[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000186

Length: 761

Sequence [FASTA format sequence]
GACTCCTCTA GGGAATTTAA TGATTGAGGC TCACCTGGGC ACCATGGAGA CCCAGAGGGC
CAGCCTGTGC CTGGGGCGCT GGTCACTGTG GCTTCTGCTG CTGGCACTCG TGGTGCCCTC
GGCCAGCGCC CAGGCCCTCA GCTACAGGGA GGCCGTGCTT CGTGCTGTGG ATCGCCTCAA
CGAGCAGTCC TCGGAAGCTA ATCTCTACCG CCTCCTGGAG CTGGACCAGC CGCCCAAGGC
CGACGAGGAC CCGGGCACCC CAAAACCTGT GAGCTTCACG GTGAAGGAGA CTGTGTGTCC
CAGGCCGACC CGGCAGCCCC CGGAGCTGTG TGACTTCAAG GAGAACGGGC GGGTGAAACA
GTGTGTGGGG ACAGTCACCC TGGATCAGAT CAAGGACCCG CTCGACATCA CCTGCAATGA
GGTTCAAGGT GTCAGGGGAG GTCGCCTGTG CTATTGTAGG CGTAGGTTCT GCGTCTGTGT
CGGACGAGGA TGACGGTTGC GACGGCAGGC TTTCCCTCCC CCAATTTTCC CGGGGCCAGG
TTTCCGTCCC CCAATTTTTC CGCCTCCACG TTTCCGGCCC GCACCATTCG GTCCACCAAG
GTTCCCTGGT AGACGGTGAA GGATTTGCAG GCAACTCACC CAGAAGGCCT TTCGGTACAT
TAAAATCCCA GCAAGGAGAC CTAAGCATCT GCTTTGCCCA GGCCCGCATC TGTCAAATAA
ATTCTTGTGA AACCAAAAAA AAAAAAAAAA AAAAAAAAAA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Homo sapiens]. 1332e-31O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCampcathelin-related antimicrobial peptide [Mus musculus]. 1224e-28O
Contig/Assembly ProteinNgpneutrophilic granule protein [Mus musculus]. 57.41e-08O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Canis lupus familiaris]. 1285e-30O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCATHL3cathelicidin-3 precursor [Bos taurus]. 1553e-38O
Contig/Assembly ProteinCATHL1cathelicidin-1 precursor [Bos taurus]. 1523e-37O
Contig/Assembly ProteinCATHL4cathelicidin-4 precursor [Bos taurus]. 1522e-37O
Contig/Assembly ProteinLOC786887PREDICTED: cathelicidin-4-like [Bos taurus]. 1522e-37O
Contig/Assembly ProteinLOC100336703PREDICTED: Cathelicidin 1-like [Bos taurus]. 1509e-37O
Contig/Assembly ProteinCATHL6cathelicidin-6 precursor [Bos taurus]. 1492e-36O
Contig/Assembly ProteinCATHL2cathelicidin-2 precursor [Bos taurus]. 1486e-36O
Contig/Assembly ProteinCATHL5cathelicidin-5 precursor [Bos taurus]. 1471e-35O
Contig/Assembly ProteinCAMPcathelicidin-7 precursor [Bos taurus]. 1462e-35O
Contig/Assembly ProteinLOC100141058PREDICTED: Bac7.5 protein-like [Bos taurus]. 1361e-33O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPG-2protegrin-2 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG3protegrin-3 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG1protegrin-1 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG4protegrin-4 precursor [Sus scrofa]. 1951e-55O
Contig/Assembly ProteinPR39antibacterial protein PR-39 precursor [Sus scrofa]. 1891e-48O
Contig/Assembly ProteinPMAP-23antibacterial peptide PMAP-23 precursor [Sus scrofa]. 1883e-48O
Contig/Assembly ProteinPMAP-36antibacterial peptide PMAP-36 precursor [Sus scrofa]. 1846e-47O


Assembly Members: 279      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10001A07BMWN1_0001_A07.bHX205656 
BMWN10001B08BMWN1_0001_B08.bHX205663 
BMWN10001D08BMWN1_0001_D08.bHX205680 
BMWN10001E04BMWN1_0001_E04.bHX205687 
BMWN10002D01BMWN1_0002_D01.bHX205747 
BMWN10002D08BMWN1_0002_D08.bHX205752 
BMWN10002G04BMWN1_0002_G04.bHX205774 
BMWN10002H12BMWN1_0002_H12.bHX205786 
BMWN10003C12BMWN1_0003_C12.bHX205801 
BMWN10003D01BMWN1_0003_D01.bHX205802 
BMWN10003E09BMWN1_0003_E09.bHX205813 
BMWN10003F08BMWN1_0003_F08.bHX205818 
BMWN10003F12BMWN1_0003_F12.bHX205821 
BMWN10005B12BMWN1_0005_B12.bHX205888 
BMWN10005H04BMWN1_0005_H04.bHX205922 
BMWN10007B05BMWN1_0007_B05.bHX205992 
BMWN10007C09BMWN1_0007_C09.bHX206004 
BMWN10008D09BMWN1_0008_D09.bHX206083 
BMWN10009A07BMWN1_0009_A07.bHX206127 
BMWN10009G09BMWN1_0009_G09.bHX206177 
BMWN10010C11BMWN1_0010_C11.bHX206209 
BMWN10010D11BMWN1_0010_D11.bHX206220 
BMWN10010E03BMWN1_0010_E03.bHX206223 
BMWN10011B10BMWN1_0011_B10.bHX206271 
BMWN10012A09BMWN1_0012_A09.bHX206329 
BMWN10012B02BMWN1_0012_B02.b  
BMWN10012C04BMWN1_0012_C04.bHX206337 
BMWN10012G10BMWN1_0012_G10.bHX206365 
BMWN10013B05BMWN1_0013_B05.bHX206387 
BMWN10013C07BMWN1_0013_C07.bHX206394 
BMWN10013G12BMWN1_0013_G12.bHX206434 
BMWN10015G06BMWN1_0015_G06.bHX206502 
BMWN10016C10BMWN1_0016_C10.bHX206523 
BMWN10016F04BMWN1_0016_F04.bHX206546 
BMWN10016F09BMWN1_0016_F09.bHX206549 
BMWN10017B03BMWN1_0017_B03.bHX206573 
BMWN10017B12BMWN1_0017_B12.b  
BMWN10017C11BMWN1_0017_C11.bHX206585 
BMWN10018B10BMWN1_0018_B10.bHX206629 
BMWN10018D07BMWN1_0018_D07.bHX206647 
BMWN10018H10BMWN1_0018_H10.bHX206684 
BMWN10018H11BMWN1_0018_H11.bHX206685 
BMWN10019D03BMWN1_0019_D03.bHX206711 
BMWN10020A11BMWN1_0020_A11.bHX206755 
BMWN10020C01BMWN1_0020_C01.bHX206763 
BMWN10020D11BMWN1_0020_D11.bHX206782 
BMWN10020E06BMWN1_0020_E06.bHX206787 
BMWN10020G02BMWN1_0020_G02.bHX206800 
BMWN10021D02BMWN1_0021_D02.bHX206839 
BMWN10021D09BMWN1_0021_D09.bHX206845 
BMWN10021G08BMWN1_0021_G08.bHX206872 
BMWN10022D06BMWN1_0022_D06.b  
BMWN10022D07BMWN1_0022_D07.bHX206901 
BMWN10022E01BMWN1_0022_E01.bHX206906 
BMWN10023A08BMWN1_0023_A08.bHX206943 
BMWN10023A12BMWN1_0023_A12.bHX206946 
BMWN10023G01BMWN1_0023_G01.bHX206980 
BMWN10024C07BMWN1_0024_C07.bHX207015 
BMWN10024C12BMWN1_0024_C12.bHX207020 
BMWN10024G05BMWN1_0024_G05.bHX207043 
BMWN10025H06BMWN1_0025_H06.bHX207116 
BMWN10026E12BMWN1_0026_E12.bHX207161 
BMWN10026F03BMWN1_0026_F03.bHX207164 
BMWN10026G01BMWN1_0026_G01.bHX207173 
BMWN10027G06BMWN1_0027_G06.bHX207239 
BMWN10028C08BMWN1_0028_C08.bHX207278 
BMWN10028C11BMWN1_0028_C11.bHX207280 
BMWN10028E07BMWN1_0028_E07.bHX207297 
BMWN10028F10BMWN1_0028_F10.bHX207310 
BMWN10028G02BMWN1_0028_G02.bHX207313 
BMWN10028H02BMWN1_0028_H02.bHX207321 
BMWN10030B05BMWN1_0030_B05.bHX207396 
BMWN10030E03BMWN1_0030_E03.bHX207418 
BMWN10030E07BMWN1_0030_E07.bHX207421 
BMWN10030G02BMWN1_0030_G02.bHX207436 
BMWN10030G11BMWN1_0030_G11.bHX207443 
BMWN10031C01BMWN1_0031_C01.bHX207468 
BMWN10031D09BMWN1_0031_D09.bHX207484 
BMWN10031F12BMWN1_0031_F12.bHX207506 
BMWN10032D01BMWN1_0032_D01.bHX207552 
BMWN10032D09BMWN1_0032_D09.bHX207559 
BMWN10032E12BMWN1_0032_E12.bHX207570 
BMWN10033C08BMWN1_0033_C08.bHX207606 
BMWN10034G03BMWN1_0034_G03.bHX207706 
BMWN10035G03BMWN1_0035_G03.bHX207765 
BMWN10036B10BMWN1_0036_B10.bHX207792 
BMWN10036E02BMWN1_0036_E02.bHX207812 
BMWN10036H12BMWN1_0036_H12.bHX207840 
BMWN10037C04BMWN1_0037_C04.b  
BMWN10037E04BMWN1_0037_E04.bHX207871 
BMWN10037F10BMWN1_0037_F10.bHX207885 
BMWN10037H03BMWN1_0037_H03.bHX207900 
BMWN10038B05BMWN1_0038_B05.bHX207913 
BMWN10039B02BMWN1_0039_B02.b  
BMWN10039B11BMWN1_0039_B11.bHX207962 
BMWN10039C10BMWN1_0039_C10.b  
BMWN10039D05BMWN1_0039_D05.bHX207970 
BMWN10040B09BMWN1_0040_B09.b  
BMWN10040E09BMWN1_0040_E09.bHX208017 
BMWN10040F07BMWN1_0040_F07.bHX208022 
BMWN10040F12BMWN1_0040_F12.bHX208026 
BMWN10041B02BMWN1_0041_B02.b  
BMWN10041C12BMWN1_0041_C12.bHX208051 
BMWN10041D04BMWN1_0041_D04.bHX208053 
BMWN10041E05BMWN1_0041_E05.bHX208058 
BMWN10041H11BMWN1_0041_H11.b  
BMWN10043C11BMWN1_0043_C11.b  
BMWN10044B03BMWN1_0044_B03.bHX208156 
BMWN10044B07BMWN1_0044_B07.bHX208159 
BMWN10046A02BMWN1_0046_A02.bHX208262 
BMWN10046C03BMWN1_0046_C03.bHX208277 
BMWN10046D09BMWN1_0046_D09.bHX208288 
BMWN10046F03BMWN1_0046_F03.b  
BMWN10046F04BMWN1_0046_F04.bHX208303 
BMWN10047A12BMWN1_0047_A12.bHX208341 
BMWN10047C08BMWN1_0047_C08.bHX208357 
BMWN10047E05BMWN1_0047_E05.bHX208374 
BMWN10047H02BMWN1_0047_H02.b  
BMWN10048C04BMWN1_0048_C04.bHX208427 
BMWN10048D11BMWN1_0048_D11.bHX208444 
BMWN10048E04BMWN1_0048_E04.bHX208448 
BMWN10048F01BMWN1_0048_F01.bHX208456 
BMWN10048G11BMWN1_0048_G11.bHX208476 
BMWN10048G12BMWN1_0048_G12.bHX208477 
BMWN10049B11BMWN1_0049_B11.bHX208503 
BMWN10050E03BMWN1_0050_E03.bHX208609 
BMWN10050G03BMWN1_0050_G03.bHX208626 
BMWN10050G06BMWN1_0050_G06.bHX208629 
BMWN10050G07BMWN1_0050_G07.bHX208630 
BMWN10050H04BMWN1_0050_H04.bHX208637 
BMWN10050H05BMWN1_0050_H05.bHX208638 
BMWN10051C04BMWN1_0051_C04.bHX208665 
BMWN10052A05BMWN1_0052_A05.b  
BMWN10052H09BMWN1_0052_H09.b  
BMWN10053A04BMWN1_0053_A04.bHX208770 
BMWN10053E08BMWN1_0053_E08.bHX208801 
BMWN10053H06BMWN1_0053_H06.b  
BMWN10054A06BMWN1_0054_A06.bHX208829 
BMWN10054G03BMWN1_0054_G03.bHX208876 
BMWN10055A03BMWN1_0055_A03.bHX208891 
BMWN10055G01BMWN1_0055_G01.b  
BMWN10056A09BMWN1_0056_A09.b  
BMWN10056B04BMWN1_0056_B04.bHX208939 
BMWN10056E05BMWN1_0056_E05.b  
BMWN10056G01BMWN1_0056_G01.bHX208973 
BMWN10057A08BMWN1_0057_A08.bHX208993 
BMWN10057A12BMWN1_0057_A12.bHX208996 
BMWN10057F04BMWN1_0057_F04.bHX209040 
BMWN10058B01BMWN1_0058_B01.b  
BMWN10058C10BMWN1_0058_C10.bHX209084 
BMWN10059A09BMWN1_0059_A09.bHX209119 
BMWN10059D07BMWN1_0059_D07.bHX209150 
BMWN10060A01BMWN1_0060_A01.bHX209183 
BMWN10060A03BMWN1_0060_A03.bHX209185 
BMWN10060F12BMWN1_0060_F12.b  
BMWN10061B06BMWN1_0061_B06.b  
BMWN10061H03BMWN1_0061_H03.bHX209301 
BMWN10061H11BMWN1_0061_H11.bHX209306 
BMWN10062A03BMWN1_0062_A03.b  
BMWN10062B07BMWN1_0062_B07.bHX209318 
BMWN10062B10BMWN1_0062_B10.bHX209320 
BMWN10062E04BMWN1_0062_E04.bHX209345 
BMWN10062E11BMWN1_0062_E11.b  
BMWN10062F12BMWN1_0062_F12.bHX209357 
BMWN10062G07BMWN1_0062_G07.bHX209362 
BMWN10063D12BMWN1_0063_D12.bHX209401 
BMWN10063E12BMWN1_0063_E12.bHX209409 
BMWN10064B01BMWN1_0064_B01.bHX209441 
BMWN10064F10BMWN1_0064_F10.bHX209481 
BMWN10064G07BMWN1_0064_G07.bHX209486 
BMWN10065A07BMWN1_0065_A07.bHX209504 
BMWN10065A11BMWN1_0065_A11.b  AK399751
BMWN10065G06BMWN1_0065_G06.bHX209544 
BMWN10065G11BMWN1_0065_G11.bHX209548 
BMWN10065H08BMWN1_0065_H08.bHX209553 
BMWN10066G03BMWN1_0066_G03.bHX209602 
BMWN10066G07BMWN1_0066_G07.bHX209606 
BMWN10066H07BMWN1_0066_H07.b  
BMWN10067B01BMWN1_0067_B01.bHX209627 
BMWN10067B02BMWN1_0067_B02.bHX209628 
BMWN10067F02BMWN1_0067_F02.bHX209662 
BMWN10067H03BMWN1_0067_H03.bHX209677 
BMWN10068B06BMWN1_0068_B06.bHX209694 
BMWN10068B10BMWN1_0068_B10.bHX209697 
BMWN10068D05BMWN1_0068_D05.bHX209709 
BMWN10069D11BMWN1_0069_D11.bHX209790 
BMWN10069E06BMWN1_0069_E06.bHX209795 
BMWN10069G10BMWN1_0069_G10.bHX209821 
BMWN10070B05BMWN1_0070_B05.bHX209841 
BMWN10070C01BMWN1_0070_C01.bHX209846 
BMWN10070E09BMWN1_0070_E09.bHX209868 
BMWN10070F04BMWN1_0070_F04.bHX209870 
BMWN10071B05BMWN1_0071_B05.bHX209895 
BMWN10072A10BMWN1_0072_A10.bHX209951 
BMWN10072G07BMWN1_0072_G07.bHX210003 
BMWN10073A02BMWN1_0073_A02.bHX210014 
BMWN10073G04BMWN1_0073_G04.b  
BMWN10073H03BMWN1_0073_H03.bHX210068 
BMWN10074A10BMWN1_0074_A10.bHX210077 
BMWN10074F01BMWN1_0074_F01.b  
BMWN10074F02BMWN1_0074_F02.bHX210112 
BMWN10074G11BMWN1_0074_G11.bHX210125 
BMWN10075B12BMWN1_0075_B12.bHX210150 
BMWN10075D01BMWN1_0075_D01.b  
BMWN10075D08BMWN1_0075_D08.bHX210164 
BMWN10076C01BMWN1_0076_C01.bHX210222 
BMWN10077D02BMWN1_0077_D02.bHX210290 
BMWN10077E01BMWN1_0077_E01.bHX210299 
BMWN10077E11BMWN1_0077_E11.bHX210307 
BMWN10078A05BMWN1_0078_A05.bHX210340 
BMWN10078D03BMWN1_0078_D03.bHX210363 
BMWN10080A07BMWN1_0080_A07.bHX210465 
BMWN10080B12BMWN1_0080_B12.bHX210476 
BMWN10080F01BMWN1_0080_F01.bHX210501 
BMWN10080G07BMWN1_0080_G07.b  
BMWN10081A06BMWN1_0081_A06.bHX210528 
BMWN10081F07BMWN1_0081_F07.bHX210568 
BMWN10082A08BMWN1_0082_A08.bHX210596 
BMWN10082A09BMWN1_0082_A09.bHX210597 
BMWN10083A07BMWN1_0083_A07.b  
BMWN10083C04BMWN1_0083_C04.bHX210673 
BMWN10083C12BMWN1_0083_C12.bHX210680 
BMWN10083D03BMWN1_0083_D03.bHX210683 
BMWN10083E04BMWN1_0083_E04.bHX210694 
BMWN10083H10BMWN1_0083_H10.b  
BMWN10084D12BMWN1_0084_D12.bHX210749 
BMWN10084E05BMWN1_0084_E05.b  
BMWN10084F08BMWN1_0084_F08.bHX210763 
BMWN10085C04BMWN1_0085_C04.bHX210794 
BMWN10085E06BMWN1_0085_E06.bHX210812 
BMWN10085H06BMWN1_0085_H06.bHX210831 
BMWN10086B05BMWN1_0086_B05.b  
BMWN10086C07BMWN1_0086_C07.bHX210848 
BMWN10086H10BMWN1_0086_H10.bHX210886 
BMWN10087A11BMWN1_0087_A11.b  
BMWN10087G08BMWN1_0087_G08.bHX210941 
BMWN10087G11BMWN1_0087_G11.b  
BMWN10088A02BMWN1_0088_A02.bHX210952 
BMWN10088A05BMWN1_0088_A05.bHX210955 
BMWN10088A06BMWN1_0088_A06.bHX210956 
BMWN10088D09BMWN1_0088_D09.bHX210984 
BMWN10088G05BMWN1_0088_G05.bHX211010 
BMWN10089B01BMWN1_0089_B01.bHX211032 
BMWN10089D12BMWN1_0089_D12.bHX211056 
BMWN10089F07BMWN1_0089_F07.bHX211070 
BMWN10089G05BMWN1_0089_G05.bHX211080 
BMWN10090A02BMWN1_0090_A02.bHX211090 
BMWN10090A07BMWN1_0090_A07.bHX211095 
BMWN10090F08BMWN1_0090_F08.bHX211139 
BMWN10090G05BMWN1_0090_G05.bHX211144 
BMWN10090H02BMWN1_0090_H02.bHX211151 
BMWN10091A06BMWN1_0091_A06.bHX211163 
BMWN10091A12BMWN1_0091_A12.bHX211168 
BMWN10091E05BMWN1_0091_E05.bHX211196 
BMWN10091E10BMWN1_0091_E10.bHX211199 
BMWN10091E12BMWN1_0091_E12.bHX211200 
BMWN10091H02BMWN1_0091_H02.bHX211216 
BMWN10092A04BMWN1_0092_A04.bHX211223 
BMWN10092B11BMWN1_0092_B11.bHX211234 
BMWN10092D05BMWN1_0092_D05.bHX211244 
BMWN10093B07BMWN1_0093_B07.bHX211279 
BMWN10093F03BMWN1_0093_F03.bHX211317 
BMWN10095F07BMWN1_0095_F07.bHX211453 
BMWN10096D04BMWN1_0096_D04.bHX211508 
BMWN10096E03BMWN1_0096_E03.b  
BMWN10097D05BMWN1_0097_D05.bHX211559 
BMWN10097G01BMWN1_0097_G01.bHX211578 
BMWN10097H08BMWN1_0097_H08.bHX211588 
BMWN10098B09BMWN1_0098_B09.b  
BMWN10099A05BMWN1_0099_A05.bHX211645 
BMWN10099A06BMWN1_0099_A06.b  
BMWN10099B07BMWN1_0099_B07.bHX211654 
BMWN10099E08BMWN1_0099_E08.b  
BMWN10100A01BMWN1_0100_A01.bHX211693 
BMWN10100D04BMWN1_0100_D04.bHX211717 
BMWN10100F02BMWN1_0100_F02.bHX211734 
BMWN10100G01BMWN1_0100_G01.b  
BMWN10100G07BMWN1_0100_G07.b  
BMWN10100G09BMWN1_0100_G09.bHX211746 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
105C13800.511WNGCA/A
G13200.489GGA/G
262A13500.523WSCCA/P
G12300.477CCG/P
321C13800.511WNCCG/P
T13200.489CTG/L
570C12300.482W-
G13200.518
581C11900.472W-
G13300.528


Alignment:      TOP

20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0086_B05.b :
BMWN1_0065_A11.b :
BMWN1_0041_H11.b :
BMWN1_0046_F03.b :
BMWN1_0037_H03.b :
BMWN1_0037_F10.b :
BMWN1_0099_B07.b :
BMWN1_0059_A09.b :
BMWN1_0087_G11.b :
BMWN1_0089_G05.b :
BMWN1_0040_F12.b :
BMWN1_0036_H12.b :
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b :
BMWN1_0013_G12.b :
BMWN1_0062_F12.b :
BMWN1_0080_G07.b :
BMWN1_0096_D04.b :
BMWN1_0010_E03.b :
BMWN1_0021_G08.b :
BMWN1_0083_A07.b :
BMWN1_0008_D09.b :
BMWN1_0057_F04.b :
BMWN1_0073_A02.b :
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b :
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b :
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b :
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b :
BMWN1_0069_G10.b :
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b :
BMWN1_0088_A05.b :
BMWN1_0002_G04.b :
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b :
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b :
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b :
BMWN1_0030_E07.b :
BMWN1_0062_A03.b :
BMWN1_0046_A02.b :
BMWN1_0046_D09.b :
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b :
BMWN1_0057_A12.b :
BMWN1_0020_A11.b :
BMWN1_0075_D08.b :
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b :
BMWN1_0061_H11.b :
BMWN1_0044_B07.b :
BMWN1_0047_H02.b :
BMWN1_0028_C08.b :
BMWN1_0056_G01.b :
BMWN1_0001_E04.b :
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b :
BMWN1_0100_D04.b :
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b :
BMWN1_0036_B10.b :
BMWN1_0037_E04.b :
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : aagggggggggggntnnncnttnnnntttttancaanttc
BMWN1_0017_B03.b :
BMWN1_0003_D01.b :
BMWN1_0083_C04.b :
BMWN1_0069_E06.b :
BMWN1_0083_E04.b :
BMWN1_0092_D05.b :
BMWN1_0099_A06.b :
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b :
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b :
BMWN1_0073_G04.b :
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b :
BMWN1_0046_F04.b :
BMWN1_0041_E05.b :
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b :
BMWN1_0001_D08.b :
BMWN1_0053_A04.b :
BMWN1_0031_D09.b :
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b :
BMWN1_0030_E03.b :
BMWN1_0035_G03.b :
BMWN1_0031_C01.b :
BMWN1_0037_C04.b :
BMWN1_0063_D12.b :
BMWN1_0022_D06.b :
BMWN1_0077_D02.b :
BMWN1_0078_D03.b :
BMWN1_0081_F07.b :
BMWN1_0003_E09.b :
BMWN1_0068_D05.b :
BMWN1_0034_G03.b :
BMWN1_0003_F08.b :
BMWN1_0067_F02.b :
BMWN1_0092_A04.b :
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b :
BMWN1_0070_F04.b :
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b :
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b :
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b :
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b :
BMWN1_0005_H04.b :
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b :
BMWN1_0098_B09.b :
BMWN1_0040_E09.b :
BMWN1_0028_H02.b :
BMWN1_0070_E09.b :
BMWN1_0022_D07.b :
BMWN1_0012_B02.b :
BMWN1_0039_B02.b :
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b :
BMWN1_0002_D08.b :
BMWN1_0058_C10.b :
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b :
BMWN1_0085_H06.b :
BMWN1_0001_A07.b :
BMWN1_0040_B09.b :
BMWN1_0023_G01.b :
BMWN1_0075_B12.b :
BMWN1_0088_D09.b :
BMWN1_0092_B11.b :
BMWN1_0032_E12.b : nngccgtgagacgcagtagtattctatacttttttaggca
BMWN1_0100_G01.b :
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b :
BMWN1_0062_E11.b :
BMWN1_0074_F01.b :
BMWN1_0056_E05.b :
BMWN1_0041_B02.b :
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b : ncccgctcaggacgcgccnttctatttacccccncnnnnngggattttnngggcncccct
BMWN1_0052_H09.b :
BMWN1_0087_A11.b :
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0086_B05.b : naactagttatacgccgctagt
BMWN1_0065_A11.b : ntttagcagagtacacgcagtact
BMWN1_0041_H11.b : gcatgtacgacgcattagta
BMWN1_0046_F03.b :
BMWN1_0037_H03.b : ttttggagagtagacxxxxxxxxxxxxxxxx
BMWN1_0037_F10.b : ttttncgagagtacgaxxxxxxxxxxxxxxxxxx
BMWN1_0099_B07.b : ttgggcaggtagacgccgtaxxxxxxxxxxxxxxxx
BMWN1_0059_A09.b : nttggagagtacgaggxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0087_G11.b : ttttggcatagagacgccgtaxxxxxxx
BMWN1_0089_G05.b : nnnggagacggtagacgxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F12.b : ttcccaatgacacgccgtagtatttatxxxxxxxx
BMWN1_0036_H12.b : ttgcgcaggaagacgccgtaxxxxxxxxxxxxxxxxxx
BMWN1_0088_G05.b : nnnaaggagaggtagacxxxxxxxxxxxxxx
BMWN1_0030_G11.b : ttttggagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0091_E05.b : nccgagagtagacgxxxxxxxxxxx
BMWN1_0016_F04.b : ttttaggcagagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0018_B10.b : tttttcccaagtaacgacgxxxxxxxxxxx
BMWN1_0013_G12.b : ttttttcgcaggtagacgxxxxxxxxxx
BMWN1_0062_F12.b : ntttggatagtacgacgxxxxxxxxxx
BMWN1_0080_G07.b : ttttagacagtacgacgxxxxxxxxx
BMWN1_0096_D04.b : tttttggacggtacgacgxxxxxxxxxxx
BMWN1_0010_E03.b : nnnnnggagagtacgaggxxxxxxxxxx
BMWN1_0021_G08.b : ttttggagagtacgaggxxxxxxxxxxx
BMWN1_0083_A07.b : nnnttcgcagagacgaggxxxxxxxxxx
BMWN1_0008_D09.b : nttaaccgagagtacgacgxxxxxxxxxx
BMWN1_0057_F04.b : nnnngggagagtacgaggxxxxxxxxxxx
BMWN1_0073_A02.b : tttgcatgagtaagacxxxxxxxxxxxxx
BMWN1_0050_G06.b : nnnnnggatagtagacxxxxxxxxxxxxx
BMWN1_0024_G05.b : ttttgggagagtagaggxxxxxxxxxxx
BMWN1_0058_B01.b : tcgcgagtacgaxxxxxxxxxxxxxx
BMWN1_0005_B12.b : nttttggacgagtagacgcagtagtatt
BMWN1_0084_D12.b : tttttagcaggtagacgxxxxxxxxx
BMWN1_0100_F02.b : tttttggagagtacgacgxxxxxxxxxx
BMWN1_0050_H04.b : nnggaggcaggtagaggccgtaxxxxx
BMWN1_0099_E08.b : ntcgcaagtagacgxxxxxxxxxxx
BMWN1_0062_E04.b : nttgggacggtacgaxxxxxxxxxxxxxxx
BMWN1_0050_H05.b : nnttgggacggtagaxxxxxxxxxxxxxx
BMWN1_0090_G05.b : nnnnaaggagagtxxxxxxxxxxxxxxxxxx
BMWN1_0074_F02.b : tttccatatacgacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0012_A09.b : tttttagacgagtagacgxxxxxxxxxxx
BMWN1_0090_H02.b : nnnggcgagagtxxxxxxxxxxxxxxxxx
BMWN1_0018_H10.b : nntttgagacgagtagaxxxxxxxxxxxxxx
BMWN1_0100_G09.b : ttttacgagagtacgaggxxxxxxxxxxxx
BMWN1_0012_C04.b : tttttggcagagagacgxxxxxxxxxxxx
BMWN1_0022_E01.b : tttatggatagtacgacgxxxxxxxxxxx
BMWN1_0077_E01.b : tttttggatagtaagaggxxxxxxxxxx
BMWN1_0088_A02.b : nnnaacgagagtacgaggxxxxxxxxxx
BMWN1_0028_G02.b : ttttagcaagtacacgcagtagtatt
BMWN1_0097_H08.b : nnnnggagagtagaggxxxxxxxxxx
BMWN1_0020_C01.b : nnnnccgatagtxxxxxxxxxxxxxxxxxx
BMWN1_0011_B10.b : tttttagcaggtacacgccgtaxxxxx
BMWN1_0020_G02.b : ntttcgatggtacgacgxxxxxxxxxx
BMWN1_0075_D01.b : ttttccgagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0093_B07.b : tttttgcaggtagaxxxxxxxxxxxxxxx
BMWN1_0066_G03.b : nnnaagatggtxxxxxxxxxxxxxxxxx
BMWN1_0007_B05.b : nnnnnnggacagtxxxxxxxxxxxxxxxxxx
BMWN1_0065_G11.b : nttttggagagtacgaggxxxxxxxxxx
BMWN1_0086_H10.b : nnttgagagagtagaggxxxxxxxxxxx
BMWN1_0055_A03.b : nnngggagagtagacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0024_C07.b : nntttagacgagtagacxxxxxxxxxxxxx
BMWN1_0083_C12.b : tttttagacgagtagaggxxxxxxxxxxx
BMWN1_0030_G02.b : ttttagcagagtagacxxxxxxxxxxxx
BMWN1_0062_G07.b : ntttggatagtacgaggxxxxxxxxxxx
BMWN1_0044_B03.b : nnnccgaggtaagacgccgtagtatt
BMWN1_0061_B06.b : tccagagtacgaxxxxxxxxxxxxxx
BMWN1_0069_G10.b : tttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0039_D05.b : nggaggttnnnnnnnccagagtacacgcagtagtat
BMWN1_0076_C01.b : tttnncgatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0100_A01.b : tttttagcaggtagacgcagtagtattaaxxxxxxxxxx
BMWN1_0013_C07.b : tttttggcagagagaxxxxxxxxxxxxxxx
BMWN1_0050_G07.b : nnnngggagagtagacxxxxxxxxxxxxxx
BMWN1_0053_E08.b : tttttggcaggtacgacgxxxxxxxxxxx
BMWN1_0088_A06.b : nnnnaagagagtacgacgxxxxxxxxxx
BMWN1_0033_C08.b : tttttggagagtacgacgcagtagtaxxxxxxxxxxxxxxx
BMWN1_0072_G07.b : tttaggatagtacgacgxxxxxxxxxxxx
BMWN1_0085_C04.b : naaaccgagagtacgaggxxxxxxxxxxx
BMWN1_0002_H12.b : nttttggagagtacacgcantagtaxxx
BMWN1_0015_G06.b : tttttggagagtacgacgcagtagtaxx
BMWN1_0064_G07.b : nnnaaggagagtacgaggxxxxxxxxxx
BMWN1_0082_A08.b : tttcgcagagtacgaggxxxxxxxxxxx
BMWN1_0088_A05.b : nnnggcgacggtagaggxxxxxxxxxxx
BMWN1_0002_G04.b : ntttggagagtagaggxxxxxxxxxxx
BMWN1_0089_D12.b : ttttaggacggacgaggxxxxxxxxxx
BMWN1_0018_D07.b : tttttagacgagtacacxxxxxxxxxxxxxx
BMWN1_0081_A06.b : tttttagagagtacgaxxxxxxxxxxxxxxx
BMWN1_0074_A10.b : tttcgagagtacgaxxxxxxxxxxxxxx
BMWN1_0047_C08.b : nnntccagagtagacgccntaxxxxxx
BMWN1_0050_E03.b : nnnnnggacgagtagacxxxxxxxxxxxxxx
BMWN1_0070_C01.b : tttttggatggtxxxxxxxxxxxxxxxxxxx
BMWN1_0041_D04.b : nnggcaagtacacgxxxxxxxxxx
BMWN1_0048_E04.b : ttttnggcagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_B02.b : tttttggatagtacgacgxxxxxxxxxx
BMWN1_0053_H06.b : tttaacgcagtacacgxxxxxxxxx
BMWN1_0030_E07.b : tttttggcagagtacgacgxxxxxxxxxxx
BMWN1_0062_A03.b : ntccatattacgaxxxxxxxxxxxxxx
BMWN1_0046_A02.b : tttggatagtagacgxxxxxxxxxxx
BMWN1_0046_D09.b : nnnggatggtagaggxxxxxxxxxxx
BMWN1_0078_A05.b : nnnnnggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_A12.b : nntttagcaggtacacgcantaxxxxxx
BMWN1_0086_C07.b : nnttagagagtacgaggxxxxxxxxxx
BMWN1_0057_A12.b : nnnnccgatagtacgaxxxxxxxxxxxxx
BMWN1_0020_A11.b : ntgccagagtacgaxxxxxxxxxxxxxx
BMWN1_0075_D08.b : nnngggagagtacgacgxxxxxxxxxxx
BMWN1_0016_C10.b : tttttacgagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_E12.b : nnnnnncgagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0019_D03.b : tttccgatagtacgaggxxxxxxxxxxxx
BMWN1_0021_D09.b : nncccagagtacgaxxxxxxxxxxxxxxx
BMWN1_0061_H11.b : ttttggagagtacgacgxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B07.b : nngggagagtacgaxxxxxxxxxxxxxx
BMWN1_0047_H02.b : nnntttcgaaagtxxxxxxxxxxxxxxxxxx
BMWN1_0028_C08.b : ttttagcagagacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0056_G01.b : ttccacaggtacgacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0001_E04.b : nnngggatagtagacgccgtaxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b : nnnnnggcagagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0041_C12.b : nggcatttttntttggcagagtagacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0031_F12.b : tttttgaaagtacacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0100_D04.b : tttncgagagtagaggxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b : tttttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_C11.b : tttttggacggtacacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_F08.b : nnnaagcagagtagaggxxxxxxxxxxxxxxxxxxxxx
BMWN1_0064_F10.b : tttttggatagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0054_A06.b : ttttaggcagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_C03.b : ntaaccgagagtagaggcagtagtattaaxxxxxxxx
BMWN1_0048_G11.b : nntttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0072_A10.b : tttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0068_B06.b : ttttaggatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0007_C09.b : ntttaggagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0020_D11.b : tgggagagtacgacgcagtagtattaaxxxxxxxxx
BMWN1_0036_B10.b : ttttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0037_E04.b : ttttccgaaggaagaggxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0071_B05.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0097_D05.b : ctttnnaatttttttnttnnnnnnnnnnngggaagtacacgccntagnttttatxxxxxx
BMWN1_0017_B03.b : tttttaagagagtacgacgxxxxxxxxxx
BMWN1_0003_D01.b : nttacgcaggtagacgccgtaxxx
BMWN1_0083_C04.b : nnnnccgcaggagaggxxxxxxxxx
BMWN1_0069_E06.b : tttttagatagtacgacgxxxxxxxx
BMWN1_0083_E04.b : tttttggcaggtagacxxxxxxxxxxxx
BMWN1_0092_D05.b : ttaaccgagagtacgacgxxxxxxxxxx
BMWN1_0099_A06.b : ngggcaggtaacacgccgtagt
BMWN1_0032_D01.b : tttttagcagagtacacxxxxxxxxxxxxx
BMWN1_0003_C12.b : ttttaggagagtagacxxxxxxxxxx
BMWN1_0080_A07.b : tttttcgagagtacgaxxxxxxxxxxxxx
BMWN1_0084_F08.b : tttttcgcaggtagacxxxxxxxxxxx
BMWN1_0048_F01.b : tttttggcaggtagaggxxxxxxxx
BMWN1_0067_H03.b : tttggatagtacgaggcagtagta
BMWN1_0064_B01.b : nttttagatagtacgaggxxxxxxxxx
BMWN1_0065_H08.b : ntttgggagagtacgacgxxxxxxxxx
BMWN1_0043_C11.b : ttttggcaggtagacgxxxxxxxxx
BMWN1_0093_F03.b : tttttgcagagacacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0080_B12.b : tttttggatagtacgacgxxxxxxxxx
BMWN1_0028_F10.b : tttttagcaggtacacgxxxxxxxxx
BMWN1_0056_A09.b : tggctagaaagaxxxxxxxxxxxx
BMWN1_0073_G04.b : nggatagtacgacgccgtagta
BMWN1_0062_B07.b : nnnnccatggtacgaggxxxxxxxxxxxxxxxxxxxx
BMWN1_0083_H10.b : nttttacacggtagaggccgtaxxx
BMWN1_0036_E02.b : ttggagagtaagacgxxxxxxxxx
BMWN1_0046_F04.b : nnnccgacggtagacgxxxxxxxx
BMWN1_0041_E05.b : nnccgaagtagacgxxxxxxxxx
BMWN1_0048_G12.b : nntttagcagagtagacxxxxxxxxxxx
BMWN1_0066_G07.b : nttttacgagagtacgaggxxxxxxxxxx
BMWN1_0030_B05.b : tttttccagagtacgacgcagtagtax
BMWN1_0060_A01.b : tttggagagtaagacgxxxxxxx
BMWN1_0001_D08.b : nnnnggcaggtacgacgxxxxxxxx
BMWN1_0053_A04.b : tttttaccagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0031_D09.b : tttttccagagaagaxxxxxxxxxxxxx
BMWN1_0002_D01.b : ttttagagagtacacgxxxxxxxxxx
BMWN1_0065_G06.b : tttggcatgagtxxxxxxxxxxxxxxx
BMWN1_0100_G07.b : nttaagagagtaacacgccgtxxxxx
BMWN1_0030_E03.b : ttagcaagtagacgcagtagtattaaxxxxxxxx
BMWN1_0035_G03.b : tttttggcagagagacxxxxxxxxxxx
BMWN1_0031_C01.b : ttttagcaagtacgangcagtagtaxx
BMWN1_0037_C04.b : nggcaatgtacgacgcagtcgtaxx
BMWN1_0063_D12.b : tttttgcacggtagacgxxxxxxxx
BMWN1_0022_D06.b : gcacataaagacgccgtacxxx
BMWN1_0077_D02.b : nnnnggagagtacgacgxxxxxxxx
BMWN1_0078_D03.b : tttttggagagtacgaggccgtaxxx
BMWN1_0081_F07.b : ttgggagagtacgacgxxxxxxxxx
BMWN1_0003_E09.b : ttttagcaggtacgacgccgtaxxxxx
BMWN1_0068_D05.b : ttttggatagtacgacgccgtaxxxxx
BMWN1_0034_G03.b : tttttggcaagtacacgxxxxxxxxx
BMWN1_0003_F08.b : ttttggcaagtacgaxxxxxxxxxxxxx
BMWN1_0067_F02.b : tttccgagagtacgacgxxxxxxxxx
BMWN1_0092_A04.b : ttttgggatggtxxxxxxxxxxxxxxxxx
BMWN1_0074_G11.b : ttttggatagtacgaggxxxxxxxxxx
BMWN1_0024_C12.b : nttttaccaggtagacgxxxxxxxxxx
BMWN1_0061_H03.b : ttttccgatagtacgaggxxxxxxxxx
BMWN1_0089_F07.b : nnnggggagagtacgaggxxxxxxxxxxx
BMWN1_0010_D11.b : nnnggagatggtacgacgxxxxxxxxx
BMWN1_0084_E05.b : nnncgcaattacgaxxxxxxxxxxx
BMWN1_0070_F04.b : ttcccatagtacgacgxxxxxxxxxx
BMWN1_0091_E10.b : nnttggagagtacgacgccgtaxxxxx
BMWN1_0091_A12.b : ttgggagattacgacgxxxxxxxxxx
BMWN1_0009_G09.b : nntttaggagagtacgacgxxxxxxxxxx
BMWN1_0001_B08.b : nnttgatagtaagaxxxxxxxxxxxxx
BMWN1_0066_H07.b : nntcccatagtacgaggxxxxxxxx
BMWN1_0082_A09.b : tttttggagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0032_D09.b : ttttagacagagtacacgxxxxxxxxx
BMWN1_0060_A03.b : tttgagatggtacgaggxxxxxxxxxx
BMWN1_0013_B05.b : tttttaagcaagntagacxxxxxxxxxxxxx
BMWN1_0047_E05.b : nnnnnggcagagtacacgxxxxxxxxxx
BMWN1_0062_B10.b : ttttggatggtacgaggcagtxxxxx
BMWN1_0090_A02.b : ttttaggcaggtagaggxxxxxxxxx
BMWN1_0090_A07.b : nnnaaggagagtaagaggxxxxxxxx
BMWN1_0083_D03.b : ttttccgcaggtxxxxxxxxxxxxxxxxxx
BMWN1_0009_A07.b : nttttgagagagtacgacgxxxxxxxxxx
BMWN1_0069_D11.b : tttttggatagtacgacgxxxxxxxxxx
BMWN1_0038_B05.b : tttccgcaggaagaggxxxxxxxxxx
BMWN1_0087_G08.b : nnnttcacgggtagaggccgtagta
BMWN1_0018_H11.b : ttttttcgcaggtacgacgcagtagtaxx
BMWN1_0050_G03.b : nnnaacgcaggtagaxxxxxxxxxxxxxx
BMWN1_0060_F12.b : ttttagccgagtxxxxxxxxxxxxxxxxx
BMWN1_0095_F07.b : ttttaccagagtacacxxxxxxxxxxxx
BMWN1_0021_D02.b : tttttggatagtacgacgxxxxxxxxx
BMWN1_0051_C04.b : tttttggcaagtagacgxxxxxxxxxx
BMWN1_0054_G03.b : tttttggcaagtagacxxxxxxxxxxxxxx
BMWN1_0020_E06.b : tttnggatagtacgaggxxxxxxxxxxx
BMWN1_0057_A08.b : nnnaaagacagtacgacgxxxxxxxxxx
BMWN1_0089_B01.b : nnnggggagagtacgaggxxxxxxxxxx
BMWN1_0025_H06.b : nnnaaagcaggtacacgxxxxxxxx
BMWN1_0040_F07.b : tttggcaggtagacgxxxxxx
BMWN1_0065_A07.b : tttttggatagtxxxxxxxxxxxxxxxxxx
BMWN1_0067_B01.b : tttttggatagtacgacgxxxxxxxxxxx
BMWN1_0091_A06.b : ntttagacagagtacgacgcagtagtaxx
BMWN1_0005_H04.b : nnttacagagaagaggxxxxxxxxx
BMWN1_0023_A08.b : nntttagcagagtacacgxxxxxxxxxxx
BMWN1_0080_F01.b : ttttacgagagtacgaggxxxxxxxxx
BMWN1_0091_H02.b : ttttccagagtacgacgxxxxxxxxxx
BMWN1_0026_G01.b : tttttggagagtagaggxxxxxxxxxx
BMWN1_0049_B11.b : tttttggacgagtacacxxxxxxxxxxxxxxxxxxxxx
BMWN1_0028_C11.b : tttttggcagagtagacxxxxxxxxxxxxx
BMWN1_0023_A12.b : nntttagcaggtagacgxxxxxxxxxx
BMWN1_0028_E07.b : tttttggcaggtacacgxxxxxxxxx
BMWN1_0077_E11.b : ntttacgagagtacgacgxxxxxxxxxx
BMWN1_0098_B09.b : tttcccagagtagacgcagtagta
BMWN1_0040_E09.b : nncccaataagaggccgtagtax
BMWN1_0028_H02.b : ttttggcaggtacacgccgtaxxxxxx
BMWN1_0070_E09.b : ttttggacagtacgacgxxxxxxxxx
BMWN1_0022_D07.b : nttggcaggtacgaggccgtaxxxx
BMWN1_0012_B02.b : tttagaaagtagaggxxxxxxxxx
BMWN1_0039_B02.b : nnnngcgagtagaggcagtagtat
BMWN1_0026_E12.b : tttttggcaggtacgacgxxxxxxxxx
BMWN1_0026_F03.b : ttttnggacgagtacacgxxxxxxxxx
BMWN1_0099_A05.b : ttttggacgagtxxxxxxxxxxxxxxxxx
BMWN1_0059_D07.b : nttccgacagtacgaggxxxxxxxxxxx
BMWN1_0002_D08.b : nnnnggacgagtagacgxxxxxxxxx
BMWN1_0058_C10.b : nttggatggtacgacgxxxxxxxxxx
BMWN1_0003_F12.b : nttttgagcaggtagaxxxxxxxxxxxxx
BMWN1_0010_C11.b : ttttttggagagtacgacgxxxxxxxxxx
BMWN1_0091_E12.b : tttttagcagagtagaggxxxxxxxxxxx
BMWN1_0056_B04.b : nnnccgagagtacgaggxxxxxxxxxx
BMWN1_0068_B10.b : tttttagatagtxxxxxxxxxxxxxxxx
BMWN1_0085_H06.b : tttttggcagagtagaggxxxxxxxxxx
BMWN1_0001_A07.b : ttttggcagagtagacgxxxxxxxxx
BMWN1_0040_B09.b : ngaaattaagacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_G01.b : ntttnggacgagtacacgxxxxxxxxxxx
BMWN1_0075_B12.b : ttttacacaggtagaxxxxxxxxxxxxxx
BMWN1_0088_D09.b : ttttggcagagtaagaggccxxxxxxxxxxxxxxxxxx
BMWN1_0092_B11.b : ttttggagagtagaxxxxxxxxx
BMWN1_0032_E12.b : tttattgggaatttgttgattttnccattttttggttnnnggcatagtxxxxxxxxxxxx
BMWN1_0100_G01.b : ttaagatagaacgacgcagtagtxxxxxxxxxxxxxx
BMWN1_0039_C10.b : tttggcaagacgaggxxxx
BMWN1_0012_G10.b : ttttttggcagagtagaxxxxxxxxx
BMWN1_0073_H03.b : ttttacgatagtacgaggxxxx
BMWN1_0039_B11.b : ttttcctaagagaggxxxxxxxxxxxxxxxxx
BMWN1_0052_A05.b : tttaggcaggtagacngcanta
BMWN1_0027_G06.b : ttttggcagagtagaggxxxxx
BMWN1_0096_E03.b : tttccgacggtagaggxxxxxxxxxxxxxxxxxxx
BMWN1_0062_E11.b : cttagaacgaggcctttattatttatacgactc
BMWN1_0074_F01.b : taccatagtacacgxxxxxxxxx
BMWN1_0056_E05.b : ncactattxxxxxxxxxxxxxxxxx
BMWN1_0041_B02.b : ttgcagtgagacgxxxxxxxx
BMWN1_0085_E06.b : nnaaaggacgagtacacgxxxxxxxxxxxxxxx
BMWN1_0016_F09.b : ttttttggacggtagacgxxxxxxxxxxxxxxx
BMWN1_0097_G01.b : tttttggagagtagaggxxxxxxxxxxxxxxxx
BMWN1_0017_B12.b : gggaaacggnactcccnnncntnnnttntntttttttttttggcaggtacacgcantagn
BMWN1_0052_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0087_A11.b : ttttnncgagagtxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : .......GACTCCTCTAGGGAATTTAATGATTGAGGCTCACCTG*GGCACCATGG**AGA
---------+---------+---------+---------+---------+---------+ 50
BMWN1_0086_B05.b : atttatcGACTCCTCTAGGGAATTTAATGAATT*GGCTCTCCTC*CCTTTAATGG**AGA
BMWN1_0065_A11.b : ttttaacgactcccCTAGGGAATTTAATGAATTGGGCTCACCTT*TTCACCATGG**AGA
BMWN1_0041_H11.b : tttatacgactcactcccGGAATTTAATGAATT*GGCTCACCCG*CTTAAAAAGG**AGA
BMWN1_0046_F03.b : aTTAAATGAATT*GGGCTCCCCC*TTTACCATGG**AGA
BMWN1_0037_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0059_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0087_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGGCTC*CCTT*AGCACCATGG**AGA
BMWN1_0089_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0040_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGACTCACCTG*GGCACCATGG**AGA
BMWN1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxttTGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGCTCACCTGTGGCACCATGG**AGA
BMWN1_0030_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0091_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0013_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0062_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*AGAACCATGG**AGA
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0021_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCC*CTTACCATGG**AGA
BMWN1_0008_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GCCACCATGG**AGA
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0073_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACTTG*GGCACCATGG**AGA
BMWN1_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0024_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0058_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCCCACTTG*GGCACCATGG**AGA
BMWN1_0005_B12.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0084_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*TTCACCATGG**AGA
BMWN1_0062_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0090_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0074_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcccttaTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0012_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0090_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0012_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0022_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0077_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0028_G02.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0097_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0020_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0075_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0093_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0066_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*GGCACCATGG**AGA
BMWN1_0007_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0065_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0086_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0055_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0024_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTC*GGCTCCATGG**AGA
BMWN1_0030_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0062_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0044_B03.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GTGCCCATGG**AGA
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCCCTTT*GGCACCATGG**AGA
BMWN1_0069_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0039_D05.b : taaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0076_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0013_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0033_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0085_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0002_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0015_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0064_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0082_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0002_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0089_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0081_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0074_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCCCACTTG*GGCACCATGG**AGA
BMWN1_0047_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTGGGTCACCATGG**AGA
BMWN1_0070_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0041_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0048_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*AGCA*CATGG**AGA
BMWN1_0030_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCCCCTA*AGCACCATGG**AGA
BMWN1_0046_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0046_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTGGGCTCACCTT*GGCACCATGG**AGA
BMWN1_0078_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0047_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0057_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0075_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0016_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0063_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0019_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0021_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0061_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0044_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0047_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTC*GGTTCCATGG**AGA
BMWN1_0028_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0056_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0017_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0090_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0064_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0054_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0072_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0068_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0007_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0036_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0037_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0071_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0017_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0003_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0069_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_A06.b : atttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCC*TTTAA*ATGG**AGA
BMWN1_0032_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0003_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0084_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0067_H03.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0064_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0065_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GTCACCATGG**AGA
BMWN1_0043_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTCCGCTTCCATGG**AGA
BMWN1_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTT*TTAACCATGG**AGA
BMWN1_0073_G04.b : tttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TTAACCATGG**AGA
BMWN1_0062_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GCCATTATGG**AGA
BMWN1_0036_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCT*TTCACCATGG**AGA
BMWN1_0046_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*CGTTCCATGG**AGA
BMWN1_0041_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*CTTACCATGG**AGA
BMWN1_0048_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0066_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0030_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0060_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCT*TGCACCATGG**AGA
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0002_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0065_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0100_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*GTTTACATGG**AGA
BMWN1_0030_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcattaGCTCACCTG*GGCACCATGG**AGA
BMWN1_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0037_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*TGCACCATGG**AGA
BMWN1_0063_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCT*TTTAACGTGG**AGA
BMWN1_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0078_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0068_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0034_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0067_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0092_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTGGCACCATGG**AGA
BMWN1_0074_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0024_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CTCTCCATGG**AGA
