[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000164

Length: 786

Sequence [FASTA format sequence]
GAGACCCAGG CTGGGCATAA AGGAGGGAAT CGCAGGATGA ATTGAGGCTC ACCTGGGCAC
CATGGAGACC CAGAGGGCCA GCCTGTGCCT GGGGCGCTGG TCACTGTGGC TTCTGCTGCT
GGGACTCGTG GTGCCCTCGG CCAGCGCCCA GGCCCTCAGC TACAGGGAGG CCGTGCTTCG
AGCCGTGGAT CGCCTCAACG AGCAGTCCTC AGAAGCTAAT CTCTACCGCC TCCTGGAGCT
GGACCAGCCG CCCAAGGCCG ACGAGGACCC GGGCACCCCA AAACCTGTGA GCTTCACGGT
GAAGGAGACT GTGTGTCCCA GGCCGACCCG GCGGCCCCCG GAGCTGTGTG ACTTCAAGGA
GAACGGGCGG GTGAAACAGT GTGTGGGGAC AGTCACCCTG GATCAGATCA AGGACCCGCT
CGACATCACC TGCAATGAGG TTCAAGGTGT CAGGGGAGGT CGCCTGTGCT ATTGTAGGGG
TAGGTTCTGC ATCTGTGTCG GATGAGGATG ACGGTTGCGA CGGCAGGCTT TCCCTCCCCC
AATTTTCCCG GGGCCAGGTT TCCGTCCCCC AATTTTTCCG CCTCCACCTT TCCGGCCCGC
ACCATTCAGT CCACCAAGGT TCCCTGGTAG ACGGTGAAGG ATTTGCAGGC AACTCACCCA
GAAGGCCTTT CGGTACATTA AAATCCCAGC AAGGAGACCT AAGCATCTGC TTTGCCCAGG
CCCGCATCTG TCAAATAAAT TCTTGTGAAA CCAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Homo sapiens]. 1393e-33O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCampcathelin-related antimicrobial peptide [Mus musculus]. 1232e-28O
Contig/Assembly ProteinNgpneutrophilic granule protein [Mus musculus]. 625e-10O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Canis lupus familiaris]. 1379e-33O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCATHL3cathelicidin-3 precursor [Bos taurus]. 1763e-44O
Contig/Assembly ProteinLOC786887PREDICTED: cathelicidin-4-like [Bos taurus]. 1731e-43O
Contig/Assembly ProteinCATHL4cathelicidin-4 precursor [Bos taurus]. 1731e-43O
Contig/Assembly ProteinCATHL6cathelicidin-6 precursor [Bos taurus]. 1693e-42O
Contig/Assembly ProteinCATHL1cathelicidin-1 precursor [Bos taurus]. 1692e-42O
Contig/Assembly ProteinCATHL2cathelicidin-2 precursor [Bos taurus]. 1686e-42O
Contig/Assembly ProteinLOC100336703PREDICTED: Cathelicidin 1-like [Bos taurus]. 1677e-42O
Contig/Assembly ProteinCATHL5cathelicidin-5 precursor [Bos taurus]. 1663e-41O
Contig/Assembly ProteinCAMPcathelicidin-7 precursor [Bos taurus]. 1654e-41O
Contig/Assembly ProteinLOC100141058PREDICTED: Bac7.5 protein-like [Bos taurus]. 1553e-39O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNPG1protegrin-1 precursor [Sus scrofa]. 2621e-70O
Contig/Assembly ProteinPG-2protegrin-2 precursor [Sus scrofa]. 2622e-70O
Contig/Assembly ProteinNPG3protegrin-3 precursor [Sus scrofa]. 2599e-70O
Contig/Assembly ProteinNPG4protegrin-4 precursor [Sus scrofa]. 2198e-63O
Contig/Assembly ProteinPR39antibacterial protein PR-39 precursor [Sus scrofa]. 2122e-55O
Contig/Assembly ProteinPMAP-23antibacterial peptide PMAP-23 precursor [Sus scrofa]. 2091e-54O
Contig/Assembly ProteinPMAP-36antibacterial peptide PMAP-36 precursor [Sus scrofa]. 2083e-54O


Assembly Members: 120      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10001C12BMWN1_0001_C12.bHX205675 
BMWN10001F07BMWN1_0001_F07.bHX205700 
BMWN10001G10BMWN1_0001_G10.bHX205711 
BMWN10002H01BMWN1_0002_H01.bHX205779 
BMWN10003G06BMWN1_0003_G06.bHX205823 
BMWN10004B02BMWN1_0004_B02.bHX205838 
BMWN10005F02BMWN1_0005_F02.b  
BMWN10006B06BMWN1_0006_B06.bHX205935 
BMWN10007H06BMWN1_0007_H06.bHX206051 
BMWN10009E06BMWN1_0009_E06.b  
BMWN10010D10BMWN1_0010_D10.bHX206219 
BMWN10010D12BMWN1_0010_D12.bHX206221 
BMWN10010H06BMWN1_0010_H06.bHX206256 
BMWN10011E08BMWN1_0011_E08.bHX206292 
BMWN10011H03BMWN1_0011_H03.b  
BMWN10012A02BMWN1_0012_A02.bHX206325 
BMWN10013G09BMWN1_0013_G09.bHX206431 
BMWN10015B10BMWN1_0015_B10.b  
BMWN10015C06BMWN1_0015_C06.b  
BMWN10016G05BMWN1_0016_G05.bHX206552 
BMWN10018B09BMWN1_0018_B09.b  
BMWN10020C11BMWN1_0020_C11.bHX206771 
BMWN10020D02BMWN1_0020_D02.bHX206774 
BMWN10022B03BMWN1_0022_B03.bHX206889 
BMWN10022H12BMWN1_0022_H12.b  
BMWN10023E04BMWN1_0023_E04.bHX206968 
BMWN10024D10BMWN1_0024_D10.b  
BMWN10024F05BMWN1_0024_F05.bHX207038 
BMWN10025H09BMWN1_0025_H09.bHX207119 
BMWN10028A01BMWN1_0028_A01.bHX207254 
BMWN10030B04BMWN1_0030_B04.bHX207395 
BMWN10030D10BMWN1_0030_D10.bHX207415 
BMWN10030E11BMWN1_0030_E11.bHX207425 
BMWN10030F10BMWN1_0030_F10.bHX207433 
BMWN10031A08BMWN1_0031_A08.bHX207454 
BMWN10031D02BMWN1_0031_D02.bHX207479 
BMWN10032C05BMWN1_0032_C05.bHX207547 
BMWN10034A10BMWN1_0034_A10.bHX207656 
BMWN10036B01BMWN1_0036_B01.bHX207784 
BMWN10036F12BMWN1_0036_F12.bHX207828 
BMWN10039D08BMWN1_0039_D08.bHX207973 
BMWN10039E08BMWN1_0039_E08.bHX207979 
BMWN10040D10BMWN1_0040_D10.bHX208014 
BMWN10041G02BMWN1_0041_G02.bHX208068 
BMWN10042C02BMWN1_0042_C02.bHX208096 
BMWN10042D07BMWN1_0042_D07.bHX208106 
BMWN10042E02BMWN1_0042_E02.bHX208111 
BMWN10042F12BMWN1_0042_F12.bHX208118 
BMWN10044D12BMWN1_0044_D12.bHX208178 
BMWN10045G03BMWN1_0045_G03.bHX208247 
BMWN10046D08BMWN1_0046_D08.bHX208287 
BMWN10046E05BMWN1_0046_E05.bHX208295 
BMWN10047C10BMWN1_0047_C10.bHX208359 
BMWN10047D08BMWN1_0047_D08.bHX208366 
BMWN10047H10BMWN1_0047_H10.bHX208404 
BMWN10048B04BMWN1_0048_B04.bHX208416 
BMWN10048B11BMWN1_0048_B11.bHX208422 
BMWN10048F08BMWN1_0048_F08.bHX208463 
BMWN10049A12BMWN1_0049_A12.bHX208496 
BMWN10049E03BMWN1_0049_E03.bHX208529 
BMWN10050C10BMWN1_0050_C10.bHX208593 
BMWN10050D05BMWN1_0050_D05.bHX208599 
BMWN10051F01BMWN1_0051_F01.bHX208693 
BMWN10052C05BMWN1_0052_C05.bHX208731 
BMWN10057D09BMWN1_0057_D09.bHX209024 
BMWN10059A08BMWN1_0059_A08.b  
BMWN10059C11BMWN1_0059_C11.b  
BMWN10059G06BMWN1_0059_G06.bHX209176 
BMWN10060A05BMWN1_0060_A05.bHX209187 
BMWN10061F08BMWN1_0061_F08.bHX209287 
BMWN10061G07BMWN1_0061_G07.b  
BMWN10062D05BMWN1_0062_D05.bHX209335 
BMWN10063A08BMWN1_0063_A08.bHX209376 
BMWN10063C06BMWN1_0063_C06.bHX209391 
BMWN10063G06BMWN1_0063_G06.bHX209420 
BMWN10067C07BMWN1_0067_C07.bHX209640 
BMWN10068H11BMWN1_0068_H11.bHX209756 
BMWN10069D10BMWN1_0069_D10.bHX209789 
BMWN10070H02BMWN1_0070_H02.bHX209886 
BMWN10071E01BMWN1_0071_E01.b  
BMWN10072B03BMWN1_0072_B03.b  
BMWN10073F01BMWN1_0073_F01.bHX210055 
BMWN10074D07BMWN1_0074_D07.bHX210101 
BMWN10076B04BMWN1_0076_B04.bHX210214 
BMWN10076C06BMWN1_0076_C06.bHX210224 
BMWN10076G02BMWN1_0076_G02.bHX210257 
BMWN10078B03BMWN1_0078_B03.bHX210345 
BMWN10078D08BMWN1_0078_D08.bHX210366 
BMWN10078H02BMWN1_0078_H02.bHX210390 
BMWN10079E03BMWN1_0079_E03.bHX210434 
BMWN10080A02BMWN1_0080_A02.bHX210462 
BMWN10082G09BMWN1_0082_G09.bHX210644 
BMWN10083A04BMWN1_0083_A04.b  
BMWN10083B05BMWN1_0083_B05.bHX210664 
BMWN10083G01BMWN1_0083_G01.bHX210705 
BMWN10083H03BMWN1_0083_H03.b  
BMWN10085A05BMWN1_0085_A05.b  
BMWN10085F03BMWN1_0085_F03.bHX210819 
BMWN10086E07BMWN1_0086_E07.bHX210864 
BMWN10086F03BMWN1_0086_F03.b  
BMWN10087B03BMWN1_0087_B03.bHX210898 
BMWN10087C09BMWN1_0087_C09.b  
BMWN10087E08BMWN1_0087_E08.bHX210923 
BMWN10088A03BMWN1_0088_A03.bHX210953 
BMWN10088D11BMWN1_0088_D11.bHX210986 
BMWN10090D03BMWN1_0090_D03.bHX211119 
BMWN10090F01BMWN1_0090_F01.bHX211136 
BMWN10093C07BMWN1_0093_C07.bHX211288 
BMWN10094B10BMWN1_0094_B10.bHX211357 
BMWN10094H02BMWN1_0094_H02.bHX211405 
BMWN10095C02BMWN1_0095_C02.b  
BMWN10095D02BMWN1_0095_D02.bHX211434 
BMWN10095E05BMWN1_0095_E05.bHX211446 
BMWN10096A02BMWN1_0096_A02.bHX211478 
BMWN10096B01BMWN1_0096_B01.bHX211486 
BMWN10096C09BMWN1_0096_C09.bHX211502 
BMWN10097C03BMWN1_0097_C03.b  
BMWN10097H01BMWN1_0097_H01.bHX211584 
BMWN10098D08BMWN1_0098_D08.bHX211613 
BMWN10098F09BMWN1_0098_F09.bHX211630 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
123C4400.386WNGCA/A
G7000.614GGA/G
181A7000.609WSCGA/R
T4500.391CGT/R
184C7000.614WSGCC/A
T4400.386GCT/A
608A6700.632W-
G3900.368


Alignment:      TOP

20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0042_C02.b : nnnttcttttnnnnncccaggttagacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0087_C09.b : nttaaca
BMWN1_0076_G02.b : ntttggcag
BMWN1_0009_E06.b : nnccgagag
BMWN1_0022_H12.b : ttacca
BMWN1_0044_D12.b : ttttccagagtagacgxxxx
BMWN1_0087_B03.b : nnttagccagtagacgxx
BMWN1_0070_H02.b : ttttggatagtacgaggxx
BMWN1_0031_A08.b : ttttagacagtagacxxxxxxxxxxxxxxx
BMWN1_0096_A02.b : ttttaag
BMWN1_0071_E01.b : ttaccag
BMWN1_0032_C05.b : nnnnnggca
BMWN1_0042_E02.b : nnnggca
BMWN1_0024_D10.b : ntttgc
BMWN1_0083_A04.b : ttttggca
BMWN1_0087_E08.b : nnnaacgagag
BMWN1_0063_C06.b : nttttggat
BMWN1_0024_F05.b : ttaaccc
BMWN1_0076_B04.b : nnnnngga
BMWN1_0034_A10.b : tttttagcaa
BMWN1_0094_H02.b : tttttggacg
BMWN1_0098_F09.b : ttttccgacggaacacxxxxxx
BMWN1_0090_D03.b : ttttgggac
BMWN1_0039_E08.b : ttttgg
BMWN1_0078_D08.b : nnnnnggacg
BMWN1_0011_E08.b : tttttagc
BMWN1_0012_A02.b : ntttaggc
BMWN1_0028_A01.b : nttttgc
BMWN1_0078_H02.b : nntttggata
BMWN1_0030_E11.b : ttttggag
BMWN1_0022_B03.b : nnnnggatagtacgaggxx
BMWN1_0030_F10.b : ttttagac
BMWN1_0052_C05.b : tttttagc
BMWN1_0016_G05.b : tttttggacgagtacacxxxxx
BMWN1_0047_H10.b : nnttaagcag
BMWN1_0045_G03.b : nnnccgat
BMWN1_0090_F01.b : ttttgg
BMWN1_0095_D02.b : tttttggcaggtagaggx
BMWN1_0048_F08.b : ttttnggcagagtacacxxxxxx
BMWN1_0010_D12.b : nnttttttntnnnggga
BMWN1_0051_F01.b : tttttggca
BMWN1_0042_F12.b : ntttggat
BMWN1_0042_D07.b : nggc
BMWN1_0047_C10.b : nnttaggca
BMWN1_0097_H01.b : tttttcgc
BMWN1_0078_B03.b : nnnggacgaga
BMWN1_0063_G06.b : ttttacacg
BMWN1_0004_B02.b : nnaaagg
BMWN1_0049_E03.b : nnnaagg
BMWN1_0039_D08.b : nnnccgatttnnnnnnncca
BMWN1_0060_A05.b : tttttggatagtacgacgxxx
BMWN1_0057_D09.b : nnnnccgatattacgaggxx
BMWN1_0001_G10.b : tttttggaagagtacgaggcag
BMWN1_0050_C10.b : nnttagatagtagacxxxx
BMWN1_0031_D02.b : ttttggacagtagaggx
BMWN1_0067_C07.b : ttttggagagtacgacg
BMWN1_0096_B01.b : ttttaagagattagacgxx
BMWN1_0059_C11.b : ttttggagagtagaggx
BMWN1_0036_B01.b : tttggcaggtacgaggxx
BMWN1_0096_C09.b : tttttggacggtagacg
BMWN1_0020_D02.b : nngggcgattagacgx
BMWN1_0048_B11.b : tttttcccagagtagacxxxxx
BMWN1_0069_D10.b : ttttagaatagtxxxxxxxxxx
BMWN1_0061_G07.b : cc
BMWN1_0082_G09.b : tttagga
BMWN1_0047_D08.b : nnnngg
BMWN1_0083_H03.b : nnaaaggc
BMWN1_0036_F12.b : tttc
BMWN1_0088_D11.b : nttc
BMWN1_0048_B04.b : nnnttaagc
BMWN1_0010_H06.b : nnnaa
BMWN1_0072_B03.b : ttta
BMWN1_0020_C11.b : ttttcg
BMWN1_0068_H11.b : tttttgcgag
BMWN1_0013_G09.b : tttttggacgagtacacgx
BMWN1_0003_G06.b : ntttccagagtacgacgca
BMWN1_0086_E07.b : nnnnggagagtagaxxx
BMWN1_0005_F02.b : ttt
BMWN1_0007_H06.b : nnntttgagagtacaggc
BMWN1_0015_B10.b : nttgccacccgacgaxxxxx
BMWN1_0011_H03.b : tttttag
BMWN1_0093_C07.b : tttttgc
BMWN1_0094_B10.b : ttttt
BMWN1_0098_D08.b : tttta
BMWN1_0006_B06.b : nnntta
BMWN1_0061_F08.b : nnccgtg
BMWN1_0001_C12.b : tttttggc
BMWN1_0062_D05.b : tttaggat
BMWN1_0010_D10.b : ntttagg
BMWN1_0049_A12.b : ntttta
BMWN1_0074_D07.b : ngg
BMWN1_0030_D10.b : ttttagc
BMWN1_0059_A08.b : tggatagaaagaxxxx
BMWN1_0002_H01.b : tttttgga
BMWN1_0085_F03.b : ttttgcgca
BMWN1_0063_A08.b : tttttgg
BMWN1_0015_C06.b : nttgcacagcagacgcc
BMWN1_0046_E05.b : nnccg
BMWN1_0040_D10.b : nnnttgctttnnnnnnngg
BMWN1_0083_G01.b : ntttttggcag
BMWN1_0079_E03.b : ntttacgacg
BMWN1_0073_F01.b : tttttgg
BMWN1_0080_A02.b : tttttaga
BMWN1_0088_A03.b : nnnaaaga
BMWN1_0023_E04.b : naaagg
BMWN1_0025_H09.b : nttttg
BMWN1_0041_G02.b : tttgg
BMWN1_0001_F07.b : nnttga
BMWN1_0086_F03.b : tttggc
BMWN1_0085_A05.b : nnntt
BMWN1_0050_D05.b : nnnttcg
BMWN1_0095_E05.b : ttttta
BMWN1_0083_B05.b : naaaccg
BMWN1_0059_G06.b : t
BMWN1_0097_C03.b : ngggcaagtagacgxx
BMWN1_0030_B04.b : ttttaggcagagtag
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : .........GAGACCCAGGCTGGGCATAAAGGAGGGAATCGCAGGATGAATTGAGGCTCA
---------+---------+---------+---------+---------+---------+ 51
BMWN1_0042_C02.b : xxxxxxxxxGAGACCCAGGCTGGGCATAAAGGAGGGTCCCGCAGGCTGGGAGGAGGCTCA
BMWN1_0087_C09.b : catatgacgcagtattatttatatACTCCTATAGGGAATTTAA**ATGAATTGAGGCTCC
BMWN1_0076_G02.b : gaacgacgcagtattatttataccaCTCCTATAGGGAATTTA***ATGAATTGAGGCTCA
BMWN1_0009_E06.b : aataggccactcgtatttataccactcactcTAGGGAATTTAA***TGAATTG*GGCTCA
BMWN1_0022_H12.b : gagtagacgcagtagtatttatcgactcaccTAGGGAATTTA***ATGAATTGAGGCTCA
BMWN1_0044_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcATTAGGCTCA
BMWN1_0087_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcATTAGGCTCA
BMWN1_0070_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaTGAGGCTCA
BMWN1_0031_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttttttttttttttttttttttGGGCTCA
BMWN1_0096_A02.b : acggtagacgcantaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0071_E01.b : agtaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCCCC
BMWN1_0032_C05.b : gagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0042_E02.b : agtacgacgcantaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0024_D10.b : acggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0083_A04.b : gagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0087_E08.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0063_C06.b : agtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0024_F05.b : agagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0076_B04.b : tagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0034_A10.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0094_H02.b : agtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0090_D03.b : ggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0039_E08.b : caagtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0078_D08.b : gtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0011_E08.b : aggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0012_A02.b : aggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0028_A01.b : aggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0078_H02.b : gttagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0030_E11.b : agtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0022_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCTCA
BMWN1_0030_F10.b : aagtaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0052_C05.b : aagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0016_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0047_H10.b : agtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0045_G03.b : gtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0090_F01.b : gagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0095_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0048_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0010_D12.b : tagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0051_F01.b : gagtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0042_F12.b : attacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0042_D07.b : aggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0047_C10.b : gagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0097_H01.b : agagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0078_B03.b : gtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0063_G06.b : agtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0004_B02.b : acgagacacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0049_E03.b : caggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0039_D08.b : gagtacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0060_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0057_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0001_G10.b : tagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0050_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCA
BMWN1_0031_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0067_C07.b : cagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0096_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0059_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccctttaAGGCTCA
BMWN1_0036_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0096_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0048_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCA
BMWN1_0069_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtataAGGCTCA
BMWN1_0061_G07.b : atgttaagacgccactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0082_G09.b : gagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0047_D08.b : cagagtagacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0083_H03.b : atggtacgacgcantaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0036_F12.b : gagatgagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0088_D11.b : cgcaggaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0048_B04.b : agagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0010_H06.b : tgatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0072_B03.b : catgagtagacgcagtagtattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0020_C11.b : agagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0068_H11.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCA
BMWN1_0013_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGGCTCA
BMWN1_0003_G06.b : ntagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccGCTCA
BMWN1_0086_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCA
BMWN1_0005_F02.b : tccacggntagacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCA
BMWN1_0007_H06.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatttGCTCA
BMWN1_0015_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacctttaaaTCA
BMWN1_0011_H03.b : caagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0093_C07.b : agagacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0094_B10.b : ggcaggtacacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0098_D08.b : gagagtagacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0006_B06.b : cgacggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0061_F08.b : agtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0001_C12.b : aagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0062_D05.b : ggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0010_D10.b : agagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0049_A12.b : gacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0074_D07.b : agagtacgacgccgtagtatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0030_D10.b : agagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0059_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtagaggCTC
BMWN1_0002_H01.b : tagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0085_F03.b : ggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0063_A08.b : agagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0015_C06.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcattaaaTCA
BMWN1_0046_E05.b : acggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0040_D10.b : agagtacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0083_G01.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0079_E03.b : agtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0073_F01.b : atagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0080_A02.b : cggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0088_A03.b : cgagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0023_E04.b : agagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0025_H09.b : gacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0041_G02.b : caggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0001_F07.b : gagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0086_F03.b : aagtgagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0085_A05.b : gcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0050_D05.b : caggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0095_E05.b : gcgagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0083_B05.b : acggacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
BMWN1_0059_G06.b : ttttggagagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
BMWN1_0097_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctataaatA
BMWN1_0030_B04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
---------+---------+---------+---------+---------+---------+ 110
