026_G04.b :
MLN01_0044_G04.b :
LNG01_0108_E11.b :
LNG01_0107_C10.b :
MLN01_0066_E01.b :
ILNT1_0027_D03.b :
PTG01_0104_H02.b :
SPLT1_0016_E01.b :
SMG01_0096_G03.b :
PBL01_0014_D08.b :
BMWN1_0100_C01.b :
UTR01_0011_D01.b :
SMG01_0095_A04.b :
UTR01_0098_F10.b :
UTR01_0025_A06.b :
UTR01_0023_H08.b : ggggtgaacat
UTR01_0026_F09.b :
UTR01_0028_D04.b :
BMWN1_0063_G07.b :
UTR01_0019_B01.b :
MLN01_0087_G11.b :
CLNT1_0104_B10.b :
SMG01_0101_A06.b :
UTR01_0017_G10.b :
UTR01_0038_G11.b :
UTR01_0020_F05.b :
CLNT1_0105_D05.b :
UTR01_0090_B12.b :
BMWN1_0064_G10.b :
CLNT1_0134_D12.b :
HTMT1_0097_E03.b :
ITT01_0101_E02.b :
BMWN1_0050_C02.b :
UTR01_0034_A05.b :
UTR01_0070_E03.b :
MLN01_0065_D04.b :
SMG01_0078_G06.b :
SMG01_0052_C11.b :
UTR01_0093_H04.b : nnnnggctaggactatgacxxxxxxxxxx
SPL01_0076_B04.b :
OVRT1_0151_G11.b :
UTR01_0060_E09.b :
UTR01_0087_G12.b :
UTR01_0087_G04.b :
ILNT1_0052_F11.b :
SPL01_0043_G10.b :
LNG01_0014_E05.b :
UTR01_0091_B08.b :
SPLT1_0050_H08.b :
UTR01_0058_H10.b :
THY01_0026_H10.b :
BMWN1_0054_F08.b :
ITT01_0008_D05.b :
CLNT1_0127_D10.b :
MLN01_0093_A08.b :
PBL01_0064_H04.b :
BMWN1_0049_D11.b :
UTR01_0092_F05.b :
UTR01_0082_B03.b : nnnncc
ILNT1_0036_H06.b :
ITT01_0001_C11.b :
ITT01_0064_F06.b :
SPL01_0005_A04.b : cg
ITT01_0008_C05.b :
ITT01_0055_B12.b :
ITT01_0001_C10.b :
CLNT1_0049_H02.b :
SKNB1_0057_C08.b :
ITT01_0063_F12.b :
ITT01_0055_E07.b :
ILNT1_0021_D12.b :
MLN01_0004_F07.b :
PBL01_0097_D08.b :
THY01_0063_E03.b :
PBL01_0053_C05.b :
ITT01_0099_G02.b :
ITT01_0064_C09.b :
ITT01_0066_F06.b :
ITT01_0071_C09.b :
ITT01_0030_B03.b :
ITT01_0053_E05.b :
ITT01_0011_D05.b :
MLN01_0022_H07.b :
ITT01_0076_E12.b :
ITT01_0020_E06.b :
ITT01_0041_G11.b :
UTR01_0084_B08.b :
ITT01_0001_D01.b :
ITT01_0011_G05.b :
MLN01_0062_D07.b :
MLN01_0063_A02.b :
TCH01_0035_A03.b :
ADR01_0078_G07.b :
ITT01_0063_H12.b :
PBL01_0065_F05.b :
MLN01_0078_B06.b :
UTR01_0099_D05.b :
CLNT1_0042_F11.b :
LNG01_0075_F09.b :
ADR01_0094_C06.b :
BFLT1_0021_A10.b :
CLNT1_0007_D07.b :
CLNT1_0089_G05.b :
MLN01_0051_F09.b :
MLN01_0033_H07.b :
LNG01_0084_D04.b :
TCH01_0076_G02.b :
MLN01_0090_G01.b :
MLN01_0030_F04.b :
MLN01_0038_A06.b :
MLN01_0072_C11.b :
MLN01_0080_E10.b :
LNG01_0063_F08.b :
MLN01_0039_H07.b :
MLN01_0066_E09.b :
LNG01_0110_C09.b :
MLN01_0092_A02.b :
SPL01_0086_G04.b :
MLN01_0013_F06.b :
LNG01_0015_C11.b : ggct
OVR01_0080_G09.b : aatttttct
THY01_0109_F08.b :
SMG01_0003_C03.b :
TES01_0070_F10.b :
SMG01_0039_E04.b :
SKNB1_0003_A03.b :
MLN01_0081_H03.b : tttttt
SKNB1_0001_C03.b :
OVRM1_0168_B11.b :
ADR01_0009_H09.b :
MLN01_0090_C12.b :
UTR01_0008_H12.b :
UTR01_0002_C01.b :
THY01_0052_D11.b :
UTR01_0013_E04.b :
UTR01_0012_E06.b :
UTR01_0010_E08.b :
SPL01_0015_E05.b :
UTR01_0044_A09.b :
UTR01_0026_A01.b :
UTR01_0024_B03.b :
UTR01_0024_C07.b :
UTR01_0015_A11.b :
UTR01_0090_B11.b :
UTR01_0044_H06.b :
SPL01_0011_D07.b :
UTR01_0017_E12.b :
MLN01_0092_D07.b :
MLN01_0033_D12.b : nn
LNG01_0086_F09.b : nnnn
UTR01_0041_B05.b :
UTR01_0016_B07.b :
UTR01_0020_C01.b :
UTR01_0090_F02.b :
UTR01_0091_H04.b :
AMP01_0068_B10.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_G12.b :
SKNB1_0056_H02.b :
SMG01_0057_H08.b :
BFLT1_0022_C04.b :
LNG01_0087_A07.b :
AMP01_0055_D03.b : ttgggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_B11.b :
UTR01_0047_D10.b :
LNG01_0091_F03.b :
SMG01_0021_B01.b :
UTR01_0055_G10.b :
LNG01_0033_F09.b :
UTR01_0035_E05.b :
CLNT1_0109_C04.b :
SKNB1_0067_E02.b :
OVRT1_0098_C08.b :
SPL01_0083_H11.b :
UTR01_0048_A11.b :
TES01_0065_F12.b :
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_F07.b :
MLN01_0001_G12.b :
CLNT1_0107_C05.b :
UTR01_0048_G02.b :
LNG01_0047_D12.b : ttgggtt
ITT01_0050_D05.b :
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b :
SMG01_0002_C04.b :
MLN01_0012_H12.b :
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b :
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b :
PST01_0081_E02.b :
MLN01_0020_A12.b :
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b :
LNG01_0079_D05.b :
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b :
PST01_0094_A07.b :
LNG01_0062_H03.b : nnna
SKNB1_0074_A08.b :
ITT01_0070_B05.b :
SPL01_0099_B10.b :
UTR01_0090_B06.b :
TCH01_0056_F05.b :
PBL01_0079_G12.b :
MLN01_0096_B01.b :
ITT01_0038_C11.b :
SKNB1_0070_C05.b :
PBL01_0067_A12.b :
ITT01_0011_A01.b :
LNG01_0072_C05.b :
ITT01_0088_D10.b :
MLN01_0103_A03.b :
LNG01_0096_B08.b :
TCH01_0063_E09.b :
SPL01_0048_F04.b :
ITT01_0071_F07.b :
LNG01_0102_A12.b : nnnnaagctagtaatatnacxxxx
OVRT1_0061_B01.b :
ITT01_0039_F04.b :
ITT01_0093_F06.b :
ITT01_0049_E06.b :
ITT01_0083_A07.b :
PBL01_0066_H03.b :
ITT01_0029_D07.b :
ITT01_0006_E02.b :
MLN01_0096_F12.b :
ITT01_0068_F06.b :
ITT01_0062_A04.b :
ITT01_0064_G01.b :
PBL01_0067_D02.b :
ITT01_0038_G12.b :
MLN01_0072_C03.b :
ITT01_0043_B09.b :
ITT01_0098_G07.b :
ITT01_0095_B02.b :
UTR01_0098_D05.b :
ITT01_0015_A03.b :
ITT01_0002_C05.b :
ITT01_0069_C12.b :
LNG01_0075_D06.b :
ITT01_0065_H05.b :
ITT01_0073_G08.b :
ITT01_0060_C07.b :
MLN01_0035_B05.b :
ITT01_0081_H05.b :
LNG01_0072_D02.b :
OVRT1_0098_E02.b :
CLNT1_0030_E05.b :
SMG01_0038_H02.b :
MLN01_0027_C06.b :
MLN01_0008_B10.b :
MLN01_0081_F09.b :
MLN01_0005_A01.b :
MLN01_0038_C06.b :
MLN01_0042_B02.b :
MLN01_0080_C04.b :
UTR01_0089_E03.b :
MLN01_0072_H09.b :
MLN01_0097_B02.b :
LNG01_0109_F08.b :
MLN01_0081_A06.b :
CLNT1_0015_A07.b :
LNG01_0063_H01.b :
MLN01_0081_E05.b :
CLNT1_0049_A07.b :
MLN01_0029_B12.b :
LNG01_0081_G11.b :
MLN01_0014_A04.b :
SPL01_0019_C06.b :
MLN01_0014_C05.b : nnnttggc
MLN01_0036_G07.b :
UTR01_0039_E09.b :
MLN01_0032_E03.b :
SKNB1_0028_F07.b :
CBLT1_0030_E10.b :
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b :
ITT01_0071_A09.b :
SKNB1_0051_F08.b :
UTR01_0007_A05.b :
SKNB1_0077_A11.b :
ITT01_0090_F05.b :
ITT01_0048_A08.b :
SKNB1_0029_A11.b :
LNG01_0104_C10.b :
PBL01_0092_B11.b :
TCH01_0011_A05.b :
TCH01_0094_A03.b :
OVR01_0094_C01.b :
ILNT1_0010_A12.b :
OVRM1_0043_G05.b :
SPL01_0096_E11.b : nnn
SPL01_0059_D09.b :
CLNT1_0081_G08.b :
LNG01_0063_F07.b :
MLN01_0060_D10.b :
UTR01_0035_B08.b :
ITT01_0016_D04.b :
PBL01_0085_C09.b :
SPL01_0103_A08.b :
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b :
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : ATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCG
---------+---------+---------+---------+---------+---------+ 127
BKFL1_0078_G06.b : ATTGCAGGACACATTGATCTTCGACACTTCTAACGCACTTGCAGCCCCTGGTTCCTCCCG
MLN01_0038_G04.b : ATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCGGGTTCCTCCCG
THY01_0032_H07.b : taggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0015_C02.b : nnnttaagatggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_D06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0063_A08.b : tttgggntgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0079_D03.b : nnnccgcggttagaggccxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_C05.b : nnnnttcgctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_D07.b : gggggcactattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
UTR01_0099_H10.b : ttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0072_D05.b : nnnggagagtacgaggccgtaxxxxxxxxxxxxxxxxx
ITT01_0095_D01.b : ngatatacaxxxxxxxxxxxxxxxxxxxxx
UTR01_0076_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0078_B02.b :
ITT01_0038_F12.b : naaaatgxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0003_B04.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_E06.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxx
ITT01_0004_G08.b : nnggataaacaxxxxxxxxxxxxxxxxxxxxx
CLNT1_0003_E04.b : ggacccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0107_H12.b : naaagatcaacaxxxxxxxxxxxxxxxxxxxx
UTR01_0051_G01.b : gctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0086_A08.b : nnnggagctagtagacgccntaxxxxxxxxxxxxxxxxx
OVRT1_0076_B11.b : naattccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_E07.b : ngggttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0058_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0069_H03.b :
UTR01_0018_A04.b : tggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_G07.b : tgggatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_D02.b : ngggtcctttnnnnggagtaagcagcxxxxxxxxxxxxxxx
PBL01_0050_C04.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_E09.b : nnggataggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_E01.b : ttatgactaacaxxxxxxxxxxxxxxxxxxxx
UTR01_0047_B07.b : ggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0029_E04.b : nnngatgaacaxxxxxxxxxxxxxxxx
ITT01_0024_H10.b : nnnaagatgaacaxxxxxxxxxxxxxxxxxxxxxx
MLN01_0026_F01.b : nnngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_G11.b : tagcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_D11.b : ngaatccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_D04.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_B12.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0075_D08.b : xxxxxxxxxxxxxxxx
TES01_0112_C07.b :
LVRM1_0032_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_E02.b : ttttggacggtacgaggxxxxxxxxxxxxxxxxx
SMG01_0041_G12.b : tttattcgactxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_A09.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_A01.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxx
CBLT1_0067_E04.b : tttttagacagtagaggxxxxxxxxxxxxxxxxxx
CBLT1_0088_D12.b : ttttgcgaggtacgaggxxxxxxxxxxxxxxxxxx
CBLT1_0068_C09.b : ncccttttnnnnnccgacagtagaggxxxxxxxxxxxxxxxxx
SPLT1_0064_E04.b : nntttttttnnnggacggtagaggcagtagtattaaxxxxx
PBL01_0007_E02.b : agtgccnttcagatacagcagctggaxxxxxxxxxx
UTR01_0088_G09.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0030_H02.b : nnntttgacagtagacxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0029_G06.b : nnnngggcgagtagacxxxxxxxxxxxxxxxxxxx
ILNT1_0031_D09.b : nnnccgaggtacgaggcagtagtattaaxxxxxxx
HTMT1_0021_F07.b : ttttggacagtagaggccgtaxxxxxxxxxxxxxx
OVRT1_0116_C08.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0097_E07.b : nnnnaagcaggacacgxxxxxxxxxxxxxxxxxxx
MLN01_0011_G06.b : nnntttgtggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_E09.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0006_E04.b : ttttnggcgagtagaxxxxxxxxxxxxxxxxxxxxx
THY01_0097_F09.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0081_B06.b : nnnggggcagtagacgxxxxxxxxxxxxxxxxxxx
ILNT1_0087_D09.b : nnnngggcagtagacgccgtaxxxxxxxxxxxxxx
HTMT1_0062_H01.b : ttttaggacggtacgacgccgtaxxxxxxxxxxxxxx
MLN01_0096_A01.b : tttttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0073_B04.b : nnnggtgaagcagcggtxxxxxxxxxx
BMWN1_0088_D04.b : ttttccgacggtagaxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_H05.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxx
CBLT1_0092_F05.b : ttggacgtgagaggxxxxxxxxxxxxxxxxxxx
UTR01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_C03.b : nggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0022_F02.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
CLNT1_0035_A07.b : nnnnccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0069_E12.b : naagatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0021_B08.b : nnggatgaacaxxxxxxxxxxxxxxxxxxx
LNG01_0080_F01.b : nnttttgatggacttgnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0040_B07.b : nnnaagagagtagcggccgtxxxxxxxxxxxxxxx
ITT01_0052_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
SMG01_0026_G04.b : nnggcttttnnnnnnagacgtaacagcxxxxxxxxxx
MLN01_0044_G04.b : nnnggctagtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_E11.b : nnnnggatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0107_C10.b : ctttcgggntgatggacttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_E01.b : nnngggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0027_D03.b : nnnaacgcaggagaggccgtaxxxxxxxxxxxx
PTG01_0104_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0016_E01.b : nnggaaaagtagaggccgtaxxxxxxxxxxxxx
SMG01_0096_G03.b : nggccttttnnntttgagtxxxxxxxxxxxxxxxxxxxxxx
PBL01_0014_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0100_C01.b : ttttccgagagtagacgxxxxxxxxxxxxxxxx
UTR01_0011_D01.b : atttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0095_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0098_F10.b : nnnttgcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_A06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_H08.b : attagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_F09.b : ggtgcactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_D04.b : ggggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_G07.b : ttttacgaggtgagacgxxxxxxxxxxxxxxxx
UTR01_0019_B01.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_G11.b : gtgattagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0104_B10.b : nnnnccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0101_A06.b : nnggagcttttnnnnggatcaagcagcxxxxxxxxxxxxxxx
UTR01_0017_G10.b : gggttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_G11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_F05.b : gggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0105_D05.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B12.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0064_G10.b : ntttaggatggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_D12.b : nttttcgttcagcgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0097_E03.b : tttgatagtacgacgccgtaxxxxxxxxxxxxx
ITT01_0101_E02.b : nnttgatgaacxxxxxxxxxxxxxxxxxxx
BMWN1_0050_C02.b : nngggcgagagaacgaggxxxxxxxxxxxxxxxxxxx
UTR01_0034_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0070_E03.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0065_D04.b : agtgcttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0078_G06.b : cggcacttnnnnggacgtaagcagcxxxxxxxxxxxxxxx
SMG01_0052_C11.b : nccgcttntnttnggagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_B04.b : tttggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_G11.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_E09.b : cattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G12.b : nnttggcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G04.b : nnnaagcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0052_F11.b : nnggggacggtaagaggxxxxxxxxxxxxxxxxxx
SPL01_0043_G10.b : nntttgctaggaatatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0014_E05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0091_B08.b : nnnnggcttggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_H08.b : nnnggcgcggtacgaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_H10.b : gggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0026_H10.b : ttgggtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0054_F08.b : ttttaggcagagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_D05.b : nnnggatgaagcagcxxxxxxxxxxxxxxx
CLNT1_0127_D10.b : ngggctttnnnngnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_A08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0064_H04.b : naatgaaacaxxxxxxxxxxxxxxxxxxx
BMWN1_0049_D11.b : nnnaaagcaggtacacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_F05.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_B03.b : ttnnnnnnnggcttggtctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0036_H06.b : nnnaaacgacggtagaggccgtaxxxxxxxxxxxxx
ITT01_0001_C11.b : nnnnggagxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_F06.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
SPL01_0005_A04.b : cttatacgtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0055_B12.b : nnnggagtaacaxxxxxxxxxxxxxxxxxx
ITT01_0001_C10.b : nnnnggataaacaxxxxxxxxxxxxxxxxxx
CLNT1_0049_H02.b : nnnttgtatttnnnngnanccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0057_C08.b : nnngggttnn
ITT01_0063_F12.b : ntttagtgxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0055_E07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ILNT1_0021_D12.b : nnnccgacagtagaggccgtaxxxxxxxxxxxxx
MLN01_0004_F07.b : ccccnttcagtggctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0097_D08.b : nnnnggagtaacaxxxxxxxxxxxxxxxxx
THY01_0063_E03.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_C05.b : nnggtgaaacaxxxxxxxxxxxxxxxxxx
ITT01_0099_G02.b : gatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0064_C09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxx
ITT01_0066_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0071_C09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0030_B03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxx
ITT01_0053_E05.b : nnngggtgaacaxxxxxxxxxxxxxxxxxx
ITT01_0011_D05.b : ngggtgaacaxxxxxxxxxxxxxxxxxx
MLN01_0022_H07.b : ntttgtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_E12.b : nnnntgagtaacaxxxxxxxxxxxxxxxxxxx
ITT01_0020_E06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0041_G11.b : nnggatgaacaxxxxxxxxxxxxxxxxxx
UTR01_0084_B08.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_D01.b : nnnaagataaacaxxxxxxxxxxxxxxxxx
ITT01_0011_G05.b : nnnggtgtaacaxxxxxxxxxxxxxxxxxx
MLN01_0062_D07.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0063_A02.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0035_A03.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_G07.b : nnnnnttgataaacaxxxxxxxxxxxxxxxxx
ITT01_0063_H12.b : nnnaagatxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_F05.b : nnggattaacaxxxxxxxxxxxxxxxxx
MLN01_0078_B06.b : nnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_D05.b : nnnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0042_F11.b : aatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0075_F09.b : nnnnngggctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0094_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0021_A10.b : ggaatactttagctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_D07.b : ngggaccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_G05.b : nnntttcgtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0051_F09.b : nnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_H07.b : nntttgctaggacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0084_D04.b : nnnnnggatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0076_G02.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0090_G01.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_F04.b : nnggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_A06.b : nnnngggttgtgacttaacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_C11.b : nnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_E10.b : ngcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_F08.b : ntttcggggcattgtacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_H07.b : nnggttgataggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_E09.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0110_C09.b : nnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0092_A02.b : tttttggctggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0086_G04.b : nnnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0013_F06.b : nnncctaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0015_C11.b : tattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0080_G09.b : tttgctggggatttggacataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_F08.b : tttgcxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0003_C03.b : nnnnggttttnnnnttatgacxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_F10.b :
SMG01_0039_E04.b : nnnggggttctnnnnntgagtaagcagcggnaxxxxxxxxx
SKNB1_0003_A03.b :
MLN01_0081_H03.b : atcttttttnggcaatggatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0001_C03.b :
OVRM1_0168_B11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0009_H09.b : nnnnngatgaacaxxxxxxxxxxxxxxxxx
MLN01_0090_C12.b : tgcttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_H12.b : attttagaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0002_C01.b : gtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0052_D11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_E04.b : tgggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_E06.b : gggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_E08.b : gggggacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0015_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0044_A09.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_A01.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_B03.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_C07.b : tggtggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_A11.b : tgggtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B11.b : nttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_H06.b : gtggataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_D07.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0017_E12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0092_D07.b : ngttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_D12.b : nnnggttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_F09.b : ttcttgtnnnnggattggacttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_B05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_B07.b : ggggtgcacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_C01.b : gggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_F02.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0091_H04.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_G12.b : nnggccttttnttaatgatcaagcagcxxxxxxxxxxxxxxx
SKNB1_0056_H02.b : nnncc
SMG01_0057_H08.b : nggttttnnnnntagataaagcagcggtaxxxxxxxxxx
BFLT1_0022_C04.b : ggactacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_A07.b : ggggtttggaacgactatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_B11.b : taggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_D10.b : ctttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_F03.b : ttgtnggcatggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0021_B01.b : nnaactattnnnnnagataaagcagcggtaxxxxxxxxx
UTR01_0055_G10.b : cctttttgtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_F09.b : ctttatgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0035_E05.b : ggggaacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0109_C04.b : nncccacttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0067_E02.b :
OVRT1_0098_C08.b : nnnnnccttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_H11.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_A11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0065_F12.b :
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0001_G12.b : nnnntagcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_C05.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_G02.b : catttggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0047_D12.b : ttagttgcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0050_D05.b : nnnggataaacaxxxxxxxxxxxxxxxxxx
PST01_0086_B12.b :
SKNB1_0046_B11.b :
THY01_0064_E11.b : catttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0002_C04.b : nnnaacatcannnnnnggagacagcagcxxxxxxxxxxxxxx
MLN01_0012_H12.b : nnnnttttgctggaccttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0045_F05.b :
SKNB1_0098_H10.b :
CLNT1_0002_E08.b : ggacacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0098_B05.b :
KDN01_0056_G06.b :
OVRT1_0023_B10.b : nnnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0081_E02.b :
MLN01_0020_A12.b : nnncccgctggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0078_H04.b :
KDN01_0093_G07.b :
LNG01_0042_G05.b : gattttataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0079_D05.b : cttttccgacggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0093_E11.b :
SKNB1_0052_E04.b :
KDN01_0034_B09.b :
LNG01_0084_C10.b : nnnttggctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0094_A07.b :
LNG01_0062_H03.b : aaaatttttcggggcatgtacatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0074_A08.b :
ITT01_0070_B05.b : nnggatcaacaxxxxxxxxxxxxxxxxxx
SPL01_0099_B10.b : nntttgataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_B06.b : nnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0056_F05.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0079_G12.b : naaagatgaacaxxxxxxxxxxxxxxxx
MLN01_0096_B01.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0038_C11.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxx
SKNB1_0070_C05.b : nnnnggg
PBL01_0067_A12.b : nnaagataaacaxxxxxxxxxxxxxxxxx
ITT01_0011_A01.b : naagatgaacaxxxxxxxxxxxxxxxxx
LNG01_0072_C05.b : nnnngggctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_D10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
MLN01_0103_A03.b : ttttngctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0096_B08.b : nnttttgctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0063_E09.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_F04.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_F07.b : nnggatgaacaxxxxxxxxxxxxxxxxx
LNG01_0102_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_B01.b : nntttacgtcagcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0039_F04.b : nnnggtgaaacaxxxxxxxxxxxxxxxxx
ITT01_0093_F06.b : ntatgatacaxxxxxxxxxxxxxxxxx
ITT01_0049_E06.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0083_A07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
PBL01_0066_H03.b : nnnnggagtaacaxxxxxxxxxxxxxxxx
ITT01_0029_D07.b : nnggatgaacaxxxxxxxxxxxxxxxxx
ITT01_0006_E02.b : nnttgatgaacaxxxxxxxxxxxxxxxxxx
MLN01_0096_F12.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0068_F06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0062_A04.b : nnnnggtgatacaxxxxxxxxxxxxxxxxxx
ITT01_0064_G01.b : nnnggtgaaacaxxxxxxxxxxxxxxxxx
PBL01_0067_D02.b : nnnggatacacaxxxxxxxxxxxxxxxxx
ITT01_0038_G12.b : nnaagataaacaxxxxxxxxxxxxxxxx
MLN01_0072_C03.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0043_B09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0098_G07.b : nnnggatacacaxxxxxxxxxxxxxxxxx
ITT01_0095_B02.b : nggatgaacaxxxxxxxxxxxxxxxxx
UTR01_0098_D05.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0015_A03.b : nngggataaacxxxxxxxxxxxxxxxxxx
ITT01_0002_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0069_C12.b : nnggtcaaacaxxxxxxxxxxxxxxxxx
LNG01_0075_D06.b : ttttnnggttggtacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0065_H05.b : ntttgatgaacaxxxxxxxxxxxxxxxxxx
ITT01_0073_G08.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
ITT01_0060_C07.b : nnnggtgxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B05.b : nnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_H05.b : nnnngatgaacaxxxxxxxxxxxxxxxxx
LNG01_0072_D02.b : nnnnnggctgtacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_E02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0030_E05.b : nnnnccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0038_H02.b : nnggggcttttnnnnngggtcxxxxxxxxxxxxxxxxxxxx
MLN01_0027_C06.b : nnggcttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0008_B10.b : nnnnttaatggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_F09.b : ngctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0005_A01.b : nntttaggcatggactatgacagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_C06.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_B02.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_C04.b : ngctgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_E03.b : nnnggcttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_H09.b : nnnnggcatggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_B02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_F08.b : ntttnnggttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_A06.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_A07.b : ngggcttttnnngggaaccctcagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_H01.b : nttttttgattgtacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0081_E05.b : ngggtaggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_A07.b : nccggttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0029_B12.b : nnttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0081_G11.b : nnnnaagctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_A04.b : nntttagctggtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_C06.b : ggggaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_C05.b : tggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0036_G07.b : ggggtgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_E09.b : ggggggaaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0032_E03.b : nnccctaggnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0028_F07.b :
CBLT1_0030_E10.b : ttttacgagagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_A12.b :
PST01_0010_C01.b :
ITT01_0069_E09.b : nnggatgaacaxxxxxxxxxxxxxxxx
ITT01_0071_A09.b : nnnggagtaacaxxxxxxxxxxxxxxxx
SKNB1_0051_F08.b : nnnnnttaacgctggctctgggaaaaaa
UTR01_0007_A05.b : ctttttgatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0077_A11.b :
ITT01_0090_F05.b : nnnggataaacaxxxxxxxxxx
ITT01_0048_A08.b : nnnggatgaacaxxxxxxxxxxxxxxx
SKNB1_0029_A11.b : nnggc
LNG01_0104_C10.b : nnttttgctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0092_B11.b : nnnggatgaacaxxxxxxxxxxxxx
TCH01_0011_A05.b : nnnnggctaggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0094_A03.b : ttttggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0094_C01.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0010_A12.b : nnnnggcgagtagaggccgtaxxxxxxxxxx
OVRM1_0043_G05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_E11.b : nnggtttnnnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0059_D09.b : nnnggctaggacttanacagtttgtcacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0081_G08.b : nnnggttcttnnnnnnnacgtcgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_F07.b : nngggctttttcgncgattggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_D10.b : ttaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxx
UTR01_0035_B08.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0016_D04.b : nnnggatacacax
PBL01_0085_C09.b : nnnggtg
SPL01_0103_A08.b : nnnnggctagtac
SMG01_0097_D11.b :
ITT01_0029_E12.b :
MLN01_0045_B01.b :
UTR01_0050_D08.b :
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : GGGCTACGCCTGTCTGAGCGTCCTGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
---------+---------+---------+---------+---------+---------+ 183
BKFL1_0078_G06.b : GGGCTACGCCTGTCTGAGCGTCGCT*Catgaaaaatggacataactgtttcctaagacat
MLN01_0038_G04.b : GGGCTACGCCTGTCTGAGCGTCGCT*CTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
THY01_0032_H07.b : xxxxxxxxxxxxxxxxxxxxtCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0015_C02.b : xxxxxxxxxxxxxxxxxxxxxCTTTCCTTTCCGCG*CTGCCCATA*CCGGG*G*TTCACA
ITT01_0084_D06.b : xxxxxxxxxxxxxxxxxxxxxCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0063_A08.b : xxxxxxxxxxxxxxxxxxtggCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0079_D03.b : xxxxxxxxxxxxxxxxxxxxgCTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0020_C05.b : xxxxxxxxxxxxxxxxxxxtaCTGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0020_D07.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATG
SMG01_0004_B12.b : xxxxxxxxxxxxxxxxxxxxxcTTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0099_H10.b : xxxxxxxxxxxxxxxxxxxcttTTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0072_D05.b : xxxxxxxxxxxxxxxxxxxxxgCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0095_D01.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0076_C12.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0078_B02.b : naaacctaacgtggcacggcCTTTCTTTCCGCG*CTGCC*AGA*CCGGG*G*TCCAC*
ITT01_0038_F12.b : xxxxxxxxxxxxxxxxxxxxxcCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0003_B04.b : xxxxxxxxxxxxxxxxxxxxxxTGGCTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0076_E06.b : xxxxxxxxxxxxxxxxxxxxxcTGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0004_G08.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0003_E04.b : xxxxxxxxxxxxxxxxxxxxxtCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0107_H12.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0051_G01.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0086_A08.b : xxxxxxxxxxxxxxxxxxxxxgCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
OVRT1_0076_B11.b : xxxxxxxxxxxxxxxxxxxcatTGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_E07.b : xxxxxxxxxxxxxxxxxxxgctTTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0058_G02.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
TES01_0069_H03.b : ntttactgcggttgctatGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0018_A04.b : xxxxxxxxxxxxxxxxxxxxxxcTTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0039_G07.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0076_D02.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0050_C04.b : xxxxxxxxxxxxxxxxxxxxxxgGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0103_E09.b : xxxxxxxxxxxxxxxxxxxxxxxGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0047_B07.b : xxxxxxxxxxxxxxxxxxxctggGGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0029_E04.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0024_H10.b : xxxxxxxxxxxxxxxxxxxxxxcTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0026_F01.b : xxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCGTA
THY01_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0066_D11.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0071_D04.b : xxxxxxxxxxxxxxxxxxxxxxxGGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0069_B12.b : xxxxxxxxxxxxxxxxxxxxxxcTGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0075_D08.b : xxxxxxxxxxxxxxxxcctgtactGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0112_C07.b : ttctgcagtggctctgGCCTTTC*GCG*CTGCCCAGA*CCGGG*G*TCC*CA
LVRM1_0032_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0081_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0041_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0041_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0024_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0014_D11.b : xxxxxxxxxxxxxxxxxxxxxxtcCTTTTTCCGCGCCTGCCCAGAACCGGG*G*TCCATA
CBLT1_0067_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0088_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0068_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0064_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCCTC*CA**CAAAGACCGGG*G*TCCACA
PBL01_0007_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0030_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPLT1_0029_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxgCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
HTMT1_0021_F07.b : xxxxxxxxxxxxxxxxxxxxxxxtGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
OVRT1_0116_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxTCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0097_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCACA*CCGGG*G*TCCACA
MLN01_0011_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0048_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0006_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0097_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0081_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0087_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
HTMT1_0062_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0096_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0073_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0088_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0065_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CBLT1_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0072_A06.b : xxxxxxxxxxxxxxxxxxxxxxxgCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0098_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0035_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0069_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0021_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0080_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPLT1_0040_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0052_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0026_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0044_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0108_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
LNG01_0107_C10.b : xxxxxxxxxxxxxxxxxxxxxxggTCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0066_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0027_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PTG01_0104_H02.b : nnnnnnnnnnnnnnnnnxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*GNTCCATA
SPLT1_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGTCCAGA*CCGGG*G*TCCATA
SMG01_0096_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0014_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0100_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0011_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0095_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnCCTTTCCCCG*CTGCCCAGA*CCGGGNGNTCCATA