BMWN1_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0089_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0010_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0084_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CTTTATATGG**AGA
BMWN1_0070_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*GGCACCATGG**AGA
BMWN1_0091_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0009_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0001_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCT*TGCACCATGG**AGA
BMWN1_0066_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0082_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0032_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0060_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0013_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0047_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0062_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0090_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0090_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TTCACCATGG**AGA
BMWN1_0083_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0009_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0069_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0038_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0087_G08.b : tttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCC*GTCACCATGG**AGA
BMWN1_0018_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0050_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0060_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTA*TGAACCATGG**AGA
BMWN1_0095_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0051_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0054_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0020_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0057_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0089_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0025_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0040_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GCCACTATGG**AGA
BMWN1_0065_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0067_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0005_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CGTACCATGG**AGA
BMWN1_0023_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0080_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*GGCACCATGG**AGA
BMWN1_0026_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0049_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GGCACCATGG**AGA
BMWN1_0028_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0023_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTTGCACCATGG**AGA
BMWN1_0098_B09.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*TTCACCATGG**AGA
BMWN1_0040_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*TTCACCATGG**AGA
BMWN1_0028_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0070_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTGGCACCATGG**AGA
BMWN1_0022_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0012_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0039_B02.b : taaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GCCACTTTGG**AGA
BMWN1_0026_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*GGCACCATGG**AGA
BMWN1_0026_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0099_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0002_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0058_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0010_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0085_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0001_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0040_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttaagaTCACCTG*GGCACCATGG**AGA
BMWN1_0023_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0075_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0088_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GGCACCATGG**AGA
BMWN1_0092_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0032_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0100_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxcccctttaaagGACCTG*GGCATCANGG**AGA
BMWN1_0039_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCACTGGTAGA
BMWN1_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0073_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*CGCTCCATGG**AGA
BMWN1_0039_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*TGCACCATGG**AGA
BMWN1_0052_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GCGCCTATGG**AGA
BMWN1_0027_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0096_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccattaatACCTG*GGCACCATGG**AGA
BMWN1_0062_E11.b : ccatagggaattaaatgatttccgccgccttttaggcctcCCTG*GGCACCATGG**AGA
BMWN1_0074_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcCCTTTGGCACCATGG**AGA
BMWN1_0056_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcatccCCTT*TACACCATGG**AGA
BMWN1_0041_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcaCCC*TTTCAAATGG**AGA
BMWN1_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0016_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0017_B12.b : tttanacgactcctatanggaatttaatgaattgaggctcacctgggcacCATGG**AGA
BMWN1_0052_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagagggnctgggaaagATGG**AGA
BMWN1_0087_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaacaataacccatcaaaccactggacgtg
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
---------+---------+---------+---------+---------+---------+ 110
BMWN1_0086_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCCGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0065_A11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0041_H11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTCGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0046_F03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0037_H03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0037_F10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0099_B07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0059_A09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0087_G11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0089_G05.b : CCCAGAGGGCCAGCCCGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0040_F12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0036_H12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0088_G05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0030_G11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0091_E05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0016_F04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0018_B10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0013_G12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0062_F12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0080_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGCCCTCTAGGTACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0096_D04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0010_E03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0021_G08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0083_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0008_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0057_F04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0073_A02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0050_G06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0024_G05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0058_B01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0005_B12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0084_D12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0100_F02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0050_H04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0099_E08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0062_E04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0050_H05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0090_G05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0074_F02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0012_A09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0090_H02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0018_H10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0100_G09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0012_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0022_E01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0077_E01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0088_A02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0028_G02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0097_H08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0020_C01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0011_B10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0020_G02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0075_D01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0093_B07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0066_G03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0007_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0065_G11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0086_H10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0055_A03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0024_C07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0083_C12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0030_G02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0062_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0044_B03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0061_B06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0069_G10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0039_D05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0076_C01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0100_A01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0013_C07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0050_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0053_E08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0088_A06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0033_C08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0072_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0085_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0002_H12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0015_G06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0064_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0082_A08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0088_A05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0002_G04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0089_D12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0018_D07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0081_A06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0074_A10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0047_C08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0050_E03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0070_C01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0041_D04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0048_E04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0067_B02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0053_H06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0030_E07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0062_A03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0046_A02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0046_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0078_A05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0047_A12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0086_C07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCCCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0057_A12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0020_A11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0075_D08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0016_C10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0063_E12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0019_D03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0021_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0061_H11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0044_B07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0047_H02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0028_C08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0056_G01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0001_E04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0048_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0041_C12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0031_F12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0100_D04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0048_D11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0017_C11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0090_F08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0064_F10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0054_A06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0046_C03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0048_G11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0072_A10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0068_B06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0007_C09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0020_D11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0036_B10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0037_E04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0071_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0097_D05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0017_B03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0003_D01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0083_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0069_E06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0083_E04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0092_D05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0099_A06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0032_D01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0003_C12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0080_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0084_F08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0048_F01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0067_H03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0064_B01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0065_H08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0043_C11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0093_F03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0080_B12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0028_F10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0056_A09.b : CCCAGAGGGCCAGCCTGTGCCTGGGCCTCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0073_G04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0062_B07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0083_H10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0036_E02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0046_F04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0041_E05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0048_G12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0066_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0030_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0060_A01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0001_D08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0053_A04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0031_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0002_D01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0065_G06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0100_G07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0030_E03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0035_G03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0031_C01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0037_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0063_D12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0022_D06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0077_D02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0078_D03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0081_F07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0003_E09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0068_D05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0034_G03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0003_F08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0067_F02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0092_A04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0074_G11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0024_C12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0061_H03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0089_F07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0010_D11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0084_E05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0070_F04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0091_E10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0091_A12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0009_G09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0001_B08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0066_H07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0082_A09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0032_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0060_A03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0013_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0047_E05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0062_B10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0090_A02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0090_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0083_D03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0009_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0069_D11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0038_B05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0087_G08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0018_H11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0050_G03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0060_F12.b : CCCAGAGGGCCAGCCTGTGCCAGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0095_F07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0021_D02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0051_C04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0054_G03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0020_E06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0057_A08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0089_B01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0025_H06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0040_F07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0065_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0067_B01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0091_A06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0005_H04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0023_A08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0080_F01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0091_H02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0026_G01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0049_B11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0028_C11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0023_A12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0028_E07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0077_E11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0098_B09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0040_E09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0028_H02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0070_E09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0022_D07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0012_B02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0039_B02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0026_E12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0026_F03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0099_A05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0059_D07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0002_D08.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0058_C10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0003_F12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0010_C11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0091_E12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0056_B04.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0068_B10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0085_H06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0001_A07.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0040_B09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0023_G01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0075_B12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0088_D09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0092_B11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0032_E12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0100_G01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0039_C10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0012_G10.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0073_H03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0039_B11.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0052_A05.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0027_G06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0096_E03.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCAGCTGCTGGCACTCG
BMWN1_0062_E11.b : CCCTGAGGGCCCTCCTGTGCCTGGGGCTCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0074_F01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0056_E05.b : CACAGAGGGCCAGCCTGTGCCTGGGCCGCTGGTAACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0041_B02.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0085_E06.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0016_F09.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0097_G01.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGGACTCG
BMWN1_0017_B12.b : CCCAGAGGGCCAGCCTGTGCCTGGGGCGCTGGTCACTGTGGCTTCTGCTGCTGGCACTCG
BMWN1_0052_H09.b : CCCAGAAGGCCACCCTGTTGCGGGGGCGCTAGTCACAGTGGCTTCAGCTGCTGGGACTCG
BMWN1_0087_A11.b : aaaagccaacactgtgcctggggacgctggtcactgatggcttctgctgaCTGGGACTCA
BMWN1_0070_B05.b : tttgggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0055_G01.b :
20110601C-000186 : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
---------+---------+---------+---------+---------+---------+ 169
BMWN1_0086_B05.b : TGGTGCCCTCGGCCAGCGCCCATGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0065_A11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0041_H11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0046_F03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTGGGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0037_H03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0037_F10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0099_B07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0059_A09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0087_G11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0089_G05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0040_F12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0036_H12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0088_G05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0030_G11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_E05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0016_F04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0018_B10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0013_G12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_F12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0080_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0096_D04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0010_E03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0021_G08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0008_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0057_F04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0073_A02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_G06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0024_G05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0058_B01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0005_B12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0084_D12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_F02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_H04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0099_E08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_E04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_H05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0090_G05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0074_F02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0012_A09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0090_H02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0018_H10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_G09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0012_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0022_E01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0077_E01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0088_A02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_G02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0097_H08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0020_C01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0011_B10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0020_G02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0075_D01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0093_B07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0066_G03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0007_B05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0065_G11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0086_H10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0055_A03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0024_C07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_C12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0030_G02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0044_B03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0061_B06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0069_G10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0039_D05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0076_C01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_A01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0013_C07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0053_E08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0088_A06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0033_C08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0072_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0085_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0002_H12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0015_G06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0064_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0082_A08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0088_A05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0002_G04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0089_D12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0018_D07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0081_A06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0074_A10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0047_C08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_E03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0070_C01.b : TGGTGCCCTCGGCCAGCGCCCATGC*CCTCAGCTACAGGGAGGCCGTGCTTCCTGCTGTG
BMWN1_0041_D04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_E04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0067_B02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0053_H06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0030_E07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_A03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0046_A02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0046_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0078_A05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0047_A12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0086_C07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0057_A12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0020_A11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0075_D08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0016_C10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0063_E12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0019_D03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0021_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0061_H11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0044_B07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0047_H02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_C08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0056_G01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0001_E04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0041_C12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0031_F12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_D04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_D11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0017_C11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0090_F08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0064_F10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0054_A06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0046_C03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_G11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0072_A10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0068_B06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0007_C09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0020_D11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0036_B10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0037_E04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0071_B05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0097_D05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0017_B03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0003_D01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0069_E06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_E04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0092_D05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0099_A06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0032_D01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0003_C12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0080_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0084_F08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_F01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0067_H03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0064_B01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0065_H08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0043_C11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0093_F03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0080_B12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_F10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0056_A09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0073_G04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_B07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_H10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0036_E02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0046_F04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0041_E05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0048_G12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0066_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0030_B05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0060_A01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0001_D08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0053_A04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0031_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0002_D01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0065_G06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_G07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0030_E03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0035_G03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0031_C01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0037_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0063_D12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0022_D06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0077_D02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0078_D03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0081_F07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0003_E09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0068_D05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0034_G03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0003_F08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0067_F02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0092_A04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0074_G11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0024_C12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0061_H03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0089_F07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0010_D11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0084_E05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0070_F04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_E10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_A12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0009_G09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0001_B08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0066_H07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0082_A09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0032_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0060_A03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0013_B05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0047_E05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_B10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0090_A02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0090_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0083_D03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0009_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0069_D11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0038_B05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0087_G08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0018_H11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0050_G03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0060_F12.b : TGGTGCCCTCGGCCACCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0095_F07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0021_D02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0051_C04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0054_G03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0020_E06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0057_A08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0089_B01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0025_H06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0040_F07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0065_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0067_B01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_A06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0005_H04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0023_A08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0080_F01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_H02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0026_G01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0049_B11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_C11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0023_A12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_E07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0077_E11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCATCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0098_B09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0040_E09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0028_H02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0070_E09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0022_D07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0012_B02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0039_B02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0026_E12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0026_F03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0099_A05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0059_D07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0002_D08.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0058_C10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0003_F12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0010_C11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0091_E12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0056_B04.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0068_B10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0085_H06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0001_A07.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0040_B09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0023_G01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0075_B12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0088_D09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0092_B11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0032_E12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0100_G01.b : TGGTGCCCTCGCCCAGCGCCCAAGATCCTCAGCTACAGGGAGGCCGTGCTTCTCGCTGTG
BMWN1_0039_C10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0012_G10.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0073_H03.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0039_B11.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0052_A05.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0027_G06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0096_E03.b : TGGTGCCCTCGGCCAGCGCCCATGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0062_E11.b : TGGTGCCCTCTGTCAGCGCCCAGGT*CCTCAGCTACTGGGAGGCCGTGCTTCCTGCTGTG
BMWN1_0074_F01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0056_E05.b : TGGTGCCCTCGGCCAGCGCCCAAGC*CCTCACCTACACGGAGGCCGTGCTTCATGCTGTG
BMWN1_0041_B02.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0085_E06.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0016_F09.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0097_G01.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0017_B12.b : TGGTGCCCTCGGCCAGCGCCCAGGC*CCTCAGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0052_H09.b : TGGAGCCATCAGCCAACGCCCAGAC*CCTCTACTACAGGGAGGCCGTGCTTCTTGCTGTG
BMWN1_0087_A11.b : TGGTGCCCTCAGCCAGCGCCCAGGC*CCTCAACTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0070_B05.b : xxxxxxxxxxxxxxxxxxxCCAGGC*CCTCTGCTACAGGGAGGCCGTGCTTCGTGCTGTG