BMWN1_0042_C02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0087_C09.b : CCCT*TTAAC*ATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0076_G02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0009_E06.b : CCCC*GTTACAATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0022_H12.b : CCTT*TACACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0044_D12.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0087_B03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0070_H02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0031_A08.b : CCTG*GGCACCATGGAAACCCAGAAGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0096_A02.b : CCTG*GTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0071_E01.b : CTTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0032_C05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0042_E02.b : CCCG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0024_D10.b : CCCC*GTTTCCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0083_A04.b : CCTGGGCTACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0087_E08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0063_C06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0024_F05.b : CCCG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0076_B04.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0034_A10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0094_H02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0098_F09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0090_D03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0039_E08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0078_D08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0011_E08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0012_A02.b : CCTG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0028_A01.b : CCTG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0078_H02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0030_E11.b : CCTT*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0022_B03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0030_F10.b : CCTGTTGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0052_C05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0016_G05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0047_H10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0045_G03.b : CCTG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0090_F01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0095_D02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0048_F08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0010_D12.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0051_F01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0042_F12.b : CCTG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0042_D07.b : CCTT*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0047_C10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0097_H01.b : CCCG*TTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0078_B03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0063_G06.b : CCTGTGGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0004_B02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0049_E03.b : CCTG*GTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0039_D08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0060_A05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0057_D09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0001_G10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0050_C10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0031_D02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0067_C07.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0096_B01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0059_C11.b : CCTG*GGCACCATGGAGACCCAGAGGGCCACCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0036_B01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0096_C09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0020_D02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0048_B11.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0069_D10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0061_G07.b : CCCG*TATAGCATGGACACCAAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0082_G09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0047_D08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0083_H03.b : CCTC*GCCTTTATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0036_F12.b : CCCG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0088_D11.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0048_B04.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0010_H06.b : CCTC*GTTACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0072_B03.b : CCTG*TTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0020_C11.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0068_H11.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0013_G09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0003_G06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0086_E07.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0005_F02.b : CCTG*GCCCTTAAGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCCCCCTTAAGAGGC
BMWN1_0007_H06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0015_B10.b : CCTG*GGNNAGATGGAGACCCAGAGGGCCACCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0011_H03.b : CNCC*GGCACCATGGATACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0093_C07.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0094_B10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0098_D08.b : CCCG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0006_B06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0061_F08.b : CCTGTGGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0001_C12.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0062_D05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0010_D10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0049_A12.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0074_D07.b : CCTT*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0030_D10.b : CCCG*TTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0059_A08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0002_H01.b : CCTGTGGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0085_F03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0063_A08.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0015_C06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCAGGGGCGCTGGTCACTGTGGC
BMWN1_0046_E05.b : CCCG*GTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0040_D10.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0083_G01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0079_E03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0073_F01.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0080_A02.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0088_A03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0023_E04.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0025_H09.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0041_G02.b : CCTCGTGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0001_F07.b : CCTG*TGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0086_F03.b : CCCC*TGTTAAATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0085_A05.b : CCTC*CTTTCCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0050_D05.b : CCCGGGTCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0095_E05.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0083_B05.b : CCTG*CGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0059_G06.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0097_C03.b : CCTG*GGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0030_B04.b : xxxxxxGCACCATGGAGACCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGC
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
---------+---------+---------+---------+---------+---------+ 170
BMWN1_0042_C02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0087_C09.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0076_G02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0009_E06.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0022_H12.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0044_D12.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0087_B03.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0070_H02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0031_A08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAACTACAGGGAGG
BMWN1_0096_A02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0071_E01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0032_C05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0042_E02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0024_D10.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0083_A04.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0087_E08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0063_C06.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0024_F05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0076_B04.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0034_A10.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0094_H02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0098_F09.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0090_D03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0039_E08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0078_D08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0011_E08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0012_A02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0028_A01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0078_H02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0030_E11.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0022_B03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0030_F10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0052_C05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0016_G05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0047_H10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0045_G03.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0090_F01.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0095_D02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0048_F08.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0010_D12.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0051_F01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0042_F12.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0042_D07.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0047_C10.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0097_H01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0078_B03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0063_G06.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0004_B02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0049_E03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0039_D08.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0060_A05.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0057_D09.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0001_G10.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0050_C10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0031_D02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0067_C07.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0096_B01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0059_C11.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0036_B01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0096_C09.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0020_D02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0048_B11.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0069_D10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0061_G07.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0082_G09.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0047_D08.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0083_H03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0036_F12.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0088_D11.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0048_B04.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0010_H06.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0072_B03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0020_C11.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0068_H11.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0013_G09.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0003_G06.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0086_E07.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0005_F02.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0007_H06.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0015_B10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCATGCCCTCACCTACAGGGAGG
BMWN1_0011_H03.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCTGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0093_C07.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0094_B10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0098_D08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0006_B06.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0061_F08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0001_C12.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0062_D05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0010_D10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0049_A12.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0074_D07.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0030_D10.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0059_A08.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0002_H01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0085_F03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0063_A08.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0015_C06.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCATCTACAGGGAGG
BMWN1_0046_E05.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0040_D10.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0083_G01.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0079_E03.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0073_F01.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0080_A02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0088_A03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0023_E04.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0025_H09.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0041_G02.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0001_F07.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0086_F03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0085_A05.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0050_D05.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0095_E05.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0083_B05.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0059_G06.b : TTCTGCTGCTGGCACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0097_C03.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0030_B04.b : TTCTGCTGCTGGGACTCGTGGTGCCCTCGGCCAGCGCCCAGGCCCTCAGCTACAGGGAGG
BMWN1_0076_C06.b : nnnnnnggagagtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
---------+---------+---------+---------+---------+---------+ 230
BMWN1_0042_C02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0087_C09.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCATAAGCTAATCTCTACCGCC
BMWN1_0076_G02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0009_E06.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0022_H12.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0044_D12.b : CCGTGCTTCGAGCCGTGGATCGCCTCAGCGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0087_B03.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0070_H02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0031_A08.b : CCGTGCTTCCAGCCGTGGATCGCCTCAACGAACAGTCCTCAAAAACTAATCTCTACCGCC
BMWN1_0096_A02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0071_E01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0032_C05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0042_E02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAGGGTAATCTCTACCGCC
BMWN1_0024_D10.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0083_A04.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0087_E08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0063_C06.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0024_F05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0076_B04.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0034_A10.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0094_H02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0098_F09.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0090_D03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0039_E08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0078_D08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0011_E08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0012_A02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0028_A01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0078_H02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0030_E11.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0022_B03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0030_F10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0052_C05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0016_G05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0047_H10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0045_G03.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTGGGAAGCTAATCTCTACCGCC
BMWN1_0090_F01.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0095_D02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0048_F08.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0010_D12.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0051_F01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0042_F12.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCGGAGAAGCTAATCTCTACCGCC
BMWN1_0042_D07.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCGGGGGAAGCTAATCTCTACCGCC
BMWN1_0047_C10.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0097_H01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0078_B03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0063_G06.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0004_B02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0049_E03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0039_D08.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0060_A05.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0057_D09.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0001_G10.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0050_C10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0031_D02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0067_C07.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0096_B01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0059_C11.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0036_B01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0096_C09.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0020_D02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0048_B11.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0069_D10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0061_G07.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACTAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0082_G09.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0047_D08.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0083_H03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCACAAGCTAATCTCTACCGCC
BMWN1_0036_F12.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0088_D11.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0048_B04.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0010_H06.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0072_B03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0020_C11.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0068_H11.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0013_G09.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0003_G06.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0086_E07.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0005_F02.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0007_H06.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0015_B10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0011_H03.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0093_C07.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0094_B10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0098_D08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0006_B06.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0061_F08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0001_C12.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0062_D05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0010_D10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0049_A12.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0074_D07.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0030_D10.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0059_A08.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0002_H01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0085_F03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0063_A08.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0015_C06.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0046_E05.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCGGAAGCTAATCTCTACCGCC
BMWN1_0040_D10.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0083_G01.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0079_E03.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0073_F01.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0080_A02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0088_A03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0023_E04.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0025_H09.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0041_G02.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAGGGGAATCTCTACCGCC
BMWN1_0001_F07.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0086_F03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0085_A05.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0050_D05.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0095_E05.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0083_B05.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0059_G06.b : CCGTGCTTCGTGCTGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0097_C03.b : CCGTGCTTCGAGCCGTGGATCGCCTCAGCGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0030_B04.b : CCGTGCTTCGAGCCGTGGATCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0076_C06.b : xxxxxxxxxxxxxxxxxxxTCGCCTCAACGAGCAGTCCTCAGAAGCTAATCTCTACCGCC
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
---------+---------+---------+---------+---------+---------+ 290
BMWN1_0042_C02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0087_C09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0076_G02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0009_E06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0022_H12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0044_D12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0087_B03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0070_H02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0031_A08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGAAGAAGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0096_A02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0071_E01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0032_C05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0042_E02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0024_D10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0083_A04.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0087_E08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0063_C06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0024_F05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0076_B04.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0034_A10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0094_H02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0098_F09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0090_D03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0039_E08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0078_D08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0011_E08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0012_A02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0028_A01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0078_H02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0030_E11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0022_B03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0030_F10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0052_C05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0016_G05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0047_H10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0045_G03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0090_F01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0095_D02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0048_F08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0010_D12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0051_F01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0042_F12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0042_D07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0047_C10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0097_H01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0078_B03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0063_G06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0004_B02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0049_E03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0039_D08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0060_A05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0057_D09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0001_G10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0050_C10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0031_D02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0067_C07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0096_B01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0059_C11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0036_B01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0096_C09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0020_D02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0048_B11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0069_D10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0061_G07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0082_G09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0047_D08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0083_H03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0036_F12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0088_D11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0048_B04.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0010_H06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0072_B03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0020_C11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0068_H11.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0013_G09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0003_G06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0086_E07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0005_F02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0007_H06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0015_B10.b : TCCTGTAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0011_H03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0093_C07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0094_B10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0098_D08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0006_B06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0061_F08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0001_C12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0062_D05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0010_D10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0049_A12.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0074_D07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0030_D10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0059_A08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0002_H01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0085_F03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0063_A08.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0015_C06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0046_E05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0040_D10.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0083_G01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0079_E03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0073_F01.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0080_A02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0088_A03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0023_E04.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0025_H09.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0041_G02.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0001_F07.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0086_F03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0085_A05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0050_D05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0095_E05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0083_B05.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0059_G06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0097_C03.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0030_B04.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0076_C06.b : TCCTGGAGCTGGACCAGCCGCCCAAGGCCGACGAGGACCCGGGCACCCCAAAACCTGTGA
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
---------+---------+---------+---------+---------+---------+ 350
BMWN1_0042_C02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0087_C09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0076_G02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0009_E06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0022_H12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0044_D12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0087_B03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0070_H02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0031_A08.b : GCTTCACGGTGAAAGAAACTGTGTGTCCCAAGCCGACCCGGCGGCCCCCGGAACTGTGTG
BMWN1_0096_A02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0071_E01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0032_C05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0042_E02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0024_D10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0083_A04.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0087_E08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0063_C06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0024_F05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0076_B04.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0034_A10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0094_H02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0098_F09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0090_D03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0039_E08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0078_D08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0011_E08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0012_A02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0028_A01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0078_H02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0030_E11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0022_B03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0030_F10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0052_C05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0016_G05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0047_H10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0045_G03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0090_F01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0095_D02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0048_F08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0010_D12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0051_F01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0042_F12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0042_D07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0047_C10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0097_H01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0078_B03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0063_G06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0004_B02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0049_E03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0039_D08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0060_A05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0057_D09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0001_G10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0050_C10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0031_D02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0067_C07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0096_B01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0059_C11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0036_B01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0096_C09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0020_D02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0048_B11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0069_D10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0061_G07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCATGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0082_G09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0047_D08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0083_H03.b : GCTTCACAGTGAAGGAGACTGTGTGTCCCATGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0036_F12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0088_D11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0048_B04.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0010_H06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0072_B03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0020_C11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0068_H11.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0013_G09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0003_G06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0086_E07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0005_F02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0007_H06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0015_B10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0011_H03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0093_C07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0094_B10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0098_D08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0006_B06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0061_F08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0001_C12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0062_D05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0010_D10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0049_A12.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0074_D07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0030_D10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0059_A08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0002_H01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0085_F03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0063_A08.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0015_C06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0046_E05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0040_D10.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0083_G01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0079_E03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0073_F01.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0080_A02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0088_A03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0023_E04.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0025_H09.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0041_G02.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0001_F07.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0086_F03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0085_A05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0050_D05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0095_E05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0083_B05.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0059_G06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0097_C03.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0030_B04.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0076_C06.b : GCTTCACGGTGAAGGAGACTGTGTGTCCCAGGCCGACCCGGCGGCCCCCGGAGCTGTGTG
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
---------+---------+---------+---------+---------+---------+ 410
BMWN1_0042_C02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0087_C09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0076_G02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0009_E06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0022_H12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0044_D12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0087_B03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0070_H02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0031_A08.b : ACTTCAAAGAAAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAAATCA
BMWN1_0096_A02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0071_E01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0032_C05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0042_E02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0024_D10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0083_A04.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0087_E08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0063_C06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0024_F05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0076_B04.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0034_A10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0094_H02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0098_F09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0090_D03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0039_E08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0078_D08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0011_E08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0012_A02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0028_A01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0078_H02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0030_E11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0022_B03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0030_F10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0052_C05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0016_G05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0047_H10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0045_G03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0090_F01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0095_D02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0048_F08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0010_D12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0051_F01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0042_F12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0042_D07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0047_C10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0097_H01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0078_B03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0063_G06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0004_B02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0049_E03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0039_D08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0060_A05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0057_D09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0001_G10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0050_C10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0031_D02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0067_C07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0096_B01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0059_C11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0036_B01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0096_C09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0020_D02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0048_B11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0069_D10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0061_G07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0082_G09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0047_D08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0083_H03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0036_F12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0088_D11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0048_B04.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0010_H06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0072_B03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0020_C11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0068_H11.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0013_G09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0003_G06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0086_E07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0005_F02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0007_H06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0015_B10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGAATCAGATTA
BMWN1_0011_H03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0093_C07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0094_B10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0098_D08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0006_B06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0061_F08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0001_C12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0062_D05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0010_D10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0049_A12.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0074_D07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0030_D10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0059_A08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0002_H01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0085_F03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0063_A08.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0015_C06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0046_E05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0040_D10.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0083_G01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0079_E03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0073_F01.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0080_A02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0088_A03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0023_E04.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0025_H09.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0041_G02.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0001_F07.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0086_F03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0085_A05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0050_D05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0095_E05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0083_B05.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0059_G06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0097_C03.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0030_B04.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0076_C06.b : ACTTCAAGGAGAACGGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCA
BMWN1_0046_D08.b : naaagggcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
---------+---------+---------+---------+---------+---------+ 469
BMWN1_0042_C02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0087_C09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0076_G02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0009_E06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0022_H12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0044_D12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0087_B03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0070_H02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0031_A08.b : AGGACCCGCTCGACATCACCTGCAATG*AAGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0096_A02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0071_E01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0032_C05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0042_E02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0024_D10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0083_A04.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0087_E08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0063_C06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0024_F05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0076_B04.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0034_A10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0094_H02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0098_F09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0090_D03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0039_E08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0078_D08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0011_E08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0012_A02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0028_A01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0078_H02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0030_E11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0022_B03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0030_F10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0052_C05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0016_G05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0047_H10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0045_G03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0090_F01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0095_D02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0048_F08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0010_D12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0051_F01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0042_F12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0042_D07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0047_C10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0097_H01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0078_B03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0063_G06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0004_B02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0049_E03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0039_D08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0060_A05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0057_D09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0001_G10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0050_C10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0031_D02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0067_C07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0096_B01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0059_C11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0036_B01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0096_C09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0020_D02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0048_B11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0069_D10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0061_G07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0082_G09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0047_D08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0083_H03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0036_F12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0088_D11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0048_B04.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0010_H06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0072_B03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0020_C11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0068_H11.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0013_G09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0003_G06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0086_E07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0005_F02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0007_H06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0015_B10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCACGGTGTCATGGGAGGTCGCCTGTGC
BMWN1_0011_H03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0093_C07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0094_B10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0098_D08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0006_B06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0061_F08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0001_C12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0062_D05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0010_D10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0049_A12.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0074_D07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0030_D10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0059_A08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0002_H01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0085_F03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0063_A08.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0015_C06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCACCCCGTCAGGGGAGGTCGCCTGTGC
BMWN1_0046_E05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0040_D10.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0083_G01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0079_E03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0073_F01.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0080_A02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0088_A03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0023_E04.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0025_H09.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0041_G02.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0001_F07.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0086_F03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0085_A05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0050_D05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0095_E05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0083_B05.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0059_G06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0097_C03.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0030_B04.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0076_C06.b : AGGACCCGCTCGACATCACCTGCAATG*AGGTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0046_D08.b : xxxxxxxxxxxxxxxxxACCTGCAATGCATTTTCAAGGTGTCAGGGGAGGTCGCCTGTGC
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
---------+---------+---------+---------+---------+---------+ 528
BMWN1_0042_C02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0087_C09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0076_G02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0009_E06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0022_H12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0044_D12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0087_B03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0070_H02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0031_A08.b : TATTGTAAGGGTAGGTTCTGCATCTGTGTCGGAAGAAGATGAAGGTTGCGACGGCAGGC*
BMWN1_0096_A02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0071_E01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0032_C05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0042_E02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0024_D10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0083_A04.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0087_E08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0063_C06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0024_F05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0076_B04.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0034_A10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0094_H02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0098_F09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0090_D03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0039_E08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0078_D08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0011_E08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0012_A02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0028_A01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0078_H02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0030_E11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0022_B03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0030_F10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0052_C05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0016_G05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0047_H10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0045_G03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0090_F01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0095_D02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0048_F08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0010_D12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0051_F01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0042_F12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0042_D07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0047_C10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0097_H01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0078_B03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0063_G06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0004_B02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0049_E03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0039_D08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0060_A05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0057_D09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0001_G10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0050_C10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0031_D02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0067_C07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0096_B01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0059_C11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0036_B01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0096_C09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0020_D02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0048_B11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0069_D10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0061_G07.b : TATTGTACGGGTAGGTTCTGCATCTGTGTCAGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0082_G09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0047_D08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0083_H03.b : TATTGTAAGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACTGTTGCGACGGCAGGC*
BMWN1_0036_F12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0088_D11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0048_B04.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0010_H06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0072_B03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0020_C11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0068_H11.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0013_G09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0003_G06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0086_E07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0005_F02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0007_H06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0015_B10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCAGATGATGATGACTGTTGCGACTGCATGT*
BMWN1_0011_H03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAAGCT
BMWN1_0093_C07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0094_B10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0098_D08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0006_B06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0061_F08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0001_C12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0062_D05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0010_D10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0049_A12.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0074_D07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0030_D10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0059_A08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0002_H01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0085_F03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0063_A08.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0015_C06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0046_E05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0040_D10.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0083_G01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0079_E03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0073_F01.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0080_A02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0088_A03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0023_E04.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0025_H09.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0041_G02.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0001_F07.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0086_F03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0085_A05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0050_D05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0095_E05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0083_B05.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0059_G06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0097_C03.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0030_B04.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0076_C06.b : TATTGTAGGGGTAGGTTCTGCATCTGTGTCGGATGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0046_D08.b : TATTGTAGGCGTAGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGC*
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
---------+---------+---------+---------+---------+---------+ 588
BMWN1_0042_C02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0087_C09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0076_G02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0009_E06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0022_H12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCGCAATTTTTCCGCCTCCACC
BMWN1_0044_D12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0087_B03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0070_H02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0031_A08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0096_A02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0071_E01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0032_C05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0042_E02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0024_D10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0083_A04.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0087_E08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0063_C06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0024_F05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0076_B04.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0034_A10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0094_H02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0098_F09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0090_D03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0039_E08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0078_D08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0011_E08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0012_A02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0028_A01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0078_H02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0030_E11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0022_B03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0030_F10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0052_C05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0016_G05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0047_H10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0045_G03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0090_F01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0095_D02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0048_F08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0010_D12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0051_F01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0042_F12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0042_D07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0047_C10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0097_H01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0078_B03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0063_G06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0004_B02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0049_E03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0039_D08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0060_A05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0057_D09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0001_G10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0050_C10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0031_D02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0067_C07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0096_B01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCNAC
BMWN1_0059_C11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0036_B01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0096_C09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0020_D02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0048_B11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0069_D10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0061_G07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0082_G09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0047_D08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0083_H03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0036_F12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0088_D11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0048_B04.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0010_H06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0072_B03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0020_C11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0068_H11.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0013_G09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0003_G06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0086_E07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0005_F02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0007_H06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0015_B10.b : TTTCCCTCCCCCATTTTTCCCGGTGCCtatgttttcgtcccctaattttcccgcctctcc
BMWN1_0011_H03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0093_C07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0094_B10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0098_D08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0006_B06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0061_F08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0001_C12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0062_D05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0010_D10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0049_A12.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0074_D07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0030_D10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0059_A08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0002_H01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0085_F03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0063_A08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0015_C06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0046_E05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0040_D10.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0083_G01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0079_E03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0073_F01.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0080_A02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0088_A03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0023_E04.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0025_H09.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0041_G02.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0001_F07.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0086_F03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0085_A05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0050_D05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0095_E05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0083_B05.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0059_G06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0097_C03.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0030_B04.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0076_C06.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0046_D08.b : TTTCCCTCCCCCAATTTTCCCGGGGCCAGGTTTCCGTCCCCCAATTTTTCCGCCTCCACC
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
---------+---------+---------+---------+---------+---------+ 645
BMWN1_0042_C02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0087_C09.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAATGATTTG
BMWN1_0076_G02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0009_E06.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0022_H12.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0044_D12.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0087_B03.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0070_H02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0031_A08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0096_A02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0071_E01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0032_C05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0042_E02.b : TTT*CCGGCCCGCACCATTCGGTCCACC***AGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0024_D10.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0083_A04.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0087_E08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0063_C06.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0024_F05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0076_B04.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0034_A10.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0094_H02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0098_F09.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0090_D03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0039_E08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0078_D08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0011_E08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0012_A02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0028_A01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0078_H02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0030_E11.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0022_B03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0030_F10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0052_C05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0016_G05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTT
BMWN1_0047_H10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0045_G03.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0090_F01.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0095_D02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0048_F08.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0010_D12.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0051_F01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0042_F12.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0042_D07.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0047_C10.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0097_H01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0078_B03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0063_G06.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0004_B02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0049_E03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0039_D08.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0060_A05.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0057_D09.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0001_G10.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0050_C10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0031_D02.b : TTTTCCGGCCCGCACCATTTCATCCACC**AAGGTTCCCTGGTAAACCGTGAAGGATTTG
BMWN1_0067_C07.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0096_B01.b : TTT*CCGGGCCGCACCATTCAGTCCACC**AAGGTTTCCTGGTAGACGGTGAAAGATTTG
BMWN1_0059_C11.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0036_B01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AGGTTNCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0096_C09.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0020_D02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0048_B11.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0069_D10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0061_G07.b : TTT*CCGGCCCGCATCATTCAGTCCACG**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0082_G09.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0047_D08.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0083_H03.b : TTT*CCGGCCCGCACCATTCATTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0036_F12.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0088_D11.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0048_B04.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0010_H06.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0072_B03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0020_C11.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0068_H11.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0013_G09.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0003_G06.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0086_E07.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0005_F02.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0007_H06.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0015_B10.b : attttcggcccgactatttcagttcacctaggttcccctgctatactgtgtacgatttgc
BMWN1_0011_H03.b : TTT*CCCGCCCGCACCATTTCGGCCCACCAAAGGTCCCCTGGTAAACGGTGAAGGATTTG
BMWN1_0093_C07.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0094_B10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0098_D08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0006_B06.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0061_F08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0001_C12.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0062_D05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0010_D10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0049_A12.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0074_D07.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0030_D10.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0059_A08.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0002_H01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0085_F03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0063_A08.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0015_C06.b : TTT*CCGGCCCGCACCATTCGGTCCCCC**AAGGTTCCCTGGTAGACCGTGAAGGATTTG
BMWN1_0046_E05.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0040_D10.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0083_G01.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0079_E03.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAANGATTTG
BMWN1_0073_F01.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0080_A02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACNGTGAAGGATTTG
BMWN1_0088_A03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0023_E04.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0025_H09.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0041_G02.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAAGATTTG
BMWN1_0001_F07.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0086_F03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0085_A05.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0050_D05.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0095_E05.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0083_B05.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0059_G06.b : TTT*CCGGCCCGCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0097_C03.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0030_B04.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0076_C06.b : TTT*CCGGCCCGCACCATTCAGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0046_D08.b : TTT*CCGGGGCCCACCATTCGGTCCACC**AAGGTTCCCTGGTAGACGGTGAAGGATTTG
BMWN1_0095_C02.b : ttttccgaggtacgaxxxxxxxxxxxx
BMWN1_0018_B09.b : tt
20110601C-000164 : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
---------+---------+---------+---------+---------+---------+ 701
BMWN1_0042_C02.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0087_C09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0076_G02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0009_E06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0022_H12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0044_D12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0087_B03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0070_H02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0031_A08.b : CAGGCAACTC*ACCCAAAA*GGCCTTTCCGTTACATTAAAATCCC*CACAAGAAAACTAA
BMWN1_0096_A02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0071_E01.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCCAAGAGACCTA
BMWN1_0032_C05.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0042_E02.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCCGT*ACATTAAAATCC**AGCAAGGAGACCTA
BMWN1_0024_D10.b : CATGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCCCAGCAAGGAGACCTA
BMWN1_0083_A04.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0087_E08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0063_C06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0024_F05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0076_B04.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0034_A10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0094_H02.b : CANGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTTAAATCCC*AGCAAGGAGACCTA
BMWN1_0098_F09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0090_D03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0039_E08.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0078_D08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0011_E08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0012_A02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAA*TCCC*AGCAAGGAGACCTA
BMWN1_0028_A01.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCNGT*ACATTA*AATCCCCAGCA*GGAGACCTA
BMWN1_0078_H02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0030_E11.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0022_B03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0030_F10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0052_C05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0016_G05.b : GCAGGCACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCCCAGCAGGGAGACCTA
BMWN1_0047_H10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0045_G03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0090_F01.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0095_D02.b : CANGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0048_F08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0010_D12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCTGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0051_F01.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0042_F12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0042_D07.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0047_C10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0097_H01.b : CAGGCAACTC*ACCCAAAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0078_B03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0063_G06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0004_B02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0049_E03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0039_D08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0060_A05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0057_D09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0001_G10.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0050_C10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0031_D02.b : CAGGCCACTCCACCAAAAA*GGCCTTTCCGT*TCATTAAATTCCC*AGCATGGAaaacct
BMWN1_0067_C07.b : CAGGCAACTC*ACCCAGAA*TGCCTTTCGGT*ACATTAAAATCCC*AGCAAAGAGACCTA
BMWN1_0096_B01.b : CAGGCNACTC*ACCAAGAA*GGCCTTCNG*T*ACATTAAAATCCC*AGCAAGGAGACCNT
BMWN1_0059_C11.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0036_B01.b : CAGGCAACTC*ACCCAGAA**GCCTTTCGGT*ACATTAAATCCC***AGCAGGAGAACTN
BMWN1_0096_C09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCNGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0020_D02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0048_B11.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0069_D10.b : CAGGCAACTC*ACCCAGAA*TGCCTTTCGGT*ACATTAAATCCC**AGCAAGGAGACCTA
BMWN1_0061_G07.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGATACATT*AAATCCC*AGCAAGGAGACCTA
BMWN1_0082_G09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0047_D08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0083_H03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0036_F12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0088_D11.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0048_B04.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0010_H06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0072_B03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0020_C11.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0068_H11.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0013_G09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0003_G06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0086_E07.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0005_F02.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0007_H06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0015_B10.b : aggcaatccaccaaaatgcctttcagtacattataatcccatataggaaacttaatcatc
BMWN1_0011_H03.b : CAAGGCACTC*ACCCCAAA*AGCCCTTCCGT*TACTTTAAATCCC*AGCAAagaaaacct
BMWN1_0093_C07.b : CANGCAACTC*ACCCAGAA*GGCCTTTCNGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0094_B10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0098_D08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0006_B06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0061_F08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0001_C12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0062_D05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0010_D10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0049_A12.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0074_D07.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0030_D10.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0059_A08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0002_H01.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0085_F03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0063_A08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0015_C06.b : CAGGCAACTC*ACTCAGAA*AGCCCTTCGGT*ACATT*AAATCCC*CGCAAGGAGATCTA