UTR01_0098_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0025_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0023_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0026_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0028_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0063_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0087_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0104_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0101_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0038_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0020_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0105_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0090_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0064_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0134_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
HTMT1_0097_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0101_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxcCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
BMWN1_0050_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0065_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0052_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0076_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVRT1_0151_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0060_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0087_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0087_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0052_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0043_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0014_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0091_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPLT1_0050_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0026_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0054_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0008_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0127_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0093_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0064_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BMWN1_0049_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0092_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0082_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0036_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0001_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0064_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0008_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0055_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0001_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0049_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxaGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0057_C08.b : nntnnaatacgtttgcacggcttgtGCTTTCCGCG*CTGCCCGA**CCGGG*G*TCCATA
ITT01_0063_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0055_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ILNT1_0021_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0004_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0097_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
THY01_0063_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0053_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0099_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0064_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0066_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0071_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0030_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0053_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0011_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCTGA*CCGGG*G*TCCATA
MLN01_0022_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0076_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0020_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0041_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0084_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0011_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0062_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0063_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ADR01_0078_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0063_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0065_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0078_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0099_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0042_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0075_F09.b : xxxxxxxxxxxxxxxxxxxxxxxacGCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ADR01_0094_C06.b : nnxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0021_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0007_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0089_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
MLN01_0051_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0033_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0084_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0076_G02.b : xxxxxxxxxxxxxxxxxxxxxxxctGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0090_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0030_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0038_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0080_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0063_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0039_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0066_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0110_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0092_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0086_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0013_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0015_C11.b : xxxxxxxxxxxxxxxxxxaaaaaaaCCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVR01_0080_G09.b : xxxxxxxxxxxxxxxxxxxxxxxactGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
THY01_0109_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCCTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0003_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0070_F10.b : tttccacgttggctctgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCATA
SMG01_0039_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0003_A03.b : nnnnnnaaaactcacggtggcccggCCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCAC*
MLN01_0081_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0001_C03.b : tttttacacacagtggccacgGCTTTCGCG*CTGC*CAGA*CCGGG*G*TC*ACA
OVRM1_0168_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ADR01_0009_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0090_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0008_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0002_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
THY01_0052_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0013_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0012_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0010_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0015_E05.b : nnnnnnnnnnnnnnnnxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0044_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0026_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0024_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0024_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0015_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0011_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0017_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0092_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0033_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0086_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0041_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0016_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0020_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0091_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0035_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0056_H02.b : gtgtnnnnntaatacacgtttgcatgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
SMG01_0057_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
BFLT1_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0087_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0055_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0083_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0047_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0091_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SMG01_0021_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0055_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0035_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0109_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SKNB1_0067_E02.b : nntttcacacgtggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCC*TA
OVRT1_0098_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SPL01_0083_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
UTR01_0048_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TES01_0065_F12.b : ttttttcctgcagttgctatgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TCCATA
AMP01_0010_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0071_F07.b : nnnnnnnnnnnnnnnnnnxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0001_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0107_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0048_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0047_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0050_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0086_B12.b : nnncctgaggttgctctgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TC*ATA
SKNB1_0046_B11.b : nnnnttagcggtggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCC*TA
THY01_0064_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
SMG01_0002_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0012_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PST01_0045_F05.b : nnggtgacgttggcactgGCTTTCGCG*CTGCCCAGG*CCGGG*G*TCC*TA
SKNB1_0098_H10.b : aagggtggctatgGCTTTCGCG*CTGCCCGA**CCGGG*G*TCC*TA
CLNT1_0002_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0098_B05.b : nnnccgactgttgctctgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TCCACA
KDN01_0056_G06.b : nnttggcgttggctctgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
OVRT1_0023_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0081_E02.b : ncctacgttggctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCATA
MLN01_0020_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
KDN01_0078_H04.b : ttttactgcagtggctatgGCTTCCGCG*CTGC*CAGA*CCGGG*G*TC*ATA
KDN01_0093_G07.b : nnnncctgcgttggctatgGCTTTCGCG*CTGCC*AGA*CCGGG*G*TCC*TA
LNG01_0042_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
LNG01_0079_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PST01_0093_E11.b : nnnncctgcgtttgctatgGCTTTCGCG*CTGCCC*GA*CCGGG*G*TCCAC*
SKNB1_0052_E04.b : aaaantcaactgtggctgGCTTTCGCG*C*GCCCAGA*CCGGG*G*TCC*TA
KDN01_0034_B09.b : ttttttgctgcggtggctatggCCTTTCGCG*CTGCC*AGA*CCGGG*G*TCC*TA
LNG01_0084_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
PST01_0094_A07.b : nntttcctactgttgctatggCCTTTCGCG*CTGCCCAGA*CCGGG*G*TCC*TA
LNG01_0062_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxaCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SKNB1_0074_A08.b : nnnnnctgactgtggctacgGCTTTCGCG*CTGCCCAGA*CCGGG*G*TC*ATA
ITT01_0070_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0099_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0090_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
TCH01_0056_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0079_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0096_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0038_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0070_C05.b : ggtttnnnnnnnccaccgtggctatgGCTTTCGCG*CTGCCCG**ACCGGG*G*TCC*CA
PBL01_0067_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0011_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0072_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0088_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0103_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0096_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
TCH01_0063_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPL01_0048_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
ITT01_0071_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0102_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCGCCTGCCAAGACCGGGG*G*TCCATA
OVRT1_0061_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0093_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0049_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0083_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
PBL01_0066_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0029_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0006_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCATA*CCGGG*G*TCCACA
MLN01_0096_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0068_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGG*CCGGG*G*TCCATA
ITT01_0062_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCTCA
ITT01_0064_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
PBL01_0067_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0038_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0072_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0043_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0098_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0095_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0098_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0015_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCTGA*CCGGG*G*TCCACA
ITT01_0002_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0069_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0075_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxaCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0065_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0073_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0060_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0035_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
LNG01_0072_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVRT1_0098_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
CLNT1_0030_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SMG01_0038_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0027_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0008_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0081_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0005_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0038_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0042_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0080_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
UTR01_0089_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0072_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0097_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0109_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0081_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0015_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0063_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0049_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0029_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
LNG01_0081_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
MLN01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0019_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0014_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0036_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCACG*CTGCCCAGACCGGGG*A*TCCATA
UTR01_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
MLN01_0032_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0028_F07.b : nnnnggtcactgtggctgctCTTTCGCG*CTGCCCGA**CCGGG*G*TCC*CA
CBLT1_0030_E10.b : xxxxxxxxxxxgtccgcttacccctttTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
KDN01_0017_A12.b : ttttnnnnaactacgttggctctggcTTTTCCCG*CTGCC*AGA*CCGGG*G*TCCATA
PST01_0010_C01.b : tatttntnnncctgcgttggctacggcTTTTTTCC*CGCTGCCCGACCGGG*G*TCC*TA
ITT01_0069_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0071_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0051_F08.b : aaaaaaaaaaaaaaaaaaaaaacttttTTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0007_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0077_A11.b : nnnnnttagctgtggctctgggTTTCGCG*CTGCCC*GA*CCGGG*A*TC*ATA
ITT01_0090_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
ITT01_0048_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SKNB1_0029_A11.b : tcnnnnnnnnccttacgttgtgcactggTTTCGCG*CTGCC*AGA*CCGGG*G*TCCATA
LNG01_0104_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
PBL01_0092_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
TCH01_0011_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
TCH01_0094_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
OVR01_0094_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ILNT1_0010_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
OVRM1_0043_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCCAGA*CCGGG*G*TCCATA
SPL01_0096_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
SPL01_0059_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCCAGA*CCGGG*G*TCCACA
CLNT1_0081_G08.b : xxxxxxxxxxxxxxxxxxxatcgttcagtgCCGCG*CTGNNNAGA*NCGGG*G*NCCATA
LNG01_0063_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCG*CTGCCAAGA*CCGGG*G*TCCATA
MLN01_0060_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG*CTGCCCAGA*CCGGG*G*TCCACA
UTR01_0035_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG*CTGCCCAGA*CCGGG*G*TCCATA
ITT01_0016_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA*CCGGG*G*TCCCTA
PBL01_0085_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGGG*G*TCCATA
SPL01_0103_A08.b : ttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0097_D11.b : ncccttattnnnnngggatcaagcagcggnaxxxxxx
ITT01_0029_E12.b : nnnggtgaagcagcx
MLN01_0045_B01.b : nnnn
UTR01_0050_D08.b : catxxxx
UTR01_0040_H07.b :
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : nnnnnnnnnnnnnnnnnnnnnnnntttgtccacgctgcccccactggaggtcctcacaga
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
---------+---------+---------+---------+---------+---------+ 242
BKFL1_0078_G06.b : gcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0032_H07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0015_C02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0084_D06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0063_A08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0079_D03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0020_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0020_D07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0004_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGATTTTCACAATGTCCGGAGCC
UTR01_0099_H10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0072_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0095_D01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0076_C12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0078_B02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0038_F12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0003_B04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0076_E06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0004_G08.b : CGGCG*TTGCTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0003_E04.b : CGGCGCTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0107_H12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0051_G01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0086_A08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0076_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0072_E07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0058_G02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TES01_0069_H03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0018_A04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0039_G07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0076_D02.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0050_C04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0103_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0033_E01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0047_B07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0029_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0024_H10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAACGTCCGGAGCC
MLN01_0026_F01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0094_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BFLT1_0066_D11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0071_D04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0069_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0075_D08.b : CCCCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TES01_0112_C07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LVRM1_0032_E12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0081_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0041_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0041_A09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0024_A01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0014_D11.b : CGGCGCTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CBLT1_0067_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CBLT1_0088_D12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CBLT1_0068_C09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0064_E04.b : CGGCGNTTGTTCTTGATTCCCCTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0007_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0088_G09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0030_H02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0029_G06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0031_D09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
HTMT1_0021_F07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0116_C08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0097_E07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0011_G06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0048_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0006_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0097_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0081_B06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0087_D09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
HTMT1_0062_H01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0096_A01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0073_B04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0088_D04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0065_H05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CBLT1_0092_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0072_A06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0098_C03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0022_F02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0035_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0069_E12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0021_B08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0080_F01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0040_B07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0052_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0026_G04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0044_G04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0108_E11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0107_C10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0066_E01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0027_D03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PTG01_0104_H02.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0016_E01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0096_G03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0014_D08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCGCAATGTCCGGAGCC
BMWN1_0100_C01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0011_D01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0095_A04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0098_F10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0025_A06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0023_H08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0026_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0028_D04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0063_G07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0019_B01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0087_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0104_B10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0101_A06.b : CGNGCGTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0017_G10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0038_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0020_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0105_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0090_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACCTTCACAATGTCCGGAGCC
BMWN1_0064_G10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0134_D12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
HTMT1_0097_E03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0101_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0050_C02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0034_A05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0070_E03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0065_D04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0078_G06.b : CGNGCGTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0052_C11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0093_H04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0076_B04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0151_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0060_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0087_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0087_G04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0052_F11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0043_G10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0014_E05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0091_B08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPLT1_0050_H08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0058_H10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0026_H10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0054_F08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0008_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0127_D10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0093_A08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0064_H04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BMWN1_0049_D11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0092_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0082_B03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0036_H06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0001_C11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0064_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCGCAATGTCCGGAGCC
SPL01_0005_A04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0008_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0055_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0001_C10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCA
CLNT1_0049_H02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0057_C08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0063_F12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0055_E07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0021_D12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0004_F07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0097_D08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0063_E03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0053_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0099_G02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0064_C09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0066_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0071_C09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0030_B03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0053_E05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0011_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0022_H07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0076_E12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0020_E06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0041_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0084_B08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0001_D01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0011_G05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0062_D07.b : CGGCG*TTATTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0063_A02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0035_A03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ADR01_0078_G07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0063_H12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0065_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0078_B06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0099_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0042_F11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0075_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ADR01_0094_C06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BFLT1_0021_A10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0007_D07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0089_G05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0051_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0033_H07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0084_D04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0076_G02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0090_G01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0030_F04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0038_A06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0072_C11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0080_E10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0063_F08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0039_H07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0066_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0110_C09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0092_A02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0086_G04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0013_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0015_C11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVR01_0080_G09.b : CAGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0109_F08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0003_C03.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TES01_0070_F10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0039_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0003_A03.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0081_H03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0001_C03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRM1_0168_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ADR01_0009_H09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0090_C12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0008_H12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0002_C01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0052_D11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0013_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0012_E06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0010_E08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0015_E05.b : CGGCG*TTGTTCTCGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGCCCGGAGCC
UTR01_0044_A09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0026_A01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0024_B03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0024_C07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0015_A11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0090_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTT*AAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0044_H06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0011_D07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0017_E12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0092_D07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0033_D12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0086_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0041_B05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0016_B07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0020_C01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0090_F02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0091_H04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
AMP01_0068_B10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0035_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0056_H02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0057_H08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
BFLT1_0022_C04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0087_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
AMP01_0055_D03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0083_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0047_D10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0091_F03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0021_B01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0055_G10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0033_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0035_E05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0109_C04.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0067_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0098_C08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0083_H11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0048_A11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TES01_0065_F12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
AMP01_0010_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0071_F07.b : CGNGCGTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0001_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0107_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0048_G02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0047_D12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0050_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0086_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0046_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
THY01_0064_E11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0002_C04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0012_H12.b : CGNGCGTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0045_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0098_H10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0002_E08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0098_B05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
KDN01_0056_G06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0023_B10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0081_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0020_A12.b : CGGCTGTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
KDN01_0078_H04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
KDN01_0093_G07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0042_G05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0079_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0093_E11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0052_E04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