BMWN1_0055_G01.b :
20110601C-000186 : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
---------+---------+---------+---------+---------+---------+ 227
BMWN1_0086_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0065_A11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0041_H11.b : GATCGCC*TCAACGAGCAGTCCTCGGG*GGGTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0046_F03.b : GATCGCC*TCAACNANCACTCCTGGGG*GGCGAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0037_H03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0037_F10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0099_B07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0059_A09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0087_G11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0089_G05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0040_F12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0036_H12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0088_G05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0030_G11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_E05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0016_F04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0018_B10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0013_G12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_F12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0080_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0096_D04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0010_E03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0021_G08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0008_D09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0057_F04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0073_A02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_G06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0024_G05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0058_B01.b : GATCGCC*TCAACGAGCAGTCGTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0005_B12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0084_D12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_F02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_H04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0099_E08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_E04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_H05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0090_G05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0074_F02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0012_A09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0090_H02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0018_H10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_G09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0012_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0022_E01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0077_E01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0088_A02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_G02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0097_H08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0020_C01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0011_B10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0020_G02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0075_D01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0093_B07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0066_G03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0007_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0065_G11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0086_H10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0055_A03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0024_C07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_C12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0030_G02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0044_B03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0061_B06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0069_G10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0039_D05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0076_C01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_A01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0013_C07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0053_E08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0088_A06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0033_C08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0072_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0085_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0002_H12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0015_G06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0064_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0082_A08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0088_A05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0002_G04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0089_D12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0018_D07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0081_A06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0074_A10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0047_C08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_E03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0070_C01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0041_D04.b : GATCGCC*TCAACGAGCAGTCCGGGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_E04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0067_B02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0053_H06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0030_E07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_A03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0046_A02.b : GATCGCC*TCAACGAGCAGTCCGGGGG*GGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0046_D09.b : GATCGCC*TCAACGAGCAGTCCGGGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0078_A05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0047_A12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0086_C07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0057_A12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0020_A11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0075_D08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0016_C10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0063_E12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0019_D03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0021_D09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0061_H11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0044_B07.b : GATCGCC*TCAACGAGCAGTCCTGGGG*GGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0047_H02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_C08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0056_G01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0001_E04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0041_C12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0031_F12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_D04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_D11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0017_C11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0090_F08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0064_F10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0054_A06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0046_C03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_G11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0072_A10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0068_B06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0007_C09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0020_D11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0036_B10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0037_E04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0071_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0097_D05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0017_B03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0003_D01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0069_E06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_E04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0092_D05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0099_A06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0032_D01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0003_C12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0080_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0084_F08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_F01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0067_H03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0064_B01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0065_H08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0043_C11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGGGAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0093_F03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0080_B12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_F10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0056_A09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0073_G04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_B07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_H10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0036_E02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0046_F04.b : GATCGCC*TCAACGAGCAGTCCTCGGG*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0041_E05.b : GATCGCC*TCAACGAGCAGTCCTCGGG*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0048_G12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0066_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0030_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0060_A01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0001_D08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0053_A04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0031_D09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0002_D01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0065_G06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_G07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0030_E03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0035_G03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0031_C01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0037_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0063_D12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0022_D06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0077_D02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0078_D03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0081_F07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0003_E09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0068_D05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0034_G03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0003_F08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0067_F02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0092_A04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0074_G11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0024_C12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0061_H03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0089_F07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0010_D11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0084_E05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0070_F04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_E10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_A12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0009_G09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0001_B08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0066_H07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0082_A09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0032_D09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0060_A03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0013_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0047_E05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_B10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0090_A02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0090_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0083_D03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0009_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0069_D11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0038_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0087_G08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0018_H11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0050_G03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0060_F12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0095_F07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0021_D02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0051_C04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0054_G03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0020_E06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0057_A08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0089_B01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0025_H06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0040_F07.b : GATCGCC*TCAACGAGCAGTCCTCGGAAGCGTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0065_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0067_B01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_A06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0005_H04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0023_A08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0080_F01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_H02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0026_G01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0049_B11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_C11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0023_A12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_E07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0077_E11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0098_B09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0040_E09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*GGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0028_H02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0070_E09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0022_D07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0012_B02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0039_B02.b : GATCGCC*TCAACGAGCAGTCCTCGGAGGGGGGATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0026_E12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0026_F03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0099_A05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0059_D07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0002_D08.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0058_C10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0003_F12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0010_C11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0091_E12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0056_B04.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0068_B10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0085_H06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0001_A07.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0040_B09.b : GATCGCC*TCAGCGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0023_G01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0075_B12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0088_D09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0092_B11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0032_E12.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0100_G01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*ACCTAATCTCAAACGCCTCCTGGAGCTGGACC
BMWN1_0039_C10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCGCTACCGCCTCCTGGAGCTGGACC
BMWN1_0012_G10.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0073_H03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0039_B11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCGGATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0052_A05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0027_G06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0096_E03.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0062_E11.b : GATCGCC*TCAACGAGCATTCCTCGGA*AACTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0074_F01.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0056_E05.b : GATCGCC*TCAACAAGCACTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0041_B02.b : GATCGCC*TCAACGAGCAGTCCTCGGA*GGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0085_E06.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0016_F09.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0097_G01.b : GATCGCC*TCAACGAGCAGGCGTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0017_B12.b : GATCGCC*TNCACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0052_H09.b : GATCGCCATCAACGAGCAGTCCTCGAA*AGCTAATCTCTACCGCCTCCTGGAGCTAGACC
BMWN1_0087_A11.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0070_B05.b : GATCGCC*TCAACGAGCAGTCCTCGGA*AGCTAATCTCTACCGCCTCCTGGAGCTGGACC
BMWN1_0055_G01.b :
20110601C-000186 : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
---------+---------+---------+---------+---------+---------+ 286
BMWN1_0086_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0065_A11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0041_H11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0046_F03.b : AGCCGCCCAAGGCCGACAAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0037_H03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0037_F10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0099_B07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0059_A09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0087_G11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0089_G05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0040_F12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0036_H12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0088_G05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0030_G11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_E05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0016_F04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0018_B10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0013_G12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_F12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0080_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0096_D04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0010_E03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0021_G08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0008_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0057_F04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0073_A02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_G06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0024_G05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0058_B01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0005_B12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0084_D12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_F02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_H04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0099_E08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_E04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_H05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0090_G05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0074_F02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0012_A09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0090_H02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0018_H10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_G09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0012_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0022_E01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0077_E01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0088_A02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_G02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0097_H08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0020_C01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0011_B10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0020_G02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0075_D01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0093_B07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0066_G03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0007_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0065_G11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0086_H10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0055_A03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0024_C07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_C12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0030_G02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0044_B03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0061_B06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0069_G10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0039_D05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0076_C01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_A01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0013_C07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0053_E08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0088_A06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0033_C08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0072_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0085_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0002_H12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0015_G06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0064_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0082_A08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0088_A05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0002_G04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0089_D12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0018_D07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0081_A06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0074_A10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0047_C08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_E03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0070_C01.b : AGCCGCCCAAGGCCGACTAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0041_D04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_E04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0067_B02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0053_H06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0030_E07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_A03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0046_A02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0046_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0078_A05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0047_A12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0086_C07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0057_A12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0020_A11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0075_D08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0016_C10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0063_E12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0019_D03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0021_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0061_H11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0044_B07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0047_H02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_C08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0056_G01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0001_E04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0041_C12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0031_F12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_D04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_D11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0017_C11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0090_F08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0064_F10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0054_A06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0046_C03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_G11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0072_A10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0068_B06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0007_C09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0020_D11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0036_B10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0037_E04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0071_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0097_D05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0017_B03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0003_D01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0069_E06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_E04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0092_D05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0099_A06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0032_D01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0003_C12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0080_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0084_F08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_F01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0067_H03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0064_B01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0065_H08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0043_C11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0093_F03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0080_B12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_F10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0056_A09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0073_G04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_B07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_H10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0036_E02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0046_F04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0041_E05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0048_G12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0066_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0030_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0060_A01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0001_D08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0053_A04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0031_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0002_D01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0065_G06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_G07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0030_E03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0035_G03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0031_C01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0037_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0063_D12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0022_D06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0077_D02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0078_D03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0081_F07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0003_E09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0068_D05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0034_G03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0003_F08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0067_F02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0092_A04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0074_G11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0024_C12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0061_H03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0089_F07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0010_D11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0084_E05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0070_F04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_E10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_A12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0009_G09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0001_B08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0066_H07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0082_A09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0032_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0060_A03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0013_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0047_E05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_B10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0090_A02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0090_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0083_D03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0009_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0069_D11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0038_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0087_G08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0018_H11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0050_G03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0060_F12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0095_F07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0021_D02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0051_C04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0054_G03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0020_E06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0057_A08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0089_B01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0025_H06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0040_F07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0065_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0067_B01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_A06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0005_H04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0023_A08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0080_F01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_H02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0026_G01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0049_B11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_C11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0023_A12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_E07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0077_E11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0098_B09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0040_E09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0028_H02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0070_E09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0022_D07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0012_B02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0039_B02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0026_E12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0026_F03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0099_A05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0059_D07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0002_D08.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0058_C10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0003_F12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0010_C11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0091_E12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0056_B04.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0068_B10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0085_H06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0001_A07.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0040_B09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0023_G01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0075_B12.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0088_D09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0092_B11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0032_E12.b : AGCCGCCCTATGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0100_G01.b : ACCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGCGAGCTTCACGGTGAAA
BMWN1_0039_C10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0012_G10.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0073_H03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0039_B11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0052_A05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0027_G06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0096_E03.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0062_E11.b : AACCGCCCATGGCCGACCAGGACCCG*GGCACCCCGAAATCTGTGAGCTTCACGGTGAAG
BMWN1_0074_F01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0056_E05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGACCTTCACGGTGAAC
BMWN1_0041_B02.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0085_E06.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0016_F09.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0097_G01.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0017_B12.b : AGCCCGCCCANGCCGACGAGGACCCGGGGCACCCCAAAACCTGTGAGCTTCACGGTGAAA
BMWN1_0052_H09.b : AGCCACCCAAGGCCGACTAGGACACT*GGCACCCCTAAACCTGTGAGCTTCACAGTGAAG
BMWN1_0087_A11.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCGAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0070_B05.b : AGCCGCCCAAGGCCGACGAGGACCCG*GGCACCCCAAAACCTGTGAGCTTCACGGTGAAG
BMWN1_0055_G01.b :
20110601C-000186 : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
---------+---------+---------+---------+---------+---------+ 346
BMWN1_0086_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0065_A11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0041_H11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0046_F03.b : GAGACTGTGTGTCCCATGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0037_H03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0037_F10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0099_B07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0059_A09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0087_G11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0089_G05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0040_F12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0036_H12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0088_G05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0030_G11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_E05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0016_F04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0018_B10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0013_G12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_F12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0080_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0096_D04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0010_E03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0021_G08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0008_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0057_F04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0073_A02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_G06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0024_G05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0058_B01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0005_B12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0084_D12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0100_F02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_H04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0099_E08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_E04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_H05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0090_G05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0074_F02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0012_A09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0090_H02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0018_H10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0100_G09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0012_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0022_E01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0077_E01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0088_A02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_G02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0097_H08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0020_C01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0011_B10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0020_G02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0075_D01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0093_B07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0066_G03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0007_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0065_G11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0086_H10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0055_A03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0024_C07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_C12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0030_G02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0044_B03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0061_B06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0069_G10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0039_D05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0076_C01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0100_A01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0013_C07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0053_E08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0088_A06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0033_C08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0072_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0085_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCTCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0002_H12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0015_G06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0064_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0082_A08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0088_A05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0002_G04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0089_D12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0018_D07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0081_A06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0074_A10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0047_C08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_E03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0070_C01.b : GAGACTGTGTGTCCCACGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGACAAC
BMWN1_0041_D04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_E04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0067_B02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0053_H06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0030_E07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_A03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0046_A02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0046_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0078_A05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0047_A12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0086_C07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0057_A12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0020_A11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0075_D08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0016_C10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0063_E12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0019_D03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0021_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0061_H11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0044_B07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0047_H02.b : GAGACTGTGTGTCCCATGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_C08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0056_G01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0001_E04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0041_C12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0031_F12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0100_D04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_D11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0017_C11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0090_F08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0064_F10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0054_A06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0046_C03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_G11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0072_A10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0068_B06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0007_C09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0020_D11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0036_B10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0037_E04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0071_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0097_D05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0017_B03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0003_D01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0069_E06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_E04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0092_D05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0099_A06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0032_D01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0003_C12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0080_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0084_F08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_F01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0067_H03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0064_B01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0065_H08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0043_C11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0093_F03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0080_B12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_F10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0056_A09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0073_G04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_B07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_H10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0036_E02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0046_F04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0041_E05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0048_G12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0066_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0030_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0060_A01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0001_D08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0053_A04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0031_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0002_D01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0065_G06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0100_G07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0030_E03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0035_G03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0031_C01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0037_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0063_D12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0022_D06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0077_D02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0078_D03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0081_F07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0003_E09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0068_D05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0034_G03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0003_F08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0067_F02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0092_A04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0074_G11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0024_C12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0061_H03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0089_F07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0010_D11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0084_E05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0070_F04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_E10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_A12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0009_G09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0001_B08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0066_H07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0082_A09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0032_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0060_A03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0013_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0047_E05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_B10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0090_A02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0090_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0083_D03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0009_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0069_D11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0038_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0087_G08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0018_H11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0050_G03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0060_F12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0095_F07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0021_D02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0051_C04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0054_G03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0020_E06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0057_A08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0089_B01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0025_H06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0040_F07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0065_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0067_B01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_A06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0005_H04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0023_A08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0080_F01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_H02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0026_G01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0049_B11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_C11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0023_A12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_E07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0077_E11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0098_B09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0040_E09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0028_H02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0070_E09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0022_D07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0012_B02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0039_B02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0026_E12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0026_F03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0099_A05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0059_D07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0002_D08.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0058_C10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0003_F12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0010_C11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0091_E12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0056_B04.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0068_B10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0085_H06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0001_A07.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0040_B09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0023_G01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0075_B12.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0088_D09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0092_B11.b : GAGACTGTGTGTCCCATGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0032_E12.b : GAGACTGTGTGTCCCANGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAG*AGAAC
BMWN1_0100_G01.b : GAGACTGTGTGTCCCACGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0039_C10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0012_G10.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0073_H03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0039_B11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTNCAGGAGAAC
BMWN1_0052_A05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0027_G06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0096_E03.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0062_E11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCACCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0074_F01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0056_E05.b : GATACTGTGTGTCCCATGCCGACCCGGCAACCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0041_B02.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0085_E06.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0016_F09.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0097_G01.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0017_B12.b : GAGACTGTGTGTCCCANGCCCGACCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0052_H09.b : GAGACAGTGTGTCCCAGGCCGACCCGGACGCCCCTGGAACTGTGTGACTTCAATGAAAAC
BMWN1_0087_A11.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCTGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0070_B05.b : GAGACTGTGTGTCCCAGGCCGACCCGGCAGCCCCCGGAGCTGTGTGACTTCAAGGAGAAC
BMWN1_0055_G01.b :
20110601C-000186 : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
---------+---------+---------+---------+---------+---------+ 405
BMWN1_0086_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0065_A11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0041_H11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0046_F03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAAATCAAGGACCC*GCTCGA
BMWN1_0037_H03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0037_F10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0099_B07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0059_A09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0087_G11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0089_G05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0040_F12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0036_H12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0088_G05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0030_G11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_E05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0016_F04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0018_B10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0013_G12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_F12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0080_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0096_D04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0010_E03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0021_G08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0008_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0057_F04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0073_A02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_G06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0024_G05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0058_B01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0005_B12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0084_D12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_F02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_H04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0099_E08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_E04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_H05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0090_G05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0074_F02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0012_A09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0090_H02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0018_H10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_G09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0012_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0022_E01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0077_E01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0088_A02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_G02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0097_H08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0020_C01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0011_B10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0020_G02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0075_D01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0093_B07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0066_G03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0007_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0065_G11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0086_H10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0055_A03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0024_C07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_C12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0030_G02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0044_B03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0061_B06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0069_G10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0039_D05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0076_C01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_A01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0013_C07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0053_E08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0088_A06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0033_C08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0072_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0085_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0002_H12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0015_G06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0064_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0082_A08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0088_A05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0002_G04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0089_D12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0018_D07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0081_A06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0074_A10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0047_C08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_E03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0070_C01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGAATCATATCAGGGACCC*GCTCGA
BMWN1_0041_D04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_E04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0067_B02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0053_H06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0030_E07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_A03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0046_A02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0046_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0078_A05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0047_A12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0086_C07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0057_A12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0020_A11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0075_D08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0016_C10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0063_E12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0019_D03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0021_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0061_H11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0044_B07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0047_H02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_C08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0056_G01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0001_E04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0041_C12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0031_F12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_D04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_D11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0017_C11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0090_F08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0064_F10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0054_A06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0046_C03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_G11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0072_A10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0068_B06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0007_C09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0020_D11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0036_B10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0037_E04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0071_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0097_D05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0017_B03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0003_D01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0069_E06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_E04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0092_D05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0099_A06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0032_D01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0003_C12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0080_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0084_F08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_F01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0067_H03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0064_B01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0065_H08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0043_C11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0093_F03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0080_B12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_F10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0056_A09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0073_G04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_B07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_H10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0036_E02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0046_F04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0041_E05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0048_G12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0066_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0030_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0060_A01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0001_D08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0053_A04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0031_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0002_D01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0065_G06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_G07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0030_E03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0035_G03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0031_C01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0037_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0063_D12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0022_D06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0077_D02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0078_D03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0081_F07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0003_E09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0068_D05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0034_G03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0003_F08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0067_F02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0092_A04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0074_G11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0024_C12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0061_H03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0089_F07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0010_D11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0084_E05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0070_F04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_E10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_A12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0009_G09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0001_B08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0066_H07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0082_A09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0032_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0060_A03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0013_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0047_E05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_B10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0090_A02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0090_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0083_D03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0009_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0069_D11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0038_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0087_G08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0018_H11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0050_G03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0060_F12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0095_F07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0021_D02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0051_C04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0054_G03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0020_E06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0057_A08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0089_B01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0025_H06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0040_F07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0065_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0067_B01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_A06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0005_H04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0023_A08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0080_F01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_H02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0026_G01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0049_B11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_C11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0023_A12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_E07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0077_E11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0098_B09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0040_E09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0028_H02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0070_E09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0022_D07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0012_B02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0039_B02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0026_E12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0026_F03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0099_A05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0059_D07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0002_D08.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0058_C10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0003_F12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0010_C11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0091_E12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0056_B04.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0068_B10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0085_H06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0001_A07.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0040_B09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0023_G01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0075_B12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0088_D09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0092_B11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGAATCAGATCAAGGACCC*GCCCGA
BMWN1_0032_E12.b : GGGCGGGTGAAAACGTGTGTGGGGACCGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0100_G01.b : GGGCGGGTGAAACACTGTGTGGGGACAGTCACCCTGGATCAAATCAAGGACCC*GCTCGA
BMWN1_0039_C10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0012_G10.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0073_H03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0039_B11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0052_A05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0027_G06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0096_E03.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0062_E11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATAAAGGACCC*GCTCGA
BMWN1_0074_F01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0056_E05.b : GGGTGGGTGAAACAGTGTGTGGGGACAGTCACCCTGTATCATATCAAGGACCC*GTTCGA
BMWN1_0041_B02.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0085_E06.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0016_F09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0097_G01.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0017_B12.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCTTGGATCAAATCAAGGACCNNGCTCGA
BMWN1_0052_H09.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACTCTGGATCATATCTATGACCC*GCTCTA
BMWN1_0087_A11.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGTATCAGATCAAGGACCC*GCTCGA
BMWN1_0070_B05.b : GGGCGGGTGAAACAGTGTGTGGGGACAGTCACCCTGGATCAGATCAAGGACCC*GCTCGA
BMWN1_0055_G01.b :
20110601C-000186 : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
---------+---------+---------+---------+---------+---------+ 463
BMWN1_0086_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0065_A11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0041_H11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAAGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0046_F03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAAGGGAGGTCGCCTGTGCTATTGTACGCGT
BMWN1_0037_H03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0037_F10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0099_B07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0059_A09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0087_G11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0089_G05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0040_F12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0036_H12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0088_G05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0030_G11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_E05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0016_F04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0018_B10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0013_G12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_F12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0080_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0096_D04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0010_E03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0021_G08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0008_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0057_F04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0073_A02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_G06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0024_G05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0058_B01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0005_B12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0084_D12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0100_F02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_H04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0099_E08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_E04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_H05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0090_G05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0074_F02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0012_A09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0090_H02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0018_H10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0100_G09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0012_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0022_E01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0077_E01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0088_A02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_G02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0097_H08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0020_C01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0011_B10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0020_G02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0075_D01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0093_B07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0066_G03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0007_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0065_G11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0086_H10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0055_A03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0024_C07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_C12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0030_G02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0044_B03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0061_B06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0069_G10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0039_D05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0076_C01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0100_A01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0013_C07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0053_E08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0088_A06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0033_C08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0072_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0085_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0002_H12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0015_G06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0064_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0082_A08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0088_A05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0002_G04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0089_D12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0018_D07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0081_A06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0074_A10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0047_C08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_E03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0070_C01.b : CATCACCTGCAATGAC*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0041_D04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_E04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0067_B02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0053_H06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0030_E07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_A03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0046_A02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0046_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0078_A05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0047_A12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0086_C07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0057_A12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0020_A11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0075_D08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0016_C10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0063_E12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0019_D03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0021_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0061_H11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0044_B07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0047_H02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_C08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0056_G01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0001_E04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0041_C12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0031_F12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0100_D04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_D11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0017_C11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0090_F08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0064_F10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0054_A06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0046_C03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_G11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0072_A10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0068_B06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0007_C09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0020_D11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0036_B10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0037_E04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0071_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0097_D05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0017_B03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0003_D01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0069_E06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_E04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0092_D05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0099_A06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0032_D01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0003_C12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0080_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0084_F08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_F01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0067_H03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0064_B01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0065_H08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0043_C11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0093_F03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0080_B12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_F10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0056_A09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0073_G04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_B07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_H10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0036_E02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0046_F04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0041_E05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0048_G12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0066_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0030_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0060_A01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0001_D08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0053_A04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0031_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0002_D01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0065_G06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0100_G07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0030_E03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0035_G03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0031_C01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAAGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0037_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0063_D12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0022_D06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0077_D02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0078_D03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0081_F07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0003_E09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0068_D05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0034_G03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0003_F08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0067_F02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0092_A04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0074_G11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0024_C12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0061_H03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0089_F07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0010_D11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0084_E05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0070_F04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_E10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_A12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0009_G09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0001_B08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0066_H07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0082_A09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0032_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0060_A03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0013_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0047_E05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_B10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0090_A02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0090_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0083_D03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0009_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0069_D11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0038_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0087_G08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0018_H11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0050_G03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0060_F12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0095_F07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0021_D02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0051_C04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0054_G03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0020_E06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0057_A08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0089_B01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0025_H06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0040_F07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0065_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0067_B01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_A06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0005_H04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0023_A08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0080_F01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_H02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0026_G01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0049_B11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_C11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0023_A12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_E07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0077_E11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0098_B09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0040_E09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0028_H02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0070_E09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0022_D07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0012_B02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0039_B02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0026_E12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0026_F03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0099_A05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0059_D07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0002_D08.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0058_C10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0003_F12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0010_C11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0091_E12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0056_B04.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0068_B10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0085_H06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0001_A07.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0040_B09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0023_G01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0075_B12.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0088_D09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0092_B11.b : AATCACCTGCAATGAA*GTTCA*AAGTGTCAGGAGAGGTCCCCTGTGCTATTGTATGCTT