BMWN1_0046_E05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0040_D10.b : CANGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0083_G01.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0079_E03.b : CANGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0073_F01.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0080_A02.b : CAGGCAACTC*ACCCAGAANGGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0088_A03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0023_E04.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0025_H09.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0041_G02.b : CAGGCAACTC*ACCCAGAA*AGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0001_F07.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0086_F03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0085_A05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0050_D05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0095_E05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0083_B05.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0059_G06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0097_C03.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0030_B04.b : CANGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCC**AGCAAGGAGACCCT
BMWN1_0076_C06.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0046_D08.b : CAGGCAACTC*ACCCAGAA*GGCCTTTCGGT*ACATTAAAATCCC*AGCAAGGAGACCTA
BMWN1_0095_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTAAAATCCT*AGCAAGGAGACCTA
BMWN1_0018_B09.b : tttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgA
20110601C-000164 : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
---------+---------+---------+---------+---------+---------+ 758
BMWN1_0042_C02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0087_C09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCCnnttt
BMWN1_0076_G02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGcanccnnnnnn
BMWN1_0009_E06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAACTTC
BMWN1_0022_H12.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCCNNNan
BMWN1_0044_D12.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0087_B03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0070_H02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CGTGTGaaaacaaaaaa
BMWN1_0031_A08.b : AGCATCTGCTTTTTCCCAGGCCCGCATCTGTAAA*ATAAATT*CTTGGGAAACCCCNNAN
BMWN1_0096_A02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAATTN*CTTtgtgaaccnacttc
BMWN1_0071_E01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*TT*AATT*CTTGTtgaccccgntnt
BMWN1_0032_C05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAcccnnnnna
BMWN1_0042_E02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTNGAAACcannnn
BMWN1_0024_D10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATTAATT*CTTGTGAAACCCtataa
BMWN1_0083_A04.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCA
BMWN1_0087_E08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAA
BMWN1_0063_C06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0024_F05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0076_B04.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCNA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0034_A10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAAACAAAAAA
BMWN1_0094_H02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0098_F09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCNA*ATAAATTTCTTGTGAAccaannnna
BMWN1_0090_D03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0039_E08.b : AACATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0078_D08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0011_E08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTNGAACCTACTTC
BMWN1_0012_A02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0028_A01.b : AGCATCTGCTTTG*CCCCAGGCCGCCTCTGTCAA*TAAATTC*CTGTTGAACCCAAAAAA
BMWN1_0078_H02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0030_E11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAACCCAAAAAA
BMWN1_0022_B03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAA
BMWN1_0030_F10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0052_C05.b : AGCATCTGCTTTT*GCCAGGCCCGCATCTGTCAA*ATAAA*T*CTTGTNGAANCAAAAAA
BMWN1_0016_G05.b : AGCATCTGCTTTG*CCCAGGGCCGCATCTGTCAA*ATTAATT*CTTGTGAAACCCAAnnn
BMWN1_0047_H10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0045_G03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0090_F01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0095_D02.b : AGCATCTGCTTTG*CCCANGCCCGCATCTGTCAA*ATAAAAT*CTTGTGAAACCAAAAAA
BMWN1_0048_F08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAA
BMWN1_0010_D12.b : AGCATCTGCTTTT*GCCAGGCCCGCATCTGTCNA*ATAAATT*CTTGTGAAAACAAAAAA
BMWN1_0051_F01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCNAAAAA
BMWN1_0042_F12.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0042_D07.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATTTCTTGTGAAAACCaanaa
BMWN1_0047_C10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0097_H01.b : AGCATCTGCTTTG*CCCCAGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCCAAANN
BMWN1_0078_B03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0063_G06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0004_B02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCNNNNNN
BMWN1_0049_E03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0039_D08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAAACCAAAAA
BMWN1_0060_A05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0057_D09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCTACTTC
BMWN1_0001_G10.b : AACATCTGCTTTG*CCCAGCCCCCCATCTGTCAAAATAATTT*CTTGTGAAACCAACCNA
BMWN1_0050_C10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGCAACCNannnn
BMWN1_0031_D02.b : aatcatctgcttttccccagcccccccttctggtcaaattaaatttcttgtggaccccct
BMWN1_0067_C07.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCNAGAAA
BMWN1_0096_B01.b : AACATCTGCTTTT*GCCANGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0059_C11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0036_B01.b : AGCATCTGCTTTG*CCCAGGCC*GCATCTGTCAA*ATA*ATT*CTGGTGAACaaaaaaaa
BMWN1_0096_C09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0020_D02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCNanaaa
BMWN1_0048_B11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0069_D10.b : ACCATCTGCTTTT*GCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaataa
BMWN1_0061_G07.b : AGCATCTGCTTTG*CCCAGACCCGCATCCGCTAA*ATAA*TT*CTTGTGAAACCcttcac
BMWN1_0082_G09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCNA*ATAAATT*CTTGTGAAACCnnnnnn
BMWN1_0047_D08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAn
BMWN1_0083_H03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCnnnntt
BMWN1_0036_F12.b : AACATCTGCTTTG*CCCANGCCCGCATCTGTCAA*AATAATT*CTTGTGAAACCAAAAAA
BMWN1_0088_D11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0048_B04.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0010_H06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0072_B03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCannnnn
BMWN1_0020_C11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaannan
BMWN1_0068_H11.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0013_G09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0003_G06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAACAAA
BMWN1_0086_E07.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0005_F02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGNAACCNNNNan
BMWN1_0007_H06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0015_B10.b : tgctttgtccacgcccacttcgacaaataaatccttgtgaatccactactataatatacc
BMWN1_0011_H03.b : aaccacctgctttgcccaggccccccatctgccaaaaaaaattcttgtgaaacccaacct
BMWN1_0093_C07.b : AGCATCTGCTTTT*GCCAGGCC*GCATCTGTCAA*AATAATTCTTTGTGAAaccannnnn
BMWN1_0094_B10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAACCnnnnnnn
BMWN1_0098_D08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAAACc
BMWN1_0006_B06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCnnnnnn
BMWN1_0061_F08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCnnnnnn
BMWN1_0001_C12.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAAT**CTTGTGAAACCnannna
BMWN1_0062_D05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAn
BMWN1_0010_D10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAA
BMWN1_0049_A12.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0074_D07.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAANNNN
BMWN1_0030_D10.b : AGCATCTGCTTTG*CCAAGG*CCGCATCTGTCNA*ATAAATT*CTTGTGAAAACAAAAAA
BMWN1_0059_A08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAcattc
BMWN1_0002_H01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0085_F03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0063_A08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0015_C06.b : ATCATCTGCTTTG*CCCAGGCCCGCATCTGTCCA*AAAAATT*CTTGTGAAACCCAtcaa
BMWN1_0046_E05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0040_D10.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATTTCTTGTGAACCAAaaaaa
BMWN1_0083_G01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0079_E03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAAACAAAAAA
BMWN1_0073_F01.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*AATAATT*CTTGTGAAACCAAAAAA
BMWN1_0080_A02.b : AGCATCTGCTTTT*GCCANGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0088_A03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0023_E04.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0025_H09.b : AGCATCTGCTTTT*GCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0041_G02.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0001_F07.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCCanaaa
BMWN1_0086_F03.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0085_A05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCNaanna
BMWN1_0050_D05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAAGCNaannn
BMWN1_0095_E05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0083_B05.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCaaaaaa
BMWN1_0059_G06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAANCCnnnnnn
BMWN1_0097_C03.b : AGCATCTGCTTTTGCCCAAGCCCGCTTCTGTCAA*ATATATT*CTTGTGAAACCCAAAtt
BMWN1_0030_B04.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAAT**CTTGTGAAACCAAAAAA
BMWN1_0076_C06.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0046_D08.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0095_C02.b : AGCATCTGCTTTG*CCCAGGCCTGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0018_B09.b : AGCATCTGCTTTG*CCCAGGCCCGCATCTGTCAA*ATAAATT*CTTGTGAAACCAAAAAA
20110601C-000164 : AAAAAAAAAAAAAAAAAAAAAAAAAAAA................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b : AAAAAAAAAA
BMWN1_0087_C09.b : aattattttattaaataatatttcncaataatatccctacattttttattcgtgattatt
BMWN1_0076_G02.b : nnnnnanngaaaannnaaaaaaaaaaaaanaanaaaanaannnnnannnnnnnnnannnn
BMWN1_0009_E06.b : AAAAANTAAAAtctaaacaaaaactttatatacctttcatatatccttaccggggcctaa
BMWN1_0022_H12.b : aaaaaaaaaaaaaaaaaaacaaaataaataaattaatantatttattttttattaaaant
BMWN1_0044_D12.b : AAAAAAn
BMWN1_0087_B03.b : naaaaaaaaaaaaaaaaaaanaanaaannaannnnnnnaaannaaaaaaccggcggccgg
BMWN1_0070_H02.b : aaaaaaaaaaaaaaaa
BMWN1_0031_A08.b : Naaanaaaaaaaataaaaaaaaaacatatatcttttttataatttttttgtgtgggtgnc
BMWN1_0096_A02.b : aaaaaa
BMWN1_0071_E01.b : aatataaaaataattacaaacatttattttctgttacttttgcttaatttttgttttccc
BMWN1_0032_C05.b : nnnnnnnaaaanaaaaaaaaaaaaaannnnnaanaaanannnanaaaannnannnnaaaa
BMWN1_0042_E02.b : naaannannaaaaaaaaaaaaaaaaaaanaaaaannnnannaaannnnaaaannnnnnnn
BMWN1_0024_D10.b : taaatataaaaatttatattttaacccatccccctcattctctcctttttaccgctccct
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b : A
BMWN1_0024_F05.b : AAAn
BMWN1_0076_B04.b : AAA
BMWN1_0034_A10.b : AA
BMWN1_0094_H02.b : AA
BMWN1_0098_F09.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_D03.b : AAAA
BMWN1_0039_E08.b : AAAAAAA
BMWN1_0078_D08.b : AAAA
BMWN1_0011_E08.b : CAAAAAaaaaa
BMWN1_0012_A02.b : AAAAAA
BMWN1_0028_A01.b : AAAAAAA
BMWN1_0078_H02.b : AAAAA
BMWN1_0030_E11.b : AAAAAAAA
BMWN1_0022_B03.b :
BMWN1_0030_F10.b : AAAAAAAAA
BMWN1_0052_C05.b : AAAAAAAAA
BMWN1_0016_G05.b : nnnnnnnnnnnnnnnnnnnnaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_H10.b : AAAAAAAAA
BMWN1_0045_G03.b : AAAAAAAAAAA
BMWN1_0090_F01.b : AAAAAAAAAAAAA
BMWN1_0095_D02.b : AA
BMWN1_0048_F08.b :
BMWN1_0010_D12.b : AAAA
BMWN1_0051_F01.b : AAAAAAAAAAAA
BMWN1_0042_F12.b : AAAAAAAAAAAAA
BMWN1_0042_D07.b : aaaaaaaaaaannaaaaaaaannanannnnnaataaaagaaaaaaanaaaaaaaannann
BMWN1_0047_C10.b : aaaaaaaaaaaaaa
BMWN1_0097_H01.b : NAANNNNAAAAAAAAtaaaaataantatntttattatttttntttnnttttntttttttt
BMWN1_0078_B03.b : AAAAAAAAAAAAA
BMWN1_0063_G06.b : aaaaaaaaaaaaaaaa
BMWN1_0004_B02.b : aanaaaaaaaaaaaaaaaannanaaanaaaaananaaaannnaannannnnnnttgtcxx
BMWN1_0049_E03.b : aaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0039_D08.b : AAAAAAAA
BMWN1_0060_A05.b : AAAAAAAAAAA
BMWN1_0057_D09.b : CAAAAAAAAAAAAAAaaaa
BMWN1_0001_G10.b : AAAAAAAAAAAAAAAgananaagactaggagaatagaagaaggngaacagatgagtggcc
BMWN1_0050_C10.b : aaaaaannnaaaaaaaaaaaaaaagataaataaaaaaaaaanaaantnnnnnnnnnnnnn
BMWN1_0031_D02.b : attaattaattaaccaattatttctctactacactttaatttctattattacatactcca
BMWN1_0067_C07.b : AAnatgatttatataataatgaaaaaaaaaaatttattcxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_B01.b : AAAAAAA
BMWN1_0059_C11.b : AAAAAAAAAAAA
BMWN1_0036_B01.b : aaaaaaaaaaaa
BMWN1_0096_C09.b : aaaaaaaaaaaaaa
BMWN1_0020_D02.b : aaaaaaaaaananaaatanaaaaaaanaaaaaaaaaaaaanangggtxxxxxxxxxxxxx
BMWN1_0048_B11.b : AAAAAAAAAAAA
BMWN1_0069_D10.b : aaaaaaaataaaaaacttcctttgcctgtgtatccccttttttgggggcttattttattc
BMWN1_0061_G07.b : ataaatacatattttgtacaataatattaaattagatacattcactctccatactacata
BMWN1_0082_G09.b : nannannaaannnnnnnannnnnnnnnnnnnnnnnntnccgncggccgcggatctccctt
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : taagaaatagaaacaaacacacccgatatggaaagaatccttgcttttattgctaacatt
BMWN1_0036_F12.b : AA
BMWN1_0088_D11.b : AAA
BMWN1_0048_B04.b : AAAA
BMWN1_0010_H06.b : AAAAAAAAAAAAA
BMWN1_0072_B03.b : anannaaanaaaaaaaaaaaaaaaaaaanaanaannnnnnnnnnnannnnnnnnnnnnna
BMWN1_0020_C11.b : aananaaaaaaaaaaaaaaaaaaaaanaaaaaaaaaaanaannggtttxxxxxxxxxxxx
BMWN1_0068_H11.b : aaaaaaaaaaaaaa
BMWN1_0013_G09.b : AAAAAAA
BMWN1_0003_G06.b : AAAAAAn
BMWN1_0086_E07.b : AAAAAAAAAA
BMWN1_0005_F02.b : annnnannaaaaaaaaaaaaaaaaaaaaanananaaaannnnnnaaannnnnnnnnnnnn
BMWN1_0007_H06.b : aaaaaaaaaaaaaaa
BMWN1_0015_B10.b : tactaatattattcaattttatttcatttaatctttaatcttctttcactccttatcttc
BMWN1_0011_H03.b : tcaaaaaaaaaaaaaattaattatttttttactacacccttcataaattacattactatc
BMWN1_0093_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0094_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnngnggnnggggatcgcnnntngggaggg
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : nannnnnnnaannnnnannnnnnnnnnnnnnnnnccncngccncngaatctccctttnnn
BMWN1_0061_F08.b : nannannanaaanaaaaaaaaaanaacggggccgcggatcncccataagggggggctgat
BMWN1_0001_C12.b : aananannaaannaaaaaaaaanaaaaaaaaannnaannnnnnnnnanannnnnnnnnnn
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b : A
BMWN1_0074_D07.b : aaaattatataaaataaaattataatataataaaaaaaattatntntnnttnttnntttt
BMWN1_0030_D10.b : AAA
BMWN1_0059_A08.b : tatataaattatctaattagatatatctaacataccttaattcttccatatatatccctc
BMWN1_0002_H01.b : AAA
BMWN1_0085_F03.b : AAA
BMWN1_0063_A08.b : AAAAA
BMWN1_0015_C06.b : aaattaaaatatatactacaaaataataaaactcattaactcaacaaataatctcactcc
BMWN1_0046_E05.b : AAAAAAAA
BMWN1_0040_D10.b :
BMWN1_0083_G01.b : AAAA
BMWN1_0079_E03.b : AAAAAA
BMWN1_0073_F01.b : AAAAAAAAA
BMWN1_0080_A02.b : AAAAAAAAA
BMWN1_0088_A03.b : AAAAAAAAAA
BMWN1_0023_E04.b : AAAAAAAAAAAA
BMWN1_0025_H09.b : aaaaaaaaaaaaaa
BMWN1_0041_G02.b : aaaaaaaaaaaaaaaa
BMWN1_0001_F07.b : aaaaaaaaaaanaaaaaaaaaaaataaaanaaanaananttnntttccccggcxxxxxxx
BMWN1_0086_F03.b : aaaaaataaaaaaaaaatatctatttntttatataataaatttnntcgnncataaatttt
BMWN1_0085_A05.b : aaaaaaaaaaaaaaaaaaaaaaaaananannaaaaanngxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_D05.b : aaanaaaaaaaaaaaaaaaaaatataattnnaanananaaanaaataaacanaaaaantt
BMWN1_0095_E05.b : aaaaaaaaaaaaaaaaaannnnnnnnnnnnnnannnggggnanaaaannnnntttaaaaa
BMWN1_0083_B05.b : aaaaaaaaaaaaaaaaaa
BMWN1_0059_G06.b : aannnnannaaaanaaaaaaaaaaaaannnnccccaaaaaaaaaaaaaaaaaaaaaaana
BMWN1_0097_C03.b : atcataataaatcctcaatacaatgtatatactttttttttcttttccctcttacggttc
BMWN1_0030_B04.b : AAAA
BMWN1_0076_C06.b : AAAAA
BMWN1_0046_D08.b : AAAAAAAAA
BMWN1_0095_C02.b : AAAAAAAAA
BMWN1_0018_B09.b : AAAAAAAA
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : aaatccacccaagcgtgtgtggtctcgcggcccgaaatttcccttatgggggggttattt
BMWN1_0076_G02.b : nnnnnnnnnnnannnagaaananaaannaggggcggcggaccggcccccccccttataag
BMWN1_0009_E06.b : gaatctcctgtgccggggctcattatttccttaaatgagggatattggatccaaatggaa
BMWN1_0022_H12.b : ataaaattatatttttttggggttcgccggccccccaatctcccttttagggggggttat
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : gattcccctttagggggggttattgaacccaaactgaaaaaaacattgatgaattggaac
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : ttccctcctcggcggcttctatcccctttaattgagatatttatcccgccgctcaataaa
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : tgccttttctcggccctcgccattttttcgtgtgggaggattttcatttaatataataaa
BMWN1_0032_C05.b : nnnttttttccggggcccgcgattcccctttggggggggttattggaccccaaaataaaa
BMWN1_0042_E02.b : nnnnnnannnnnnnnnngggggcccgcgcccccccaatccccccttggggggggtatatt
BMWN1_0024_D10.b : ctttacccacctctctaaccttatttttttttgtaataaattaatataaatttaaaacat
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : ggttccgcgggccggcgaatccccctttggggggggttttttggatccccaaccttaaaa
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : tttttttttgggccccggggcggggtatctctttttggggggggttttgtgccccaacca
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0049_E03.b : xxxxgcacttataaaatgatttgttggattcggaacaaacaccactattatggggttgaa
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : cccgccttggttcccggtccgcgaattttacttgtttgtagatttattgaaaccctccca
BMWN1_0050_C10.b : nnnnccccccttaaatcaccttatatatgaataaaaattgccgcgcccccctttattcct
BMWN1_0031_D02.b : atttattccttttcctcccggcggccgaactcttctttcttttaaacggtttattcgtca
BMWN1_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : tttttttcgggggacccattttccctttggaggaggtatttgatcccataaaaaaaaaat
BMWN1_0061_G07.b : aacattactatttgtggcggcgcccataattctctcttttggaggtgttattgtacccct
BMWN1_0082_G09.b : ttcgggggggtagattggctccttaagggagaaaatttgtttgcagattttgaaaaaccc
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ttgatcactctaattttgttcccccccccccgctccccttttgggggggtaattgatccc
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : naaaaaannnnnnnnggttcccggcccccgaatccccttggggggggtttttggccccaa
BMWN1_0020_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxatccaaattggtcccgctccctggattttttttg
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : nnngggccccgcgcacgaattttctttggggaggttaattccaccacaaaggaaacattc
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : ctcttcccctcttctacttctcttctttttcctcttctttcccttacttactacactata
BMWN1_0011_H03.b : tctccttttctttccgccccccccataatcccttttttttgggtggtactctgaccccac
BMWN1_0093_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0094_B10.b : tgattggattcaaacagaatagatccgttgttgagttggtcgaccaaaccaagaatgcat
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : gggggttaaatggcatccagacatggataaaatgggttgggggggctgggaaattccttt
BMWN1_0061_F08.b : tggatcccgaaattaaaaaaattattgttgctctcggccaccccttcccttttatggggg
BMWN1_0001_C12.b : nnnnnnannnnnnannnnaaaaaaaaaaaaaaaaaanggannagaggaaaaaaanaaaaa
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : tttcgcccaaacaacccctttttggggataataattctctccggctgtgaacttttttgg
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : acaccacattctccatccctcttcccatataatatatttatataataataatccatagtc
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : tccctccgcttcaccttaaacggtaactaaaaatcaaacataatattaaacaaataaaaa
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0086_F03.b : tctgggggcgggtattccctttgggggggttatttgtttccaaaattataaaaaacttga
BMWN1_0085_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_D05.b : ggtccccggccccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_E05.b : gggccgcggccccattcccccttaggggggtttaatgtttccaaactgataatatatttg
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : aananaaaaattccngggccggaaccccccttaaggagggtttatggaaccaaaatggaa
BMWN1_0097_C03.b : cactcacttattaatttattccgcgcctcggggtacccccttttagggggggtctattgg
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : gccccacacctaataaaaattattgtgggagttggggaaaccaccacaacaaatgcttaa
BMWN1_0076_G02.b : agggccttttggccccagaaaacaaaaaaactttggggagtttgaaaaaccccccacctg
BMWN1_0009_E06.b : aaaccacattagaagttggggaaaaaatccttaatggagaaaataaaaggctttttttta
BMWN1_0022_H12.b : tgggtcccaacacaaaaaaaaaaattttgtgaattttgggacacccccccacctaaatgg
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : aaacccctcttaaattgcgggaaaaaaagtgtttttttgaaaaatttggaagcctttttt
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : tcaacattgtgagaatgctgtagagacacacaacactaataatctaagcaatagttttgt
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : ttgtatttttgtgacttacaaccccattaattgttgtaacccaccccaatactctgcttt
BMWN1_0032_C05.b : aaaaacttggtaatttgggaaaacccccccttgaaggcgcggaaaaaaacgtttttttgt
BMWN1_0042_E02.b : ggcaccaaaaactaaaaaaaaaatgttgggaattgcgcccacccccaccgaagggcgggg
BMWN1_0024_D10.b : ttcatctaccttcttatcttttataaaaaaataatacctacataatttttataatcttcc
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : aataacttggtggggtttggacacacccccaacttaaaagggtgggaaaaaaaagccttt
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : tataaataacctttggggttttgaaccaccccccactgatggggggaaaaaaaatttttt
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0049_E03.b : caatccttaacttgagaatttggaaagctttttttttattggaaatctttaaggccgcga
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : aaagctacaattgcgtattttaaacagcctaaaaagaaagcgttgtaaaaaagtttttat
BMWN1_0050_C10.b : ttttgggggggttactgcaacccacaaaaaaaaatatttttttttttttttccccccccc
BMWN1_0031_D02.b : ttccccctagtataagtatcatttactgattgattggaactctccacacctctatatttc
BMWN1_0067_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaactttaaccgg
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : ctttattattttggaaaaacccccttttgattgctttaaaaaaattttttttttgaaaaa
BMWN1_0061_G07.b : acactaaattactacctcatttcttttcactctacacaactgtaatttatgaacatattc
BMWN1_0082_G09.b : cttttggatggggggaaaaaaacgctttaattgggaaaataagagagcctttggtttaat
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : aacacgaaaaaaaattctggtggaggggaaacacccacatttttgcgggaaaaaaaaacc
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : accaaataaatttttggggttttggcacacccccccaaaaggcgggaaaaaagttttttt
BMWN1_0020_C11.b : gataagggctaattgtagtcgccaaaaaaaaaatgctttttttgtggaatttggcaaccc
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : ttggggtgtttgccccacaccccaacaaatgggcaaaaaaatagtttttatagaaaactt
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : aaattcttcatctcttttacactaccacctctattcgtttattctataactatttttttt
BMWN1_0011_H03.b : actaataatataatttttggcaatctttggccacaactctttaataacaattttcagaaa
BMWN1_0093_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0094_B10.b : ggaaaaaaagatttatttgtaagttaggatcgcaatcctttatttttaccaacaaacctg
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : ttggggggggtattggaaaaaccccctttattgggaaatttgtggtgttggtgcctctct
BMWN1_0061_F08.b : ggaaaatgcccccaaccgagaaaattaggtggcttttgtgtaactccaccccaataaggc
BMWN1_0001_C12.b : gggggggaaaaagaaaaaaaaaaaaaaaaaagaggagggagttggagacgaaagnagaaa
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : ttgggggggaccaccctcttcagaagggaaacaaatgtgttttttggaaaatattagcct
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : ataactccactaatactaggtatattaaatcaccaataattatttacactttctttctct
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : taatctggtaaacaccctaccaaacatctttcaaacaactacaataatttaaattttaaa
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0086_F03.b : gatttgggaaaacaaaactggtttgcgggaaaaaggcgttttttggaatttggaaccctt
BMWN1_0085_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_E05.b : gtggttggaacccccccccgaatggggaaaaaattgcttttttgggaatttgagagccat
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : acaacattgtataatttggaaaaacatacgacaaccaaggaaaaaaatggttaattagga
BMWN1_0097_C03.b : accccaccttgaaaaatacttttggcgatttgggaacaaacccacctttaatggctgaaa
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : aaaaaatttttcttttgagaaaatttggatgtcttttttttcattttaaaattttgggcg
BMWN1_0076_G02.b : gggggcgtgaaaaaattttttttttgtttaaaatggaagccctggcttaaaaaaaacaaa
BMWN1_0009_E06.b : aatgtggccttttaggtttttttaaaactttttaaaccgcaataattattttcacacccc
BMWN1_0022_H12.b : gcgaaaaaaaaatttttttattttaaaatattgggagacgtatattttttattttacaac
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : tatttgaaacccttaaaacccgaaaaaaaaattaaaacaccattgccttctttttatttt
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : attaaaacccccttttttgaagttagataagaatatttttccataataagaaaccaataa
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : taaaggtgcttcatttagtactgacgaaancctcttatcttcagataaaacatccctcca
BMWN1_0032_C05.b : gaaattttgggaagcctttcctttattttaaacattaaaaagcggcaaaaaaaagtatac
BMWN1_0042_E02.b : aaaaaatctctttttttggaaaatggggggcgctttgttttttttacacaccttagacgc
BMWN1_0024_D10.b : ctacttatctatacacctcctttgatctctcaaataaatatatttccctacatatttctt
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : ttttgggaaaatttggaagggtattgcctttttttgaaaccctataaagcccgcaaaaaa
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : tttatggaaatttgtgagcccttttttttttttaaacccactaaaacgcccaaaaaaaat
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0049_E03.b : taatttgttaaataaaaaattgcatacatttttttttcaagccctggggttgttttgaga
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : tgttaaatttgttggcccccccttaattttaaacaaataacttcaaaaaaaatttaataa
BMWN1_0050_C10.b : ttcttgttttatggaaaaaaattttcttttttaaaaatatgataaccctttttttttctt
BMWN1_0031_D02.b : tgtataaaattttctctctcctactttcatactatctagcatttctccactacatctact
BMWN1_0067_C07.b : gaaaaaaatttaacaaaaaattctttatttttttttaggggggggggagggggaagtttt
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : ttcgaaaccaatccttttatttaaacttaaaaccccgcaaaaccaaatttacttacccgt
BMWN1_0061_G07.b : tttttcttttgaaaacttgatactaatttttttattttaaacccatacatctcctataga
BMWN1_0082_G09.b : tttaacaattatagcctgttttaaaccttttaaccccgcatggccttttttaacttcccg
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ttttttcggaaattggagctcctttccttttttttaaacatttaacccccgaaaaaaaaa
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : tgtgaaatttggggccctttttttttttgaaaccttaagccgcaaaaaaatttacaccca
BMWN1_0020_C11.b : ccttgcttttacttgagaaaaattaaactttttttaaaaaatttaaaaaccactattttc
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : gcaaagcattttttttatagcaaaaaatgcaagctgaaaaataaatttacacaatccttt
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : ccatattattctcttacctctccatctcttattcgcactttattttccattataatctta
BMWN1_0011_H03.b : aagagcgttttatcttaaagtctttgctcctaactctatcacttctaaaccatctattaa
BMWN1_0093_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgttccggttcgggggaggggggggag
BMWN1_0094_B10.b : ccttaaaaattaataaaaaatccattcttttatgttcagttcggggaggggggggagggt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : ttgtaaccagtggaggaagaaaatatcttttttagaaaacatcggtgggtctttttttta
BMWN1_0061_F08.b : ggaaaaataatgtttttataacaattgggttggtttttgtttttgttaacgggtaagacg
BMWN1_0001_C12.b : ggagggaaaaaaaggaagaaaaaaaaaaaaaaagaganggaagaaggagaagaaaaaagg
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : attatgttattaaaactacttcacaataaaaaaccagtcacccttttttttttttttttt
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : tctcctcactttttattctattcttattatatatttaatatacatcacaaaccacctaat
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : ataccttctccttttaatttttcctttatctcacaccatatccctctatacacaatccta
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0086_F03.b : tgctcttttgaaacccttaaaccgcacaaacatttaaaacaaaatttgcttcattttatt
BMWN1_0085_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0050_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_E05.b : tcttttttgaaccctaaagccgcaaaaaaaattacaccccattggtttttttttttcggg
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : atttttgggcaattgtttttttaacctttttgccccaaaaaaagtcaaaaaccatttcct
BMWN1_0097_C03.b : aaaaacttttttttttcaaatatttgaactcatttcttttttttcactttaaacaagcgg
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : gcacaaacaaatataaaacccttttttttttttttttatttctcgcgccggggaaggtgg
BMWN1_0076_G02.b : aaaacctggaataaattttttatcaccccccggggctttttttttttcttctccggggag
BMWN1_0009_E06.b : tttcttttttttttgttcaggttctggcgaagtgggaatggttttattcataatagaacg
BMWN1_0022_H12.b : ctttaagacccccaaaaaaatatctacaccacaaaatcggttttttttatttttttccgc
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : caggtcggggggaggtgggaaggtttttcttctaaaaaaaccccccccccggggaaaggg
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : aaacatatatttaattttactctaattcttttaaatatttatttaggcgaaggacgatgg
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : tatttttttatatttcgtttagggtggggggaggaggatctcatattataaatattacca
BMWN1_0032_C05.b : caaaacaattcttttctttttttttttcggggccgggggagggtgggagagttttttcca
BMWN1_0042_E02.b : ccaaaaaaaaatttacaccccactttttcttttttttttttttccgggcggggggagggg
BMWN1_0024_D10.b : cttcttatttcttatagaacataaaggcgcgcagtttttaatctttatgatctctcctat
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : xxxxxxxxxxxxxxxxxxcccccaaccccgggaaaagcgtttgatattggcccttttcct
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : aagtttaaccacccccttttccttcttttttttgtttccgggtccggggagaggggggaa
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : tttaacaacacctttttttttttttttttttccgggtgcgggggggggggggggtttttt
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcctaaaagaacccccaacccc
BMWN1_0049_E03.b : tttcttttagggggagggtggggcgtttcttttgtaaaggtgttggccaaatggggggat
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : acatgagtttttttttaaagatactggtaagaggattatcgcaaatattattcgccgatg
BMWN1_0050_C10.b : ataattttttcacctccaaaagaaaattaggacatatttttcttttatttttttttacaa
BMWN1_0031_D02.b : ctttctataataacctgtcaaatagtcatatttctcttaccctatatcactcttatcatt
BMWN1_0067_C07.b : ttctttaaaacctccccaccccgaaagaggttttgtatatggcatcttatttctcataaa
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : tttttttttttttttatccagtcacgggggaaagtggggaatttcttttcgtataaaaac
BMWN1_0061_G07.b : aatcataaagactctattgccttttattttttttcttcgtcatgcggcagttggggagtt
BMWN1_0082_G09.b : tgccggggttagtgtggagagttttggggagttagggaggttcttcccccgagaaaaacc
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ttaataaaacaggtggtttttttttttttttccggttcagggggagagggggagagtttt
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : cttttttttttttttttttcccgggggggggaggggagggttttttctcaaatagacccc
BMWN1_0020_C11.b : tttttttttatttttaagggtcagggggaggtgtggaaagttttcttttctttttttatt
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : ctttttttttttttgtcggggggggggaggtgagaaattttttcacacaaaaaacccccc
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : tctcacacctattcttctatatctttttcacccatcattcttcccactctttcgtttttc
BMWN1_0011_H03.b : ctcttaataaaaactgaatgcccctcttttttttttttttttttttcgacatcaatgagg
BMWN1_0093_C07.b : ttttttccaataaaaaccgccacccccggaaaaggggttgcgtattggcgccccttcctt
BMWN1_0094_B10.b : ttttctgcttctttatcgttctccccggaaaggggggtgggatttttnncttccataccc
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : ttttcaacccttcgggcgggcggtagaaagttttttccccctttttgtatttttttattt
BMWN1_0061_F08.b : ggaaaaattttaggagaaaggaggtggtttttttttttcaggggggggggggggggggag
BMWN1_0001_C12.b : aaggagaaagaggaggggggagggananngaagaaaggagaaggaggggggggggagaga
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : gggggcgggggaggagtgcggttttcttcttaaaaaacccccagggggcgggaggggttt
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : tctttctctttactttattatatacccataatacttcacataaagatctatcatttttat
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : aagtacttaattaattcttattccccaggaatttcgatcgacattttatatccattacaa
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxatcccgtttaag
BMWN1_0086_F03.b : ttccggcccggggaggggtggaagttttttccacaataaaaaacccccccgccggggaga
BMWN1_0085_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccataaagaacccgcaaaccccgggaaa
BMWN1_0050_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
BMWN1_0095_E05.b : gcgggggaggggggaagtttttcaacaaaaaccccccggccgggaaggtttttttttggg
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : ctttttttttcggtcagggagggtggggagtttttttattattaaccgcaccacggggaa
BMWN1_0097_C03.b : ctacaaaatttcaacaacggtttttttttttatttgtttcatcacaggggagagtgggga
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : aataattttttctcaaaaaacaaccccaccccgagagaaaggggtttctaaaagcgcacc
BMWN1_0076_G02.b : agttggggagttttcgcgcaaaaaaaaatagatctggggggatttgggttttataaatcg
BMWN1_0009_E06.b : atcaacctgtaggagagttcttttaatgcgacactttccccccctgttaataccggcgcc
BMWN1_0022_H12.b : gtgcgggagaggggggggaaggtttttccacaaataaagaccccccccacccccgggagg
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : gtttgcatggggccccttccccttccccaaaaaaaaccggccgggtctttgggggcggga
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : atgaatttttttacaaatgaaacagcaaaagcacccgaggttttttaatacataataaat
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : ccccccactaggagagatttttttcatttataattttatattacattattaacactccat
BMWN1_0032_C05.b : ataaaaaaaccccacccccccgcgaaaagaggtttttctaatttggaccctttctccttt
BMWN1_0042_E02.b : gggggatttctctcccaaaaaaaacaccgccaccccgcggggaaagggtgttttattttg
BMWN1_0024_D10.b : cctccaccttagcccccattgagacatgtatccccttttttcatcctcctccccattctg
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : xxxxxxxxxxccctaattaacccctgcccggtcttcgggtcgggaggggttcccctccta
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : ttcaaaaaaaaaaaccccccctgatatttgttccggaacgtttcccccccccaagggttt
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : agtttttcttcccattaaagaaccccccaccccccggggaaaaggggttttgctttatgg
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : tttcaaaaaaaaaccccccccccccggggaaggggtttttatattgggcctctctccccc
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : gggagaaggggttttgcatattggcccttttcctttttcctcaaaaaatcctccgcccgt
BMWN1_0049_E03.b : ttcctttttcatatatgaaccctcccctctgttcttgatttagggaggtttacttctcac
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : aacgaaacaccgcgtgggagttttgcttacatgatatcaccacacaatgcgagaaaaaga
BMWN1_0050_C10.b : cagggggagggaggggattttttttattatatacaccccccccccctaaaagattttttc
BMWN1_0031_D02.b : atctttacactctctctccagtcaagattcttcatctaatttttcctactttctataatc
BMWN1_0067_C07.b : aaatcgaatttgtttttgttgggaaagtatactcctaaaggggtatggtttcccaaaaga
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : aaaaggcgtttgcctaggggcccccttcgcttcccccaaaaaaaacccggcgccgggttt
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : accccacccgcggaaagtcggttttccttatgggccctttcgcctccacttaaaataccg
BMWN1_0061_G07.b : tattctctcatttttattcccacccccacggaggaagttgctgtttatggacttccttct
BMWN1_0082_G09.b : gcttcccttggggagagttttttttttgggacatattccctccccggcttttgggcgggg
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : tcttcaataaaaacccccacacccccgggaaaaagggttttctataggggcacttccccc
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : cccccgggggaagggttttttttgcgccctctccctcccaccaaaaatccccccttttgt
BMWN1_0020_C11.b : ccccacgcgcgggggaagggggttttttttttgggacaattccccccccccccccggaaa
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : cacggcgctggacaatgtctataattaagcactttcccctcccacatattaccccgcctt
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : tcttctcactttttatcctcccttcttctctcattttctcctatattagtttctccatca
BMWN1_0011_H03.b : aaaggttctacaattattttttttaaaccaaaacctcccccccgcgtgaaataagagtta
BMWN1_0093_C07.b : ccccccaaaaaccccccccgggtttgggggggggagggtttttccccccaggggggattt
BMWN1_0094_B10.b : cccacaaaaagaggctcgtttttttttggccccctttttccccctaaggggggatgtttt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : cttcggagaggggggagggggggggggtgttttttcttttatagaccccccaccccgggc
BMWN1_0061_F08.b : ttttttcatctatataatcaacccaccccgggatattgtttgtaagggtcctcccccttc
BMWN1_0001_C12.b : nnnnatgaaaaaaggagagcccaggcagagaagaggagaaaaaaagaagagnnccgnggg
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : tttttgtacctccctccccacaaaaaatcacgttgtgggattccccgcccataattattc
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : attattccaccacgaaacaattatactaatatttctctaatattcccacttatcccagac
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : ctataatatatcccactcaagaaataacattatattttaccattccacatctattaatct
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : aaaacgcccccccctctggaaaacgcgtttttgttattgggcccctcctccatttcccaa
BMWN1_0086_F03.b : ggggttcgttttggcgcccctcccttcccccaaaaatcgccgccccagttttttggtcgc
BMWN1_0085_A05.b : aggggtttcgttatggggccttttcctttccccctaaaaatcctgccccggctttggggg
BMWN1_0050_D05.b : ccctttaataaccgcccaccccggagaaaaggggtttttgttatggggcctttccctttc
BMWN1_0095_E05.b : ctcccccttccccaaaaaacgcggctggttttggggggaaggttttcccaaggggtatcg
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : agcgtttaatattgtcctttcccccccaaaaaatcatcatattgttcgggcgtaggttcc
BMWN1_0097_C03.b : gattttttttctcaaaaaaaacacccccaccccgaggaagatgcctttctttttgagcct
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : tattcctaaccataaaaatacccaccctatatataggtcgtggaatgtttttttctaacc
BMWN1_0076_G02.b : cccttctcttcttttataagaaagccgggcttattctgttgtggggggatttattctcca
BMWN1_0009_E06.b : aggtattcctctagaaagggtaatccttctcaggagtaatgttcttccaaaccgtgatat
BMWN1_0022_H12.b : aagagtttttatgaattggcacacctaccactctctagcacaaaaaaccagattctctta
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : aagttatttctccaagggggtattgttttccccaaattggagaatcgaaaaaaatgtgta
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : aaccacccaacccagcctaatataactatcaagatgatgaattcttcccagccagaatat
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : acttattaggagggggtttcttttattccaaatggctctattattatattagttgtttta
BMWN1_0032_C05.b : cctctcaaaaaaaccactcccctggtgtttttgggtgggggaaaggttattcccctccta
BMWN1_0042_E02.b : ccccttccccctcccaccaacaaaaaccggcggctgtttttgggggtggggagagtgtcc
BMWN1_0024_D10.b : attttaatctctagaacaaccacctatttttttaatccttcatcacactcctaacttaaa
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : aggggggaaacggtttccccaaagggggaaccgcggaaaaaattgtaaaaaggcccaaaa
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : attttttcccaaattgggtaaaccgaaaaatttttaaaaggccacaaagccccacaaaaa
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : ggaccttttcctttctccactaaaaaaaccctgccctggagtttttgggcgggggagacg
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : ttcctaaaaataacacccccccctttttttggccgggggagatttttctctccagggggg
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : ttttgggtgggggaagggttactttatctaggggggtaattgtttctccaaatgcgggaa
BMWN1_0049_E03.b : tggggaagatactcttccctaagggggggaacgttaacataattttggaagggcgaaaaa
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : ctctggtctgcgccttggaaggggataactataaggtcataagtatagtaagactgacgg
BMWN1_0050_C10.b : ttttttgccctctttaattaaaaaatatattagtctttttttttgtctcgagatatttac
BMWN1_0031_D02.b : caactacaacaatacaacataatatcccgtctctatttctattcatggatcatacctatc
BMWN1_0067_C07.b : ggaaccaaaaaaactctaaagagcaattggacaactataaggccttttgttttttaaacc
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : tgctgggggaaggtattccctctctaagggggtatacgtttcccaaattcgggtaacccg
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : agggctatttttgtttctggagagttttccctcccagaagggtttatttacacacaaaag
BMWN1_0061_G07.b : ctatcactacatatattctgtaattgttatctgtggtagtgcttttactcttcgctggga
BMWN1_0082_G09.b : gcgggggtttttctccggagggggtttttttttcccggggtttgggtttccccaaaatag
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ttctcacccaaaaatactacatctgggatgtcttctgggggcgacctcttcttatagagg
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : gggggggagtttttcctttctggggtgtttttttccctataggggaaaccagaaaaattt
BMWN1_0020_C11.b : acgcgttttttgtttttgggccctcgcctcttactcccaaaaaaggggtattaggttttc
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : attttctcatctccttatcttatacctcccaagggtgacaattcttcacataacgaggaa
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : tccttacacactatcattttgctctttaccatggagtttccatttacttacacctactta
BMWN1_0011_H03.b : tttatattttattattttctcccttaatcatcataaataatcgttctccattttattgct
BMWN1_0093_C07.b : gtttcccaaatgggggaacccgaaaaaaattgaaaaagggccaaagggggaaaaaaaggg
BMWN1_0094_B10.b : tcttcggggggggggttccaaaaaaggggtaaggccccaagggggagaaaaaagggggtt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : gagagagttttgtgtttgggagccctttccccctctccaaggggtattctgctttgccta
BMWN1_0061_F08.b : cacgggaatttgtctccgttgttgggatcgggcgataatctttagaaggcgattaagcct
BMWN1_0001_C12.b : gaggaggaaagaagagaggaggaaggggaggagaaaaaaaacagaaaggggaaaacggaa
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : caaggtgtttctttcttaaaattgtataagagaaaatttaaaagagcaggtactggaatg
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : ctataactaatatattcttctcatacactcctctttagtaacctacaccactctattgtt
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : cttaatttacataccacacatttttatttaacataaacatcttattacccctttaactca
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : ttaaaaaacccagccgccttatcctttgttggcggagagaattattcttctcctaagggg
BMWN1_0086_F03.b : cgagggtgttctctctttagggggaattggtttcccccaacggggtaacccaaaataatt
BMWN1_0085_A05.b : cgggagggttatcctcctcaagggggtatctgttctcaaaatcggggaaacccggaaaac
BMWN1_0050_D05.b : tcccctaaaaaaccctacccctggtttttggcgggcggaagttttctcttctacaagggg
BMWN1_0095_E05.b : tttccaatggggaaccaagaaatttaaaagcccagggcaataaagggcttttgtttttcc
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : acattaagggatatggtctaaagttggaaaacggaaaaagaaaaaagtgataaggaaaaa
BMWN1_0097_C03.b : tcccacctccccccaaaattatcacccactctgactttactgggagcaagaccactccct