KDN01_0034_B09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0084_C10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0094_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0062_H03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0074_A08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0070_B05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0099_B10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0090_B06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0056_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0079_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0096_B01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0038_C11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0070_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0067_A12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0011_A01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0072_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0088_D10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0103_A03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0096_B08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0063_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0048_F04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0071_F07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0102_A12.b : CGGCGTTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0061_B01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0039_F04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0093_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0049_E06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0083_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0066_H03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0029_D07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0006_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0096_F12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0068_F06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0062_A04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0064_G01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0067_D02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0038_G12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCGCAATGTCCGGAGCC
MLN01_0072_C03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0043_B09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0098_G07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0095_B02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0098_D05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0015_A03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0002_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0069_C12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0075_D06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0065_H05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0073_G08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0060_C07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0035_B05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0081_H05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0072_D02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRT1_0098_E02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0030_E05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0038_H02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0027_C06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0008_B10.b : CGGCGNTTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTCTCACAATGTCCGGAGCC
MLN01_0081_F09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0005_A01.b : CGGCG*TCGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0038_C06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0042_B02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0080_C04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0089_E03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0072_H09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0097_B02.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0109_F08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0081_A06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0015_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0063_H01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0081_E05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0049_A07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0029_B12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0081_G11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0014_A04.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0019_C06.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0014_C05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0036_G07.b : CGGCGATTGTTCTTGATTCCCGTCGTAACTTAGATGGAGACTTTCACGATGTCCAGAGCC
UTR01_0039_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0032_E03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0028_F07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CBLT1_0030_E10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
KDN01_0017_A12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PST01_0010_C01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0069_E09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0071_A09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0051_F08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0007_A05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0077_A11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0090_F05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0048_A08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SKNB1_0029_A11.b : CGGCG*TTGTTCTTGATCCCTTTCATAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0104_C10.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0092_B11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0011_A05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
TCH01_0094_A03.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVR01_0094_C01.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ILNT1_0010_A12.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
OVRM1_0043_G05.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0096_E11.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0059_D09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
CLNT1_0081_G08.b : CGGNNGTTCTTTTAGAGTCCCGTCGNAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
LNG01_0063_F07.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
MLN01_0060_D10.b : CCGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
UTR01_0035_B08.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0016_D04.b : TCGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
PBL01_0085_C09.b : CGGCG*TTGTTCTTGATTCCCGTCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SPL01_0103_A08.b : xxxxxxxggggttggcctactggCGTAACTTAAAGGGAGACTTTCACAATGTCCGGAGCC
SMG01_0097_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAGACTTTCACAATGTCCGGAGCC
ITT01_0029_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCACAATGTCCGGAGCC
MLN01_0045_B01.b : nggcatgtactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_H07.b : tgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0041_C07.b :
UTR01_0023_E04.b :
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : aggtgttcttgagtcccatctgtcccttggaaggagacgcttcctcctgggagggccacg
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
---------+---------+---------+---------+---------+---------+ 301
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0032_H07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0015_C02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0084_D06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGTAGGAACCCA
UTR01_0063_A08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0079_D03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0020_C05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0020_D07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0004_B12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0099_H10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0072_D05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0095_D01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0076_C12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0078_B02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0038_F12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0003_B04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0076_E06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0004_G08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0003_E04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0107_H12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0051_G01.b : CTCGATGTCC*TACAAATGAAAGAGAAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0086_A08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0076_B11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0072_E07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0058_G02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TES01_0069_H03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0018_A04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0039_G07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0076_D02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0050_C04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0103_E09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0033_E01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0047_B07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0029_E04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0024_H10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0026_F01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0094_G11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BFLT1_0066_D11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0071_D04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0069_B12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0075_D08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TES01_0112_C07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LVRM1_0032_E12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0081_E02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0041_G12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0041_A09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0024_A01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0014_D11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CBLT1_0067_E04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CBLT1_0088_D12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CBLT1_0068_C09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0064_E04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0007_E02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0088_G09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0030_H02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0029_G06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0031_D09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
HTMT1_0021_F07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0116_C08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0097_E07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0011_G06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0048_E09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0006_E04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0097_F09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0081_B06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0087_D09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
HTMT1_0062_H01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0096_A01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0073_B04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0088_D04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0065_H05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CBLT1_0092_F05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0072_A06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTCGCAGCAGGAACCCA
ITT01_0098_C03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0022_F02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0035_A07.b : CTCGATGTCC*TGCAAATGAGAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0069_E12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0021_B08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0080_F01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0040_B07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0052_F06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0026_G04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0044_G04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0108_E11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0107_C10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0066_E01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0027_D03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PTG01_0104_H02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0016_E01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0096_G03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0014_D08.b : CTCGATGTCCGTGCGGATGAAAGATGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0100_C01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0011_D01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0095_A04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0098_F10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0025_A06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0023_H08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0026_F09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0028_D04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0063_G07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0019_B01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0087_G11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0104_B10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0101_A06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0017_G10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0038_G11.b : CTCGATGTCT*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0020_F05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0105_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0090_B12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0064_G10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0134_D12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
HTMT1_0097_E03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0101_E02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0050_C02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0034_A05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0070_E03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0065_D04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0078_G06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0052_C11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0093_H04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0076_B04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0151_G11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0060_E09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0087_G12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0087_G04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0052_F11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0043_G10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0014_E05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0091_B08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPLT1_0050_H08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0058_H10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0026_H10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0054_F08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0008_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0127_D10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0093_A08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0064_H04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BMWN1_0049_D11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0092_F05.b : CTCGATGTCC*TACAAACGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0082_B03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0036_H06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0001_C11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0064_F06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0005_A04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0008_C05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0055_B12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0001_C10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0049_H02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0057_C08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0063_F12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0055_E07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0021_D12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0004_F07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0097_D08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0063_E03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0053_C05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0099_G02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0064_C09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0066_F06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0071_C09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0030_B03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0053_E05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0011_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0022_H07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0076_E12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0020_E06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0041_G11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0084_B08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0001_D01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0011_G05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0062_D07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0063_A02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0035_A03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ADR01_0078_G07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0063_H12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0065_F05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0078_B06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0099_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0042_F11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0075_F09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ADR01_0094_C06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BFLT1_0021_A10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0007_D07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0089_G05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0051_F09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0033_H07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0084_D04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0076_G02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0090_G01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGCCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0030_F04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0038_A06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0072_C11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0080_E10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0063_F08.b : CTCGATGTCC*TGCAAATGAAAGAGGGGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0039_H07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0066_E09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0110_C09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0092_A02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0086_G04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0013_F06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0015_C11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVR01_0080_G09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0109_F08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0003_C03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TES01_0070_F10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0039_E04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0003_A03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0081_H03.b : CTCCATGTCC*TGCAAATGAAAGAAGAAGATGTCCTCCAGTTCCTTGCAGCAAGAACCCA
SKNB1_0001_C03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRM1_0168_B11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ADR01_0009_H09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0090_C12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0008_H12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0002_C01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0052_D11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0013_E04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0012_E06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0010_E08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0015_E05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTCGCAGCAGGAACCCA
UTR01_0044_A09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0026_A01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0024_B03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0024_C07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0015_A11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0090_B11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0044_H06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0011_D07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0017_E12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0092_D07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0033_D12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0086_F09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0041_B05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0016_B07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0020_C01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0090_F02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0091_H04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
AMP01_0068_B10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0035_G12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0056_H02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0057_H08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
BFLT1_0022_C04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0087_A07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
AMP01_0055_D03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0083_B11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0047_D10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0091_F03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0021_B01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0055_G10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0033_F09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0035_E05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0109_C04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0067_E02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0098_C08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0083_H11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0048_A11.b : CCCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TES01_0065_F12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
AMP01_0010_B11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0071_F07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0001_G12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0107_C05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0048_G02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0047_D12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0050_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0086_B12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0046_B11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
THY01_0064_E11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0002_C04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0012_H12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0045_F05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0098_H10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0002_E08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0098_B05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
KDN01_0056_G06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0023_B10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0081_E02.b : CTCGATGTCC*TGCAAATGGAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0020_A12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
KDN01_0078_H04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
KDN01_0093_G07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0042_G05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0079_D05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0093_E11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0052_E04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
KDN01_0034_B09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0084_C10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0094_A07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0062_H03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0074_A08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0070_B05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0099_B10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0090_B06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0056_F05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0079_G12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0096_B01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0038_C11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0070_C05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0067_A12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0011_A01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0072_C05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0088_D10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0103_A03.b : CTCGATGTCT*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0096_B08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0063_E09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0048_F04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0071_F07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0102_A12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0061_B01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0039_F04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0093_F06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0049_E06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0083_A07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0066_H03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0029_D07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0006_E02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0096_F12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0068_F06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0062_A04.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0064_G01.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0067_D02.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0038_G12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0072_C03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0043_B09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0098_G07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0095_B02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0098_D05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0015_A03.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0002_C05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0069_C12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0075_D06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0065_H05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0073_G08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0060_C07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0035_B05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAGCCCA
ITT01_0081_H05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0072_D02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRT1_0098_E02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0030_E05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0038_H02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0027_C06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0008_B10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0081_F09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0005_A01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0038_C06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0042_B02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0080_C04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0089_E03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0072_H09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0097_B02.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGGACCCA
LNG01_0109_F08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0081_A06.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0015_A07.b : CTCGATGCCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0063_H01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0081_E05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0049_A07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0029_B12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0081_G11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0014_A04.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0019_C06.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0014_C05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0036_G07.b : CTCTATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCACCAGGAAACCA
UTR01_0039_E09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0032_E03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0028_F07.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CBLT1_0030_E10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
KDN01_0017_A12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PST01_0010_C01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0069_E09.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0071_A09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0051_F08.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0007_A05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0077_A11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAAGAACCCA
ITT01_0090_F05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0048_A08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SKNB1_0029_A11.b : CTCTATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0104_C10.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0092_B11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0011_A05.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
TCH01_0094_A03.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVR01_0094_C01.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ILNT1_0010_A12.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
OVRM1_0043_G05.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0096_E11.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0059_D09.b : CTCGATATCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
CLNT1_0081_G08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
LNG01_0063_F07.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
MLN01_0060_D10.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0035_B08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0016_D04.b : CTCGATGTAC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
PBL01_0085_C09.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SPL01_0103_A08.b : CTCGATGTCC*TGCAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
SMG01_0097_D11.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
ITT01_0029_E12.b : CTCGATGTCC*TACAAATGAAAGAGGAGGATGTCCTCAAGTTCCTTGCACCACGAACCCA
MLN01_0045_B01.b : xxxxxxxxxxxxxxxxxxgagAGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0050_D08.b : xxxxxxxxxxxxxxxxxxxxxxGAGGAGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0040_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxtgGGATGTCCTCAAGTTCCTTGCAGCAGGAACCCA
UTR01_0041_C07.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_E04.b : gxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0100_D11.b :
SPL01_0026_D12.b :
MLN01_0062_A12.b :
ITT01_0085_F07.b : tgtatggcctgcacatgaacagacgaagatggcctcacagttccttgcatgaggagccca
UTR01_0025_H04.b :
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
---------+---------+---------+---------+---------+---------+ 359
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0032_H07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0015_C02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0084_D06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0063_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0079_D03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0020_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0020_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0004_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0099_H10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0072_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0095_D01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0076_C12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0078_B02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0038_F12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0003_B04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0076_E06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0004_G08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0003_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0107_H12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0051_G01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0086_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0076_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0072_E07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0058_G02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TES01_0069_H03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0018_A04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACNAAAGGAAAAGT
UTR01_0039_G07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0076_D02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0050_C04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0103_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0033_E01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0047_B07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0029_E04.b : CC*TTGGTGGCACCA*ACCTTGGCTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0024_H10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0026_F01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0094_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BFLT1_0066_D11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0071_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0069_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0075_D08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TES01_0112_C07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LVRM1_0032_E12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATTTACAAAAGGAAAAGT
BMWN1_0081_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0041_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0041_A09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0024_A01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0014_D11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CBLT1_0067_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CBLT1_0088_D12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CBLT1_0068_C09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0064_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0007_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0088_G09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0030_H02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0029_G06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0031_D09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
HTMT1_0021_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0116_C08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0097_E07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0011_G06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0048_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0006_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0097_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0081_B06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0087_D09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