BMWN1_0032_E12.b : CATCCCCTGCAATtgagttccaagtttcaggggaagtcccccctttctattgtaggccta
BMWN1_0100_G01.b : TATCACCTGCAATGAT*GTTCA*AGGTGTCAAGGGAGGTCGCCTGTGCTACTGCACGCGT
BMWN1_0039_C10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0012_G10.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0073_H03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0039_B11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTANGCGT
BMWN1_0052_A05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0027_G06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0096_E03.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0062_E11.b : CATCACCTGCAATGAGTGTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0074_F01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0056_E05.b : CATCACCTGCAATGAT*GTTCA*AGGTGTCACGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0041_B02.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0085_E06.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0016_F09.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0097_G01.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0017_B12.b : CATCACCTGCAATGAagtttcagggtgtcaggggagggtccccgttctattgaaagccta
BMWN1_0052_H09.b : AATCAACTGCAATGAA*GTACATAGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAAGCGT
BMWN1_0087_A11.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0070_B05.b : CATCACCTGCAATGAG*GTTCA*AGGTGTCAGGGGAGGTCGCCTGTGCTATTGTAGGCGT
BMWN1_0055_G01.b :
20110601C-000186 : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
---------+---------+---------+---------+---------+---------+ 523
BMWN1_0086_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0065_A11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0041_H11.b : AGGTTCTGCGTCTGTGTCCGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0046_F03.b : ATGTTCTGCGTCTGTGTCAGACGAGGATGACGGTTGCGACGGCATGCTTTCCCTCCCCCA
BMWN1_0037_H03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0037_F10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0099_B07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0059_A09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0087_G11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0089_G05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0040_F12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0036_H12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0088_G05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0030_G11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_E05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCNA
BMWN1_0016_F04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCTA
BMWN1_0018_B10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0013_G12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_F12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0080_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0096_D04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0010_E03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0021_G08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0008_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0057_F04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0073_A02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_G06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0024_G05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0058_B01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0005_B12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0084_D12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0100_F02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_H04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0099_E08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_E04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_H05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0090_G05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0074_F02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0012_A09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0090_H02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0018_H10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0100_G09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0012_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0022_E01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0077_E01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0088_A02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_G02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0097_H08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0020_C01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0011_B10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0020_G02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0075_D01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0093_B07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0066_G03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0007_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0065_G11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0086_H10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0055_A03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0024_C07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_C12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0030_G02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0044_B03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0061_B06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0069_G10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0039_D05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0076_C01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0100_A01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0013_C07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0053_E08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0088_A06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0033_C08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0072_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0085_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0002_H12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0015_G06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0064_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0082_A08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0088_A05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0002_G04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0089_D12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0018_D07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0081_A06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0074_A10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0047_C08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_E03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0070_C01.b : ATGTTCTGCGTCTGTGTCTGACTAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0041_D04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_E04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0067_B02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0053_H06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0030_E07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_A03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0046_A02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0046_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0078_A05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0047_A12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0086_C07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0057_A12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0020_A11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0075_D08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0016_C10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0063_E12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0019_D03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0021_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0061_H11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0044_B07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0047_H02.b : AGGTTCTGCGTCTGTGTCAGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_C08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0056_G01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0001_E04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0041_C12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0031_F12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCATGCTTTCCCTCCCCCA
BMWN1_0100_D04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_D11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0017_C11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0090_F08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0064_F10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0054_A06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0046_C03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_G11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0072_A10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0068_B06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0007_C09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0020_D11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0036_B10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0037_E04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0071_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0097_D05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0017_B03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0003_D01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0069_E06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_E04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0092_D05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0099_A06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0032_D01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0003_C12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0080_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0084_F08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_F01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0067_H03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0064_B01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0065_H08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0043_C11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0093_F03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0080_B12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_F10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0056_A09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0073_G04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_B07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_H10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0036_E02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0046_F04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0041_E05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0048_G12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0066_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0030_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0060_A01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0001_D08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0053_A04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0031_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0002_D01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0065_G06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0100_G07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0030_E03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0035_G03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0031_C01.b : ATGTTCTGCGTCTGTGTCAGACGAGGATGACGGTTGCGACGGCATGCTTTCCCTCCCCTA
BMWN1_0037_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0063_D12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0022_D06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0077_D02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0078_D03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0081_F07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0003_E09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0068_D05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0034_G03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0003_F08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0067_F02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0092_A04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0074_G11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0024_C12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0061_H03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0089_F07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0010_D11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0084_E05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0070_F04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_E10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_A12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0009_G09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0001_B08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0066_H07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0082_A09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0032_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0060_A03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0013_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0047_E05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_B10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0090_A02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0090_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0083_D03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0009_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0069_D11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0038_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0087_G08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0018_H11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0050_G03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0060_F12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0095_F07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0021_D02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0051_C04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0054_G03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0020_E06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0057_A08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0089_B01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0025_H06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0040_F07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0065_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0067_B01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_A06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0005_H04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0023_A08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0080_F01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_H02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0026_G01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0049_B11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_C11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0023_A12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_E07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0077_E11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0098_B09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0040_E09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0028_H02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0070_E09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0022_D07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0012_B02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0039_B02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0026_E12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0026_F03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0099_A05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0059_D07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0002_D08.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0058_C10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0003_F12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0010_C11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0091_E12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0056_B04.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0068_B10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0085_H06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0001_A07.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0040_B09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAAGCTTTCCCTCCCCCA
BMWN1_0023_G01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0075_B12.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0088_D09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0092_B11.b : AAGTTCTGCATacgatccatacaaaaaggacgcagccacatctcttttaacctcctagga
BMWN1_0032_E12.b : ggttctgccttcgtttccaaaaaggataaaggttccaaaggagggttttccccccccctt
BMWN1_0100_G01.b : AGGTTCCGCTTCTGTGTCGGACGAGGATGACTGTTGCAACGGCTGGCTTTCCCTCCCCCT
BMWN1_0039_C10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0012_G10.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0073_H03.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0039_B11.b : ANGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTTCCTCCCCCC
BMWN1_0052_A05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0027_G06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0096_E03.b : AGGTTCTGCGTCTGTGTCGGACAAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0062_E11.b : ACGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0074_F01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0056_E05.b : AGGTTCTGCGTCTGTGTCCAACGAGGATGACGGTTGCGACGGCATGCTTTCCCTCCCCCA
BMWN1_0041_B02.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0085_E06.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0016_F09.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0097_G01.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0017_B12.b : agttctccttccggtttccaacaaagaataacgttttccaaggcaaggctttccctcccc
BMWN1_0052_H09.b : AGGTTCTGCGTCTGTGACCGACTACGATGACGGTTGCGACGGCAAGCTTTCCCTCCCCCA
BMWN1_0087_A11.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0070_B05.b : AGGTTCTGCGTCTGTGTCGGACGAGGATGACGGTTGCGACGGCAGGCTTTCCCTCCCCCA
BMWN1_0055_G01.b :
20110601C-000186 : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
---------+---------+---------+---------+---------+---------+ 581
BMWN1_0086_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0065_A11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0041_H11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCCCAATTTTTCCCCCTCCACCTTTCCCGCCCC
BMWN1_0046_F03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0037_H03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0037_F10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0099_B07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0059_A09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0087_G11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0089_G05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0040_F12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0036_H12.b : TTTTTCC*GGGGCCAGGTTT*CCGTCCCCC*ATTTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0088_G05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0030_G11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0091_E05.b : TTTTTCC*GGGGGCAGGTTT*CCGTCCCC**AATTTTTCCGCCTCCACTTTCCNG**CCC
BMWN1_0016_F04.b : NNTTT*CCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTGCCGGCCCC
BMWN1_0018_B10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0013_G12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0062_F12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0080_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0096_D04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0010_E03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0021_G08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0083_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0008_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0057_F04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0073_A02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0050_G06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0024_G05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0058_B01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0005_B12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0084_D12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0100_F02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0050_H04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0099_E08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0062_E04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0050_H05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0090_G05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0074_F02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0012_A09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0090_H02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0018_H10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0100_G09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0012_C04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0022_E01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0077_E01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0088_A02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0028_G02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0097_H08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0020_C01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0011_B10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0020_G02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0075_D01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0093_B07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0066_G03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0007_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0065_G11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0086_H10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0055_A03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0024_C07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0083_C12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0030_G02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0062_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0044_B03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0061_B06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0069_G10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0039_D05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0076_C01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0100_A01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0013_C07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0050_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0053_E08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0088_A06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0033_C08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0072_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0085_C04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0002_H12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0015_G06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0064_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0082_A08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0088_A05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0002_G04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0089_D12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0018_D07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0081_A06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0074_A10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0047_C08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0050_E03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0070_C01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0041_D04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0048_E04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0067_B02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0053_H06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0030_E07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0062_A03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0046_A02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0046_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0078_A05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0047_A12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0086_C07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0057_A12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0020_A11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0075_D08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0016_C10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0063_E12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0019_D03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0021_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0061_H11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0044_B07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0047_H02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0028_C08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0056_G01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0001_E04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0048_C04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0041_C12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0031_F12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0100_D04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0048_D11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0017_C11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0090_F08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0064_F10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0054_A06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0046_C03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0048_G11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0072_A10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0068_B06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0007_C09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0020_D11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0036_B10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0037_E04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0071_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0097_D05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0017_B03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCGNNGCCC
BMWN1_0003_D01.b : ATTTTCCCGGGGTCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCATCTTTCCGGCCCC
BMWN1_0083_C04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0069_E06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0083_E04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0092_D05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0099_A06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0032_D01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0003_C12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0080_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0084_F08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0048_F01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0067_H03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*TATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0064_B01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0065_H08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0043_C11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0093_F03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0080_B12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0028_F10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0056_A09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0073_G04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0062_B07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0083_H10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0036_E02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0046_F04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0041_E05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0048_G12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0066_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0030_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0060_A01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0001_D08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0053_A04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0031_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0002_D01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0065_G06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0100_G07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0030_E03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0035_G03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0031_C01.b : TTTTcccgggccaagttccgtcccctaatttttccgctccacctttcccgcccccacttt
BMWN1_0037_C04.b : ATTTTCCCGGGGCCAGGTTTTCCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0063_D12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0022_D06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0077_D02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0078_D03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0081_F07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0003_E09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0068_D05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0034_G03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0003_F08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0067_F02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0092_A04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0074_G11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0024_C12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0061_H03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0089_F07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0010_D11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0084_E05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0070_F04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0091_E10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0091_A12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0009_G09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0001_B08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0066_H07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0082_A09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0032_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0060_A03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0013_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0047_E05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0062_B10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0090_A02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0090_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0083_D03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0009_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0069_D11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0038_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0087_G08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0018_H11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0050_G03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0060_F12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0095_F07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0021_D02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0051_C04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0054_G03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0020_E06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0057_A08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0089_B01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0025_H06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0040_F07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0065_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0067_B01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0091_A06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0005_H04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0023_A08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0080_F01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0091_H02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0026_G01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0049_B11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0028_C11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0023_A12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0028_E07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0077_E11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0098_B09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0040_E09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0028_H02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0070_E09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0022_D07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0012_B02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0039_B02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0026_E12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0026_F03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0099_A05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0059_D07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0002_D08.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0058_C10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0003_F12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0010_C11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0091_E12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0056_B04.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0068_B10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0085_H06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0001_A07.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0040_B09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCAGCCCG
BMWN1_0023_G01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0075_B12.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0088_D09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0092_B11.b : cttgaataataaaaatattttatctcacccattagcaaatatactaaaccgcaagggccc
BMWN1_0032_E12.b : ttttccggggggccgtttttccttccccatattttttccccccccaccttttggggcccc
BMWN1_0100_G01.b : ATTTTCCCGGGGCCAGGCTT*CCGTCCCCC*AATTTATCCGCCCCCACCTTTCCGGCCCC
BMWN1_0039_C10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0012_G10.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0073_H03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0039_B11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0052_A05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0027_G06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0096_E03.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0062_E11.b : ATTTTCCGGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0074_F01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0056_E05.b : ATTTTCCCGGGGCCAGGTTT*CCCCTCCCC*AATTTTTCCACCTCCACGTTTCCAGCCCG
BMWN1_0041_B02.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0085_E06.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0016_F09.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0097_G01.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0017_B12.b : ccattttccccggggccagggtttcgcccccccaatttttccccccccccttttttcggc
BMWN1_0052_H09.b : ATTATCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCATTCCGGCCCC
BMWN1_0087_A11.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACCTTTCCGGCCCC
BMWN1_0070_B05.b : ATTTTCCCGGGGCCAGGTTT*CCGTCCCCC*AATTTTTCCGCCTCCACGTTTCCGGCCCG