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : ggggtttatttgttttccaatatcgggacacccagaaaaattcttcaaacgttaaaaggt
BMWN1_0076_G02.b : gaggggaaagctctacaaaaaagggaaaccccgaaaagtgtgacaagcatccccggggat
BMWN1_0009_E06.b : cgcgataatttgtaaaaggcaatggcgcttaacatatgcccctgcgccttttaatctccc
BMWN1_0022_H12.b : tttttgcggggtgggaatcgttttctctccccgagaggtggaatacctatacacacaaca
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : caaggccaaaggcgccacctaaaggccgtgtgtttttttaggcccccccaaaactaataa
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : ctaattatcataattttataataaggatatattacttcaataaatcacaaaatataatac
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : atcatatataatttatataatcttataatacactgctagttcttatactttaccctctga
BMWN1_0032_C05.b : agggggggatttctttttctcccatttggggtgaaacgcgagaaaaatttgtgaaaaggg
BMWN1_0042_E02.b : cccctccggggggggatgcccttttccccaaggggggaacacaaaaaaaataatgttaaa
BMWN1_0024_D10.b : agcactctttatagatactatccacagagacttctatatttcctatatccccgccttttg
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : gcggaaactaaaggccccttgtgggttttttagggcccccccggaatacaaaacccccct
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : agccgctttgtttttttagcccccccacaaaaaaaaaaacccttttatttgacccccccc
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : gtattcctcccccaagggggtaatagtgttttccccaaacggggggataccccgaagaaa
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : gggttatcttttcccccaccgggggaacaaccaaaaaaaatttgttaagaggccgcaaat
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : accgggaaaaaattggtaacaaggccaaaaaggcgaacaaaaaagggcctttgtggtttt
BMWN1_0049_E03.b : gctttaacatagaaggaagtgcgtgattttagggccccccccgtatatataaaacccctc
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : aaaatggtggaatatggaagaacttgtcgacgggctgccggtggcccctcgtatgcgcca
BMWN1_0050_C10.b : catctcggagggtgatcctcttccccaaaagggcaaacaacaaaaactcttttactggtt
BMWN1_0031_D02.b : ctaacaccctatctcattcttttcatctcaaatcgcctccattcttctactttcatggtt
BMWN1_0067_C07.b : cccttaataaccataccccccttggggcaccaatataaagtgttttctaaacattcgcat
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : aaaacctttgtacaacagcccaaggccggacacaaaagggccgtgtgggttttttagtgc
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : gggtacaacaaaaaatacttacaagttacatagggcgaacctataaagctcttttctttt
BMWN1_0061_G07.b : tattttattcttcacacatcggactacagctattacttgtttaactcactcggcaaccat
BMWN1_0082_G09.b : gttaacacaggaaatagtggcgaacccaaaagcggcgtggggttattccgggtcgccctt
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : aggattttcttttccctatgatgggggacacccgaaaaatatttaggaaggatctcttat
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : taaagcgcagaggggtaataaagccctttggtttttatcccccccgaaaataaatcctta
BMWN1_0020_C11.b : cggggagcggggttaccccaaaaagagggtaaaaagcccccacaggggagaaaccaaaag
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : ccataatactttctaacaatctttataaacaaaaataagagttgttcctttcttctctct
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : acttttattcttactctatcaccataatcgctttaccttcagtcacttaatatctccact
BMWN1_0011_H03.b : cgttgttctttttccactccctcccacggggtcaaacttttctcttaaatgtgggataaa
BMWN1_0093_C07.b : ggctgggtttttttagtcccccccgcacacaaaaacccctttagggggaacccgcggaaa
BMWN1_0094_B10.b : tgtgtttttttttccccccccaaaaaaaaaattcttttttaggggccccacaaaaaaaaa
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : agggggggaaacggttaacactttaggggaagcttctttccccaaaacgcaaaaccccgg
BMWN1_0061_F08.b : caaagagaggatttagagatttttgatgggccgtcgatattgaaatctcctttgttttta
BMWN1_0001_C12.b : caaaagaagagggangagnagaagggggggcgggcgnaggaaacaccagaacccggagag
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : gttttttttttttcccccccccactatttttttttggtgagaaaaaaaaaaatagtggag
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : tcccagcaaccacaacttatccatattgatatattatatacatccaataaatactcgcaa
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : ctacaccattcatattagagttctagttctcaataaaactattatacattgaattataaa
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : gttaatggttctccccaaaacgcgggaataccggtaatatacctttgacgaggccacctt
BMWN1_0086_F03.b : gtataaaggcccaaagggcgaaatttaatgtctgtgtggctcttataggcccccccagag
BMWN1_0085_A05.b : tttttcaaaggcccaaaaggccataactaaaggcggtttggggtttttataggccccccc
BMWN1_0050_D05.b : atatgtgtctccaaataggggtaaacccggaaaaatttgtaaaaacgcccagaggccaaa
BMWN1_0095_E05.b : ccccccccaaaaaaacccctaaagagggccccgaaaangttccaaaccccgctataccaa
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : aaaggcttttggtttttttttctccgccaccaaatattattgggggacaggaaatagaat
BMWN1_0097_C03.b : tacagtgagttacttgtctctatatacgggtgaatatacaaatatttttcaacccctaac
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : taaaaatataactctctttgtttttctacccgcacctctgtataattatattccctggag
BMWN1_0076_G02.b : ttttaaaggcgcttgtttttattatcccccccaaaaattgattaccggagaggggaacct
BMWN1_0009_E06.b : ccaaaaaataatgtcttaaaaaagaaaaacgtgtaaaaagcgctccacatctccgctctt
BMWN1_0022_H12.b : ctggggatacccgatagaaaatctttgaaacaagcgccgtagagccactaactacaaaga
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : acttcataatgggaaccccggaaaaaaagttctctgaacactggccctttaacccctaaa
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : cataaacgtgaatacgccatacatttttctcgtttctttttttctatcattaatcatcaa
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : caaaacaactacatgtgtttggctgatctataaaatatantctagttgatatgtatataa
BMWN1_0032_C05.b : cgcaaagaggggaacaataaaaggccgcgttggtttttttttaatcccccccctcgaaaa
BMWN1_0042_E02.b : aaggcccgcaggcgcaaaactaaagcggcccgttgtggtttttttacaccccccccccgg
BMWN1_0024_D10.b : ttttcttttatactccccctctaccatatacatacttccctangtgtttttttaggncta
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : aggaggggaaccccgagtataagaaggttctcaaaaactgggcctcttacacctataaaa
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : aaaaaaaaattcccagaagagggggcttttaacaccgaaaacccccttccgagaatatta
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : cttggtaaaaaggccctaagaggcggacaccaaaagagcgcgctggtggggttttataag
BMWN1_0047_C10.b :
BMWN1_0097_H01.b : ggcccatatatatggcggcgctgtggttgttttatcactgccccccacaaaaaaataaaa
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : aataggccccccccagaacaaaaaatccctcatagggggaaacccaagattaaaatggtt
BMWN1_0049_E03.b : taatgagagttaacccgccaaaagaaactttttcataaaacggggtcccttgtacactgc
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : ttactgtatttatgaatacacggatgaaatggggatagagactatcagcactagcattga
BMWN1_0050_C10.b : ctttgaccaccccaaaacctcctcttattttctataaccgccgcaaataacacaaaatat
BMWN1_0031_D02.b : tatatacattctcctctatactacgctctatacgttcatttctcttctacgatgactaat
BMWN1_0067_C07.b : tacgcctaatagtgtttgctgagcctataatttataacaatcataggtgacacctacacg
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : cccccccagaaacataaaaatgccctcgaagaggcgaacccggatataaaagaggtttcc
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : tatcaccccctcccaactatataataaccctttatgtagaacaccggtataatattgtct
BMWN1_0061_G07.b : attatggcccctctattttatcatcctctcccaaatatacacaattctattagatttact
BMWN1_0082_G09.b : taaagccccccccccgcatataaaggggcccccggagggaaaaagggtttcaaagaccct
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ggcgcaaaatgaagaccgcggtgtgtgtttttattagcccccccgctaaactaaaataaa
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : aggggggcccagaaaaangttcccaacccccttcaacacacaaaaagctttcgggaagtt
BMWN1_0020_C11.b : ccctttgtaggttttttagagccgcccccaaagaagccctgtgttttttataagggcccc
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : cccctcgtaataacacaattctcgattactgtaataaattaaatttattttttataaatt
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : ctcttttctcttctgctattcagtctacttttgatttcttatctctcctccctctttctt
BMWN1_0011_H03.b : tcaatgatactattgctataagccacagatacagcaccaactgtgtgccttctttttctt
BMWN1_0093_C07.b : aaaaggttccccaaccccgccccttctccccctaaaaagtcttctctagggggtttttaa
BMWN1_0094_B10.b : agtttttggggaggggggttttnccccccccaacaccccctttgaaggttattanttttt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : aaatgtttttcaaggcccccctccgaaaaataaatgcttgttggtttattgttaccccgc
BMWN1_0061_F08.b : aactctccccaaatataatagtcttaatgagggcccggtataaaattgtcctgaccttga
BMWN1_0001_C12.b : aaaacaaacccccaacagagaaaaaa
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : gggatcgccccataaaagactctctggtgatttccttagagttgcgggagggcgccccgc
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : taacctatacctaatcttcaccatctctccgattctacacttcaatactttataaacaac
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : aatacttacaattcaataactcccactcaactaacttttttctcttccaccctactacta
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : aagccctctcataaaaggcttcttgtggtctttccttacgccccccccaccaaaataaaa
BMWN1_0086_F03.b : aataaaagaggcccatcaggggaaacccgggataaaagaggttctctaaactcgtgctcc
BMWN1_0085_A05.b : agaaatataaaaatctcttttgaggggcaacccggtagaaaaaaggggttccctaaaccc
BMWN1_0050_D05.b : cctaagggccgtttggtgtttataatccccccccaaaataccaaaccctcctatgagggg
BMWN1_0095_E05.b : aaaaagtcttgggggttttttatttttgggttccggggccccccccccntnnnnnccccc
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : ttttcgaaccacatctgtgcaccacaaaatatcttttggagggtaaacaaaattgtgggn
BMWN1_0097_C03.b : gagtctacatataaagccgtcttagttttatattgcctccacccaaagatacaaaacctt
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : gaggtaccccgaataaaataatgtttttcttaatctctttctctatatcaatagataata
BMWN1_0076_G02.b : cgcctataatngttcttcaacacgctgtttagatcactataagagtggctttcaagaggt
BMWN1_0009_E06.b : aaacccctataatagatttttgaagatttatccatgattactgtgggcgccggccacccc
BMWN1_0022_H12.b : gcgccttgctgtgttttatctaacacccacaccaataaaata
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : aatttcttctgggagaggctctcacaaaatattgggtttccacgggtcacaccccactct
BMWN1_0070_H02.b :
BMWN1_0031_A08.b : caacatactctatatatatccttaat
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : cccctcctttattattcaactttagattatatatttatattatctactatagtgcactac
BMWN1_0032_C05.b : tataaatattccttcaagagggggcacccccgaaataaataagggttctccagaatctcg
BMWN1_0042_E02.b : aaaanaacaacatccttcatgaggggggcccaccccatat
BMWN1_0024_D10.b : tccatatataagtctacaattagtcggtttgtatttatactatattatcagctactctaa
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : acccctctcagaagggttcttaaagttaattgtgtgtccgggggggccccccccccccct
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b : a
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : gcccccccgtgaagaagataaaatcacccctctgaagagggcacacgcggatatatataa
BMWN1_0047_C10.b :
BMWN1_0097_H01.b :
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : tctcaaactcctgcctctttcacagcacaaaatcctctctcggggaggtctccaccgaga
BMWN1_0049_E03.b : tctgtttactccttttatggaggttcttttgagagtgtttttatgggtactcttatggaa
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : cgatagtgagggttgccatgatgatgtagacatatgttgaaactcanatggctcccatac
BMWN1_0050_C10.b : aatttttcggctccctagtatataatctcccataatatatgattttttacaattatagtc
BMWN1_0031_D02.b : gactgtcctcttactcaaaagatctacgtaatcctctacttactctctcaatctatatat
BMWN1_0067_C07.b : atttgttacatagactccaaacggagcggagattcccgaacaacaatttaannnnnaagg
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : agaactcgcgccttttccacctctagaaatgcttctcgtgagagtcttaaccagaatatt
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : ctcctacttcactcttttataatccatttattttgtcttcttgaatggtgtatccctatt
BMWN1_0061_G07.b : cgcccttataacgtgctttccatttcacgttctctatttctccgaagaacgtctttatga
BMWN1_0082_G09.b : tcccctatctcacgctcctaaaagccctctttaagggggtctttaaagcttattatattg
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : aattctaatgaggaggtacaccggaacaataaaggttttctcaaaataactgtgttcctc
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : ttttttttttgtggtgcggtggccccacccctttttctccactacccaaggaggagggag
BMWN1_0020_C11.b : ctagagagaaaaaaaccttattaggggacacccgggatctttcgtcctccagaaaccggc
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : tattttattatatatgataaatttgtttttttatgggtatattttttatgtgtgagtaat
BMWN1_0007_H06.b :
BMWN1_0015_B10.b : cttatatattttttctcttcatatacctactttaactataattctttctttt
BMWN1_0011_H03.b : ttccttctccccctctccctattctctacttatgtggtgtgaaggcg
BMWN1_0093_C07.b : aaataattatgtgttggggggtgggccccccccctccttttttttaaaannngnnnaaaa
BMWN1_0094_B10.b : tgtgttttcggggggcgcccccccccccccccccnnnnnncctatataaaaaaaatattt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : cgaaaaaacaaaatctcccagaaggggcaccgagataaaagtgttcccggccccctctcc
BMWN1_0061_F08.b : cgtggctctcctataattcctttgtggttattatgttagcattggngccccttggctcnc
BMWN1_0001_C12.b :
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : ctctcttaacaccnnaaagagggacgaattcacaaataataaannnnnnnntacatataa
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : gactgctgataacttcatagtgtgcttgtcctctatttctatacacatttatgcatatca
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : ccaatttacacaatatcacatcaactacatatagccaaaataatatacaccttccttaca
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : atgtccccataagagaggaaacacccatctaataatagtgtttccagaataacctatgct
BMWN1_0086_F03.b : ttaaaaccttaaaaatctctctcttgaagggtttcatcaatagatatggggtgccgcggt
BMWN1_0085_A05.b : ctgcgccttgtacacctattaaaaattcccttccgcaggaggtttcttccacagatattt
BMWN1_0050_D05.b : acccagggaataaaatggtttctcataacctgttctttttaacctaagaaaaaactttct
BMWN1_0095_E05.b : ccccnnnnnnngggggggacccccccacacgatgccttaannntnnnnt
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : ggcggtgccccccgcccctttttcctgcccccnnnnaagggngacctccactcctcttag
BMWN1_0097_C03.b : ctttaggtgcaccaagacaataatactttcttgtattatatcattcctgcccctcaaaat
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : actctcttgagtgtcttataacacctatattgtgtggtgctgggattcactccatatttt
BMWN1_0076_G02.b : tttacctgatggctggg
BMWN1_0009_E06.b : tcccctttcccttctcaccccccnnnggggggngggnaaagggtaagatggttcatcata
BMWN1_0022_H12.b :
BMWN1_0044_D12.b :
BMWN1_0087_B03.b : atattttctcaaaactcca
BMWN1_0070_H02.b :
BMWN1_0031_A08.b :
BMWN1_0096_A02.b :
BMWN1_0071_E01.b : caatataatatatacaa
BMWN1_0032_C05.b : ttctctttatacacccgcaataaatttc
BMWN1_0042_E02.b :
BMWN1_0024_D10.b : tgttcctcatatttacttcctatacttatctccccatttcg
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b : ttctttcaaaacaaagaaaatagag
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b :
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b : gaggtggttcctgagaactctggcgttcttgtgtaaccacgc
BMWN1_0047_C10.b :
BMWN1_0097_H01.b :
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : atattggggctctccgggggccaccccacccctctctaattattgaacatatctcataaa
BMWN1_0049_E03.b : cccgcgttcactctggtctcttatattaataatccnccccacnnnnccannnnnggnaca
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b : agata
BMWN1_0050_C10.b : tctctctaataagttttctctcgctatagtatctccctc
BMWN1_0031_D02.b : atctatctcctccttctacaaccattctatcttctctaccacaacttactatctcctata
BMWN1_0067_C07.b : ttgacattaanagataagaatg
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : tggttgctccgggtgaccacccccccccctcattttccacaacctccccataaaagaagt
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : atgcgtgagttagaaggaaccactctctctctgctattcagcataaataacgatagaagt
BMWN1_0061_G07.b : aggtctacaacatataaatgtgagaccgcggtggatctcacacgcgcttctcttcactac
BMWN1_0082_G09.b : attttgtgggggcgccgcgcccaccccccctcctttcttcaacaccacccctccaaaaaa
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : gacacccgtcttgagaattattcttgattgaaggctctctatccctatattttgtaggat
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b : acaaccctcagagacaataaaaccancacannan
BMWN1_0020_C11.b : tttcttaagaag
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b : taagtttaaataatattgttattagaagagaat
BMWN1_0007_H06.b :
BMWN1_0015_B10.b :
BMWN1_0011_H03.b :
BMWN1_0093_C07.b : agagaagttgtatt
BMWN1_0094_B10.b : ttt
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : tgagagcgttataaatttttttttagagagtttcttggtggaataggtggccgccgggca
BMWN1_0061_F08.b : tnccggccgccccgacncananaaagggcaaaatactcttactccccttatttn
BMWN1_0001_C12.b :
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b : tattnnttgnttttactactatatc
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : cttacttcactatctattagctaccaactattcacattcacgtatgttgacaaactactc
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : cactctactcatactttcctatctaccatacaatacttcactcttgcttcattaacaatc
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : tctctcaacaccctaggaatattccttcctcatgaatgtctcttacgaaatttctctata
BMWN1_0086_F03.b : ggcaccctcccgtgttttattaaccaaaccatcccgaaataaggggt
BMWN1_0085_A05.b : gtagattcacaggggtggaacccccccccctctaatatttcacaataattccccgcaata
BMWN1_0050_D05.b : ctgagggtgtctttactgatgattctgtgtgctcatggggacaccacaccctctcttttc
BMWN1_0095_E05.b :
BMWN1_0083_B05.b :
BMWN1_0059_G06.b : attaataaatnn
BMWN1_0097_C03.b : acccctaggataaactatctcacg
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b : aattttta
BMWN1_0076_G02.b :
BMWN1_0009_E06.b : atnnnnnnnnngctctcttnntgn
BMWN1_0022_H12.b :
BMWN1_0044_D12.b :
BMWN1_0087_B03.b :
BMWN1_0070_H02.b :
BMWN1_0031_A08.b :
BMWN1_0096_A02.b :
BMWN1_0071_E01.b :
BMWN1_0032_C05.b :
BMWN1_0042_E02.b :
BMWN1_0024_D10.b :
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b :
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b :
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b :
BMWN1_0047_C10.b :
BMWN1_0097_H01.b :
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b : gt
BMWN1_0049_E03.b : ctccctcgctctagtcttctctaa
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b :
BMWN1_0050_C10.b :
BMWN1_0031_D02.b : tattcacgaccgctagaacatatttacatactattgancncacgcttgtactn
BMWN1_0067_C07.b :
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b : gtattatctactg
BMWN1_0048_B11.b :
BMWN1_0069_D10.b : gagtctgattaactctctctaatagctatg
BMWN1_0061_G07.b : tacatacatatattgatcctcttaatcgcatcatgtcacttag
BMWN1_0082_G09.b : gggtgcttttg
BMWN1_0047_D08.b :
BMWN1_0083_H03.b : ttcgtgttgtaaaccctactatcgaatat
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b :
BMWN1_0020_C11.b :
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b :
BMWN1_0007_H06.b :
BMWN1_0015_B10.b :
BMWN1_0011_H03.b :
BMWN1_0093_C07.b :
BMWN1_0094_B10.b :
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : ccccccccccnnnnnccgccccaccacaangaaagggggggggcgtctcttcttctgcta
BMWN1_0061_F08.b :
BMWN1_0001_C12.b :
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b :
BMWN1_0030_D10.b :
BMWN1_0059_A08.b : acacctcn
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b : tctatacatgatg
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : tgggtgattggattgagcactctctaccgctcactctctctacttgccataacctataac
BMWN1_0086_F03.b :
BMWN1_0085_A05.b : taattgagatttc
BMWN1_0050_D05.b : ttaccaatactccccacaaaaagaggtgtaatctaacattatgcctatttagtgtagctn
BMWN1_0095_E05.b :
BMWN1_0083_B05.b :
BMWN1_0059_G06.b :
BMWN1_0097_C03.b :
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :
20110601C-000164 : ............................................................
---------+---------+---------+---------+---------+---------+ 786
BMWN1_0042_C02.b :
BMWN1_0087_C09.b :
BMWN1_0076_G02.b :
BMWN1_0009_E06.b :
BMWN1_0022_H12.b :
BMWN1_0044_D12.b :
BMWN1_0087_B03.b :
BMWN1_0070_H02.b :
BMWN1_0031_A08.b :
BMWN1_0096_A02.b :
BMWN1_0071_E01.b :
BMWN1_0032_C05.b :
BMWN1_0042_E02.b :
BMWN1_0024_D10.b :
BMWN1_0083_A04.b :
BMWN1_0087_E08.b :
BMWN1_0063_C06.b :
BMWN1_0024_F05.b :
BMWN1_0076_B04.b :
BMWN1_0034_A10.b :
BMWN1_0094_H02.b :
BMWN1_0098_F09.b :
BMWN1_0090_D03.b :
BMWN1_0039_E08.b :
BMWN1_0078_D08.b :
BMWN1_0011_E08.b :
BMWN1_0012_A02.b :
BMWN1_0028_A01.b :
BMWN1_0078_H02.b :
BMWN1_0030_E11.b :
BMWN1_0022_B03.b :
BMWN1_0030_F10.b :
BMWN1_0052_C05.b :
BMWN1_0016_G05.b :
BMWN1_0047_H10.b :
BMWN1_0045_G03.b :
BMWN1_0090_F01.b :
BMWN1_0095_D02.b :
BMWN1_0048_F08.b :
BMWN1_0010_D12.b :
BMWN1_0051_F01.b :
BMWN1_0042_F12.b :
BMWN1_0042_D07.b :
BMWN1_0047_C10.b :
BMWN1_0097_H01.b :
BMWN1_0078_B03.b :
BMWN1_0063_G06.b :
BMWN1_0004_B02.b :
BMWN1_0049_E03.b :
BMWN1_0039_D08.b :
BMWN1_0060_A05.b :
BMWN1_0057_D09.b :
BMWN1_0001_G10.b :
BMWN1_0050_C10.b :
BMWN1_0031_D02.b :
BMWN1_0067_C07.b :
BMWN1_0096_B01.b :
BMWN1_0059_C11.b :
BMWN1_0036_B01.b :
BMWN1_0096_C09.b :
BMWN1_0020_D02.b :
BMWN1_0048_B11.b :
BMWN1_0069_D10.b :
BMWN1_0061_G07.b :
BMWN1_0082_G09.b :
BMWN1_0047_D08.b :
BMWN1_0083_H03.b :
BMWN1_0036_F12.b :
BMWN1_0088_D11.b :
BMWN1_0048_B04.b :
BMWN1_0010_H06.b :
BMWN1_0072_B03.b :
BMWN1_0020_C11.b :
BMWN1_0068_H11.b :
BMWN1_0013_G09.b :
BMWN1_0003_G06.b :
BMWN1_0086_E07.b :
BMWN1_0005_F02.b :
BMWN1_0007_H06.b :
BMWN1_0015_B10.b :
BMWN1_0011_H03.b :
BMWN1_0093_C07.b :
BMWN1_0094_B10.b :
BMWN1_0098_D08.b :
BMWN1_0006_B06.b : ctgcgtatattt
BMWN1_0061_F08.b :
BMWN1_0001_C12.b :
BMWN1_0062_D05.b :
BMWN1_0010_D10.b :
BMWN1_0049_A12.b :
BMWN1_0074_D07.b :
BMWN1_0030_D10.b :
BMWN1_0059_A08.b :
BMWN1_0002_H01.b :
BMWN1_0085_F03.b :
BMWN1_0063_A08.b :
BMWN1_0015_C06.b :
BMWN1_0046_E05.b :
BMWN1_0040_D10.b :
BMWN1_0083_G01.b :
BMWN1_0079_E03.b :
BMWN1_0073_F01.b :
BMWN1_0080_A02.b :
BMWN1_0088_A03.b :
BMWN1_0023_E04.b :
BMWN1_0025_H09.b :
BMWN1_0041_G02.b :
BMWN1_0001_F07.b : gtaaag
BMWN1_0086_F03.b :
BMWN1_0085_A05.b :
BMWN1_0050_D05.b :
BMWN1_0095_E05.b :
BMWN1_0083_B05.b :
BMWN1_0059_G06.b :
BMWN1_0097_C03.b :
BMWN1_0030_B04.b :
BMWN1_0076_C06.b :
BMWN1_0046_D08.b :
BMWN1_0095_C02.b :
BMWN1_0018_B09.b :