HTMT1_0062_H01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0096_A01.b : CC*TTGGTGGCACCA*ACCTCGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0073_B04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0088_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0065_H05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CBLT1_0092_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0072_A06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0098_C03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0022_F02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0035_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0069_E12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0021_B08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0080_F01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0040_B07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0052_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0026_G04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0044_G04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0108_E11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0107_C10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0066_E01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0027_D03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PTG01_0104_H02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0016_E01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0096_G03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0014_D08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAGTGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0100_C01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0011_D01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0095_A04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0098_F10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0025_A06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0023_H08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTTCATCTACAAAAGGAAAAGT
UTR01_0026_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0028_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0063_G07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0019_B01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0087_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0104_B10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0101_A06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0017_G10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0038_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0020_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0105_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0090_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0064_G10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0134_D12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
HTMT1_0097_E03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0101_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0050_C02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0034_A05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0070_E03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0065_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0078_G06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0052_C11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0093_H04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0076_B04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0151_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0060_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0087_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0087_G04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0052_F11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0043_G10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0014_E05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0091_B08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPLT1_0050_H08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0058_H10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0026_H10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACCGTACATCTACAAAAGGAAAAGT
BMWN1_0054_F08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0008_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0127_D10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0093_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0064_H04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BMWN1_0049_D11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0092_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0082_B03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0036_H06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0001_C11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0064_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0005_A04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0008_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0055_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0001_C10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0049_H02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0057_C08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0063_F12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0055_E07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0021_D12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0004_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0097_D08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0063_E03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0053_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0099_G02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0064_C09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0066_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0071_C09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0030_B03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0053_E05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0011_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0022_H07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0076_E12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0020_E06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0041_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0084_B08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0001_D01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCGAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0011_G05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0062_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0063_A02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0035_A03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ADR01_0078_G07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0063_H12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0065_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0078_B06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0099_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0042_F11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0075_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ADR01_0094_C06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BFLT1_0021_A10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0007_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0089_G05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0051_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0033_H07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0084_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0076_G02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACACCTACAAAAGGAAAAGT
MLN01_0090_G01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0030_F04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0038_A06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0072_C11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0080_E10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0063_F08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0039_H07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0066_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0110_C09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0092_A02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0086_G04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0013_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0015_C11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVR01_0080_G09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAGAGGAAAAGT
THY01_0109_F08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0003_C03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TES01_0070_F10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0039_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0003_A03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0081_H03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACCAAAGGAAAAGT
SKNB1_0001_C03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRM1_0168_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ADR01_0009_H09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0090_C12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0008_H12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0002_C01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0052_D11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0013_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0012_E06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0010_E08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0015_E05.b : CC*TCGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0044_A09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0026_A01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0024_B03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0024_C07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0015_A11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0090_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0044_H06.b : CC*TTGGTGGCACCA*ACCCTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0011_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0017_E12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACNAAAGGAAAAGT
MLN01_0092_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0033_D12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0086_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0041_B05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0016_B07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0020_C01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0090_F02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0091_H04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
AMP01_0068_B10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0035_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0056_H02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0057_H08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
BFLT1_0022_C04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0087_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
AMP01_0055_D03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0083_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0047_D10.b : CC*TTGGTGGCGCCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0091_F03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0021_B01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0055_G10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0033_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0035_E05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0109_C04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0067_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0098_C08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0083_H11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0048_A11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TES01_0065_F12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
AMP01_0010_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0071_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0001_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0107_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0048_G02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0047_D12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0050_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0086_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0046_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
THY01_0064_E11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0002_C04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0012_H12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0045_F05.b : CC*TTGGTGCCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0098_H10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0002_E08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0098_B05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
KDN01_0056_G06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0023_B10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0081_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0020_A12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
KDN01_0078_H04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
KDN01_0093_G07.b : CC*TTGGTGGCACCA*ACCTTGGCTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0042_G05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0079_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0093_E11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0052_E04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
KDN01_0034_B09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0084_C10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0094_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0062_H03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAGAGT
SKNB1_0074_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0070_B05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0099_B10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0090_B06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0056_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0079_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0096_B01.b : CCGTTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0038_C11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0070_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0067_A12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0011_A01.b : CC*TTGGTGGCACCG*ACCTTGACTTCCAAATGGGACAGTACATCTACAAAAGGAAAAGT
LNG01_0072_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0088_D10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0103_A03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0096_B08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0063_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0048_F04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0071_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0102_A12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0061_B01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0039_F04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0093_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0049_E06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0083_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0066_H03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0029_D07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0006_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0096_F12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0068_F06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0062_A04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0064_G01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0067_D02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0038_G12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0072_C03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0043_B09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0098_G07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0095_B02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0098_D05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0015_A03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0002_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0069_C12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0075_D06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0065_H05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0073_G08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0060_C07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0035_B05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0081_H05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0072_D02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRT1_0098_E02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0030_E05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0038_H02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0027_C06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0008_B10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0081_F09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0005_A01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0038_C06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0042_B02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0080_C04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0089_E03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0072_H09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0097_B02.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0109_F08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0081_A06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0015_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0063_H01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0081_E05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0049_A07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0029_B12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0081_G11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0014_A04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0019_C06.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0014_C05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0036_G07.b : CC*TTGATGGCACCATACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0039_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0032_E03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0028_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CBLT1_0030_E10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
KDN01_0017_A12.b : CC*TTGGTGGCACCG*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PST01_0010_C01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0069_E09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0071_A09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0051_F08.b : CC*TTGGTGGTACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0007_A05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0077_A11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACCAAAGGAAAAGT
ITT01_0090_F05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0048_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SKNB1_0029_A11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0104_C10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0092_B11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0011_A05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
TCH01_0094_A03.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVR01_0094_C01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ILNT1_0010_A12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
OVRM1_0043_G05.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0096_E11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0059_D09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
CLNT1_0081_G08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
LNG01_0063_F07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0060_D10.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0035_B08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0016_D04.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
PBL01_0085_C09.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SPL01_0103_A08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
SMG01_0097_D11.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
ITT01_0029_E12.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
MLN01_0045_B01.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0050_D08.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0040_H07.b : CC*TTGGTGGCACCA*ACCTTGACTTCCAAATGGAACAGTACATCTACAAAAGGAAAAGT
UTR01_0041_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACATCTACAAAAGGAAAAGT
UTR01_0023_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
SKNB1_0100_D11.b :
SPL01_0026_D12.b : gctttttgggtggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_A12.b : nnntggctaggactatgacagtttgtacxxxxxx
ITT01_0085_F07.b : ccgttgatcggcacccatcttgacttccaaatgacacagtagtgctccccccggataagt
UTR01_0025_H04.b : gggtggacxxxxxxxxxx
BFLT1_0061_H10.b :
BMWN1_0032_B11.b :
20110601C-000130 : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
---------+---------+---------+---------+---------+---------+ 419
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0032_H07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0015_C02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0084_D06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0063_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0079_D03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0020_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0020_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0004_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0099_H10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0072_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0095_D01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0076_C12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0078_B02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0038_F12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0003_B04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0076_E06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0004_G08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0003_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0107_H12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0051_G01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0086_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0076_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0072_E07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0058_G02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TES01_0069_H03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0018_A04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0039_G07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0076_D02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0050_C04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0103_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0033_E01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0047_B07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0029_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0024_H10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0026_F01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0094_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCCGGGAGAAACTTCTGTTGGCGGCTCGT
BFLT1_0066_D11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0071_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0069_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0075_D08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TES01_0112_C07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LVRM1_0032_E12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0081_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0041_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0041_A09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0024_A01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0014_D11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CBLT1_0067_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CBLT1_0088_D12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CBLT1_0068_C09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0064_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0007_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGC
UTR01_0088_G09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0030_H02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0029_G06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0031_D09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
HTMT1_0021_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0116_C08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0097_E07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0011_G06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0048_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0006_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0097_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0081_B06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0087_D09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
HTMT1_0062_H01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0096_A01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0073_B04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0088_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0065_H05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CBLT1_0092_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0072_A06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0098_C03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0022_F02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0035_A07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0069_E12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0021_B08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0080_F01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0040_B07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0052_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0026_G04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0044_G04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0108_E11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0107_C10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0066_E01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0027_D03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PTG01_0104_H02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0016_E01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0096_G03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0014_D08.b : GATGGCATCTACATGATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0100_C01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0011_D01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0095_A04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0098_F10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0025_A06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0023_H08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0026_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0028_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0063_G07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0019_B01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0087_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0104_B10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0101_A06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0017_G10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0038_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0020_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0105_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0090_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0064_G10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0134_D12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
HTMT1_0097_E03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0101_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0050_C02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0034_A05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0070_E03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0065_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0078_G06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGTGGCTCGT
SMG01_0052_C11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0093_H04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0076_B04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0151_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0060_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0087_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0087_G04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0052_F11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0043_G10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0014_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0091_B08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPLT1_0050_H08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0058_H10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0026_H10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0054_F08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0008_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0127_D10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0093_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0064_H04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BMWN1_0049_D11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0092_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0082_B03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0036_H06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0001_C11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0064_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0005_A04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0008_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0055_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0001_C10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0049_H02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0057_C08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0063_F12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0055_E07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0021_D12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0004_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0097_D08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0063_E03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0053_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0099_G02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0064_C09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0066_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0071_C09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0030_B03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0053_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0011_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0022_H07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0076_E12.b : GATGGCATCTACGTCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0020_E06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0041_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0084_B08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0001_D01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0011_G05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0062_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0063_A02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0035_A03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ADR01_0078_G07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0063_H12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0065_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0078_B06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0099_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0042_F11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0075_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ADR01_0094_C06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BFLT1_0021_A10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0007_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0089_G05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0051_F09.b : GATGGCATCTACATCATAAATTTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0033_H07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0084_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0076_G02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0090_G01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0030_F04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0038_A06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0072_C11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0080_E10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0063_F08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0039_H07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0066_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0110_C09.b : GATGGCATCTACATCATAAATCCGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0092_A02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0086_G04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0013_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0015_C11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVR01_0080_G09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0109_F08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0003_C03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TES01_0070_F10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0039_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0003_A03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0081_H03.b : GATGGCATCTACATCATAAATCTGAAGAAAACCTGGGAAAAACTTCTGGTGGCCGCTCGT
SKNB1_0001_C03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRM1_0168_B11.b : GATGGCATCTACATCATAGATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ADR01_0009_H09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0090_C12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0008_H12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0002_C01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0052_D11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0013_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0012_E06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0010_E08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0015_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0044_A09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0026_A01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0024_B03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0024_C07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0015_A11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0090_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0044_H06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0011_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0017_E12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0092_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0033_D12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0086_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0041_B05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0016_B07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0020_C01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0090_F02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0091_H04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
AMP01_0068_B10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0035_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0056_H02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0057_H08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
BFLT1_0022_C04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0087_A07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
AMP01_0055_D03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0083_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0047_D10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0091_F03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0021_B01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0055_G10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0033_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0035_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0109_C04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0067_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0098_C08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0083_H11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0048_A11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TES01_0065_F12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