BMWN1_0055_G01.b :
20110601C-000186 : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
---------+---------+---------+---------+---------+---------+ 640
BMWN1_0086_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0065_A11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0041_H11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACCGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0046_F03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTATACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0037_H03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCANGCAACTCACC
BMWN1_0037_F10.b : CACCATT*CGGTCCACCAAGGGTTCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0099_B07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAAGCAACTCACC
BMWN1_0059_A09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0087_G11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0089_G05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0040_F12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0036_H12.b : C*CCATT*CGGTCCACCAAGGT*CCCTGGTAGACGGTGAAGGATTTGCATGCCACTCACC
BMWN1_0088_G05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0030_G11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0091_E05.b : CCACATT*CGGTCCACC*AGGTTTCCTGGTAGACGGTGAggatttggcagcactcaccag
BMWN1_0016_F04.b : CAC*ATT*CGGTCCACCAAGTTCCCCTGGTAGACNGTGAAAGgatttgcagcactcaccc
BMWN1_0018_B10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0013_G12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0062_F12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0080_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCANGCAACTCACC
BMWN1_0096_D04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0010_E03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0021_G08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0083_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0008_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0057_F04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0073_A02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAATGATTTGCATGCAACTCACC
BMWN1_0050_G06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0024_G05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0058_B01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGCCACTCACC
BMWN1_0005_B12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0084_D12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0100_F02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0050_H04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0099_E08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGGGAAGGATTTGCAGGCAACTCACC
BMWN1_0062_E04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0050_H05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0090_G05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0074_F02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0012_A09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0090_H02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0018_H10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0100_G09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0012_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0022_E01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0077_E01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0088_A02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_G02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANGCAACTCACC
BMWN1_0097_H08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0020_C01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0011_B10.b : CCACATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANNGCACTCACC
BMWN1_0020_G02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0075_D01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0093_B07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANGCAACTCACC
BMWN1_0066_G03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0007_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0065_G11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0086_H10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0055_A03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0024_C07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0083_C12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0030_G02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0062_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0044_B03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0061_B06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0069_G10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0039_D05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0076_C01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0100_A01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCANGCAACTCACC
BMWN1_0013_C07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCANGCAACTCACC
BMWN1_0050_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0053_E08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0088_A06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0033_C08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0072_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0085_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0002_H12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0015_G06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0064_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0082_A08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0088_A05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0002_G04.b : CACCATT*CGGTCCACCAAAGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0089_D12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0018_D07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0081_A06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0074_A10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0047_C08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0050_E03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0070_C01.b : CACCATT*CTGTCCACCAATGTTCCCTGGTAGACTGTGAANGATTTGCACGCTACTCACC
BMWN1_0041_D04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_E04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0067_B02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0053_H06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCAGGCAACTCACC
BMWN1_0030_E07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0062_A03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0046_A02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0046_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0078_A05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0047_A12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0086_C07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0057_A12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0020_A11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0075_D08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0016_C10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0063_E12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0019_D03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0021_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0061_H11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0044_B07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0047_H02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_C08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0056_G01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCCACTCACC
BMWN1_0001_E04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0041_C12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0031_F12.b : CACCATT*CTGTCCACCAAGGTCCCTTGGTAAACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0100_D04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_D11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0017_C11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0090_F08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0064_F10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0054_A06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0046_C03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_G11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0072_A10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAATGATTTGCAGGCAACTCACC
BMWN1_0068_B06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANGCAACTCACC
BMWN1_0007_C09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0020_D11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0036_B10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0037_E04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0071_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0097_D05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0017_B03.b : CA*CATT*CGGTCCACCNAGGTTTCCTGGTAGACGGTGAAAGATTTGCAGGCNACTCACC
BMWN1_0003_D01.b : CACCATT*CTGTCCACCAAGGTTTCCTGGTATACGGTGAAAGATTTGCACGCTACTCACC
BMWN1_0083_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0069_E06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0083_E04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0092_D05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0099_A06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0032_D01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCAGGCAACTCACC
BMWN1_0003_C12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0080_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0084_F08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_F01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0067_H03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0064_B01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0065_H08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0043_C11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0093_F03.b : CACCATT*CNGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0080_B12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_F10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0056_A09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGCAACTCACC
BMWN1_0073_G04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGCAACTCACC
BMWN1_0062_B07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0083_H10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0036_E02.b : CACCATT*CGGTCCACCCAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGGCACTCACC
BMWN1_0046_F04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0041_E05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0048_G12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0066_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0030_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANGCAACTCACC
BMWN1_0060_A01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0001_D08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0053_A04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0031_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0002_D01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0065_G06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0100_G07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0030_E03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0035_G03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCANGCAACTCACC
BMWN1_0031_C01.b : cggtccaccaggttccctaggtaaccgtgaatgatttgcttgcaacttccccaaaaggcc
BMWN1_0037_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAAGCAACTCACC
BMWN1_0063_D12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0022_D06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACCGTGAACGATTTGCAGGCAACTCACC
BMWN1_0077_D02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0078_D03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0081_F07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0003_E09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0068_D05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0034_G03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0003_F08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0067_F02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0092_A04.b : CACCATT*CGGTCCACCAAAGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0074_G11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0024_C12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0061_H03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0089_F07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0010_D11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0084_E05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0070_F04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0091_E10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0091_A12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0009_G09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0001_B08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0066_H07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0082_A09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0032_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0060_A03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0013_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0047_E05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0062_B10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0090_A02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0090_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0083_D03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0009_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0069_D11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0038_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0087_G08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0018_H11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0050_G03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0060_F12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGCAACTCACC
BMWN1_0095_F07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0021_D02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0051_C04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0054_G03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCANGCAACTCACC
BMWN1_0020_E06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0057_A08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0089_B01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0025_H06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0040_F07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0065_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0067_B01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCAGGCAACTCACC
BMWN1_0091_A06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0005_H04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0023_A08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0080_F01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAANGATTTGCAGGCAACTCACC
BMWN1_0091_H02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0026_G01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAAGATTTGCAGGCAACTCACC
BMWN1_0049_B11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_C11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0023_A12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_E07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0077_E11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0098_B09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0040_E09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0028_H02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0070_E09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0022_D07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0012_B02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0039_B02.b : CACCATT*CGGTCCACCA*GGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0026_E12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0026_F03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0099_A05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0059_D07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0002_D08.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0058_C10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0003_F12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0010_C11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0091_E12.b : CACCATT*CGGTCCACCAAAGTTCCCTGGTAGACNGTGAAGGATTTGCANNGCACTCACC
BMWN1_0056_B04.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0068_B10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0085_H06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0001_A07.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0040_B09.b : CACCATT*CGGTCCACCCAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0023_G01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0075_B12.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0088_D09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0092_B11.b : atgattgtaatcaataatatttctcaactataataaaaaaaaaaaatagtttacaaagat
BMWN1_0032_E12.b : cactttttggtccccccaagtttcctggttaaaggggaagggtttttccggcaccccccc
BMWN1_0100_G01.b : CACCATTACAGTCCACTAAGGTTCCCTGGTAAACCGTGAAGGATTggctgcaactcatca
BMWN1_0039_C10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0012_G10.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0073_H03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0039_B11.b : CACCATT*CGGTCCACCAAAGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0052_A05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANGCAACTCACC
BMWN1_0027_G06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0096_E03.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAAGCAACTCACC
BMWN1_0062_E11.b : CACCAAT*CGGTCCACCAATGTTCCCTGGCAGACGGTGAATGATTTGCAGGCAACTCACC
BMWN1_0074_F01.b : CACCTTT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAATGATTTGCAGGCAACTCACC
BMWN1_0056_E05.b : CACCATT*CGGTCCAACAATGTTTCCTGGTAGACGGTGAATGATTTGCAGGCAACCCACC
BMWN1_0041_B02.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0085_E06.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0016_F09.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0097_G01.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCANNGCACTCACC
BMWN1_0017_B12.b : cccacccttttggtcccccaaagggttccctgggtaaaagggtaaggatttttcggggaa
BMWN1_0052_H09.b : CACCATT*CGGTCCACATAAGTTCCCTGGTAGACGGTGAAGGATTTGCTTGCTACTCGCC
BMWN1_0087_A11.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0070_B05.b : CACCATT*CGGTCCACCAAGGTTCCCTGGTAGACGGTGAAGGATTTGCAGGCAACTCACC
BMWN1_0055_G01.b : naagccgagagtaagaxx
20110601C-000186 : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
---------+---------+---------+---------+---------+---------+ 696
BMWN1_0086_B05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0065_A11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0041_H11.b : CAAAAGGCCTTT*CCGTACATTAAAATCCCAG*CAAGGAGACCTAAAGCATCTGCTTT*G
BMWN1_0046_F03.b : CAGAAGGCCTTT*CGGTACATTAAAATTCCCA*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0037_H03.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*NCATCTGCTTT*G
BMWN1_0037_F10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0099_B07.b : CAGAAGGCCTTC*CGGTACATTAAAATCCCAG*CAAGGAGACCTAAGCATCTTGCTTT*G
BMWN1_0059_A09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0087_G11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0089_G05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0040_F12.b : CAGAAGGCCTTT*CNGTACATTAAAATCCCAG*CAAGGAGACCCTA*GCATCTGCTTT*G
BMWN1_0036_H12.b : CAAAAAGCCCTT*TCGTACATTAAAATCCCCGCCAAGgaaacctaaaccttttgcttttg
BMWN1_0088_G05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0030_G11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0091_E05.b : aaggcttccgtacataaatcccaacaggagacctagctctgcttgcccagcccgctctgt
BMWN1_0016_F04.b : agaaggctttcngtacattaaaatccagcaagagacctaacatctgcttgcccaggccgc
BMWN1_0018_B10.b : CAGAAGGCCTTT*CGGTACATTTAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0013_G12.b : CAGAAGGCCTTT*CGGTACATTAAAATNNCCA*GCAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0062_F12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0080_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0096_D04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0010_E03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0021_G08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0083_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0008_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0057_F04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0073_A02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0050_G06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0024_G05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0058_B01.b : CAGAAGGCCTTT*CCGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0005_B12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0084_D12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0100_F02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCNTA*GCATCTGCTTT*G
BMWN1_0050_H04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0099_E08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCCG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0062_E04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0050_H05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0090_G05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0074_F02.b : CAGAAGGCCTTT*CGGTACTTTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0012_A09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0090_H02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0018_H10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0100_G09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0012_C04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0022_E01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0077_E01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0088_A02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_G02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0097_H08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0020_C01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0011_B10.b : CAGAAGGCC*TT*CGGTACATTAAA*TCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0020_G02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0075_D01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0093_B07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0066_G03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0007_B05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0065_G11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0086_H10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0055_A03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0024_C07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0083_C12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0030_G02.b : CAGAAGGCC*TT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0062_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0044_B03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0061_B06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0069_G10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0039_D05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0076_C01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0100_A01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0013_C07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0050_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0053_E08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0088_A06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0033_C08.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0072_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0085_C04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0002_H12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0015_G06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0064_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0082_A08.b : CAGAATGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0088_A05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0002_G04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAAACCTAA*GCATCTGCTTT*G
BMWN1_0089_D12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0018_D07.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0081_A06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0074_A10.b : CAGAAGGCCTTT*CNGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0047_C08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0050_E03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0070_C01.b : CTGAGCGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0041_D04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCCA*GCAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_E04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0067_B02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0053_H06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0030_E07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0062_A03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0046_A02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0046_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0078_A05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0047_A12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0086_C07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0057_A12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0020_A11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0075_D08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0016_C10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0063_E12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0019_D03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0021_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0061_H11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0044_B07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0047_H02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_C08.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0056_G01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0001_E04.b : CAGAAGGCCTTT*CNGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_C04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0041_C12.b : CAGAAGGCCTTT*CNGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0031_F12.b : CAGAAAGCCTTT*CGGTAACTTAAAATCCCAA*CAAGGAGACCTAAACATTTTGCTTT*T
BMWN1_0100_D04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_D11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0017_C11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0090_F08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0064_F10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0054_A06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0046_C03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_G11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0072_A10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0068_B06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0007_C09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0020_D11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0036_B10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0037_E04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAA*CAAAGAGACCTAA*ACATCTGCTTT*G
BMWN1_0071_B05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0097_D05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0017_B03.b : CAGAAGGCTTTT*CG*TACATTAAAaatccagcagggagactagcatctgctttgcccag
BMWN1_0003_D01.b : CAGAAGGCCTTTTCGGTTCATTAACATCCCAGCAGGGAAGACCTAA*TCATCTGCTTT*G
BMWN1_0083_C04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0069_E06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0083_E04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0092_D05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0099_A06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCCAGCAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0032_D01.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0003_C12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0080_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0084_F08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_F01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0067_H03.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0064_B01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0065_H08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0043_C11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0093_F03.b : CAGAAGGCCTTT*CGGTACATTAAA*TCCCAG*CAAGGAGAACTAA*GCATCTGCTTT*G
BMWN1_0080_B12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_F10.b : CAGAAGGCCTTT*CGGTACATTNAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0056_A09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0073_G04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAA*CAAGGAGACCTAA*ACATCTGCTTTTG
BMWN1_0062_B07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0083_H10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0036_E02.b : CCGAAGGCCTTT*CGGTACATTAAAATCCCCG*CAAGGAAACCTAA*CCATCTGCTTT*G
BMWN1_0046_F04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0041_E05.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0048_G12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0066_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0030_B05.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0060_A01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0001_D08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0053_A04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0031_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0002_D01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0065_G06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0100_G07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0030_E03.b : CAAAAGGC*TTT*CGGTACATTAAAATCCCA**CAAGGAAACCTAA*GCATCTGCTTT*G
BMWN1_0035_G03.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0031_C01.b : ttccgttaattataacccagcaagggaaccttaactttttctttgccaagacccgcttct
BMWN1_0037_C04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0063_D12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0022_D06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAT*CAAGGAGACCTAT*GCATCTGCTTT*G
BMWN1_0077_D02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0078_D03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0081_F07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0003_E09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0068_D05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0034_G03.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0003_F08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0067_F02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0092_A04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*T
BMWN1_0074_G11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0024_C12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0061_H03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0089_F07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0010_D11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0084_E05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0070_F04.b : CAGAACGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0091_E10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0091_A12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0009_G09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0001_B08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0066_H07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0082_A09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0032_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0060_A03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0013_B05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0047_E05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0062_B10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0090_A02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0090_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0083_D03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0009_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0069_D11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0038_B05.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0087_G08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0018_H11.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*N
BMWN1_0050_G03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0060_F12.b : CAGAAGGCCTTT*CGGTACATAAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0095_F07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0021_D02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0051_C04.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0054_G03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0020_E06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0057_A08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0089_B01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0025_H06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0040_F07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0065_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0067_B01.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGAACTAA*GCATCTGCTTT*G
BMWN1_0091_A06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0005_H04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0023_A08.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0080_F01.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAGGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0091_H02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0026_G01.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCCTA*GCATCTGCTTT*T
BMWN1_0049_B11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_C11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0023_A12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_E07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0077_E11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0098_B09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0040_E09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0028_H02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0070_E09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0022_D07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0012_B02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0039_B02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0026_E12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0026_F03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0099_A05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0059_D07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0002_D08.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0058_C10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0003_F12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0010_C11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0091_E12.b : CAAAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*ACATCTGCTTT*T
BMWN1_0056_B04.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0068_B10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0085_H06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0001_A07.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0040_B09.b : CAGAAGGCCTTT*CCGTAAATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0023_G01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0075_B12.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0088_D09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0092_B11.b : agctcccgcgaatttatctaaacactaaatatatgtatacaaaattccatactcccttag
BMWN1_0032_E12.b : ccaaagggccttttgtttattttaatccccccgcaaggaaaaacttaattttcttttttt
BMWN1_0100_G01.b : aaaaggcttttcagacaattataaccccgcaaggaaaccttaacatcggctttgccttag
BMWN1_0039_C10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0012_G10.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0073_H03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0039_B11.b : CAGA*GGCCTTT*CGGTACATTAAAATCCCAG*CAGGGAAAC*TAA*CCATCTGCTTT*G
BMWN1_0052_A05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0027_G06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0096_E03.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCCTA*ACATCTGCTTT*T
BMWN1_0062_E11.b : CCagaacgcctttcctgtcattaaaaccccaccaggagacctaagaatctgcttttcccc
BMWN1_0074_F01.b : CAAAAGGCCTTT*CGGTACATT*AAATCCCAG*CAAGGAGAACTAA*GCATCTGCTTT*G
BMWN1_0056_E05.b : ACGAAGGCCTTT*CGGTACATTATAAACCCAGCCAGGGAGACCTAA*CCATCTGCTTT*G
BMWN1_0041_B02.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0085_E06.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0016_F09.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0097_G01.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCCTA*GCATCTGCTTT*G
BMWN1_0017_B12.b : cccccccccaaagggccttttttgtatcttataaaccccccccgagggaaaacaaaaaaa
BMWN1_0052_H09.b : CAGAAAGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0087_A11.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0070_B05.b : CAGAAGGCCTTT*CGGTACATTAAAATCCCAG*CAAGGAGACCTAA*GCATCTGCTTT*G
BMWN1_0055_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAA*GCATCTGCTTT*G
20110601C-000186 : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 754
BMWN1_0086_B05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAtttatacatatatatatt
BMWN1_0065_A11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCcnncatatacaagaaaata
BMWN1_0041_H11.b : CCCCGGCCCC*CTTCTGTCAAAATAATT*TCTtgtgaaccccgatatacatccataaaaa
BMWN1_0046_F03.b : CCCAGTCCCCCCATCTGTTaaataatttcttgttgacccctataaatcatatattttttt
BMWN1_0037_H03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTtganccnnnnnnaanannaaaaaann
BMWN1_0037_F10.b : CCCAGG**CCGCATCTGTCAAATAAA*T*CTTGTGAAACAAAn
BMWN1_0099_B07.b : CCCAG**CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCnccnaataaataaaataat
BMWN1_0059_A09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAA
BMWN1_0087_G11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAANCCANATAATAAAAAAAAAtat
BMWN1_0089_G05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0040_F12.b : CCCCGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCNNNaaaaaaaaaaaaaaaa
BMWN1_0036_H12.b : cccagccccgcatctgttcaaattaatttcttgttaaaccccctttaatattattaaata
BMWN1_0088_G05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0030_G11.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGaaaacaaaaaaaaaaaaaaaaaaa
BMWN1_0091_E05.b : aataaatctgtgaaccaaaaaaaaaaa
BMWN1_0016_F04.b : atctgtcaataatcttgtgaacaaaaaaaaaaaaaaaaa
BMWN1_0018_B10.b : CCCCAGCCCCGCATCTGTCAAATAATTT*CTTGgtgaacccnnnaaccttcccaaaataa
BMWN1_0013_G12.b : GCCAGG*CCCGCATCTGTCNAATAAATTTCTTGTGAaccnaaaaaaaa
BMWN1_0062_F12.b : CCCAGG*CCCGCATCTGTCAAATAAAT**CTTGTGAAACCnnnnnnaannnananaanna
BMWN1_0080_G07.b : CCCAGG*CCCGCATCTGTCAAAATAATT*TCTGTGAAACAActtcnnnnnnnnnnnnnnn
BMWN1_0096_D04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_E03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTNGAACCnnnnnanannnnnnnnnnnn
BMWN1_0021_G08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnaaannnnnnanaaan
BMWN1_0083_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnnnannannaaanaaa
BMWN1_0008_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCn
BMWN1_0057_F04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCnnnnnxxxxxxxxxxxxxx
BMWN1_0073_A02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGGAACCCnnnnntatnttaatgagga
BMWN1_0050_G06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAA
BMWN1_0024_G05.b : CCCAGG*CCCGCATCTGTCAAAT*AATT*CTTGTGAAACAAAA
BMWN1_0058_B01.b : CCCACG*CCCCCATCTGTCAAATTAATT*CTTGTGACACCTAAAAtaatatttcatcatt
BMWN1_0005_B12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAA
BMWN1_0084_D12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0100_F02.b : CC*AGG*CCCGCATCTGTCAAATA*ATT*CTTGTGAAACAAAAAAA
BMWN1_0050_H04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0099_E08.b : CCCCAG*CCCGCATCTGTCAAATAATTT*CTTGTGAAACCCAAAAAAAAAtacattttct
BMWN1_0062_E04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0050_H05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0090_G05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0074_F02.b : CCCAGG*CCCGCATCTGTCAAATTAATT*CTTGTGAAACCAcccnnnnnnnaaaaataan
BMWN1_0012_A09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0090_H02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0018_H10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAA
BMWN1_0100_G09.b : CCCAGG*CCCGCATCTGTCNAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0012_C04.b : CCCAGG*CCCGCATCTGTCNAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0022_E01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAATAAAAAA
BMWN1_0077_E01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAA
BMWN1_0088_A02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0028_G02.b : CCCAGG*CCCGCATCTGTCAAATA*ATT*CTTGTGAAACAAAAAAAAAAAAAA
BMWN1_0097_H08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0020_C01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0011_B10.b : GCCANG*CCCGCATCTGTCAAATAATTT*C*TGTGAAACAAAAAAAAAAAAAA
BMWN1_0020_G02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0075_D01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0093_B07.b : C*CAGG*CCCGCATCTGTCAAATAATTT*C*TGTGAAACAAAAAAAAAAAAA
BMWN1_0066_G03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0007_B05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0065_G11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0086_H10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0055_A03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0024_C07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTTCAAAAAAA
BMWN1_0083_C12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0030_G02.b : GCCAGG*CCCGCTTCTGTCAAATAAATT*CTTGTGAACCAAAAAAAAAAAAAAAA
BMWN1_0062_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAA
BMWN1_0044_B03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0061_B06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTTCCAAANANAAAAtaa
BMWN1_0069_G10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAnnnnnnnnnnnnnnnnnn
BMWN1_0039_D05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAACAAAAAAAA
BMWN1_0076_C01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAA
BMWN1_0100_A01.b : CC*AGG*CCCGCATCTGTCAAATAAATT*C*TGTGAAAACAAAAAAn
BMWN1_0013_C07.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAGAAAAAAAAAAA
BMWN1_0050_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAA
BMWN1_0053_E08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAAAAAAA
BMWN1_0088_A06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0033_C08.b : CCCAGG*CCCGCATCTGTCAAATA*ATT*CTTGTGAAACCAAAAA
BMWN1_0072_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGNAACCAAAAAAAAAAAAAAAAA
BMWN1_0085_C04.b : CCCATG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0002_H12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0015_G06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0064_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAAAAAAAAA
BMWN1_0082_A08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAACaaaaaaaaaaaaata
BMWN1_0088_A05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0002_G04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGGAACCCAAAAAAAAAAAAAAGAAAc
BMWN1_0089_D12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAAA
BMWN1_0018_D07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAA
BMWN1_0081_A06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAA
BMWN1_0074_A10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNannaaaaaaaaaataaaat
BMWN1_0047_C08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0050_E03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0070_C01.b : CCCANG*CCCGCATCTGTCAAATA*ATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0041_D04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNNNaaaannaaaaaaaa
BMWN1_0048_E04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAA
BMWN1_0067_B02.b : CCCAGG*GCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0053_H06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0030_E07.b : GCCCAG*CCCGCATCTGTCAAAT*AATT*CTTGTGaaacaaaaaaaaaaaaaaaaaaaaa
BMWN1_0062_A03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNAAAAAAAAAAATAAAAAAC
BMWN1_0046_A02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNannaaaaaaaaaaaanana
BMWN1_0046_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNGNNNaanaaaaaaaaaaaa
BMWN1_0078_A05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0047_A12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTNGAACCNaaaaaaaaaaaaaaaaaaa
BMWN1_0086_C07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAANCCNNNNNaaaannnnaaaaaaa
BMWN1_0057_A12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNACTTCCAAAAAAAAAAAAA
BMWN1_0020_A11.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNaaaaanaaaaaaaaaaa
BMWN1_0075_D08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNaaaaaaaaaataataa
BMWN1_0016_C10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0063_E12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0019_D03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0021_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaananannannaaaaaaa
BMWN1_0061_H11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTNGAAACAAAAAAAAAAAAAAAAA
BMWN1_0044_B07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAACaaaaaanaaaaaaaaa
BMWN1_0047_H02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNannannnaaaaaaaaaaaa
BMWN1_0028_C08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNACTTCAAAAAAAAAAA
BMWN1_0056_G01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAACCAAAAA
BMWN1_0001_E04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaannaaaaaaaaanaaaaaa
BMWN1_0048_C04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0041_C12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0031_F12.b : GCCCACGCCCCCCTCTTTCAAATAAATT*CTTGTGaaacccaattaaattaaaataaaaa
BMWN1_0100_D04.b : CCCANG*CCCGCATCTGTCAAATAAATTCTTTGTGAAccnnnnnnnnnnnnnnnnnnnnn
BMWN1_0048_D11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0017_C11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0090_F08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0064_F10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACAAAAA
BMWN1_0054_A06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAGCAAAAAAAAAAAAA
BMWN1_0046_C03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTTCAAAAAAAAAAAA
BMWN1_0048_G11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAA
BMWN1_0072_A10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0068_B06.b : NCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0007_C09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0020_D11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGNAACCNNNNanaaaaaaaaaaaaaa
BMWN1_0036_B10.b : CCCAGG*CCCGCATCTGTCAAATAAATTCTTGGTGAANCCaanaanaaaaaanaaaaana
BMWN1_0037_E04.b : CCCAGG*CCCGCATCTGTCAAAATAAAT*CTTGTGAAACCCNNNNaaaaaaaaaaaaaaa
BMWN1_0071_B05.b : NCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTNGAACCaaaaaaaaaaaattaaaaaa
BMWN1_0097_D05.b : CCCAG**CCCGCATCTGTCNAATAAATT*CTTGTGAANCCnnnnnnnnnnnnnnnnnnnn
BMWN1_0017_B03.b : cccgatctgtcaaataattctgtgaaaacaaaaaaaaaa
BMWN1_0003_D01.b : CCCAGG*CCCTCCTCTGTCAAATAAATT*CTTGTGGAAtccgattcacattatttaaaca
BMWN1_0083_C04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnannnnnnnnnnnnnnnnnn
BMWN1_0069_E06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAn
BMWN1_0083_E04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnnnannnnnnnnnnnn
BMWN1_0092_D05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaannanannnnnannaaana
BMWN1_0099_A06.b : CCCAGG*CCCCCATCTGTCAAATAA*TT*CTTGTGAACCCataaaataaattacaatatt
BMWN1_0032_D01.b : CCCAGG*CCCGCATCTGTCAAATAAA*T*CTTGTGAAACAAAAA
BMWN1_0003_C12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAA
BMWN1_0080_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAACAAAAAAA
BMWN1_0084_F08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0048_F01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0067_H03.b : CCCCAG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAACGGNaaaaataaaaaatataa
BMWN1_0064_B01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0065_H08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0043_C11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAA
BMWN1_0093_F03.b : CCCAGG*CCCGCATCTGTCAAATAAATC*C*TGTGAAACAAA
BMWN1_0080_B12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0028_F10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAA
BMWN1_0056_A09.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAAAACAAAAATAATAAcca
BMWN1_0073_G04.b : CCCAAG*CCCGCATCTGTCAAATAAATT*CTTGTGGAACCCAANANAAAAATATAAAAAg
BMWN1_0062_B07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAA
BMWN1_0083_H10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCTTAAAAAAAAAAAAAAA
BMWN1_0036_E02.b : GCCCAGGCCCCCATCTGTCAAATAAATT*CTTGTGAAACCCNNNNAAAATAAATAAAAta
BMWN1_0046_F04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTTCCaaannaaaaaaaa
BMWN1_0041_E05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCNNNNAAAAGTANAAAAAAA
BMWN1_0048_G12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0066_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAA
BMWN1_0030_B05.b : CCAGG**CCCGCATCTGTCAAATAAATT*CTTGTGAAACCTACTTCAAAAAAAAAAAAAA
BMWN1_0060_A01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNNaaanaaaaanaaaaa
BMWN1_0001_D08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNAAAANANANAANNAAA
BMWN1_0053_A04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0031_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCANAAAAAAAAAAAAAAAAG
BMWN1_0002_D01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNAAAAANNAAAAAAAAAAAN
BMWN1_0065_G06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0100_G07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0030_E03.b : CCCAG**CCCGCATTTGTCAAATAAATT*CTTGTGAAACCCAncttaattactatatatt
BMWN1_0035_G03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0031_C01.b : gcaaaaaaattcttggtgaccccataaattcattatttataaataaaaatataaaattta
BMWN1_0037_C04.b : CCCAAGCCCCGCATCTGTCAAATTAATTTCTTGTGgaacctacatatattaataaaaatt
BMWN1_0063_D12.b : CCCAGG*CCCGCATCTGTCAAATAATTT*CTTGTGAcccccnnnaaaaattgataagcac
BMWN1_0022_D06.b : CCCAAG*CCCGCATCTGTCAAATTAATT*CCTGTGAAACCCAtgataacttcaaatataa
BMWN1_0077_D02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnaaannnnnnnannnn
BMWN1_0078_D03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnanannnnnnnnnnnn
BMWN1_0081_F07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAnnnnnannnnnnnnnnnna
BMWN1_0003_E09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnnnnnnnnnnaannnn
BMWN1_0068_D05.b : CCCAGG*CCCGCATCTGTCAA*TAAATT*CTTGTGAAACCnnnnnnanntnnanananaa
BMWN1_0034_G03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCnnnnnnaaannnnnnnann
BMWN1_0003_F08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCnnnnnanannnnnnnanann
BMWN1_0067_F02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaatntatatataaaatatat
BMWN1_0092_A04.b : CCCCAG*CCCGCATCTGTCAAATAAATT*CTTGTTGAACCcccaatataaacattaagca
BMWN1_0074_G11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAA
BMWN1_0024_C12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0061_H03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAA
BMWN1_0089_F07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAA
BMWN1_0010_D11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0084_E05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAtgtgtgatcac
BMWN1_0070_F04.b : CCCANG*CCCGCATCTGTCAAAT*AATT*CTTGTGAAACCaanaaaaaatttcaatatta
BMWN1_0091_E10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAA
BMWN1_0091_A12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0009_G09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACAAAAA
BMWN1_0001_B08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCACaaaaaaaatactaaaatt
BMWN1_0066_H07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAA
BMWN1_0082_A09.b : CCCA*G*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0032_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAA
BMWN1_0060_A03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0013_B05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAA
BMWN1_0047_E05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0062_B10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0090_A02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0090_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0083_D03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0009_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAA
BMWN1_0069_D11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTCAAAAAAA
BMWN1_0038_B05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAAAAAn
BMWN1_0087_G08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNANNAATAAAAAATAatacc
BMWN1_0018_H11.b : GCCAGG*CCCGCATCTGTCANNATAATT*CTTTGTGAACCAAAAAAAAAAAA
BMWN1_0050_G03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAA
BMWN1_0060_F12.b : CCCAAG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAGAATAAAAAcatgaaac
BMWN1_0095_F07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0021_D02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0051_C04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0054_G03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAA
BMWN1_0020_E06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0057_A08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0089_B01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0025_H06.b : CCCAGG*CCCGCATCTGTCNAATAAATT*CTTGTGNAACCAAAAAAAAAAAAAAAAA
BMWN1_0040_F07.b : CCCAGG*CCCGCATCTGTCAAATA*ATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0065_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAA
BMWN1_0067_B01.b : CCCAGG*CCCGCATCTGTCAAATAAATC*TTTGTGAAACAAAAAAAAAAAAAAA
BMWN1_0091_A06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAGAAAAAAAAAAAcaagag
BMWN1_0005_H04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNANNNATAAAAACATAAAct
BMWN1_0023_A08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAACAAAAAAAAAAAAAAA
BMWN1_0080_F01.b : CCCAGC*CCCGCATCTGTCAAATAAATC*CT*GTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0091_H02.b : CCCAGG*CCCGCATCTGTCAAATAAAT**CTTGTGAAACCAAAAAAAAAAAAAAAAA
BMWN1_0026_G01.b : GCCAGG*CCCGCATCTGTCAAAATAATT*CTTGTGAAACNAAAAAAAAAAAAAAAAAA
BMWN1_0049_B11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAA
BMWN1_0028_C11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAA
BMWN1_0023_A12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAAAAA
BMWN1_0028_E07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAACTTCAAAAAAAAAAAAAA
BMWN1_0077_E11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAANGNAAAAAATATAAAAg
BMWN1_0098_B09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNaaaaaaaaaaaaaaaaa
BMWN1_0040_E09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGGAACCNNNNanaaaaaaaaaaaaaa
BMWN1_0028_H02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0070_E09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNANNNaaaaaaaataaaaaa
BMWN1_0022_D07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0012_B02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNNaaaaaaaaaaaaata
BMWN1_0039_B02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAACCCCNNaaaaaaaaaaaaaaaaa
BMWN1_0026_E12.b : CCCAGG*CCCGCATCTGTCAAAATAATT*CTTGTNGAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0026_F03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0099_A05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0059_D07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGGAACCNNNNNNanannnaaaaaana
BMWN1_0002_D08.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNannnaaanannaanaaaaa
BMWN1_0058_C10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaannnnaanaannaaaaaaa
BMWN1_0003_F12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0010_C11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0091_E12.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0056_B04.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0068_B10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNaaaaaaaaaaaaaaaaaaa
BMWN1_0085_H06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaataaaaa
BMWN1_0001_A07.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNNaaaanaaaaaaaaaa
BMWN1_0040_B09.b : CCCAAG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAAAAAAAAAAAAAAAAcat
BMWN1_0023_G01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNaaaaaaaaaaaaaaaaaaa
BMWN1_0075_B12.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCNNNNaaanaaaaaaaaaaaa
BMWN1_0088_D09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0092_B11.b : aaaattattaggatatatccttttataacacaatttttatttataataaaatttatcaat
BMWN1_0032_E12.b : cccccgccccccctttttaaaaaaaattctgttgtggaccccccaaaaaaaaaaaaaaaa
BMWN1_0100_G01.b : tccgcatctgttaaaaaattcttggtgaaccaaacaataacaactttaaaaattcttaca
BMWN1_0039_C10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAAACAAAAAAAAAAn
BMWN1_0012_G10.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAA
BMWN1_0073_H03.b : CCCAG**CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAAA
BMWN1_0039_B11.b : CCCAGG*CCCGCATCTGTCAAATAAATC*C*TGTGAAACCAAAAA
BMWN1_0052_A05.b : CCCANG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACAAAAAAAAAAAAAAAA
BMWN1_0027_G06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCaaaaaaaaaaaaaaaaaaaa
BMWN1_0096_E03.b : GCCAGG*CCCGCATCTGTCAAATAATTT*CTTGTGAAACCCATTAAAAAAAtcctccttt
BMWN1_0062_E11.b : agccccccttctgtcaaataatttcttgtgaaacctatccaccatatatataaattcatc
BMWN1_0074_F01.b : CCCTG**CCCGCATCTGTCAAATAATTT*CTTGTGAAACCTgtgacaattcttattaaat
BMWN1_0056_E05.b : CCCAAG*ACCGCATCTGTCAAATAAATT*CTTGTGAAACCCCATAAAAAttacaataaat
BMWN1_0041_B02.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCCAANANNAAAATATAAAAca
BMWN1_0085_E06.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAA
BMWN1_0016_F09.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAA
BMWN1_0097_G01.b : CCCAGG*CCCGCATCTGTCAAATA*ATT*CTTGTGAACCAAAAAAAAAAAAAAAAAA
BMWN1_0017_B12.b : ttttttttttttctcccccccccccccctcttttaaaaaaaaattttcttttgagaaacc
BMWN1_0052_H09.b : CCCAAG*CCCGCATCTGTCATATAAATT*CTTGTTAAACCCttggggaggtttattgatt
BMWN1_0087_A11.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAANCCnnnnnnnnnngnanannnnn
BMWN1_0070_B05.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAA
BMWN1_0055_G01.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGAAACCAAAAAAAAAAAAAAAA
20110601C-000186 : AAAAAAA.....................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aaaatcttagaactgaaaccttaattcaccctctgatattcagatcattgagtcatttcc
BMWN1_0065_A11.b : aaacattttcattcaactttaagtccttttttttcttggcctcccggcctttcttttccc
BMWN1_0041_H11.b : ctttaaacttttaatcacacacacaaatcccttcacaccgccacccacctcgcggcgaaa
BMWN1_0046_F03.b : aattcatttaaaattataatatgttccctctcccccttatccctcttagcgaattttaat
BMWN1_0037_H03.b : aaaaaaaanaaaannaaaannnaaananaannnnnnnnnnnnggnannnnnnaaaaaaan
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : gatctatatatatataatatactttttttccgggcgccgggcactccctttggttggctt
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : ctcaaataaaaaaatgtccccggcccccggtaccccctttgaggggggaatctccccccc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : aaaaanaannannnnannaaannaaannnaaaannnnnnnnnnnnnnnnnccccnccccc
BMWN1_0036_H12.b : taatataataattacttaatctgaattctctctattatcatattacttctacacaatctt
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : ccacataaaacaaatatttttcccttttttctcccngtggnccccggcctcccttttttg
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : nnannnnnnannnnnnnnnaannnnnannnnnnnnnaaaannnnnnnnnnnnccccccnn
BMWN1_0080_G07.b : nnnnnnnnnnnnnnnnnnnnnnnaanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_E03.b : nnnanaanaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : nnaaaaaaanaaaaaantttnnnnggggcccgaatcccccntatctcacgnttaattggg
BMWN1_0083_A07.b : aaaaaaaaaaaaaaaaaaaanaaanaaaaaaaaatannnaaanaaaaannnnaanaaaaa
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : tataagaaaaacaatggtaaataataaaaatttaagcctctcaagcgtccacggccccac
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : ttcctcacacccttcacatcattgtttctctttccccgcttctcacttctcctcaaccac
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : gacaatcatgacttctatacttatttactaccatcgatttcctagcgcgccgcggaacca
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : aaataaaaaaaannnaaaannnnnntnaananntaaananttatnnttnnttnnntttta
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : attaccaacttaaaaaattttatttttttcctctctctcacctatatcaatttctttttg
BMWN1_0069_G10.b : nnnnnnnccnnnnnaaaannaaaaaaaaaaaaanannannnnannnnnnnnnnnnnnnnn
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : taattaacattttttgttgatttatttttttacttttttatttttaccggggccgggatt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : actatagtagatggtatgagaaagaatgataagaggaagcgtagattttcccccggcccc
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : taaaaannannaanaaataatataaattaatatatcatttaatttttttttgccggggcc
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aaaaaaaaanannaaaaannnnnnanannnnnaaggcggggaaacncccnaaaaaaaagg
BMWN1_0048_E04.b :
BMWN1_0067_B02.b : a
BMWN1_0053_H06.b : aaaaaaaaaaaaaaaaaaaaannnnnanaannnnnannnnnnnnnnnnnnnnnaanannn
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : AAAttattctactatccttttttgtttcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aaaaaaagaagaaaagaaaaantttnggggggcccccgagcgcccgttaggggggggtga
BMWN1_0046_D09.b : aaaaannaaaaaannnnaanaaaannaanaannnnannnannnnaaaaggtcccgggccc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b : aaa
BMWN1_0086_C07.b : aaaaaaaaaaaaaaaantxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0057_A12.b : AAA
BMWN1_0020_A11.b : aaaaataataaaatatnannaaaaaaaaaaatnnaaannannnccnngcctcccgcggtg
BMWN1_0075_D08.b : aaaataattatataaatanacaatattaaatttaattatattttttattagttttaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b : a
BMWN1_0019_D03.b : aaaa
BMWN1_0021_D09.b : aaaaaaaaaaaaaannaaaaaaananaaanaaaaaaaaaaaaaannaannaaananaaaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aaaaaaanaaaaaaaaaaaaanaaaaaaannaaannnnggtaccccggccgccgatctcc
BMWN1_0047_H02.b : aaaannaaaaaaanaaaaannnnnaaaaaaannnnnannnnaaaaaannnnannccnaaa
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ctatcaccctaacaaaaattttaattacccgggcccgcgaattccccttttggggagggt
BMWN1_0001_E04.b : aaaanaattaaannanannaaagtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b : a
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : atttaactaatattaacaattactacttagatctgtatcttattactcacattccttttc
BMWN1_0100_D04.b : annnnnnnnnnnnnnnnnnnnnnnaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : aaaaaaaaaaaaaaaaaaaaattaccncggacccaggttnccccttcgcggggggtcaat
BMWN1_0036_B10.b : aaaaaaaaaaaaaaaaaaannnnnnnnnggttccccgggcccggatttcccctttggggg
BMWN1_0037_E04.b : aaaagaaaaaggaagagnaaagngaaangannaagaaaannaaagttcccccgccgccgt
BMWN1_0071_B05.b : aaaaaaaaaa
BMWN1_0097_D05.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : aactattacataaatatacccccatcattttaacacttttattcctccttttcccccccc
BMWN1_0083_C04.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaatnnnccn
BMWN1_0092_D05.b : naaaaanaaananaaaaaannnnaaannaannnaannaaaantttnnaanncctcccgct
BMWN1_0099_A06.b : taattatatattggtacttatttatattgttcccgggggccggtaatccctttaatgaag
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : taaatatcttatttaataattaattatctacttctatctatattttttttttccgggggc
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : tacacacactacaccattaaattcgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : atgaatatacttgtaaatcaacatatatttattgtcccggggcgcggaatctccctttgg
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : acaatagttattgtacatttaataaagcttttctagtctccttcctctctcgctcccccc
BMWN1_0046_F04.b : aannaaaaaaaaaaaaaaaaaaanaaaaaannnnnnnaaxxxxxxxxxxxxxxxxxxxxx
BMWN1_0041_E05.b : Acacnaaaaacacaaagaaaacgaaaaaaaanaggnaaaaacnnncgcccccgcgcccag
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : aaaaaaaaaaaaaanaaaaaaaaaannnnnnnnnnnnnnnnnnnnnngggaccccccccc
BMWN1_0001_D08.b : AAAaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : AAggaaaacnaagatncgnnaaccaatgcgggtagggaacagaaagaatccgtgaagttt
BMWN1_0002_D01.b : AAAA
BMWN1_0065_G06.b : aaaa
BMWN1_0100_G07.b : aaaaaaaaaaaaanattatannannttatnnttatnttntattttttttccccgggcccc
BMWN1_0030_E03.b : aaatcaacttttataaaatataataagttttaattttccttctgccctttcccccccttc
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : tctaacaaattttttttatctccattacttattcccatcattcatctgctctcttctctt
BMWN1_0037_C04.b : tacattattatttttttattttattcattataacttatatttttcccggttggcccgcta
BMWN1_0063_D12.b : caatatctccgaaccatacaaatattttcattttttcttctcccccctttttttttctgt
BMWN1_0022_D06.b : cactaataccccaattccgagtctaacctactataaccttatctttcccccgcccgcgta
BMWN1_0077_D02.b : nannnnnannnnnaaannnnnnnnnnnnnnnnaannnnnnnnnnnnnnggggaaaatnna
BMWN1_0078_D03.b : nnnnnnnnnnnnnnnnntnnnnnaagctacgaagccccgtatctgcctttaatgtgggtt
BMWN1_0081_F07.b : naanannnnannnnaaaannnannnnnnnnnnnnaannaaaaaaanaatagtcccgcgcc
BMWN1_0003_E09.b : nannannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccggggccg
BMWN1_0068_D05.b : aaaaataaaaattaatttaaaatttnaaaattttttttatttttcggaagtcaatattca
BMWN1_0034_G03.b : nnannannnnnnnntannnnnngcccgcgatccccccttnnnggaggtttattggttccc
BMWN1_0003_F08.b : nnaaaaananannannnnnngtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : aaatatttaataataattttccgcggccgcgatctccctttattgagggttattggatcc
BMWN1_0092_A04.b : acgaataaaaatatgataaactacaaaaagtggcagatacatatatccccaattcaatat
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ttcaaatactattttgaaagaataataactttcccccgcccgcgaatctccttttaatga
BMWN1_0070_F04.b : aaatttaataaacaaattttaaatatttgtcccccggccgcgaatcccctttaggggggg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : aaataattattattttattcttgttcctaccccctgctccctaacctaatatttgttggg
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : aaatataancctcagaattcccttagtcttgaagaggtcccgacccttcccttttgttaa
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : taagcattattcaaactcgacccctccggagaccctactaattgctaattatttggtttt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b : a
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : aaacacgggaagtataggtagaagtgaattgttgttgcgagcgggagtcccacaatgata
BMWN1_0005_H04.b : aattaaattttttcaaatcgttattattttaacttatttttttttcgctccgcccccgcg
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : aacaaanaaaaannggaaacaaangnaatttnaaanntttatgtttccgggggccxxxxx
BMWN1_0098_B09.b : aaannanaaanannnnttnnnagggcggcgaatttccctttttggggggggttggatccc
BMWN1_0040_E09.b : aaaaaaatananaaannaaangangttcccgcgggccgcggatctccctttggcggggtt
BMWN1_0028_H02.b : a
BMWN1_0070_E09.b : aatataatatattttaaattaaattattattatttttttttttttattttttttttcccg
BMWN1_0022_D07.b : aaa
BMWN1_0012_B02.b : aaaanaaaaaaaaaaatanttnnnnaaaannnnnnnnnnnnnnnnnattatttttttttg
BMWN1_0039_B02.b : aaaacnaacaacgacaccaaacaacaccacaccccaaaaagttccggggcccccgattcc
BMWN1_0026_E12.b : aa
BMWN1_0026_F03.b : aa
BMWN1_0099_A05.b : a
BMWN1_0059_D07.b : aaaaaaaaaaaaaaaaaaaataaaaaagaaaaggtgccgggccacgaactttccttgggg
BMWN1_0002_D08.b : aaaaanaaannaaannnananaaaanaanaaaaaaaaanggcccnnnnatcccccnnaaa
BMWN1_0058_C10.b : aaaaaaaaaaaaanaaaaaaaannnanannnnnnannnnnnnnnnnnncccccnccccaa
BMWN1_0003_F12.b : aa
BMWN1_0010_C11.b : aa
BMWN1_0091_E12.b : aa
BMWN1_0056_B04.b : aaaa
BMWN1_0068_B10.b : aaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaa
BMWN1_0085_H06.b : aaaaa
BMWN1_0001_A07.b : aaaaaaaaaaaaanaannnnanaaaanannnaaannnnannnaaannaannaannnnnnn
BMWN1_0040_B09.b : agaataaaacctcataactatctagatatctaccaatctcctaatgaccaaataattaag
BMWN1_0023_G01.b : aaaaa
BMWN1_0075_B12.b : aaaaaaananaaaannnnaaaaaaaannaannnanaannannnnnnnnannnnnnnnccc
BMWN1_0088_D09.b : aa
BMWN1_0092_B11.b : gaatacaacttttaataaaaagaatcattcccagtactctttaaatatcttttaatgaga
BMWN1_0032_E12.b : aaaaat
BMWN1_0100_G01.b : atcttcaaatcatttatccaaaaaaatcaaactttcccccataaagataccttacacaca
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tcattcatccaaaaaaaataaattttacttatcttccgggcgggtgggcgccccccccta
BMWN1_0062_E11.b : tctttaatttacacataatttatcctctatttcgcttggatttatttattcatgtttatt
BMWN1_0074_F01.b : ttactaatatgaatcctctattattttataaaatttaaaattttatttgatatgtgtccc
BMWN1_0056_E05.b : cataaaccatctattccttctataatccaaaattataatacctatattgtttcccggccc
BMWN1_0041_B02.b : cacatatttctgcctttctctttcttacccttctcttcgatctatagtgttcccccggcc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b : cccaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BMWN1_0052_H09.b : ccaaaaatattaacatattgttataattgggatccccctcccactgaggtcttaaaaaaa
BMWN1_0087_A11.b : naannaaancnnaaaaaaaaaaaaaggcccctttcttttttctcgggggagggggtttgt
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aatttatttgtttctgggtgccgaattccctattttggggggtcaatttgctcccaaatt
BMWN1_0065_A11.b : tcttggggttggtttatttgctcccctccccccttaattttttgttgaggacggaaaaac
BMWN1_0041_H11.b : aaccccggccccctagcccacgttaccgtccattaccaagtcgtttactgtctacctcat
BMWN1_0046_F03.b : tctcccttcctcctacaaccctcttcgatctaggtagactgctcataacttaattaaaca
BMWN1_0037_H03.b : aaannnataatgggcgcggccgcaaacccctttgttaggggtgattttccccccaaaaaa
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : ttttggctcccaaaatgaaaaaaacttttatgggtttgactaacccccccaaaagccgat
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cgctcaaaaaaaccatttattttgttgggggaacctcccctccaagtgattgaaaaaaaa
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : cccctcaaacgggggtttattttgataaaataaaaaaaaaaaattgagtaatctggacaa
BMWN1_0036_H12.b : tttgtttgttgcgcgggccgggtattttcttttttggggggtgttttttcgctcccccaa
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : taatttatgtttcggtggcccccccctgaatccctttttggaatttatatcgacccccca
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ncccgggtaanagattctcagaaaaaaaaaaaaaaccaaatttgggatatccccacccca
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : tccccccgcccccaaattcattgaggagttgggtaattccgccccaacaatggcaagaaa
BMWN1_0083_A07.b : nnnnnnnnnnnnnnnnnccccccccccccaccacaaactcaataatgagagggcctcgca
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : acctctccggcccatttataacatatcaattggatttatttttaaaaatgaatatacatt
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : acactcttatatgcccgctgctccctttcccccctgattgggggtccactctactctcat
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : ccttttctcgtggattcccctcctcccccactttaaaaagtttaatgagatctaaccatc
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : atatcccggggcgggattccccttttgggggggtaattggcccccaaaagaaaaaaaatt
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : gccccccgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : nnnnnnnnnnngggaccgcgccccgaatttcctttgggggggtttttggccccaaaaaaa
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tcccctttggggagggttattgggtcccaaaccgaaaaaaatacttgagggagttgggac
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : cgaattccctttatggggggtaatttgttccccaacctaagaaaacctttttggattttg
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ggcgatctccctttagggggggttttttgttcccaaacaataaaaaatctttgtagagtt
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : ttttttccccccgccccgcattccccctttggggggttttgttggcccccaacataaaaa
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : nnnggtggggggcgcgggaatccccttttgtgggggttttttgttcccccccaataaaaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : ttggttccctcccagcaaaataaattggtgggtttgggacaaccacccccaaagggcggg
BMWN1_0046_D09.b : cggaatttccttttggggggttattgggtcccaaatgaaaaaacacttgggtgattggga
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : tcggaccggcgcccatcatttccttttttggggggtcattggttccacgccttgaaaaaa
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : nagctttttttgtggtgtggggcggcgcccccttttctggcgtggaggggggtgcccaca
BMWN1_0075_D08.b : ttgtcccccgcgcccggtattcctttttggggggttatttccccccacttaaaaaaattc
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaannnaaaaacccccccgcccgccccttcctttggggggggttatttccccccaacaaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : ctttagggaggggtaattggatcccgacctgaaaaaaacattggtgagtgggaccacccc
BMWN1_0047_H02.b : naaattnnnnnaagggaatgtataaatttacaagnacatttttaacttttttttttcttt
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ttatttgcttccaaactggaaaaaaacattttgttgatttgggaccaaccccccccttca
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : ataatttttattctatatatataaatatttacatctaatctgctcacataatttttatta
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : ttcaccctaaaaggaagaaaatgcggcccggagttggaaaaaccaattggttggattcgg
BMWN1_0036_B10.b : gggttatttgatatccaaatggaaaggaccccttgatttttttgggaaaaaccccatttt
BMWN1_0037_E04.b : attccctttagggaggttaattggatcccaaactaaaaaaaaactttgtttattttgaca
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ctcctctattttttttgctcttttcactcctctcctcccattttccttcttctttgtatt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : nnnnnnnngattatttnnatnttgaggtaaaaaaaacctttaatgaatgggaaaaaagaa
BMWN1_0092_D05.b : ccccctttccccttttattgggtctaataatcaaaaaaaaaaaaatatttggaaaatcca
BMWN1_0099_A06.b : gttaattttataccaaaattataaaatatccttagatttgggaaatacccactttttaat
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : cgcaaattcctttttgggggggtattttgaacccccactgaataaaaaactgtgttgatt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : gggggtttaattggatcccaaactgaaaaaaatctttgttgattttgggacaactcccac
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : attatttttttatgatgcggggcggcggattcccttttgggtggggttaatttgtgcccc
BMWN1_0046_F04.b : xxggggggggtcatgggttccctaagggggaggatattggatcagtttgaaaaacaccct
BMWN1_0041_E05.b : ggtacccgtgtggggcggttgacatgtaatcaaatttgctgtccccccccgcctctcttt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : cggagacccctttttggggcgtaacttgaaatcaaaacttgtaaaattcggaaaacattt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : tcccgggcccaaaaatcctcctttttgtggggggttattggtttttagaagtggataaaa
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : aaattcccctttgggggggtttttgggttcccaatttaaaaaaaccttggttggtttgga
BMWN1_0030_E03.b : atacatcttatagatgtttcccggcgggccatttcctttttaggggggtttttttcctcc
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : cctattactcttttatatagttgataatcctatctaaatctatatattttgattctttac
BMWN1_0037_C04.b : atttccttttttaattagtattatttggctcctcaccacgataatttcccttttagcggt
BMWN1_0063_D12.b : tttttttttttcctcgggcacgcaaccctttttatggggggtaattcgacccacatttta
BMWN1_0022_D06.b : ctccccttaggggtgggtatttcgtctccgcctcgaaaacaacttttggtgagtcgggac
BMWN1_0077_D02.b : aanaaaaaaggagggggcccggccccattctcctttaaggggggttgttgggcccccaaa
BMWN1_0078_D03.b : aattggattccaaaatgattggatacgttggggaatttcggaccaccacggctaggaagg
BMWN1_0081_F07.b : cccgaattccctttttgggggggttaattggactccaaacagaaaaaaaactttgtggtg
BMWN1_0003_E09.b : gggatcccccttttcggagggttaatgggccccccgcttgaaaaaataatttgtgagttt
BMWN1_0068_D05.b : cttacatattttttttccgggccccgcggtctcctttgtgggggggttttgggcccccac
BMWN1_0034_G03.b : ggaccggaaataccctttgaagaagttgaaaaagcccccccccggaagcattaaattaat
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : aaactgaaaaaatacttggatgaattgggacaacccccaattgaatgcatggaaaaaatc
BMWN1_0092_A04.b : tgagttcccgtcgcccgacccccccttgggagggtttattccccacacagtaataaaatt
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : gggttaatgggatccaaaaacgaaaaaaatacttgaagaatttggaccaacccaatctaa
BMWN1_0070_F04.b : taattgatccaaaatgataaaaaccttgaggtatttggacaaccccaaactaagggatgg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : gggcgcgggaatcctattttagtggggttaatttgattcgaacaccaaaacaaaaacttt
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : ggaataacgttaattagactctaaatagtatcaatcattatccaaaatttggcacgccct
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : cccgggcccgaaatctcctttttgggggtgtaattggacccaccaaataaaaaaaaattt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : tgttagttgcccgcccccgcgtttccccttaagggggggttttgggctcccaaaagaaaa
BMWN1_0005_H04.b : catttccctttggtgggggttaattttatcccacccagattgaaatcttttgtgaattcg
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : ccttagtggggttatttgctgactaacttgaaaaaacactggtgggtgtggaaaaaaacc
BMWN1_0040_E09.b : tatttgcatccctatagagagggttccttggccgattttggacacaaacagggggaattc
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ggcgcgggaattccttttaggggggtgtaattgtcccaaacataaaaaaaaacctttttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : tccggggcccggttttccctttttgggggttttattggcccccaaagaaaaaaaactttt
BMWN1_0039_B02.b : cccttttgggggggttaattggtctccaaccgaaaaaaatccttggaggattttggacca
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : ggaggttgattggacccaaactgaaaaaatcctttgttgaggttggacaaccccaacttg
BMWN1_0002_D08.b : aaggtttaatggggtcgtaacttgattaaaaaggttaataatttttgacaaatttaaaaa
BMWN1_0058_C10.b : cacccccccccaagaacaccaaaacaccacaaaccccccccccccccccccccccccctc
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : nggtgcgccggggcgcgggtacccccttgggggggtggtttgaaacaaaagctaaaattg
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_B09.b : tttcccgcgcgccgcaattcctccctttaagggggagttaagtttctgccaactaaaaaa
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : ccccccgcccgtaatttggttttatgggggctaaattgaatcaaaaacttgaaaaatttt
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : ttactaccgactcaatataattagacagtattatctccaatataaacctcaacatacgca
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : gggattttttcccaactcctcttaatatttttaggtattacatatcaactattaaaatta
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tttttattgaatagaaaataataatttttattaggagcctcccccccacccctttttttt
BMWN1_0062_E11.b : cacttaccttctctcttctaaccaccatcatttatatttcccggctaaactacacaagtt
BMWN1_0074_F01.b : ggggcagcgattctcccttttggggggggttttttcgctccccaataaaaaaatatcttg
BMWN1_0056_E05.b : gccaaatttcctttttggattgctaaattgaactccacacgaaaaaaactcctttattat
BMWN1_0041_B02.b : cggaatcccccctttagggagggttaattggttcccaaactgaaaaaaaacctttgataa
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : cattttttatttgtgaccgtcgccccccttttcttttttttggaaggtttttagccgaaa
BMWN1_0087_A11.b : ttttaccgggggggggatttttttttttgggggggtgggggtggccccaaaataaaaagg
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aaactacatactttttggtttgggacaacccacctttatttcccgtaaaaacaactcttt
BMWN1_0065_A11.b : catacctaaattaaaatgttatatccctacacttggaaatctgagggacttttttataac
BMWN1_0041_H11.b : actaccaacattaccaaggtcgcgctgtgcaacaaccccacaactacaatccaagggaca
BMWN1_0046_F03.b : attcctttttataaatcccgacaccaattgttatttgccaaacaatatcccatattaaaa
BMWN1_0037_H03.b : aaaaaaactttgtggtgtgttggcaccacccccgcagagtggggggaaaaaaagtttttt
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : taaaaacgctatatataaaatttttgtatgctctcctttcttaaacttatcaacacccaa
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cctttcttggaaaaaaaaaaaaaagatttcttttttttgtaaaattttacaacgccctaa
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : acaccccgctaaaaacagggaaaaaggggatcaatgggattctggtgtacctttccctct
BMWN1_0036_H12.b : aaaaaaaataatttttgagtttttggcccacccacaccccatataatgggtaaaaaaaaa
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : aactaaaaatcctttttaattggaccccccccccattggctgagtaaaaaaaactttttt
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : aagtagggaaaaaaaagacattgttaaatgggaagtggtgggttttttttctcaccccac
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagctgcataaaaaattaa
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : aggatggttttatggcctaatttgggaaagttggggcgtaatttttcttttttaacccta
BMWN1_0083_A07.b : cacacacaaccattataaaattttaagcttccccacaacccatttaaagttgagaacacc
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : taaaattacaaaaaaaacaccaataatatgcatctcatctgctttttaataattttaaat
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : acaaataaaaaatattgcccctttttgccaacactccctcctctactgcccttaaacaac
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : aactcaaattattccgatgaaaaataacatttatttaatacctagaagcataatctttta
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : tgttgttttggaaaaccccacttgattggctgaaaaaaagtcttttttgtgaaaatttga
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : aaaaaattttgggttgggacaccccacccgaagggggaaaaaaatgttttttttggaaat
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : acaccccaacttaaaggcgggaaaaaaaggtctttttggaaaaattggggaacctttggt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gaaacaccacaattaaaagcggtaaaaaaatgctttttttttaaaattttgtaaccctgt
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ggaccacccccccataaatgcgggaaaaaaatgcttttttgtaaaatttggaaccctttc
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aatcttgggggggtggggaacaccccaccattggaggggggagaaaaaatgttttttttt
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaatttttgatggttggaaaacaccccttttattggggggaaaaaaacctctttttggaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aaaaaaggctatattgtggaaatatgagggcgttgttttattttttaccataaagcccgg
BMWN1_0046_D09.b : cacccccccctaaaaggcgggaaaaatgtgtttttgggaaatttgggggctttgctttat
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttttttttgtggaattcccccgcctttgctttttaaaaaaattcttattttgaaaatg
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : gacaaaaaaaaaaaagagatgtttgggggatatgcaccaccccagggggaagaggagtga
BMWN1_0075_D08.b : ttttaggtttgtggcaacccccccttaatggggtgaaaaaaacttttttttttgaaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaaaaatctttgtgggtttagaacaccccactaaaagggaaaaaaaaatgctttttttaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aactcgaaggcaaggaaaaaaagctttttttggaaaattggaaagccttggctttatttg
BMWN1_0047_H02.b : ttttccccacctccttttagaaagcaaaaaaaagactccctttgaaaaaagtacttccca