AMP01_0010_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0071_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0001_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0107_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0048_G02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0047_D12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0050_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0086_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0046_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
THY01_0064_E11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0002_C04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0012_H12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0045_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0098_H10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0002_E08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0098_B05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
KDN01_0056_G06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0023_B10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0081_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0020_A12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
KDN01_0078_H04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
KDN01_0093_G07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0042_G05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0079_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0093_E11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0052_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
KDN01_0034_B09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0084_C10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0094_A07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0062_H03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0074_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0070_B05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0099_B10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0090_B06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0056_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0079_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0096_B01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0038_C11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0070_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0067_A12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0011_A01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0072_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0088_D10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0103_A03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0096_B08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0063_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0048_F04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0071_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0102_A12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0061_B01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0039_F04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0093_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0049_E06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0083_A07.b : GATGGCATCTACATCACAAATCTGAAGAGAACCTGGGAAAAACTTCTGTTGGCGGCTCGT
PBL01_0066_H03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTCCTGTTGGCGGCTCGT
ITT01_0029_D07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0006_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0096_F12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0068_F06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0062_A04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0064_G01.b : GATGGCATCTACATCATAAATCTGAAGAGGACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0067_D02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0038_G12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0072_C03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0043_B09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0098_G07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0095_B02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0098_D05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0015_A03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0002_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0069_C12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0075_D06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0065_H05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0073_G08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0060_C07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0035_B05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0081_H05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0072_D02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRT1_0098_E02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0030_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0038_H02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0027_C06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0008_B10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0081_F09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0005_A01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGTGGCTCGT
MLN01_0038_C06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0042_B02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0080_C04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0089_E03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0072_H09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0097_B02.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0109_F08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0081_A06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0015_A07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0063_H01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0081_E05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0049_A07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0029_B12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0081_G11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0014_A04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0019_C06.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0014_C05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0036_G07.b : GATGGCATCTACATCATAAATCTGAATAGAACCTGGGACAAACTTCTGTTGGCGGCTCGT
UTR01_0039_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0032_E03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGCTGGCGGCTCGT
SKNB1_0028_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CBLT1_0030_E10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
KDN01_0017_A12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PST01_0010_C01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0069_E09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0071_A09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0051_F08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0007_A05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0077_A11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0090_F05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0048_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0029_A11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0104_C10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0092_B11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0011_A05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
TCH01_0094_A03.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVR01_0094_C01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ILNT1_0010_A12.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
OVRM1_0043_G05.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0096_E11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0059_D09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
CLNT1_0081_G08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
LNG01_0063_F07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
MLN01_0060_D10.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0035_B08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0016_D04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
PBL01_0085_C09.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SPL01_0103_A08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SMG01_0097_D11.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
ITT01_0029_E12.b : GATGGCATCTACATCATAAATCTAAAGAGAACCTGGGAGAAACTTCTGTTGGCAGCTCGT
MLN01_0045_B01.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0050_D08.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0040_H07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0041_C07.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
UTR01_0023_E04.b : GATGGCATCTACATCATAAATCTGAAGAGAACCTGGGAGAAACTTCTGTTGGCGGCTCGT
SKNB1_0100_D11.b : nnnncctcacgctggctcggctgagagacctgggagAACTTCTGTTGGCGGCTCGT
SPL01_0026_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTTGGCGGCTCGT
MLN01_0062_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTTGGCGGCTCGT
ITT01_0085_F07.b : gatggcctctacatggcaaatcgtatgagaagctgttagagtcttcgggtggctgaTCGT
UTR01_0025_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0061_H10.b : aattccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0032_B11.b :
20110601C-000130 : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
---------+---------+---------+---------+---------+---------+ 478
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0032_H07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0015_C02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0084_D06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0063_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0079_D03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0020_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0020_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0004_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0099_H10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0072_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0095_D01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0076_C12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0078_B02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0038_F12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0003_B04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0076_E06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0004_G08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0003_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCCCCAGGAATACTGG
PBL01_0107_H12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0051_G01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0086_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0076_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0072_E07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0058_G02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TES01_0069_H03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0018_A04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0039_G07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0076_D02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0050_C04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0103_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0033_E01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0047_B07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0029_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0024_H10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0026_F01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0094_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BFLT1_0066_D11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0071_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0069_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0075_D08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TES01_0112_C07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LVRM1_0032_E12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0081_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0041_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0041_A09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0024_A01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0014_D11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CBLT1_0067_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CBLT1_0088_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CBLT1_0068_C09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0064_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0007_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0088_G09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0030_H02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0029_G06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0031_D09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
HTMT1_0021_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0116_C08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0097_E07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0011_G06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0048_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0006_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0097_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0081_B06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0087_D09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
HTMT1_0062_H01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0096_A01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0073_B04.b : GCCATCGTTGCCATT*GAAAACC*AGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0088_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0065_H05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CBLT1_0092_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0072_A06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0098_C03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0022_F02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0035_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0069_E12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0021_B08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0080_F01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0040_B07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0052_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0026_G04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0044_G04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0108_E11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0107_C10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0066_E01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0027_D03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PTG01_0104_H02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0016_E01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0096_G03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0014_D08.b : GCCATCGGTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0100_C01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0011_D01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0095_A04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0098_F10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0025_A06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0023_H08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0026_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0028_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0063_G07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0019_B01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0087_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0104_B10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0101_A06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0017_G10.b : GCCATTGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0038_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0020_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0105_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0090_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0064_G10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0134_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
HTMT1_0097_E03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0101_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0050_C02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0034_A05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0070_E03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0065_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0078_G06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0052_C11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0093_H04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0076_B04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0151_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0060_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0087_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0087_G04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0052_F11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0043_G10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0014_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0091_B08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPLT1_0050_H08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0058_H10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0026_H10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0054_F08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0008_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0127_D10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0093_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0064_H04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0049_D11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0092_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0082_B03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0036_H06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0001_C11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0064_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0005_A04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAAGAATACTGG
ITT01_0008_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0055_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0001_C10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0049_H02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0057_C08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0063_F12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0055_E07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0021_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0004_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0097_D08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0063_E03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0053_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0099_G02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0064_C09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0066_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0071_C09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0030_B03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0053_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0011_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0022_H07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0076_E12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0020_E06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0041_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0084_B08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0001_D01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0011_G05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0062_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0063_A02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TCH01_0035_A03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ADR01_0078_G07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0063_H12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0065_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0078_B06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0099_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0042_F11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0075_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ADR01_0094_C06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BFLT1_0021_A10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0007_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0089_G05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0051_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0033_H07.b : GCCGTCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0084_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TCH01_0076_G02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0090_G01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0030_F04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0038_A06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0072_C11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0080_E10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0063_F08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0039_H07.b : GCCATTGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0066_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0110_C09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0092_A02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0086_G04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0013_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0015_C11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVR01_0080_G09.b : GCCATCGTTGCCATTTGAAAACCCAGCCGATGTCAGTGTCATATCCCCCAGGAATACTGG
THY01_0109_F08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0003_C03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATACCCTCCAGGAATACTGG
TES01_0070_F10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0039_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0003_A03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0081_H03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0001_C03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRM1_0168_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ADR01_0009_H09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0090_C12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0008_H12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0002_C01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0052_D11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0013_E04.b : GCCATCGTTGCCATT*GAGAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0012_E06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0010_E08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0015_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0044_A09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0026_A01.b : GCCATCGTTGCCATT*GAAAACCCTGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0024_B03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0024_C07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0015_A11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0090_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0044_H06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0011_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0017_E12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0092_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0033_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0086_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0041_B05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0016_B07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0020_C01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0090_F02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0091_H04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
AMP01_0068_B10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0035_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0056_H02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0057_H08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BFLT1_0022_C04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0087_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
AMP01_0055_D03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0083_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0047_D10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0091_F03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0021_B01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0055_G10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0033_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0035_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0109_C04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0067_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0098_C08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0083_H11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0048_A11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TES01_0065_F12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
AMP01_0010_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0071_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0001_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0107_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0048_G02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0047_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0050_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0086_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0046_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
THY01_0064_E11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0002_C04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0012_H12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0045_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0098_H10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0002_E08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0098_B05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
KDN01_0056_G06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0023_B10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0081_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0020_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
KDN01_0078_H04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
KDN01_0093_G07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0042_G05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0079_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0093_E11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0052_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
KDN01_0034_B09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0084_C10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0094_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0062_H03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0074_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0070_B05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0099_B10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0090_B06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCTGTGTCATATCCTCCAGGAATACTGG
TCH01_0056_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0079_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0096_B01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0038_C11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0070_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0067_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0011_A01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0072_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0088_D10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0103_A03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0096_B08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TCH01_0063_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0048_F04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0071_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0102_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0061_B01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0039_F04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0093_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0049_E06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0083_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0066_H03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0029_D07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGC
ITT01_0006_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0096_F12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0068_F06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0062_A04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0064_G01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0067_D02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0038_G12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0072_C03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0043_B09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0098_G07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0095_B02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0098_D05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0015_A03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0002_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0069_C12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0075_D06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0065_H05.b : GCCATCGTTGCCATT*GAAAACCTAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0073_G08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0060_C07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTTCAGGAATACTGG
MLN01_0035_B05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0081_H05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0072_D02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRT1_0098_E02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0030_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0038_H02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0027_C06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0008_B10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0081_F09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0005_A01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0038_C06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0042_B02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0080_C04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0089_E03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0072_H09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0097_B02.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0109_F08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0081_A06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0015_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0063_H01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0081_E05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0049_A07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0029_B12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0081_G11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0014_A04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0019_C06.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0014_C05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0036_G07.b : GCCATCGTTGCCATT*GAAAACCAAGCCGATGTCAGTGTCATATCCTCCAAGAATACTGG
UTR01_0039_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0032_E03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0028_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CBLT1_0030_E10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
KDN01_0017_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PST01_0010_C01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0069_E09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0071_A09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0051_F08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0007_A05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0077_A11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0090_F05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0048_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0029_A11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0104_C10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0092_B11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TCH01_0011_A05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
TCH01_0094_A03.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVR01_0094_C01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ILNT1_0010_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
OVRM1_0043_G05.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0096_E11.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0059_D09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
CLNT1_0081_G08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
LNG01_0063_F07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0060_D10.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0035_B08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0016_D04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
PBL01_0085_C09.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0103_A08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SMG01_0097_D11.b : GCCATCGTTGCCACT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0029_E12.b : GCCATCGTTGCCATT*GAAAACCCACCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0045_B01.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0050_D08.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0040_H07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0041_C07.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
UTR01_0023_E04.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SKNB1_0100_D11.b : GCCATCGTTGCCAAT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
SPL01_0026_D12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
MLN01_0062_A12.b : GCCATCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
ITT01_0085_F07.b : GCCATTCTGTCCATT*GAGAACGCCTCCGATGTCATTGTCATATCCTCCAGGAATACTGG
UTR01_0025_H04.b : xxxxTCGTTGCCATT*GAAAACCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BFLT1_0061_H10.b : xxxxxxxxxxxxxxxxxxxxxCCCAGCCGATGTCAGTGTCATATCCTCCAGGAATACTGG
BMWN1_0032_B11.b :
20110601C-000130 : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
---------+---------+---------+---------+---------+---------+ 537
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0032_H07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0015_C02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0084_D06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0063_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0079_D03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0020_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0020_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0004_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0099_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0072_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0095_D01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0076_C12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0078_B02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0038_F12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0003_B04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0076_E06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0004_G08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0003_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0107_H12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0051_G01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0086_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0076_B11.b : CCAACGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0072_E07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0058_G02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TES01_0069_H03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0018_A04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0039_G07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0076_D02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0050_C04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0103_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0033_E01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0047_B07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0029_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0024_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0026_F01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0094_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BFLT1_0066_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0071_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0069_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0075_D08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TES01_0112_C07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LVRM1_0032_E12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0081_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0041_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0041_A09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0024_A01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0014_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CBLT1_0067_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CBLT1_0088_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CBLT1_0068_C09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0064_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0007_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0088_G09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0030_H02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0029_G06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0031_D09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
HTMT1_0021_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0116_C08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0097_E07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0011_G06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0048_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0006_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0097_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0081_B06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0087_D09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
HTMT1_0062_H01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0096_A01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0073_B04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0088_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0065_H05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CBLT1_0092_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0072_A06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0098_C03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0022_F02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0035_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0069_E12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0021_B08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0080_F01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0040_B07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0052_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0026_G04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0044_G04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0108_E11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0107_C10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0066_E01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0027_D03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PTG01_0104_H02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0016_E01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0096_G03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0014_D08.b : CCAGCGAGCTGTGCTGAAATTTGCTGCTGCCACTGGAACCACTC*GTATTGCTGGCCGCT
BMWN1_0100_C01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0011_D01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0095_A04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0098_F10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0025_A06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0023_H08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0026_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0028_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0063_G07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0019_B01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0087_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0104_B10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0101_A06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0017_G10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0038_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0020_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0105_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0090_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0064_G10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0134_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
HTMT1_0097_E03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0101_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0050_C02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0034_A05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0070_E03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0065_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0078_G06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0052_C11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0093_H04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0076_B04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0151_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0060_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0087_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0087_G04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0052_F11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0043_G10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0014_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0091_B08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPLT1_0050_H08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0058_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0026_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0054_F08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0008_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0127_D10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGTCGCT
MLN01_0093_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0064_H04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0049_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0092_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0082_B03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0036_H06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0001_C11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0064_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0005_A04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0008_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0055_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0001_C10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0049_H02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0057_C08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0063_F12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0055_E07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0021_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0004_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0097_D08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0063_E03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0053_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0099_G02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0064_C09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0066_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0071_C09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0030_B03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0053_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0011_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0022_H07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0076_E12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGGGCCACTC*CTATTGCTGGCCGCT
ITT01_0020_E06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0041_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0084_B08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0001_D01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0011_G05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0062_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0063_A02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0035_A03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ADR01_0078_G07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0063_H12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0065_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0078_B06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0099_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0042_F11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0075_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ADR01_0094_C06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BFLT1_0021_A10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0007_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0089_G05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0051_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0033_H07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0084_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0076_G02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGTT
MLN01_0090_G01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0030_F04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0038_A06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0072_C11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0080_E10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0063_F08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0039_H07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0066_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0110_C09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0092_A02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0086_G04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0013_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0015_C11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVR01_0080_G09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTCCCTATTGCTGGCCGCT
THY01_0109_F08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0003_C03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TES01_0070_F10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0039_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0003_A03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0081_H03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0001_C03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRM1_0168_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ADR01_0009_H09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0090_C12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0008_H12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0002_C01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0052_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0013_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0012_E06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0010_E08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0015_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0044_A09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0026_A01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0024_B03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0024_C07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0015_A11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0090_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0044_H06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0011_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0017_E12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGAAGCCACTC*CTATTGCTGGCCGCT
MLN01_0092_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0033_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0086_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0041_B05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0016_B07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0020_C01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0090_F02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0091_H04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
AMP01_0068_B10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0035_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACCGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0056_H02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0057_H08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BFLT1_0022_C04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0087_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
AMP01_0055_D03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCC
MLN01_0083_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0047_D10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0091_F03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0021_B01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0055_G10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0033_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0035_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0109_C04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0067_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0098_C08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0083_H11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0048_A11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TES01_0065_F12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
AMP01_0010_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0071_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0001_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0107_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0048_G02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0047_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0050_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCAGCT
PST01_0086_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0046_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
THY01_0064_E11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0002_C04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0012_H12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0045_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0098_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0002_E08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0098_B05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
KDN01_0056_G06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0023_B10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0081_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0020_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
KDN01_0078_H04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
KDN01_0093_G07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0042_G05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCTGCT
LNG01_0079_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0093_E11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0052_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
KDN01_0034_B09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0084_C10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0094_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0062_H03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0074_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0070_B05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0099_B10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0090_B06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0056_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0079_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0096_B01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0038_C11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0070_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0067_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0011_A01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0072_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0088_D10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0103_A03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0096_B08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0063_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0048_F04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0071_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0102_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0061_B01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0039_F04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0093_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0049_E06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0083_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0066_H03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0029_D07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0006_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0096_F12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0068_F06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0062_A04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0064_G01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0067_D02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0038_G12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0072_C03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0043_B09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0098_G07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0095_B02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0098_D05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0015_A03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0002_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0069_C12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0075_D06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0065_H05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0073_G08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0060_C07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0035_B05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0081_H05.b : CCAGCGAGCTGTGCTGAAGTTTGTTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0072_D02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRT1_0098_E02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0030_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0038_H02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0027_C06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0008_B10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0081_F09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0005_A01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0038_C06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0042_B02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0080_C04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0089_E03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0072_H09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0097_B02.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0109_F08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0081_A06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0015_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0063_H01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0081_E05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0049_A07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0029_B12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0081_G11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0014_A04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0019_C06.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0014_C05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0036_G07.b : CCAGCGAGCTGAGCTGTAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0039_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0032_E03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0028_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CBLT1_0030_E10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
KDN01_0017_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PST01_0010_C01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0069_E09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0071_A09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0051_F08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0007_A05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0077_A11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0090_F05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0048_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0029_A11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0104_C10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0092_B11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0011_A05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
TCH01_0094_A03.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVR01_0094_C01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ILNT1_0010_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
OVRM1_0043_G05.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0096_E11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0059_D09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
CLNT1_0081_G08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
LNG01_0063_F07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0060_D10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0035_B08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0016_D04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
PBL01_0085_C09.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0103_A08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SMG01_0097_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0029_E12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0045_B01.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0050_D08.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0040_H07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0041_C07.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
UTR01_0023_E04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SKNB1_0100_D11.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
SPL01_0026_D12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
MLN01_0062_A12.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
ITT01_0085_F07.b : CCATCGAGCTGTGCTGAGGATTGCTGCTGCCACTGGAGCCACTC*CTATTGATGGCCGCT
UTR01_0025_H04.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BFLT1_0061_H10.b : CCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACTGGAGCCACTC*CTATTGCTGGCCGCT
BMWN1_0032_B11.b : ttttttcgagagt
20110601C-000130 : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
---------+---------+---------+---------+---------+---------+ 596
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0032_H07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0015_C02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0084_D06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0063_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0079_D03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0020_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0020_D07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0004_B12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0099_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0072_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0095_D01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0076_C12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0078_B02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0038_F12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0003_B04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0076_E06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0004_G08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0003_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0107_H12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0051_G01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0086_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0076_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0072_E07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0058_G02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TES01_0069_H03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0018_A04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0039_G07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0076_D02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0050_C04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0103_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0033_E01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0047_B07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0029_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0024_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0026_F01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0094_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BFLT1_0066_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0071_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0069_B12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0075_D08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TES01_0112_C07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LVRM1_0032_E12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0081_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0041_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0041_A09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0024_A01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0014_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CBLT1_0067_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CBLT1_0088_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CBLT1_0068_C09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0064_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0007_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0088_G09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0030_H02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0029_G06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0031_D09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
HTMT1_0021_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0116_C08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0097_E07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0011_G06.b : TCACTCCTGGAACC*TTCACTAACCAGACCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0048_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0006_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0097_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0081_B06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0087_D09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
HTMT1_0062_H01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0096_A01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0073_B04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0088_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0065_H05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CBLT1_0092_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0072_A06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0098_C03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0022_F02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0035_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0069_E12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0021_B08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0080_F01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0040_B07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0052_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0026_G04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0044_G04.b : TCACACCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0108_E11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0107_C10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0066_E01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0027_D03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PTG01_0104_H02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0016_E01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0096_G03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0014_D08.b : TCACTCCAGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0100_C01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0011_D01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0095_A04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0098_F10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0025_A06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0023_H08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0026_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0028_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0063_G07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0019_B01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0087_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0104_B10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0101_A06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0017_G10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0038_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0020_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0105_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0090_B12.b : TCACTCCTGGAACC*TCCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0064_G10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0134_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
HTMT1_0097_E03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0101_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0050_C02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0034_A05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0070_E03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0065_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0078_G06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0052_C11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0093_H04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0076_B04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0151_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0060_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0087_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0087_G04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0052_F11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0043_G10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0014_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0091_B08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPLT1_0050_H08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0058_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAAGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0026_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0054_F08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0008_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0127_D10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0093_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0064_H04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0049_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0092_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0082_B03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0036_H06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0001_C11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0064_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0005_A04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0008_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0055_B12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0001_C10.b : TCACTCCTGGGACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0049_H02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0057_C08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0063_F12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0055_E07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0021_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0004_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0097_D08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0063_E03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0053_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0099_G02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0064_C09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0066_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0071_C09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0030_B03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0053_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0011_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0022_H07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0076_E12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0020_E06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0041_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0084_B08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0001_D01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0011_G05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0062_D07.b : TCGCTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0063_A02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0035_A03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ADR01_0078_G07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0063_H12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0065_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0078_B06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0099_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0042_F11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0075_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ADR01_0094_C06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BFLT1_0021_A10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0007_D07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0089_G05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0051_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0033_H07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCCTCCGGGAGCCAAGACTTCTG
LNG01_0084_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0076_G02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCCTCCGGGAGCCAAGACTTCTG
MLN01_0090_G01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0030_F04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0038_A06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0072_C11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0080_E10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0063_F08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0039_H07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0066_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0110_C09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0092_A02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0086_G04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0013_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0015_C11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVR01_0080_G09.b : TCACTCCTGGAACCTTTCACTAACCAGATCCCGGCAGCCTTTCGGGAACCAAGACTTCTG
THY01_0109_F08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0003_C03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TES01_0070_F10.b : CCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0039_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0003_A03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0081_H03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0001_C03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGCAGCCAAGACTTCTG
OVRM1_0168_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ADR01_0009_H09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0090_C12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0008_H12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0002_C01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0052_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0013_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0012_E06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0010_E08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0015_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0044_A09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0026_A01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0024_B03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0024_C07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0015_A11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0090_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0044_H06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0011_D07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0017_E12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0092_D07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0033_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGTCAAGACTTCTG
LNG01_0086_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0041_B05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0016_B07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0020_C01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0090_F02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAAACTTCTG
UTR01_0091_H04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
AMP01_0068_B10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0035_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0056_H02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0057_H08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BFLT1_0022_C04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0087_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
AMP01_0055_D03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0083_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0047_D10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0091_F03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0021_B01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0055_G10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0033_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0035_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0109_C04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0067_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0098_C08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0083_H11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0048_A11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TES01_0065_F12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
AMP01_0010_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0071_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0001_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0107_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0048_G02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0047_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0050_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0086_B12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0046_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCTAGGCAGCCTTCCGGGAGCCAAGACTTCTG
THY01_0064_E11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0002_C04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0012_H12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCATGACTTCTG
PST01_0045_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0098_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0002_E08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0098_B05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
KDN01_0056_G06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0023_B10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0081_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0020_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
KDN01_0078_H04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
KDN01_0093_G07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0042_G05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0079_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0093_E11.b : TCACTCCTGGAGCC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0052_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
KDN01_0034_B09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0084_C10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0094_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0062_H03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0074_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0070_B05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0099_B10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0090_B06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0056_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0079_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0096_B01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0038_C11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0070_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0067_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0011_A01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0072_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0088_D10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0103_A03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0096_B08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0063_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0048_F04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0071_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0102_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0061_B01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0039_F04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0093_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0049_E06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0083_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0066_H03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0029_D07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0006_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0096_F12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0068_F06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0062_A04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0064_G01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0067_D02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0038_G12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0072_C03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0043_B09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0098_G07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0095_B02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0098_D05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0015_A03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0002_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0069_C12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0075_D06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0065_H05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0073_G08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0060_C07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0035_B05.b : TCACTCCTGGAACC*TTCACTAACAAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0081_H05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0072_D02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRT1_0098_E02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0030_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0038_H02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0027_C06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0008_B10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0081_F09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0005_A01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0038_C06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0042_B02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0080_C04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0089_E03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0072_H09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0097_B02.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0109_F08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0081_A06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0015_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0063_H01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0081_E05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0049_A07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0029_B12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0081_G11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0014_A04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0019_C06.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0014_C05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0036_G07.b : TCAGTCCTGGAAGC*TTCACTAACCAGATCCAGGCAGCCTTCCTGGAGCCAAGACTTCTG
UTR01_0039_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0032_E03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0028_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CBLT1_0030_E10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
KDN01_0017_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PST01_0010_C01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0069_E09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0071_A09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0051_F08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0007_A05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0077_A11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0090_F05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0048_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0029_A11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0104_C10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0092_B11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0011_A05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
TCH01_0094_A03.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVR01_0094_C01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ILNT1_0010_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
OVRM1_0043_G05.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0096_E11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0059_D09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
CLNT1_0081_G08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
LNG01_0063_F07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0060_D10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0035_B08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0016_D04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
PBL01_0085_C09.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0103_A08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SMG01_0097_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0029_E12.b : TCACTCCTGGAACC*TTCACTAACCATATCCAGGCACCCTTCCGGGAGCCAAGACTTCTG
MLN01_0045_B01.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0050_D08.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0040_H07.b : TCACTCCTGGAACC*TTCACTTACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0041_C07.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
UTR01_0023_E04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SKNB1_0100_D11.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
SPL01_0026_D12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
MLN01_0062_A12.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
ITT01_0085_F07.b : TCACTCCTGGAAGC*TTCCCTAACCACATCCAAGCAGCCTTCCAGGAGCCAAGACTTCTG
UTR01_0025_H04.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BFLT1_0061_H10.b : TCACTCCTGGAACC*TTCACTAACCAGATCCAGGCAGCCTTCCGGGAGCCAAGACTTCTG
BMWN1_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACTTCTG
20110601C-000130 : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
---------+---------+---------+---------+---------+---------+ 654
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0032_H07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0015_C02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0084_D06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0063_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0079_D03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0020_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0020_D07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0004_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0099_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0072_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0095_D01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0076_C12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0078_B02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0038_F12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0003_B04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0076_E06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0004_G08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0003_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0107_H12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0051_G01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0086_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0076_B11.b : GTG*GTTACTGATCCCGGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0072_E07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0058_G02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TES01_0069_H03.b : GTG*GTTACTGATCCCAGAGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0018_A04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0039_G07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0076_D02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0050_C04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0103_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0033_E01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0047_B07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCGCAGA*GGCCTCTTATGTTAACC
ITT01_0029_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGG*GGCCTCTTATGTTAACC
ITT01_0024_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0026_F01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0094_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BFLT1_0066_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0071_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0069_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0075_D08.b : GTG*GTTACTGATCCCATTGCTGACCACCAGCCTCTCACAGAAGGCCTCTTATGTTAACC
TES01_0112_C07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LVRM1_0032_E12.b : GTG*GTTACTAATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0081_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0041_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0041_A09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0024_A01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0014_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CBLT1_0067_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CBLT1_0088_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CBLT1_0068_C09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0064_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0007_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0088_G09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0030_H02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0029_G06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0031_D09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
HTMT1_0021_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0116_C08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0097_E07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0011_G06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0048_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0006_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0097_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0081_B06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0087_D09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
HTMT1_0062_H01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0096_A01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0073_B04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0088_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0065_H05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CBLT1_0092_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0072_A06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0098_C03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0022_F02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0035_A07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0069_E12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0021_B08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0080_F01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0040_B07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0052_F06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0026_G04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0044_G04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0108_E11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0107_C10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0066_E01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0027_D03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAA*C
PTG01_0104_H02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0016_E01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0096_G03.b : GTG*GTTACTGATCCCAGGGCTGAACACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0014_D08.b : GTG*GTTACTGATCTCAGGGCTGACGACCAGCCTCTCACATA*GGCCTCTTATGTTAACC
BMWN1_0100_C01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0011_D01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0095_A04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0098_F10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0025_A06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0023_H08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0026_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0028_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0063_G07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0019_B01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0087_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0104_B10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0101_A06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0017_G10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0038_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0020_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0105_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0090_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0064_G10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0134_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
HTMT1_0097_E03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0101_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0050_C02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0034_A05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0070_E03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0065_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0078_G06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0052_C11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0093_H04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0076_B04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0151_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0060_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0087_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0087_G04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0052_F11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0043_G10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0014_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0091_B08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPLT1_0050_H08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0058_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0026_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0054_F08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0008_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0127_D10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCGCAGA*GGCCTCTTATGTTAACC
MLN01_0093_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0064_H04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0049_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0092_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0082_B03.b : GTG*GTTACTGATCCCAGGACTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0036_H06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0001_C11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0064_F06.b : GTG*GTTACCGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0005_A04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0008_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0055_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0001_C10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0049_H02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0057_C08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0063_F12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0055_E07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0021_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0004_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0097_D08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0063_E03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0053_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0099_G02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0064_C09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0066_F06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0071_C09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0030_B03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0053_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0011_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0022_H07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0076_E12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0020_E06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0041_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0084_B08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0001_D01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0011_G05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0062_D07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0063_A02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TCH01_0035_A03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ADR01_0078_G07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0063_H12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0065_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0078_B06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0099_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0042_F11.b : GTG*GTTACTGATCCCGGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0075_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ADR01_0094_C06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BFLT1_0021_A10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0007_D07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0089_G05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0051_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0033_H07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0084_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TCH01_0076_G02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0090_G01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0030_F04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0038_A06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0072_C11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0080_E10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0063_F08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0039_H07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0066_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0110_C09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0092_A02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0086_G04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0013_F06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0015_C11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVR01_0080_G09.b : GTG*GTTACTGATCCCAGGGCTGAACACCAGCCTCTCACAAA*GGCCTCTTAAGTTAACC
THY01_0109_F08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0003_C03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TES01_0070_F10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCTTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0039_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0003_A03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0081_H03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0001_C03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRM1_0168_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ADR01_0009_H09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0090_C12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0008_H12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0002_C01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0052_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0013_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0012_E06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0010_E08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0015_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0044_A09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0026_A01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0024_B03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0024_C07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0015_A11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0090_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0044_H06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0011_D07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0017_E12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0092_D07.b : GTG*GTTACCGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0033_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0086_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0041_B05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0016_B07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0020_C01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0090_F02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0091_H04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
AMP01_0068_B10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0035_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0056_H02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0057_H08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BFLT1_0022_C04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0087_A07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
AMP01_0055_D03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0083_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0047_D10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0091_F03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0021_B01.b : GTG*GTTACTGATCCCAGGGTTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0055_G10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0033_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0035_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0109_C04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0067_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0098_C08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0083_H11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0048_A11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TES01_0065_F12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
AMP01_0010_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0071_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0001_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0107_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0048_G02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0047_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0050_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0086_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0046_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
THY01_0064_E11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0002_C04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0012_H12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0045_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0098_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0002_E08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0098_B05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
KDN01_0056_G06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0023_B10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0081_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0020_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
KDN01_0078_H04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
KDN01_0093_G07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0042_G05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0079_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0093_E11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0052_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
KDN01_0034_B09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0084_C10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0094_A07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0062_H03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0074_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0070_B05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCCCACAGA*GGCCTCTTATGTTAACC
SPL01_0099_B10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0090_B06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAATC
TCH01_0056_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0079_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0096_B01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0038_C11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0070_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0067_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0011_A01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0072_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0088_D10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0103_A03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0096_B08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TCH01_0063_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0048_F04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0071_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0102_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0061_B01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0039_F04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0093_F06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0049_E06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0083_A07.b : GTG*GTTACTGATCCCAGGGCTAACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0066_H03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0029_D07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0006_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0096_F12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCTTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0068_F06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0062_A04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0064_G01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0067_D02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0038_G12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0072_C03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0043_B09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0098_G07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0095_B02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0098_D05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0015_A03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0002_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0069_C12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAACCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0075_D06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0065_H05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0073_G08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0060_C07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0035_B05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0081_H05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0072_D02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRT1_0098_E02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0030_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0038_H02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0027_C06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0008_B10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0081_F09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0005_A01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0038_C06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0042_B02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0080_C04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0089_E03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0072_H09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0097_B02.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0109_F08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0081_A06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0015_A07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0063_H01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0081_E05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0049_A07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0029_B12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0081_G11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0014_A04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0019_C06.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0014_C05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0036_G07.b : GTG*GTTACTGATCCCAGCGATGACCACCAGCCTCTCAAAGA*GGCCTCTTATGTTAACC
UTR01_0039_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0032_E03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0028_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CBLT1_0030_E10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
KDN01_0017_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PST01_0010_C01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0069_E09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0071_A09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0051_F08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0007_A05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0077_A11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0090_F05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0048_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0029_A11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0104_C10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0092_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TCH01_0011_A05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
TCH01_0094_A03.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVR01_0094_C01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ILNT1_0010_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
OVRM1_0043_G05.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0096_E11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0059_D09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
CLNT1_0081_G08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
LNG01_0063_F07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0060_D10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0035_B08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0016_D04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
PBL01_0085_C09.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0103_A08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SMG01_0097_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0029_E12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0045_B01.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0050_D08.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0040_H07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0041_C07.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
UTR01_0023_E04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SKNB1_0100_D11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
SPL01_0026_D12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
MLN01_0062_A12.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
ITT01_0085_F07.b : GTGTGTTACTGATCCCAGGGCTGACCACCACCCTCTCAGAGG*GGCCTCTTATGTTAACC
UTR01_0025_H04.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BFLT1_0061_H10.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
BMWN1_0032_B11.b : GTG*GTTACTGATCCCAGGGCTGACCACCAGCCTCTCACAGA*GGCCTCTTATGTTAACC
20110601C-000130 : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
---------+---------+---------+---------+---------+---------+ 713
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0032_H07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0015_C02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0084_D06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0063_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0079_D03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0020_C05.b : TGCCTATCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0020_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0004_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0099_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0072_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0095_D01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0076_C12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0078_B02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0038_F12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0003_B04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0076_E06.b : TGCCTACCATTGCTCTGTGTAACACAGAT*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0004_G08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0003_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0107_H12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0051_G01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0086_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0076_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0072_E07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0058_G02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TES01_0069_H03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTTGCATC
UTR01_0018_A04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0039_G07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0076_D02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0050_C04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0103_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0033_E01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0047_B07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0029_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0024_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0026_F01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0094_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BFLT1_0066_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0071_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0069_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0075_D08.b : TGCCTACCATTGCTCTGTGTAACACATACCTCACCTCTGCGTTATGCGGACATTGCCATC
TES01_0112_C07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LVRM1_0032_E12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0081_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0041_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0041_A09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0024_A01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0014_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CBLT1_0067_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CBLT1_0088_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CBLT1_0068_C09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0064_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0007_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0088_G09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0030_H02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0029_G06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0031_D09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
HTMT1_0021_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0116_C08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0097_E07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0011_G06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0048_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0006_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0097_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0081_B06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0087_D09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
HTMT1_0062_H01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0096_A01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0073_B04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0088_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0065_H05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CBLT1_0092_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0072_A06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0098_C03.b : TGCTTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0022_F02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0035_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0069_E12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0021_B08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0080_F01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0040_B07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0052_F06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0026_G04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0044_G04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0108_E11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0107_C10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0066_E01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0027_D03.b : TGCCTACCAATGCTCTGTGTAACACAGAC*TCACCTCTGCGTAATGTGGACATTGCCATC
PTG01_0104_H02.b : TGNCCTACATTGCTCTGTGNTACACAGAC*TCACCTCTGCGTTATGTGGACACTGCCATC
SPLT1_0016_E01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0096_G03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TC*CCTCTGCGTTATGTGGACATTGCCATC
PBL01_0014_D08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0100_C01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0011_D01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0095_A04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0098_F10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0025_A06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0023_H08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0026_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0028_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0063_G07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0019_B01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0087_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0104_B10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0101_A06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0017_G10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0038_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0020_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0105_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0090_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0064_G10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0134_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
HTMT1_0097_E03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0101_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0050_C02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0034_A05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0070_E03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0065_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0078_G06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0052_C11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0093_H04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0076_B04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0151_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0060_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0087_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0087_G04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0052_F11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0043_G10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0014_E05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0091_B08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPLT1_0050_H08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0058_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0026_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0054_F08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0008_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0127_D10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0093_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0064_H04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0049_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0092_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0082_B03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0036_H06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0001_C11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0064_F06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0005_A04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0008_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0055_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0001_C10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0049_H02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0057_C08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0063_F12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0055_E07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0021_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0004_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0097_D08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0063_E03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0053_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0099_G02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0064_C09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0066_F06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0071_C09.b : TGCCTACCATTGCTCCGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0030_B03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0053_E05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0011_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0022_H07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0076_E12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0020_E06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0041_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0084_B08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0001_D01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0011_G05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0062_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0063_A02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0035_A03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ADR01_0078_G07.b : TGCCTACCATTGCTCTGTGTGACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0063_H12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0065_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0078_B06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0099_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0042_F11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0075_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ADR01_0094_C06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BFLT1_0021_A10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0007_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0089_G05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0051_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0033_H07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0084_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0076_G02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0090_G01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0030_F04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0038_A06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0072_C11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0080_E10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0063_F08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0039_H07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0066_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0110_C09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0092_A02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0086_G04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0013_F06.b : TGCCTACCAGTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0015_C11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVR01_0080_G09.b : CGCCTACCATTGCTCctgggaaacaaactcccctctgcgttatggggaaattgcccttcc
THY01_0109_F08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGAAATTGCCATC
SMG01_0003_C03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCCAT
TES01_0070_F10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGAACATTGCCATC
SMG01_0039_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0003_A03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0081_H03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0001_C03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCCAT
OVRM1_0168_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ADR01_0009_H09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0090_C12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0008_H12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0002_C01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0052_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0013_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0012_E06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0010_E08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCTATC
SPL01_0015_E05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0044_A09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0026_A01.b : TGCCTACCATTGCTCTGTGTGACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0024_B03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0024_C07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0015_A11.b : TGCCTACCATTGCTCTGCGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0090_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0044_H06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0011_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0017_E12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0092_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0033_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0086_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0041_B05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0016_B07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0020_C01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0090_F02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0091_H04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
AMP01_0068_B10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0035_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0056_H02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0057_H08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BFLT1_0022_C04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0087_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
AMP01_0055_D03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0083_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0047_D10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0091_F03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0021_B01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0055_G10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0033_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0035_E05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0109_C04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0067_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0098_C08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0083_H11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0048_A11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCCCTGCGTTATGTGGACATTGCCATC
TES01_0065_F12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
AMP01_0010_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0071_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0001_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0107_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0048_G02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0047_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0050_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0086_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0046_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
THY01_0064_E11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0002_C04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0012_H12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0045_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0098_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0002_E08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0098_B05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
KDN01_0056_G06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0023_B10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0081_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0020_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
KDN01_0078_H04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
KDN01_0093_G07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0042_G05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0079_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0093_E11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0052_E04.b : TGCCTACCATTGCTCTGTGTAACACAGGC*TCACCTCTGCGTTATGTGGACATTGCCATC
KDN01_0034_B09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0084_C10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0094_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0062_H03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0074_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0070_B05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0099_B10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0090_B06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0056_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0079_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0096_B01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0038_C11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0070_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0067_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0011_A01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCGCCTCTGCGTTATGTGGACATTGCCATC
LNG01_0072_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0088_D10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0103_A03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0096_B08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0063_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0048_F04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0071_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0102_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0061_B01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0039_F04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0093_F06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0049_E06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0083_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0066_H03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0029_D07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0006_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0096_F12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0068_F06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0062_A04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0064_G01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0067_D02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0038_G12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0072_C03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0043_B09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0098_G07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0095_B02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0098_D05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0015_A03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0002_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0069_C12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0075_D06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0065_H05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0073_G08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0060_C07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0035_B05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0081_H05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0072_D02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRT1_0098_E02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0030_E05.b : TGCCTACCATTGCTCTGTGTAATACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0038_H02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0027_C06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0008_B10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0081_F09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0005_A01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0038_C06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0042_B02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0080_C04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0089_E03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0072_H09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0097_B02.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0109_F08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0081_A06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0015_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0063_H01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0081_E05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0049_A07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0029_B12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0081_G11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0014_A04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0019_C06.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0014_C05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0036_G07.b : TGCCTAACATTGCTCTGTGTATCACAGAC*TCACCTCTGCATTATGTGGACATTGCCATC
UTR01_0039_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0032_E03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0028_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CBLT1_0030_E10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
KDN01_0017_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PST01_0010_C01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0069_E09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0071_A09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0051_F08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0007_A05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0077_A11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0090_F05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0048_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0029_A11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0104_C10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0092_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0011_A05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
TCH01_0094_A03.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVR01_0094_C01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ILNT1_0010_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
OVRM1_0043_G05.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0096_E11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0059_D09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
CLNT1_0081_G08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
LNG01_0063_F07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0060_D10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0035_B08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0016_D04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
PBL01_0085_C09.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0103_A08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SMG01_0097_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0029_E12.b : TGCCTACCATTGCTCTGTGAAACACAAAC*TCACCTCTGCGTTATGTGAACATTGCCATC
MLN01_0045_B01.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0050_D08.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0040_H07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0041_C07.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
UTR01_0023_E04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SKNB1_0100_D11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
SPL01_0026_D12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
MLN01_0062_A12.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
ITT01_0085_F07.b : TGCCTACTATTGCTCTGTGTAACACACAC*TCACCTCTGCGTTATGTGTACATTGCCATC
UTR01_0025_H04.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BFLT1_0061_H10.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
BMWN1_0032_B11.b : TGCCTACCATTGCTCTGTGTAACACAGAC*TCACCTCTGCGTTATGTGGACATTGCCATC
20110601C-000130 : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
---------+---------+---------+---------+---------+---------+ 773
BKFL1_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0038_G04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
THY01_0032_H07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0015_C02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0084_D06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0063_A08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0079_D03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0020_C05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPL01_0020_D07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0004_B12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0099_H10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0072_D05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0095_D01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0076_C12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SKNB1_0078_B02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0038_F12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LNG01_0003_B04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0076_E06.b : CCGTACAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0004_G08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0003_E04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0107_H12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0051_G01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0086_A08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
OVRT1_0076_B11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0072_E07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0058_G02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
TES01_0069_H03.b : CCGTGCACCAACAAGGGAGCTCACTCAGTGGGCCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0018_A04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0039_G07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0076_D02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0050_C04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0103_E09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0033_E01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0047_B07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0029_E04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0024_H10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0026_F01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
THY01_0094_G11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BFLT1_0066_D11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0071_D04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0069_B12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0075_D08.b : CCGTGCAACAACAAGGGATCTCACTCAATGGGTCTGATTTGGAGGATGCTCTCCCGGGAA
TES01_0112_C07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LVRM1_0032_E12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0081_E02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCGGGGAA
SMG01_0041_G12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0041_A09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0024_A01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0014_D11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CBLT1_0067_E04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CBLT1_0088_D12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CBLT1_0068_C09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0064_E04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0007_E02.b : CCGTGCAGCAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0088_G09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0030_H02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0029_G06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0031_D09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
HTMT1_0021_F07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
OVRT1_0116_C08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0097_E07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0011_G06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0048_E09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0006_E04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
THY01_0097_F09.b : CCGTGCAACAACAAGGGAGCTCACTCGGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0081_B06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0087_D09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
HTMT1_0062_H01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0096_A01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0073_B04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0088_D04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0065_H05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CBLT1_0092_F05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0072_A06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0098_C03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0022_F02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0035_A07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0069_E12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0021_B08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LNG01_0080_F01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0040_B07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0052_F06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0026_G04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0044_G04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LNG01_0108_E11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LNG01_0107_C10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0066_E01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0027_D03.b : CCGgggaaaaaacaaggaagctcaatcaatggggccgaaagggttgaaggctcccccgga
PTG01_0104_H02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCCGGAA
SPLT1_0016_E01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0096_G03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0014_D08.b : CCGTGCAACAACAAAGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0100_C01.b : CCGTGCAAACACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGNCCGGGAA
UTR01_0011_D01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0095_A04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGNTGGATGCTCGCCCGGGA*
UTR01_0098_F10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0025_A06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0023_H08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0026_F09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0028_D04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0063_G07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0019_B01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0087_G11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0104_B10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0101_A06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0017_G10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0038_G11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0020_F05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0105_D05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0090_B12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCACGGGAA
BMWN1_0064_G10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0134_D12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
HTMT1_0097_E03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0101_E02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0050_C02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0034_A05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0070_E03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0065_D04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0078_G06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SMG01_0052_C11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0093_H04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPL01_0076_B04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
OVRT1_0151_G11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0060_E09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0087_G12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0087_G04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0052_F11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPL01_0043_G10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
LNG01_0014_E05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0091_B08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGAGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPLT1_0050_H08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0058_H10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
THY01_0026_H10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0054_F08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0008_D05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0127_D10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0093_A08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0064_H04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
BMWN1_0049_D11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0092_F05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0082_B03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0036_H06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0001_C11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0064_F06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SPL01_0005_A04.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATACTCGCCCGGGAA
ITT01_0008_C05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0055_B12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0001_C10.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
CLNT1_0049_H02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
SKNB1_0057_C08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0063_F12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0055_E07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ILNT1_0021_D12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0004_F07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0097_D08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
THY01_0063_E03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
PBL01_0053_C05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0099_G02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0064_C09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0066_F06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0071_C09.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0030_B03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0053_E05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0011_D05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0022_H07.b : CCGTGCAACAACAAGGGAGCTCACTCAATGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0076_E12.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0020_E06.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0041_G11.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
UTR01_0084_B08.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0001_D01.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0011_G05.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0062_D07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
MLN01_0063_A02.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
TCH01_0035_A03.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ADR01_0078_G07.b : CCGTGCAACAACAAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTCGCCCGGGAA
ITT01_0063_H12.b : CCGTGCAACAACAAGG