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : agtggcggaaaaaaaagtccttttttttgagaaattttggaggctcttttctttttttgg
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : atatacatcataaaatatacaaacatattattttcatccactatttgatatacttactta
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : ccacaaaccaaactataaatgacaaaaagaaggtgctttatacctaacttgaaaccgata
BMWN1_0036_B10.b : taatggccaaaaaaaaaaaagtttttttttggaaaatttgggaagcccctctccttattt
BMWN1_0037_E04.b : aaccccccctaaaattcgggtgaaaaaagtcctttttttaaaatttttgaaccctttgct
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : tttacacttcaccccttccgtatataactatttcaactccctttaaccccccattttctt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : aaatttggagaaatgaaaaaagggtggtttgggaaaaattgtaatgtttggatttgaaaa
BMWN1_0092_D05.b : acaacacagtaaaaaaaaagggaaaatgggtaaattttggaaattttggagatttttcct
BMWN1_0099_A06.b : gccaaaaaaaaaagcttttttttgaaatttgggctacctttctttttttaactcataacc
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tgacacacccccaccatatatcgggaaaaaaaatccctattttgataaattgggaaacgt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : ttagaatgcagggaaaaaaggctttatttgaaaaattggggatgccttgtttttttttga
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : accaaaaaacaaaattttttttgtttgtaaaaaccccccatattttggcggagaaaaaag
BMWN1_0046_F04.b : tgagggttggaaaaaacaccttttttgggaaaaagaaagtctttgtttttatttaccata
BMWN1_0041_E05.b : ttttaagggggggattttcagtgccccaaaagaaaatgttttctttgtggaagcttggaa
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : gggaaaaccccatccaaaaaggcgtttaaaaaatgaaattttttagaaatctggtttatt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : aaccccgaggaattttgaacccacccctaattggttggggttaacaaaaattgctctttt
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : aaacccccactttaattggggaaaaaaagggctttttggaaaattggggagcttttgcct
BMWN1_0030_E03.b : ccaaaaaaaaaaaaacacttgtgtgagtgagaacccaccacaattttcgttctgaaaaac
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : atctcttatatcccatatcttttactattcgtatttattttttatattactctatatctt
BMWN1_0037_C04.b : gttgggtgactctcacccctaaaatgcataatgaatatagttttttttccttctaaattg
BMWN1_0063_D12.b : caaattcatgttgaacttgcacccacactttatatatagggtgtaaaaaccctttttttt
BMWN1_0022_D06.b : accccaaactacattgccctaaaaaacatgcttatccgataattcgcgaccctctctttt
BMWN1_0077_D02.b : acaaaatatatttttgaaaattgggggcccccttcctttaagggcgagaaaaaacttttt
BMWN1_0078_D03.b : aatgaaaaaatgcttaaatttgggaagttgtgaagcattggtttctttgtaaccttcaaa
BMWN1_0081_F07.b : tttggaaaacccccccctaataggctggaaaaaatcgttttttttgaaaaattggagggc
BMWN1_0003_E09.b : gggaacacccaaacagaaattcttggaaaaaatgctttaatctgacaattggaaacccat
BMWN1_0068_D05.b : accataaattattttgtgatgtggggcccccctccactataagaggaaaaaaaatgtttt
BMWN1_0034_G03.b : ggtttttgaagaaaaatttgaaaggccttggcgttattttgaccttttttaaacttccta
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : gcttttttggaaattttggaggcattggtttattttaaccctttaaaccgccaaaaaaat
BMWN1_0092_A04.b : tatattgtttcgccaaaccaaattatagcgtggaaaaagtcttattttaaaaatatatcc
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : atggcccggaaaaattgccttatttgggaaattgggaagcaatgctttttttgaacccat
BMWN1_0070_F04.b : aaaaaatgctttttttggaaatttgggaggcattgttttaattgaaaccttaaaagccgc
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : ctttttttgggccaacccacactataattgaaatgaaaaataagcttttctttttaattt
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : tggctcttcgaaccaaaataacgttatagacttttttctctttcgacattttgtttaccc
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : gttaatttgggacaaccccatttaagaatcctcgaaaaaaaagcctttttttgaaaaatt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : ataatattggtggttgtgggaacacccaaacatgcggagggaaaaaaagtgtttttttgg
BMWN1_0005_H04.b : gacccaccacacctagatggaagggaaaattgcctccttgggaattttggtagctattgc
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : cctttattgaaataaaaaaagccttttttttatattttctaagaaaaccgcttttatcaa
BMWN1_0040_E09.b : ggggacaaaacaccttaaatgtggaataaggggggccctcttctttttttagcaattaaa
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : gtttgggaaaacccaccttttatttgccgaaaaaaaagtttctttttaaaaaattggaac
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : gtgggtttgaaaaacccccttttttgggggtaaaaactttttttttttaaaaatttggaa
BMWN1_0039_B02.b : cccccaccagaaaggcgtggaaaaattgccttttttggaaatttgggaggcccttggttt
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : aattgaaagaaaaaatgcttttttagtaaattgggagcccttgcttttttcaaccctaca
BMWN1_0002_D08.b : aacggcggtgaaaagaagcctaaaaaaggaatttttgaaaaaaattgctttttttaaatt
BMWN1_0058_C10.b : taaaaacaaccaaaatcttccccaaaaacaaacatcttttttttttttattggcccccct
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : ccatgtttgggttgcgacaccctattttgaacggtagaaacagcagtttttttttaaaat
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : xxxxxxxxxxxxxxxxxxxxxxxccccttaaggcgggaaaaaaggcttttttttaaaatt
BMWN1_0040_B09.b : aaaaaactatgtgaaagtttggggaaaaacccccacatataaaatgctttaacaaaaata
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : gaaaaaccttgcaaaaaacccaagaaaaaaaacggggaaaaaagggctttttttgggaaa
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aaataaaaaaaacaaaatataatatcagtattgtaacacaaaccatattcaccttaaaaa
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : taaaaaaatttgtttcactttaatattggctactatactatattccaactaatcagcacc
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : atatttcaatgcatatcaaaaaaaaaaaaaatataaatttcttttctctccaaattattt
BMWN1_0062_E11.b : tcgtttaatcgcatatatctttattcataatgctttcacaataagcaccatctattcatt
BMWN1_0074_F01.b : tatgagttagaaacccccacacttgatggggtgaaaaaaatgtctttttttaaaatttgg
BMWN1_0056_E05.b : ttggcacaaccccccatctaatacaccgtaacaaattcctatttttcaaatatttgatct
BMWN1_0041_B02.b : gtttgggaaaaccccccacctaaaagggcgggaaaaaaaagccttttttttggaaatttt
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : aaaaaaataaaaaactgagtatgggtttatatataaccccaaataaaggggaagtaaaaa
BMWN1_0087_A11.b : gtttggttgaacttccccccaacccccaaagtgggggggggaaaaaatattttttttttt
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : ttttggacatttctcatcttcttttttttctttttaaccctttcaaccccttcaaataaa
BMWN1_0065_A11.b : ctttcctattccactatggaagtaaaaaatttacaacttacatttctttttcctacatct
BMWN1_0041_H11.b : cttactcccccctcctcacaaaaatcggccaaccaactcgcgactacctactaacacaat
BMWN1_0046_F03.b : ttttaaaattaacttttaattaatcaataatcccctcaaaaaaattcaaacaaatttctt
BMWN1_0037_H03.b : tttttaaaaaagttgagcactctgctttttaaaaaccccatttaccccccataaaaaaat
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : aaaatttaataaaagaatccctcctttttttttcaaatcggggggggggagggttttttt
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : aaaatacaaacccccaaagggccccccctttcgttttttgctttctcggcgcaagttggg
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : attgcaccccctacaccccccattaacacaataaaaaaaccacttccttttctttttctt
BMWN1_0036_H12.b : aacctctttttttataaaaattgtgaagctctttttctttttattcacacaatttaacgc
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : ttcgtaaattagaagattttctttatttaaccctaaaaacccaaaaaaagataaaacacc
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : acccccagcagaaaagaacaaccccacacctctctttttttttttcttttgggggggggg
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : cacaccatgctttttttttttttcggtgggggaaggtggaaggtttttccctaaagattc
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : aatgaacgctttaactttttaataccctatttcccttcttcaagttccggagaagggggg
BMWN1_0083_A07.b : ttccctcttctaataaaatagtaaatttatattttttccttcacaccttaacgaataaac
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccg
BMWN1_0073_A02.b : tctcttttaaaaaaatattaccccaaatttatacttttccttaattcttaaataaatata
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : cctctttcctcttgatttttctagcccaattccgccctatgtttccccctatacattttc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : ttttctttcttcaatatatatagtaatttcataactataccatttacattctttacttaa
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : aaccttttcttttttttaacccatacaccccaaaaaaaaattaaaaactatttttttttt
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : gggaggctttttttttttgaaacttttaacgccaaaaaaatttaaacccaattttttttt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : ttttttgaaaccatatagcgcgcaaaaaaaattttaaccaaacattttgttttttttttt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gcctttttttgtaaacattaaaccccccaaacaaactttaaaaccaacatttcgctcttt
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ttttttttcaaccctttaagccgcaaaaaaaaattacaaaacatatttcttttcttttat
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : gaaaatttggggagcgttttttttatttaaaaccctaatacagcgcaaaaaaagatttaa
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaattggaaccctttccttttttttccccacttaaacccgcaaaaaaattttaaaacaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aggaaaaaattaaaaccaccaagctttcttttttttttcgggtgcggggggggggggggg
BMWN1_0046_D09.b : ttgaacctttaaggcggcaaaaaagttaaacacaacttttcttttttttttttccgggtg
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ggggttacatccctttttttctaacctttaaacccccatttaaggggtagaccggaatgt
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : caattcttttttttttgaaaatttcgagccttttgtcatcttttaaaaccccccgaaaac
BMWN1_0075_D08.b : gggagctcctgctttagttaaacattaaaatctggaacaaaatttaacacaccatttttt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaaattgaaacccctcttttatttcaccaataccccacaaaaaaatttaaaacacattct
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : tacccttaaaaccggcaaaaacaagttaaaacaacatttcctttctttttctttcaggtc
BMWN1_0047_H02.b : tgccaaactttaggcgaaaaaatataataggcaacaaaactaattctccaccctctcttt
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : aacccctttacaaccccgcaaaaaacaaattaaacaccacccactttgtcttttctttta
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : cattattcttacaaattataattttatctcattaattctgaatctactctattttctttt
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : taactcttatgtaaaatttaaaacaacaaaaacttttattttattttacacttatatggt
BMWN1_0036_B10.b : tggaacaaaaaaaaacctgcgaaaaaaaaattaaacacacaaaaatgtgtttttttttat
BMWN1_0037_E04.b : tttttgaaaccattaaacccgaaaaaaacatttaacacaaaatttccttttttttttttt
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : actaccccttttttttattttttctcccctcattttattaacccttaccatacctctttt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : aaaaattttaaaatggaaattgatataattttaattttnggttttagtttaggtttgggt
BMWN1_0092_D05.b : aatttaaccctttaaaccttttaaacattaacacccttttttttttttttttttcgagtt
BMWN1_0099_A06.b : ggctataacttctatacacatcttttactttttatctttcttagcctcggaggaaagttg
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tgtgtttttttgtaacatttaagccgggaaaaaattttataaaacccaattgcttatttt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : acccttaaggccggaaaaaaaagttttaaaacacattttcttttttttatttttcggtct
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : tcttttatttgggaaatttggtaacgtttcttcttttttgaaaaatataaacgcttcaaa
BMWN1_0046_F04.b : aaagccctttataaaattaaaacccccttgtattttttaacttccggttcgggggatgtt
BMWN1_0041_E05.b : cccccccatatttgatgcaaaaaaaagacgcctccaataacaaaagtacggcagcagctt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : tatgaccttttttggccccaataaaaccggaaaaaaacatttaacccccaaatttggttt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : tgtaaaaaattgtcgtcgtattgcatttatttgaacngtttagagccccccaagaacaag
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : ttttttaacccctttaccccgcaaaaaaattttaacaacaccttttcttttttttttttt
BMWN1_0030_E03.b : actttttttttataaattttaatcaacatcttttttttttcacaaactatatccctcaaa
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : tctaattatcaactattttttaaatccttctaatcctatttccatatttttataattgac
BMWN1_0037_C04.b : agatagaatgattgtttatcttgtactccatttagactacatctaacctataatatactt
BMWN1_0063_D12.b : tggaaattggagatgtttctctcttttctaccccatttaggccaaaataaaattttcaac
BMWN1_0022_D06.b : tttcaaccataattgcgccacacacacagtaacaacacccacttatcttttatccttcca
BMWN1_0077_D02.b : ttttgaaaaattggcacccttttttttttttcaccttcttcccctctaaatcattcaacg
BMWN1_0078_D03.b : accccataaacaacttaacagcactattgctttcttttggttttgggtcggggggaggtt
BMWN1_0081_F07.b : attgcgtttatttgacacctttaagccccaaaaaacattttaaaccaaactttgcttttt
BMWN1_0003_E09.b : tgatttttttttaaacaataaaagtccaaaaaaaaatttaaaatcaaaacttcaattttt
BMWN1_0068_D05.b : tttttaaaatggggcgcattttttttttcacccacttaaggcctaataaaatgtttcccc
BMWN1_0034_G03.b : gaaacaatttgacaaaaaaaatccatttatatttaattttaaggttttgggaaaattgtt
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaaggggggtagtt
BMWN1_0067_F02.b : ttaaaaccacaattccttttttttttttttcagtccggggggaggggggaagttttttcc
BMWN1_0092_A04.b : tcactccccttttaaaaaaccatcgccgcaataatattctaatcctacaccgtttttttt
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : taagacccgaaaaaaaaaatgacaccccaccttgccttcattttttatttaagttcgggg
BMWN1_0070_F04.b : aaaaaaaattaaaacactcattcctttttttttttccaggtgggggagggggggaagttt
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : aacaatttccaccgccctttttttaaacaaaacacccttcaccttaaaaatttcacccca
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : gggccccttctaaaccacaattaaatgagacaaactccttttctttttatttcctttctc
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : tggaagccctttcgtttttttgaaaccataaaacctcccataaaacaatataaaaacaaa
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : aaaatgtggcgaccttgctttttttgaaacattggacccaaaaaactaattacaaagaca
BMWN1_0005_H04.b : tttttttaaaaccataaaagccgaataaaactatataaatcccaccatttgctctttttt
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : cacaacaaaaccccaaatacattttttttcccacattcccgggatttttgtatgattttt
BMWN1_0040_E09.b : accccccttttagaaggttaaacgcaccctgcctcctttttattttccccctccccgggg
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ccttctctttttttgaacacatttaaccccgaaaaatatttaaccaccacttttcttttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : gctttttttattcaaaaataaaacccgtcaaaaaattttaacacccctttgctttttttt
BMWN1_0039_B02.b : atttggaacctttaaagccccaaaaaaaaatttaaaccacatttcctttctttttttttt
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : accggaaaaaatagttaaaaacaccttcctttttttttttttcagggtggggggggggag
BMWN1_0002_D08.b : tttgaaccccaaaaaaatgtttaaaaaaaaattcccctacatttattttccagttcggtg
BMWN1_0058_C10.b : cctttcttctattataaaaaaaaaatcccctctaaaaaaaattcaaaccactcttcttct
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : tgggagtgctttcttttttgttcacgttaaggcgagaaaaggaggttaacccacgttttt
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : tggaagccattctttttttgcaccctaataaccggcaaaacaattttaaccccactttcc
BMWN1_0040_B09.b : tcttttttttaaaaaaatcttgccaaacattaatgtatattttataaaacaaacaaactc
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : atgtgcagtccttaacccttttaagaacccaaaaaaaccctacaaaaacatttttcacct
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aaaataaatataataccgatacgacataataaattaataatgacttaataaatataatac
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : cattaatttttatcaccattcttcccttctttatattacatcaggagaaaatttaagttt
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tttaaaacatatttaacaaccattttcatattttttaaaaaaataaatattatttgtgct
BMWN1_0062_E11.b : tccatcactcaacatgaatattctatacttaatatagcttagcaaatatctttacttcat
BMWN1_0074_F01.b : agtcatgtttttttttttcacaatataagctgtaaaaaatttataaaaatactctttttt
BMWN1_0056_E05.b : atttctttattttcaaccactatatccgtaataaataatttacaaaaccctttccctttt
BMWN1_0041_B02.b : ggaaagccattgcttttttttgaaaccatataaagccgcgcaaaaaaactttaacacaca
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : aattttttttttatttataaattagagatccatttccttattaacaaccctttaatactt
BMWN1_0087_A11.b : tttatttttggcccccctttttttttttcccccctcccacccccaataaaaaggtataca
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tgctctaaccccattttgtctcttttttttctccgctcagggggagtgaggaggattttt
BMWN1_0065_A11.b : acaggaaaggggagactgttttattttttttttaaatataaaagaagggcatcatatatg
BMWN1_0041_H11.b : aaaccccccatcaaccgatctctcacaaacccactcctccttccttctctatcactacgc
BMWN1_0046_F03.b : ttcttttatcatccccaccacagaaaaagacctttcttacttaacttttcactcactcac
BMWN1_0037_H03.b : tatacacaagatttttttgtttttttttttcccgtttcggggagagttggaagtgttttt
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : ccctttacaccccccaccaccgggagagggggggggataggtgtcttttatattctatct
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cagtcttttcttctaaaaaaaattcccaacctactatcaaacttagttttgaggtttggc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : catggtcttggggagggggggggaaggtttttcttacttatataaacacccaaacccccc
BMWN1_0036_H12.b : gcccaaataacaatattaaaacccacacgttgtctttcttttttttttctctacccccag
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : cccttctttttttcctttaccgcggggaggagagtaaaattcctcaccacacacgccaaa
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : gggaagggtttttttttttaaataccccaccccccccaagcgagggggtgtattgggttt
BMWN1_0080_G07.b : xttatttatttccagcgggggaaaggggttgttttgggcctttcacccccccccaagaaa
BMWN1_0096_D04.b : ccaacccccggaaaagggtttgtattgggttctttccttcccaaaaaacccgtgcctggt
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaagggtttccgaagggggcccttcccttcc
BMWN1_0021_G08.b : gggttttttttttcttttccgaacaaggaaggcggggaaaattttttttagcaaaatgga
BMWN1_0083_A07.b : ataaactacacccctcttttttttcttttctagggagaggggaggggtatgtgtttttct
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : cattaagaaacccccaacccccggaaaagcggttgccaatggggcctttcgtttccttca
BMWN1_0073_A02.b : aagagtttcgcttttttctcacaaaaccagtaaagagaacttctcctactttttattcca
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : tcaaaatccactgaaaaaccgccacgtgcctttctttttactcaatctccgccgtgcgcc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : caattatatgtgaattgctataactattaaattgcaaacaattaaatcattttcaataca
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : tttttttttcgggcagggggaaggggagagagttttcccctaaaaaaccacccccccggg
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgataaaaaaccacccaccc
BMWN1_0069_G10.b : tttttccgggggggggggggggattttttttaaaaaaaaccccaccgggggaaggggttt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tttccgggtgggggaggggggtgggagggtttttcccaaaaaaacccgccacccgcgggg
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : ttattttcgaggtcgggggagaggtttgaacctttttttacatctataacccccccaccc
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : tttctcgggcgggggggggggggggagttttttctcactaaaaaaacccccccccggggg
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aaaaacatttttttttttttttttttttctgtggggggggggggggggggggtttttttc
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : cttctgtcttttttttttttttccgcccccggggagaggggggaagtttttttccaaata
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxccttaaaaaaccgcaaccccccgggaaaagggttttcatattgggcctt
BMWN1_0046_A02.b : tttttttccattaaaaacgcccacccgccgggaaaagagttttttttttgggccgtttct
BMWN1_0046_D09.b : ggggggaggtggggaggttttttcgccaaaaaaccccccacccccgggaagagggttttc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttttttttttttctcgtctggggggggtgggggagtttttcttatataaaattccccc
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : cctatatatataattcaccatcccctgttttttcttttatattttttcggggcggggggg
BMWN1_0075_D08.b : tttttttttttcagggcgggggggagggggagttttttatcataaaaaaacgcccacccg
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : ttttttttattttcggggcgggggaggggggaatttttttcaaaaaacccccacccgggg
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aggggaggggggggagttttttcctcataaaaaacccccccaccgcggggaggagggttt
BMWN1_0047_H02.b : ttcttcttttttttccccccccaggaggggaaacggtagaattttcttttttaaaacacc
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ttctttcccgcctcagggggaggggggggggagagtttctcttccacttaagaaaccccg
BMWN1_0001_E04.b : xxxccgattataaaaacccccaccccccggggaaagcgttttcctattgggcccttcccc
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : cattttacaaactcaataaaatacaataaaaagattatccactatcatacttttttttta
BMWN1_0100_D04.b : xxxxxxxxxxxxxaagaaaacgccaacccccgggaaaggggtttcatttgcccctttccc
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : tataggaaagaagatttcgcggatgtgttattttttttttcccagaaaaaggggatctgc
BMWN1_0036_B10.b : attttccaggttcaggggaaaagtggggggaattttttcctcctttatatacccccccca
BMWN1_0037_E04.b : ccgttcggggaagttttaaaaatttttccacatataaaaccccccccccctaaagaactt
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : ctaagaaccgccaacccccgggaaaggcggtttgcttttgggccccttcccttcccccca
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : attctaatttccctctattatctgatttttcactattatttcccactccctttctcttcg
BMWN1_0083_C04.b : xccgcataattattctctaactccgggaaagggggtggctatggcccttttcgtttcaaa
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : tttgggtgaaggaagggaggggtttgggaaaggaatttgggttagagagagaaagttttt
BMWN1_0092_D05.b : agggggaaattgggagatatttcaacaatacaaccccgccacaccgaggaaggctttgtg
BMWN1_0099_A06.b : ggtgttttttcgcttattaatattcacctccccggggattggttatttatattatcacat
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tttttcaggctgaggggggggtgggaaattttttataatatataaacacccacccgcagg
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxctcttcttaaaaattcccccaccccccgggaaaagcggtgttgca
BMWN1_0073_G04.b : gggggaaggtgggaggttttttcccctaaatgaatccccaacccccgggaaaaggggttt
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : taaattttaataaacatcttgcgttttattttttattctcgccacggggggagtgggaag
BMWN1_0046_F04.b : gggaaggtttttggcaaaaaggaaagctcccccccaaaaaaaagcgttctcattgggggg
BMWN1_0041_E05.b : tcttttttttcacactctaccgcgcacgggaggaagggtgaatgctttttccgtcatttt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : ccttttttattaagtcctgggggggtttttcgaagtttttttcccttaaaaaaaccgcct
BMWN1_0001_D08.b : xxxxxxxgaacccgcccaccccccggaaaaagtggtttttttttgggccttttccacttc
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : ttaacgagacaattagctttctttaaatttctcgttccggggaagtgttggagggttgtc
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : tccggtctggggggagggagggggtttttttctcataaaaaccccccaccccggggggag
BMWN1_0030_E03.b : attaatattaccaccacgtgtttcttctttttttcttcatgcgaaggggaagagaggata
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : attcctaccaattgtcattttcttctaaaagcatagaactgaatatttatttaatcattt
BMWN1_0037_C04.b : tctcaacactacaatttattttttattttatattatcacgggaacggggaggagttgttt
BMWN1_0063_D12.b : ccattctttcttttttttttttttttcccggcacggggaggaagtggggattttcttata
BMWN1_0022_D06.b : agggacggggcgggggtgaggtttttttccacatatacagtcaccctcacctccaggagg
BMWN1_0077_D02.b : gccggtgggtttgttttttttcctcggagagggagggggggattttttgcgatttttttt
BMWN1_0078_D03.b : tggtagtttttcggattatcaaccccaaaaccggggaaggggttggatattttgcctttt
BMWN1_0081_F07.b : ttttttttcggtcggggggagggggggggggttttttcacttaaaaaccccccccccggg
BMWN1_0003_E09.b : ttaaattttaggtcacggggaagggggggaggtttttccctaatataggaacagcacttc
BMWN1_0068_D05.b : cacctttgtttttttttttttcgggaggggggaggtgggggttttttcttttaaaatccc
BMWN1_0034_G03.b : gcattttttttttggttaaaggtcggggaagagttttagatttttctttttttatggagc
BMWN1_0003_F08.b : ttttctccaaaaaaagggccaagcgcaggttttccgttttaaaatgggccccctccgtta
BMWN1_0067_F02.b : ccttttaaaaccccccaccccgggaaaagcggtttttatttggagcccttcccttttccc
BMWN1_0092_A04.b : tttttatacgatataggaagatgaatgcacaatttatcatcattatcaaaacatctacca
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ggagggggaaagtttttctctccttataaacagcccccccccggggaaaggggtttgcca
BMWN1_0070_F04.b : ttcccctataataacccccccccggaaaaggggtttcttttggtcttctctctccgcaaa
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : acctccccttgtctttttttttttctctcccggggagaggggaggagtgttttttttatc
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : ttttgcttctctttcgggactacctttaacatcctttaacaatctccacaaggatatgtg
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : atcccttctttttaattttcccgttcggggggggggggggaaaattttctcccaataaaa
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : tttttttttttttttttacgttcggggagagggaggaattttttcccatataaactcgca
BMWN1_0005_H04.b : tattttcaagaatggggaagggtgggaattttttttataacaaaaaatacccaaccccct
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaaataaaaaaaccc
BMWN1_0098_B09.b : tagcaaaaaagaaaaaatttttcccgcataaaaaaagttacacaagggggaactccgttc
BMWN1_0040_E09.b : gagtgagggaaggtttctcggcggttgtgttattttctcttccccgaaagaggggggggg
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : tttttttttcagtccgggggagaggggaagtttttcctccataaaaaacccccccacccg
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : ttttacatgccgggggaggggggaatttttttccaaaaaaaaaccaccaccgggagaaag
BMWN1_0039_B02.b : ccggccgcgggggggggggggaattttttcccccctaaaaaaccccccccccccggggaa
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : ggagttttttttctaatagaaccccccccggcgggaaggggttttttatgggccctttcc
BMWN1_0002_D08.b : ggggttggggaattttttggaatttttaaaagacaaaatttttccaaaactgatataaat
BMWN1_0058_C10.b : tttttttctatatgaggtggaggaggagagggtggagcacttttttttctcctttatttc
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : tttcttttattttgcgggaggggggagggggaagtttttttccaaaaaaaacccccaccc
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : tttttttttttttcggtcgggggaggggggggagtttttctcaataaaaacccaccaccc
BMWN1_0040_B09.b : cccgaaaaaacaatctttaaaaaaacaatcctgtcattattttttatctttctctcaatc
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : ccttttgttttctttttattagggcgaggttggggggaattttctctatttttttttcca
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aagttcaaaattaagtatacacaaatagatctaaaaataactaagaacaaatcaaaacat
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : ttttccataaaataccaaacctcatgattgttaatcttacaagattctttctaaacatca
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : ctgtccaatttatgatctactaaaaatagaaacttaataaaatgagatggattcttgact
BMWN1_0062_E11.b : tcttttcctttcacacaagtccttctctaccaaaaaagatcaccatatttatccattaaa
BMWN1_0074_F01.b : ttttttttctaagcccgggggaggtgagggaatttttctcctaaaaatataccccccccc
BMWN1_0056_E05.b : tttattttccaccctccgggaagatggcgagattttcttctatataacacccccaccccc
BMWN1_0041_B02.b : ccgtttcctcttcttttatgttttccggctccgggggaaggggggggaagttttttcccc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : cggaaaacatataagtaccctacaaaaatgtcttttttttatttattaggggggagggag
BMWN1_0087_A11.b : aaaaagttctttttttttttcccccccccccaccgcaaaggagaaaattttttctccaaa
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tccctttaaaaaccccccctttctcggaataacattttctactcgcgtcctctcccctct
BMWN1_0065_A11.b : cttttttcttttataactaaaaaacttctccctactcaacataaagttcgggactctaaa
BMWN1_0041_H11.b : tcccggcacaaatacctctgcgatttcttcacatcctaataactcatccgccacccccca
BMWN1_0046_F03.b : aaaatctcataccttttgtctcttctcctatcttatcacaattcataatcttttgtagat
BMWN1_0037_H03.b : tccaaatatatacgcccaccctcggggaaaacgttttttgtatttaagctcccttcttct
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : aactctcatagataatattttggggggagtgttctctctctatggggagaatgtttctat
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cattctaccctttttcaaatacaattccttcccccctaagcactattgttaaggaatgta
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : ggaagagacgagtggatacttgcttctcttttattcttctccccccacactccgtaatcc
BMWN1_0036_H12.b : ggggataggtttaataggttttcttctctaaaataataaaatccccaccaacactgcaag
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : cctatttacctcattctccctctcccacaaactcccccccacactatttcattccctaaa
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ttttatttctctcctaacgcaaaaaatcaagtaccatgtgtttggggtgggaatacttcc
BMWN1_0080_G07.b : agggttgttttttggcccccaacggttcacctccaaggggttttgttttccggggggggt
BMWN1_0096_D04.b : tttggttgggaagtttttctcttaaaggggttcgtttcccaatgggggaaaccaaaaaaa
BMWN1_0010_E03.b : ccctaactactcctgccccggtcttcgggtgggggaaggatcacttcctcaaggggtaat
BMWN1_0021_G08.b : aacttccccttttagaaaactattcattacccgggcccccccccccccaaggtatcccca
BMWN1_0083_A07.b : ttttctcgaaacacccccgccaccatattggatcattgtttttttcatccccctctcatc
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : attaaccctcccccgccttggggggggagggtttccctctcggggggtaagggtttccca
BMWN1_0073_A02.b : tacctcataaaattctctatcataaacacctctttactattttataaatgatatttttgt
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : ggcgtcgacgccctttctccctaaatatatcttttcaaattatggactacacattattca
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : attcatattattgaaatcgcattttctatatttaataatgataatttatcccatcttatc
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : gaaagtggttttttattcgccctccctcctccccacataaccttaccactcatcttatga
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : ggggagagaggttattattgggccccttccacttcccataaagaatctgttctatgtttg
BMWN1_0069_G10.b : ttattggccttctctctcccaaaaaaaaccgtctggtttgggggggaatttttttcgagg
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : aaagggtgttttttagaggccttctcccttcccccaaaaaaaaactaggccagagtttgg
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gcgcgagaaatcgttatttgatttggacgctttcaagataaccaatgatagacatgcctg
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : aaaagggttttttatttggctcttttcccttcttcctaaaaacacactgctgtgttttct
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : gtcaaaaaaaaagcgccaccccgcgggagggggcggttttttgttgggcccctctcctcc
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaaaccccccccccggggaaaagggtttttcttttgagacctttctccttctcacaaaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : tctttttcccaccatgaaatatatctcaggtgttcggatgtgacaatgttacatccccaa
BMWN1_0046_A02.b : ctctctccttccaaaaaagacccccgcaagtcgcgcggggggggtgtggctcctcgagag
BMWN1_0046_D09.b : ttattggccctctccttcccccaacaaacatgcggccaggggtgggcggggcaaggtatc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : accccgggaaaaagggttggtttatgggtctttcgcttacgaaaaaaaccaaaggggtgt
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : gaggtttttttctttttttaggataaatataagccctcacngggcgggcggacacctatt
BMWN1_0075_D08.b : gggaaatggttttgtttaggggtctttctctcccaccaaaaacaagtcaatatattttgg
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : agaaggtttttctttgccctccttcctctccaaaaaaacccccaaatgtttgtgggggga
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : taaaatcgcccccctccccctcccaataaaaaacctcggccggtttttggcgcgcggaag
BMWN1_0047_H02.b : caccccccaacgaggaaatggatattttttaaataaaatcattttcactccactatcact
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : cccccccccgcgggaaagcgggtttttcattttggggcctttttcctttttcctcaccaa
BMWN1_0001_E04.b : tccccccaaaagaacctagccctgggttttggtgtgggaagggtttacccttctcaaggg
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : ctatccaataacaaaaaatcaaatcaatacactattaatctttatctttcatactcctta
BMWN1_0100_D04.b : ttccccacaaaaacccccgcccggtttttggtggggaggggttttcccctaaggggtatt
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : gaagggtattttttctttatatatgccccccatccggctcacagtgtttcagtcggggcg
BMWN1_0036_B10.b : cccggggagaaggggtttttttttttttcccccttttccctcccaccccacaagaacggg
BMWN1_0037_E04.b : ttttttatagacccctccattcgtctcaaagaattgcgaatcaggtttgccagaaggaat
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : cagaatcctgcgcccggtttttgttgggggaggggttctcccccccaggggggtaagggt
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ccataattcgcccatttttttattaatttcctccacactttttattgtcattaatctcac
BMWN1_0083_C04.b : tcaagaccccgggaatggtgtttgtttggggagcgttttttcccaagggggataggtttc
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : gggttaaagaanttttttntttggggtaaattttgtggggtgaggtttnttggggggggg
BMWN1_0092_D05.b : tattttcaatttcctcaacacaaagaaatcaatttctagtatacggcggatatagtacaa
BMWN1_0099_A06.b : taatattacccctatctagtatactgattttactacaatcctacattcttaaacaaataa
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : aaagagtgatttattgttgactaatcatcatcatccatattattcttacgatattattat
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : atgtggcccctttctctttttctcacaaaaatccagccccctgtaatttgggtggggaga
BMWN1_0073_G04.b : tctattgggtctcttacttttcttaataaaataatgtgccttggttttcgtgggggaggt
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : agttttttctccaaatagaaacaccccctccgcgggaaaaacctttttttatattaaatc
BMWN1_0046_F04.b : aatttttttcatagagaacatcccctcccggctttggcggggggaggttttttcgtggga
BMWN1_0041_E05.b : tcttcccacccacggcgcgggggagaggggtgtgtatttcttgttatttctaaagaacgc
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : aagcgcggtttaaaaaggttgcctttttgtgtcctttcccattctctcctccaaattntc
BMWN1_0001_D08.b : cccccaaaagaaaccttcactttttcttttggtgccgccaacttttatactctataaaag
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : atccatataaacagccccgccccacagaaatgagtgttcgatgagaggctctatcgtttg
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : agggtttgcttttgggcccccttctcctcctcccaataaccccgcccgggtttttggtgg
BMWN1_0030_E03.b : ttttatttaatataataatccacacactcccggaagaggtttattttaatgtggtcccct
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : taaatcactcttaaacattttaccttatgactatctatttttttatacctttcttacatc
BMWN1_0037_C04.b : tattctcttacaaaacatatagaattcacctgcggaaaatatttacttgttttaattaat
BMWN1_0063_D12.b : atataatacccacaccctgaggaatgtgttattttcttataccttctttccccatcctaa
BMWN1_0022_D06.b : ggttatcataagtgacaccctctcttcctcctcatagctatagcgccagcgtcattgggg
BMWN1_0077_D02.b : ctccccccccaccacaccctttttataatgagcctctctttttcctccacaaaagggtgt
BMWN1_0078_D03.b : ccttctacccagaaccggggcttggtgtgggggggtaagcttccccgcgtaaggggttcg
BMWN1_0081_F07.b : gaaggggttttttattgggcctttctccttctcccaaaaaaccccccccgggttttgggg
BMWN1_0003_E09.b : cccgaataaagccctttatcatttgggcattttcctctcccgcctatataataatggccc
BMWN1_0068_D05.b : ccccccggggaaaggtgtttttttgccctcttcctcccccccacaaaacctctccttctt
BMWN1_0034_G03.b : gcgggggcgttagaaaatctttataaaggattccctctactataaggaaaattttggtga
BMWN1_0003_F08.b : cagtatttaaatttggcccctttctttcttgcaaaaggatcccctcttaaggggtaaagg
BMWN1_0067_F02.b : tataattaactcccctctgttattcttgggggaagggtacctcctccaggccgtaatgtt
BMWN1_0092_A04.b : gtaaaaacctacaaaaaaaagacctaccactaaattaatagaaatgataataaataaata
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ttgggcctctttcccttcttccaaaataaatctcccctggatatttcttgcgggagggtg
BMWN1_0070_F04.b : aaaataccccctgtcttggggggaggagtttctctcctggggggaatttttctcaagagg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : ttaaaactctcccccaccgggacaagagcgtgtcgcttatgataacatctcctcctataa
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : cctctccctttttccctatccctcctcttccccttatcgtgtattctattttttaggaga
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : aaacccccaaaaaccgcaggaaagggggttttataaatggcccctctcccctctccccta
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : ccacgaggaaaccctttgatatgacccccttccctttcgacaaagctaaccacctttgat
BMWN1_0005_H04.b : ggagaaggtgattggttattacgtattatattctactacctacgcaacattcccgtcgct
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : ccccaccccgcggggaagagaggtttgctttggggccctcttccctcccctccacaaaaa
BMWN1_0098_B09.b : tttaattgaaacccccccccccctctcataggtggcgcgggagtgatttttcttgagggg
BMWN1_0040_E09.b : gaaatgtttgtcaaaccttgtatactacccacaccaaccctggaattctggttttttatt
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ggggaagaggtttttatatgggcccttttccttctcacaataatatttcgccacttgttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : cgtttttttttttgccctctttctttcttcctaaataaatcgcagcttttttctggtggg
BMWN1_0039_B02.b : agggtgttttctattggcccctctcctccctccccagaaaagagccacccctgatcttgg
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : tttccaaaaaaaaaaacctatcttgttgtttggcgggggggggtttctccttgagggggt
BMWN1_0002_D08.b : tttgcgcttttagaatttttttcttaaaccctccctcccccttcccctgggccggcggcc
BMWN1_0058_C10.b : tccctcgaggggggagggggtggggggattttttgtatatacatcccccccccccccacg
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : ggggaaggggtttttttttgggccctttctctcctcccaaaaagcatccctttttttttg
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : ggggaagagggtttcttatgggccttttccctcccccccaaaaaccacccccatatattg
BMWN1_0040_B09.b : tcaaggagagaaatgatgagaaacaattaattccgacacaatattccaatttccaaataa
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : aaaccaaaacacaggaaaagcgcggtgaaaaagtggtttcccctttaggccccctccccc
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : ccaaaaaagtgtgtctcacacgcgcgtagatagatgagcattaaactacactaatatacc
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : tgataaaaccaccctaagttattttccttacatttcactacctctcttagacaatacatt
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : ttattctgtctccgataaaacatacttacacatttatccctcttaggcttactactatct
BMWN1_0062_E11.b : tatcgattcttcatcctctatatactcagtctacatgaacttaaattttttacgattctc
BMWN1_0074_F01.b : agtaggaaacgtgttttttttatgaccccttactctatacaaaaaaaacttgaactctgt
BMWN1_0056_E05.b : ggaaaaaatctttctataggaacattttccttaccccccaaaattccctcctccctattc
BMWN1_0041_B02.b : ccttaacaaaacgccccccccccccgcagaaaaagttgttttccaaatgaggcccccctc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : agaggggtatgagtttttattagctgtataaaaaattacccacgacacgggggatgaatc
BMWN1_0087_A11.b : aaaaaaaaaaacctttgtgtggagaccccctttaaaaaccccccccccaaaaaaaaaaaa
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tacaataaaaatacaatataatttactgtgggaatgatatctctttccttgtggatgtta
BMWN1_0065_A11.b : gctacacacctctcttattatatatatatatggtaggtgggaagtctactcccaaaaata
BMWN1_0041_H11.b : aattagatctccctcctcctattttccacactcttcaccctcattcccctcgatgcctcc
BMWN1_0046_F03.b : tcacatctttttatatatgtcctactaccttacataaataataatattctttgaattcta
BMWN1_0037_H03.b : tcgcatcaagaaaaaagaatcaatgtgtggtgagaagaatactttccactagaattagag
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : tatttggataatggaaaaacatattgaaatcaccacactccgaaatagatctcgctctgg
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cacccccccccggcggatcagatactccactaatatgggtatccgggaaataatacttcc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : atccattactggtgtgctcacccttgctacctctccaaagcggttatatctctttcccaa
BMWN1_0036_H12.b : tagagcctcttttatttgagaaattctttctatttttctcacatagataaaaaccatata
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : atacttttttcttccccgcatatattttcttatctccagcaccttcactctttctacaac
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ctctgggtgatatgtttctcttatccggtggagcggaaagaaaacgactgtttaaatctg
BMWN1_0080_G07.b : accccgaaaaaggttaaaagcccaaaggggaaaaaaaggcttttggtttttttagccccc
BMWN1_0096_D04.b : ttgaaaaggcaaaagccaaaaaaaaaggcttggggttttttattcccccccaaacaaaat
BMWN1_0010_E03.b : cggtttcccaaatcgggataacgggaaaaattttaacaagccccaaaggccgaacctaaa
BMWN1_0021_G08.b : tcccggcgttgggggttccggttccccgatataggggaaatgttttaccaaggcaggacg
BMWN1_0083_A07.b : tcttcaaaacaagcctcccgctctgcgaagaatggacaatcctctttcctattagaggag
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : aatgggggaaccgggaaaattttaaaaggcgaaaagccgaacctaaaaggggttgggttt
BMWN1_0073_A02.b : cgtataatattctcaatagaaaaaaaaacatattaaagaagattatgaatgattttatta
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : tattgaaaccttcttccccatccaaacaccatccctatacgcctcgctcccgtttagagc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : atctatcgtactaaatctacccattgaagaacctactatcatttatttggtgataactct
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : ccgaaaatctatccacatatggtatatgttccctacacgggaatcaagaattctatttaa
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : tggggggggggttttctctctcctggggggtttttttctcacaagggggaacacgaaaat
BMWN1_0069_G10.b : gggttattttccaaaagggaaaccgaaaaattgaaagcccgggggcaataaggcttttgt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tgagggggagttttctctctctgaggggtattatgtttctccctatgtggaatccggaaa
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : atgatcaaccggaagaaatagttactgctttatagattgtatgcggtgtaaacaagagaa
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : gcgggggggagtatacctccctcaggggggtgaatgtttccaccaaaggtgataaaccga
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : tctccccaaagaaaacgcgcccactggagggtgggggggggagtgttctcccccttgggg
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaacagcagtgtgttttttgtgggggaggttattttttcccaaggggggtttatgtttc
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : agcggtaaacggtttccccaaatcgggtataccagaaaaatttgtaaaagccccaaatag
BMWN1_0046_A02.b : gggaggtggtttcccacccgtgggaaggcagggaaaaaagtagcaagagcgaggagcagg
BMWN1_0046_D09.b : tcctcgaggggggttatcgttccccaaacgggggaaccggaaaaattgggaaaaggccca
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttggggctccaagttttgtccccacgggggtattttttttccccatttggggctaccc
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : ttcgcataacccctctttccttccaagcgtacgaacagcataatgtgtctgccggtgtcg
BMWN1_0075_D08.b : gtgggagatgtatccttctccggggtatttgtcctccaacaggtgaaacgcgaaaaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : gggttttctctggggggttttttccctcccatgggcaaaccaaaaaaatttaaacggcgc
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : gtattcctctccaggggggtgtgtttcccccaatcggagaacgagaaaaatttttaaaaa
BMWN1_0047_H02.b : ttaatcactaccctatcttttatttctttccctaagaaaacactcctctcttactatggg
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : aaaatccagctccccgagttatgggcgtggggaaagggttatctcccccccagaggggtg
BMWN1_0001_E04.b : gttatcgtttccccaaaaccgggaaacccggaaaaaatttttaaaacccacaaaggccaa
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : attatttttctacctactaatctttattcatgtctgaattaatctatctttactcacaat
BMWN1_0100_D04.b : ggtttccccaatggggacccccaaaaatttgaaaagcccaaagcgcaacaaaaggcggtt
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : gcttttctcctctataagggttatccgctcaatggggtgggagggaatcccactataccg
BMWN1_0036_B10.b : cgcttttgtttttcgccccgcctgtgcttttatctccataagggggttaatttttttccc
BMWN1_0037_E04.b : ttcaataaagaaaaaaataaattttcacatacaggagtatcaaaagaatagatataaggg
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : ttcccaaatccgggaaccccgaaaaaattttgaaaaagcccaaaagccaaaaacttaagg
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ccgattctttttattattattatatattcccactaccttctactcctatactatctcttt
BMWN1_0083_C04.b : caagagggggaaaggagaaaaattggaaaaaggctaaacccaaaagaaagccggggggtt
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : gtgttttgtttaggggggttttggttgggagaaaatggttaacanaggggaattttggaa
BMWN1_0092_D05.b : gagcttgtattgtgaaactcttcgctaacgacacaatatataaacataatgaaagagggg
BMWN1_0099_A06.b : aaggtgaactacatttctaatttctgatatcttatgaaaatatgtcatatgttcccctgg
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : atactgataattaatattcttttcggtgagattcatttctacatatctgtgaattaataa
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : ggataccccccttacgcgggttatttgtttctcccaaatcgggagaatccagaataatct
BMWN1_0073_G04.b : tttctcccctgagagggattattgtttcccctatattgggatcacctaaaatattttaaa
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :