
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000186

Length: 761

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Homo sapiens]. 1332e-31O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCampcathelin-related antimicrobial peptide [Mus musculus]. 1224e-28O
Contig/Assembly ProteinNgpneutrophilic granule protein [Mus musculus]. 57.41e-08O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCAMPcathelicidin antimicrobial peptide [Canis lupus familiaris]. 1285e-30O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCATHL3cathelicidin-3 precursor [Bos taurus]. 1553e-38O
Contig/Assembly ProteinCATHL1cathelicidin-1 precursor [Bos taurus]. 1523e-37O
Contig/Assembly ProteinCATHL4cathelicidin-4 precursor [Bos taurus]. 1522e-37O
Contig/Assembly ProteinLOC786887PREDICTED: cathelicidin-4-like [Bos taurus]. 1522e-37O
Contig/Assembly ProteinLOC100336703PREDICTED: Cathelicidin 1-like [Bos taurus]. 1509e-37O
Contig/Assembly ProteinCATHL6cathelicidin-6 precursor [Bos taurus]. 1492e-36O
Contig/Assembly ProteinCATHL2cathelicidin-2 precursor [Bos taurus]. 1486e-36O
Contig/Assembly ProteinCATHL5cathelicidin-5 precursor [Bos taurus]. 1471e-35O
Contig/Assembly ProteinCAMPcathelicidin-7 precursor [Bos taurus]. 1462e-35O
Contig/Assembly ProteinLOC100141058PREDICTED: Bac7.5 protein-like [Bos taurus]. 1361e-33O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPG-2protegrin-2 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG3protegrin-3 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG1protegrin-1 precursor [Sus scrofa]. 2108e-55O
Contig/Assembly ProteinNPG4protegrin-4 precursor [Sus scrofa]. 1951e-55O
Contig/Assembly ProteinPR39antibacterial protein PR-39 precursor [Sus scrofa]. 1891e-48O
Contig/Assembly ProteinPMAP-23antibacterial peptide PMAP-23 precursor [Sus scrofa]. 1883e-48O
Contig/Assembly ProteinPMAP-36antibacterial peptide PMAP-36 precursor [Sus scrofa]. 1846e-47O

Assembly Members: 279      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10065A11BMWN1_0065_A11.b  AK399751


SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0086_B05.b :
BMWN1_0065_A11.b :
BMWN1_0041_H11.b :
BMWN1_0046_F03.b :
BMWN1_0037_H03.b :
BMWN1_0037_F10.b :
BMWN1_0099_B07.b :
BMWN1_0059_A09.b :
BMWN1_0087_G11.b :
BMWN1_0089_G05.b :
BMWN1_0040_F12.b :
BMWN1_0036_H12.b :
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b :
BMWN1_0013_G12.b :
BMWN1_0062_F12.b :
BMWN1_0080_G07.b :
BMWN1_0096_D04.b :
BMWN1_0010_E03.b :
BMWN1_0021_G08.b :
BMWN1_0083_A07.b :
BMWN1_0008_D09.b :
BMWN1_0057_F04.b :
BMWN1_0073_A02.b :
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b :
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b :
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b :
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b :
BMWN1_0069_G10.b :
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b :
BMWN1_0088_A05.b :
BMWN1_0002_G04.b :
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b :
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b :
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b :
BMWN1_0030_E07.b :
BMWN1_0062_A03.b :
BMWN1_0046_A02.b :
BMWN1_0046_D09.b :
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b :
BMWN1_0057_A12.b :
BMWN1_0020_A11.b :
BMWN1_0075_D08.b :
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b :
BMWN1_0061_H11.b :
BMWN1_0044_B07.b :
BMWN1_0047_H02.b :
BMWN1_0028_C08.b :
BMWN1_0056_G01.b :
BMWN1_0001_E04.b :
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b :
BMWN1_0100_D04.b :
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b :
BMWN1_0036_B10.b :
BMWN1_0037_E04.b :
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : aagggggggggggntnnncnttnnnntttttancaanttc
BMWN1_0017_B03.b :
BMWN1_0003_D01.b :
BMWN1_0083_C04.b :
BMWN1_0069_E06.b :
BMWN1_0083_E04.b :
BMWN1_0092_D05.b :
BMWN1_0099_A06.b :
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b :
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b :
BMWN1_0073_G04.b :
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b :
BMWN1_0046_F04.b :
BMWN1_0041_E05.b :
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b :
BMWN1_0001_D08.b :
BMWN1_0053_A04.b :
BMWN1_0031_D09.b :
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b :
BMWN1_0030_E03.b :
BMWN1_0035_G03.b :
BMWN1_0031_C01.b :
BMWN1_0037_C04.b :
BMWN1_0063_D12.b :
BMWN1_0022_D06.b :
BMWN1_0077_D02.b :
BMWN1_0078_D03.b :
BMWN1_0081_F07.b :
BMWN1_0003_E09.b :
BMWN1_0068_D05.b :
BMWN1_0034_G03.b :
BMWN1_0003_F08.b :
BMWN1_0067_F02.b :
BMWN1_0092_A04.b :
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b :
BMWN1_0070_F04.b :
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b :
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b :
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b :
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b :
BMWN1_0005_H04.b :
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b :
BMWN1_0098_B09.b :
BMWN1_0040_E09.b :
BMWN1_0028_H02.b :
BMWN1_0070_E09.b :
BMWN1_0022_D07.b :
BMWN1_0012_B02.b :
BMWN1_0039_B02.b :
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b :
BMWN1_0002_D08.b :
BMWN1_0058_C10.b :
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b :
BMWN1_0085_H06.b :
BMWN1_0001_A07.b :
BMWN1_0040_B09.b :
BMWN1_0023_G01.b :
BMWN1_0075_B12.b :
BMWN1_0088_D09.b :
BMWN1_0092_B11.b :
BMWN1_0032_E12.b : nngccgtgagacgcagtagtattctatacttttttaggca
BMWN1_0100_G01.b :
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b :
BMWN1_0062_E11.b :
BMWN1_0074_F01.b :
BMWN1_0056_E05.b :
BMWN1_0041_B02.b :
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b : ncccgctcaggacgcgccnttctatttacccccncnnnnngggattttnngggcncccct
BMWN1_0052_H09.b :
BMWN1_0087_A11.b :
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BMWN1_0086_B05.b : naactagttatacgccgctagt
BMWN1_0065_A11.b : ntttagcagagtacacgcagtact
BMWN1_0041_H11.b : gcatgtacgacgcattagta
BMWN1_0046_F03.b :
BMWN1_0037_H03.b : ttttggagagtagacxxxxxxxxxxxxxxxx
BMWN1_0037_F10.b : ttttncgagagtacgaxxxxxxxxxxxxxxxxxx
BMWN1_0099_B07.b : ttgggcaggtagacgccgtaxxxxxxxxxxxxxxxx
BMWN1_0059_A09.b : nttggagagtacgaggxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0087_G11.b : ttttggcatagagacgccgtaxxxxxxx
BMWN1_0089_G05.b : nnnggagacggtagacgxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F12.b : ttcccaatgacacgccgtagtatttatxxxxxxxx
BMWN1_0036_H12.b : ttgcgcaggaagacgccgtaxxxxxxxxxxxxxxxxxx
BMWN1_0088_G05.b : nnnaaggagaggtagacxxxxxxxxxxxxxx
BMWN1_0030_G11.b : ttttggagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0091_E05.b : nccgagagtagacgxxxxxxxxxxx
BMWN1_0016_F04.b : ttttaggcagagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0018_B10.b : tttttcccaagtaacgacgxxxxxxxxxxx
BMWN1_0013_G12.b : ttttttcgcaggtagacgxxxxxxxxxx
BMWN1_0062_F12.b : ntttggatagtacgacgxxxxxxxxxx
BMWN1_0080_G07.b : ttttagacagtacgacgxxxxxxxxx
BMWN1_0096_D04.b : tttttggacggtacgacgxxxxxxxxxxx
BMWN1_0010_E03.b : nnnnnggagagtacgaggxxxxxxxxxx
BMWN1_0021_G08.b : ttttggagagtacgaggxxxxxxxxxxx
BMWN1_0083_A07.b : nnnttcgcagagacgaggxxxxxxxxxx
BMWN1_0008_D09.b : nttaaccgagagtacgacgxxxxxxxxxx
BMWN1_0057_F04.b : nnnngggagagtacgaggxxxxxxxxxxx
BMWN1_0073_A02.b : tttgcatgagtaagacxxxxxxxxxxxxx
BMWN1_0050_G06.b : nnnnnggatagtagacxxxxxxxxxxxxx
BMWN1_0024_G05.b : ttttgggagagtagaggxxxxxxxxxxx
BMWN1_0058_B01.b : tcgcgagtacgaxxxxxxxxxxxxxx
BMWN1_0005_B12.b : nttttggacgagtagacgcagtagtatt
BMWN1_0084_D12.b : tttttagcaggtagacgxxxxxxxxx
BMWN1_0100_F02.b : tttttggagagtacgacgxxxxxxxxxx
BMWN1_0050_H04.b : nnggaggcaggtagaggccgtaxxxxx
BMWN1_0099_E08.b : ntcgcaagtagacgxxxxxxxxxxx
BMWN1_0062_E04.b : nttgggacggtacgaxxxxxxxxxxxxxxx
BMWN1_0050_H05.b : nnttgggacggtagaxxxxxxxxxxxxxx
BMWN1_0090_G05.b : nnnnaaggagagtxxxxxxxxxxxxxxxxxx
BMWN1_0074_F02.b : tttccatatacgacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0012_A09.b : tttttagacgagtagacgxxxxxxxxxxx
BMWN1_0090_H02.b : nnnggcgagagtxxxxxxxxxxxxxxxxx
BMWN1_0018_H10.b : nntttgagacgagtagaxxxxxxxxxxxxxx
BMWN1_0100_G09.b : ttttacgagagtacgaggxxxxxxxxxxxx
BMWN1_0012_C04.b : tttttggcagagagacgxxxxxxxxxxxx
BMWN1_0022_E01.b : tttatggatagtacgacgxxxxxxxxxxx
BMWN1_0077_E01.b : tttttggatagtaagaggxxxxxxxxxx
BMWN1_0088_A02.b : nnnaacgagagtacgaggxxxxxxxxxx
BMWN1_0028_G02.b : ttttagcaagtacacgcagtagtatt
BMWN1_0097_H08.b : nnnnggagagtagaggxxxxxxxxxx
BMWN1_0020_C01.b : nnnnccgatagtxxxxxxxxxxxxxxxxxx
BMWN1_0011_B10.b : tttttagcaggtacacgccgtaxxxxx
BMWN1_0020_G02.b : ntttcgatggtacgacgxxxxxxxxxx
BMWN1_0075_D01.b : ttttccgagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0093_B07.b : tttttgcaggtagaxxxxxxxxxxxxxxx
BMWN1_0066_G03.b : nnnaagatggtxxxxxxxxxxxxxxxxx
BMWN1_0007_B05.b : nnnnnnggacagtxxxxxxxxxxxxxxxxxx
BMWN1_0065_G11.b : nttttggagagtacgaggxxxxxxxxxx
BMWN1_0086_H10.b : nnttgagagagtagaggxxxxxxxxxxx
BMWN1_0055_A03.b : nnngggagagtagacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0024_C07.b : nntttagacgagtagacxxxxxxxxxxxxx
BMWN1_0083_C12.b : tttttagacgagtagaggxxxxxxxxxxx
BMWN1_0030_G02.b : ttttagcagagtagacxxxxxxxxxxxx
BMWN1_0062_G07.b : ntttggatagtacgaggxxxxxxxxxxx
BMWN1_0044_B03.b : nnnccgaggtaagacgccgtagtatt
BMWN1_0061_B06.b : tccagagtacgaxxxxxxxxxxxxxx
BMWN1_0069_G10.b : tttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0039_D05.b : nggaggttnnnnnnnccagagtacacgcagtagtat
BMWN1_0076_C01.b : tttnncgatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0100_A01.b : tttttagcaggtagacgcagtagtattaaxxxxxxxxxx
BMWN1_0013_C07.b : tttttggcagagagaxxxxxxxxxxxxxxx
BMWN1_0050_G07.b : nnnngggagagtagacxxxxxxxxxxxxxx
BMWN1_0053_E08.b : tttttggcaggtacgacgxxxxxxxxxxx
BMWN1_0088_A06.b : nnnnaagagagtacgacgxxxxxxxxxx
BMWN1_0033_C08.b : tttttggagagtacgacgcagtagtaxxxxxxxxxxxxxxx
BMWN1_0072_G07.b : tttaggatagtacgacgxxxxxxxxxxxx
BMWN1_0085_C04.b : naaaccgagagtacgaggxxxxxxxxxxx
BMWN1_0002_H12.b : nttttggagagtacacgcantagtaxxx
BMWN1_0015_G06.b : tttttggagagtacgacgcagtagtaxx
BMWN1_0064_G07.b : nnnaaggagagtacgaggxxxxxxxxxx
BMWN1_0082_A08.b : tttcgcagagtacgaggxxxxxxxxxxx
BMWN1_0088_A05.b : nnnggcgacggtagaggxxxxxxxxxxx
BMWN1_0002_G04.b : ntttggagagtagaggxxxxxxxxxxx
BMWN1_0089_D12.b : ttttaggacggacgaggxxxxxxxxxx
BMWN1_0018_D07.b : tttttagacgagtacacxxxxxxxxxxxxxx
BMWN1_0081_A06.b : tttttagagagtacgaxxxxxxxxxxxxxxx
BMWN1_0074_A10.b : tttcgagagtacgaxxxxxxxxxxxxxx
BMWN1_0047_C08.b : nnntccagagtagacgccntaxxxxxx
BMWN1_0050_E03.b : nnnnnggacgagtagacxxxxxxxxxxxxxx
BMWN1_0070_C01.b : tttttggatggtxxxxxxxxxxxxxxxxxxx
BMWN1_0041_D04.b : nnggcaagtacacgxxxxxxxxxx
BMWN1_0048_E04.b : ttttnggcagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_B02.b : tttttggatagtacgacgxxxxxxxxxx
BMWN1_0053_H06.b : tttaacgcagtacacgxxxxxxxxx
BMWN1_0030_E07.b : tttttggcagagtacgacgxxxxxxxxxxx
BMWN1_0062_A03.b : ntccatattacgaxxxxxxxxxxxxxx
BMWN1_0046_A02.b : tttggatagtagacgxxxxxxxxxxx
BMWN1_0046_D09.b : nnnggatggtagaggxxxxxxxxxxx
BMWN1_0078_A05.b : nnnnnggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0047_A12.b : nntttagcaggtacacgcantaxxxxxx
BMWN1_0086_C07.b : nnttagagagtacgaggxxxxxxxxxx
BMWN1_0057_A12.b : nnnnccgatagtacgaxxxxxxxxxxxxx
BMWN1_0020_A11.b : ntgccagagtacgaxxxxxxxxxxxxxx
BMWN1_0075_D08.b : nnngggagagtacgacgxxxxxxxxxxx
BMWN1_0016_C10.b : tttttacgagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_E12.b : nnnnnncgagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0019_D03.b : tttccgatagtacgaggxxxxxxxxxxxx
BMWN1_0021_D09.b : nncccagagtacgaxxxxxxxxxxxxxxx
BMWN1_0061_H11.b : ttttggagagtacgacgxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B07.b : nngggagagtacgaxxxxxxxxxxxxxx
BMWN1_0047_H02.b : nnntttcgaaagtxxxxxxxxxxxxxxxxxx
BMWN1_0028_C08.b : ttttagcagagacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0056_G01.b : ttccacaggtacgacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0001_E04.b : nnngggatagtagacgccgtaxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b : nnnnnggcagagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0041_C12.b : nggcatttttntttggcagagtagacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0031_F12.b : tttttgaaagtacacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0100_D04.b : tttncgagagtagaggxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b : tttttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_C11.b : tttttggacggtacacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_F08.b : nnnaagcagagtagaggxxxxxxxxxxxxxxxxxxxxx
BMWN1_0064_F10.b : tttttggatagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0054_A06.b : ttttaggcagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_C03.b : ntaaccgagagtagaggcagtagtattaaxxxxxxxx
BMWN1_0048_G11.b : nntttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0072_A10.b : tttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0068_B06.b : ttttaggatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0007_C09.b : ntttaggagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0020_D11.b : tgggagagtacgacgcagtagtattaaxxxxxxxxx
BMWN1_0036_B10.b : ttttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0037_E04.b : ttttccgaaggaagaggxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0071_B05.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxx
BMWN1_0097_D05.b : ctttnnaatttttttnttnnnnnnnnnnngggaagtacacgccntagnttttatxxxxxx
BMWN1_0017_B03.b : tttttaagagagtacgacgxxxxxxxxxx
BMWN1_0003_D01.b : nttacgcaggtagacgccgtaxxx
BMWN1_0083_C04.b : nnnnccgcaggagaggxxxxxxxxx
BMWN1_0069_E06.b : tttttagatagtacgacgxxxxxxxx
BMWN1_0083_E04.b : tttttggcaggtagacxxxxxxxxxxxx
BMWN1_0092_D05.b : ttaaccgagagtacgacgxxxxxxxxxx
BMWN1_0099_A06.b : ngggcaggtaacacgccgtagt
BMWN1_0032_D01.b : tttttagcagagtacacxxxxxxxxxxxxx
BMWN1_0003_C12.b : ttttaggagagtagacxxxxxxxxxx
BMWN1_0080_A07.b : tttttcgagagtacgaxxxxxxxxxxxxx
BMWN1_0084_F08.b : tttttcgcaggtagacxxxxxxxxxxx
BMWN1_0048_F01.b : tttttggcaggtagaggxxxxxxxx
BMWN1_0067_H03.b : tttggatagtacgaggcagtagta
BMWN1_0064_B01.b : nttttagatagtacgaggxxxxxxxxx
BMWN1_0065_H08.b : ntttgggagagtacgacgxxxxxxxxx
BMWN1_0043_C11.b : ttttggcaggtagacgxxxxxxxxx
BMWN1_0093_F03.b : tttttgcagagacacxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0080_B12.b : tttttggatagtacgacgxxxxxxxxx
BMWN1_0028_F10.b : tttttagcaggtacacgxxxxxxxxx
BMWN1_0056_A09.b : tggctagaaagaxxxxxxxxxxxx
BMWN1_0073_G04.b : nggatagtacgacgccgtagta
BMWN1_0062_B07.b : nnnnccatggtacgaggxxxxxxxxxxxxxxxxxxxx
BMWN1_0083_H10.b : nttttacacggtagaggccgtaxxx
BMWN1_0036_E02.b : ttggagagtaagacgxxxxxxxxx
BMWN1_0046_F04.b : nnnccgacggtagacgxxxxxxxx
BMWN1_0041_E05.b : nnccgaagtagacgxxxxxxxxx
BMWN1_0048_G12.b : nntttagcagagtagacxxxxxxxxxxx
BMWN1_0066_G07.b : nttttacgagagtacgaggxxxxxxxxxx
BMWN1_0030_B05.b : tttttccagagtacgacgcagtagtax
BMWN1_0060_A01.b : tttggagagtaagacgxxxxxxx
BMWN1_0001_D08.b : nnnnggcaggtacgacgxxxxxxxx
BMWN1_0053_A04.b : tttttaccagagtagacgxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0031_D09.b : tttttccagagaagaxxxxxxxxxxxxx
BMWN1_0002_D01.b : ttttagagagtacacgxxxxxxxxxx
BMWN1_0065_G06.b : tttggcatgagtxxxxxxxxxxxxxxx
BMWN1_0100_G07.b : nttaagagagtaacacgccgtxxxxx
BMWN1_0030_E03.b : ttagcaagtagacgcagtagtattaaxxxxxxxx
BMWN1_0035_G03.b : tttttggcagagagacxxxxxxxxxxx
BMWN1_0031_C01.b : ttttagcaagtacgangcagtagtaxx
BMWN1_0037_C04.b : nggcaatgtacgacgcagtcgtaxx
BMWN1_0063_D12.b : tttttgcacggtagacgxxxxxxxx
BMWN1_0022_D06.b : gcacataaagacgccgtacxxx
BMWN1_0077_D02.b : nnnnggagagtacgacgxxxxxxxx
BMWN1_0078_D03.b : tttttggagagtacgaggccgtaxxx
BMWN1_0081_F07.b : ttgggagagtacgacgxxxxxxxxx
BMWN1_0003_E09.b : ttttagcaggtacgacgccgtaxxxxx
BMWN1_0068_D05.b : ttttggatagtacgacgccgtaxxxxx
BMWN1_0034_G03.b : tttttggcaagtacacgxxxxxxxxx
BMWN1_0003_F08.b : ttttggcaagtacgaxxxxxxxxxxxxx
BMWN1_0067_F02.b : tttccgagagtacgacgxxxxxxxxx
BMWN1_0092_A04.b : ttttgggatggtxxxxxxxxxxxxxxxxx
BMWN1_0074_G11.b : ttttggatagtacgaggxxxxxxxxxx
BMWN1_0024_C12.b : nttttaccaggtagacgxxxxxxxxxx
BMWN1_0061_H03.b : ttttccgatagtacgaggxxxxxxxxx
BMWN1_0089_F07.b : nnnggggagagtacgaggxxxxxxxxxxx
BMWN1_0010_D11.b : nnnggagatggtacgacgxxxxxxxxx
BMWN1_0084_E05.b : nnncgcaattacgaxxxxxxxxxxx
BMWN1_0070_F04.b : ttcccatagtacgacgxxxxxxxxxx
BMWN1_0091_E10.b : nnttggagagtacgacgccgtaxxxxx
BMWN1_0091_A12.b : ttgggagattacgacgxxxxxxxxxx
BMWN1_0009_G09.b : nntttaggagagtacgacgxxxxxxxxxx
BMWN1_0001_B08.b : nnttgatagtaagaxxxxxxxxxxxxx
BMWN1_0066_H07.b : nntcccatagtacgaggxxxxxxxx
BMWN1_0082_A09.b : tttttggagagtxxxxxxxxxxxxxxxxxxx
BMWN1_0032_D09.b : ttttagacagagtacacgxxxxxxxxx
BMWN1_0060_A03.b : tttgagatggtacgaggxxxxxxxxxx
BMWN1_0013_B05.b : tttttaagcaagntagacxxxxxxxxxxxxx
BMWN1_0047_E05.b : nnnnnggcagagtacacgxxxxxxxxxx
BMWN1_0062_B10.b : ttttggatggtacgaggcagtxxxxx
BMWN1_0090_A02.b : ttttaggcaggtagaggxxxxxxxxx
BMWN1_0090_A07.b : nnnaaggagagtaagaggxxxxxxxx
BMWN1_0083_D03.b : ttttccgcaggtxxxxxxxxxxxxxxxxxx
BMWN1_0009_A07.b : nttttgagagagtacgacgxxxxxxxxxx
BMWN1_0069_D11.b : tttttggatagtacgacgxxxxxxxxxx
BMWN1_0038_B05.b : tttccgcaggaagaggxxxxxxxxxx
BMWN1_0087_G08.b : nnnttcacgggtagaggccgtagta
BMWN1_0018_H11.b : ttttttcgcaggtacgacgcagtagtaxx
BMWN1_0050_G03.b : nnnaacgcaggtagaxxxxxxxxxxxxxx
BMWN1_0060_F12.b : ttttagccgagtxxxxxxxxxxxxxxxxx
BMWN1_0095_F07.b : ttttaccagagtacacxxxxxxxxxxxx
BMWN1_0021_D02.b : tttttggatagtacgacgxxxxxxxxx
BMWN1_0051_C04.b : tttttggcaagtagacgxxxxxxxxxx
BMWN1_0054_G03.b : tttttggcaagtagacxxxxxxxxxxxxxx
BMWN1_0020_E06.b : tttnggatagtacgaggxxxxxxxxxxx
BMWN1_0057_A08.b : nnnaaagacagtacgacgxxxxxxxxxx
BMWN1_0089_B01.b : nnnggggagagtacgaggxxxxxxxxxx
BMWN1_0025_H06.b : nnnaaagcaggtacacgxxxxxxxx
BMWN1_0040_F07.b : tttggcaggtagacgxxxxxx
BMWN1_0065_A07.b : tttttggatagtxxxxxxxxxxxxxxxxxx
BMWN1_0067_B01.b : tttttggatagtacgacgxxxxxxxxxxx
BMWN1_0091_A06.b : ntttagacagagtacgacgcagtagtaxx
BMWN1_0005_H04.b : nnttacagagaagaggxxxxxxxxx
BMWN1_0023_A08.b : nntttagcagagtacacgxxxxxxxxxxx
BMWN1_0080_F01.b : ttttacgagagtacgaggxxxxxxxxx
BMWN1_0091_H02.b : ttttccagagtacgacgxxxxxxxxxx
BMWN1_0026_G01.b : tttttggagagtagaggxxxxxxxxxx
BMWN1_0049_B11.b : tttttggacgagtacacxxxxxxxxxxxxxxxxxxxxx
BMWN1_0028_C11.b : tttttggcagagtagacxxxxxxxxxxxxx
BMWN1_0023_A12.b : nntttagcaggtagacgxxxxxxxxxx
BMWN1_0028_E07.b : tttttggcaggtacacgxxxxxxxxx
BMWN1_0077_E11.b : ntttacgagagtacgacgxxxxxxxxxx
BMWN1_0098_B09.b : tttcccagagtagacgcagtagta
BMWN1_0040_E09.b : nncccaataagaggccgtagtax
BMWN1_0028_H02.b : ttttggcaggtacacgccgtaxxxxxx
BMWN1_0070_E09.b : ttttggacagtacgacgxxxxxxxxx
BMWN1_0022_D07.b : nttggcaggtacgaggccgtaxxxx
BMWN1_0012_B02.b : tttagaaagtagaggxxxxxxxxx
BMWN1_0039_B02.b : nnnngcgagtagaggcagtagtat
BMWN1_0026_E12.b : tttttggcaggtacgacgxxxxxxxxx
BMWN1_0026_F03.b : ttttnggacgagtacacgxxxxxxxxx
BMWN1_0099_A05.b : ttttggacgagtxxxxxxxxxxxxxxxxx
BMWN1_0059_D07.b : nttccgacagtacgaggxxxxxxxxxxx
BMWN1_0002_D08.b : nnnnggacgagtagacgxxxxxxxxx
BMWN1_0058_C10.b : nttggatggtacgacgxxxxxxxxxx
BMWN1_0003_F12.b : nttttgagcaggtagaxxxxxxxxxxxxx
BMWN1_0010_C11.b : ttttttggagagtacgacgxxxxxxxxxx
BMWN1_0091_E12.b : tttttagcagagtagaggxxxxxxxxxxx
BMWN1_0056_B04.b : nnnccgagagtacgaggxxxxxxxxxx
BMWN1_0068_B10.b : tttttagatagtxxxxxxxxxxxxxxxx
BMWN1_0085_H06.b : tttttggcagagtagaggxxxxxxxxxx
BMWN1_0001_A07.b : ttttggcagagtagacgxxxxxxxxx
BMWN1_0040_B09.b : ngaaattaagacgxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_G01.b : ntttnggacgagtacacgxxxxxxxxxxx
BMWN1_0075_B12.b : ttttacacaggtagaxxxxxxxxxxxxxx
BMWN1_0088_D09.b : ttttggcagagtaagaggccxxxxxxxxxxxxxxxxxx
BMWN1_0092_B11.b : ttttggagagtagaxxxxxxxxx
BMWN1_0032_E12.b : tttattgggaatttgttgattttnccattttttggttnnnggcatagtxxxxxxxxxxxx
BMWN1_0100_G01.b : ttaagatagaacgacgcagtagtxxxxxxxxxxxxxx
BMWN1_0039_C10.b : tttggcaagacgaggxxxx
BMWN1_0012_G10.b : ttttttggcagagtagaxxxxxxxxx
BMWN1_0073_H03.b : ttttacgatagtacgaggxxxx
BMWN1_0039_B11.b : ttttcctaagagaggxxxxxxxxxxxxxxxxx
BMWN1_0052_A05.b : tttaggcaggtagacngcanta
BMWN1_0027_G06.b : ttttggcagagtagaggxxxxx
BMWN1_0096_E03.b : tttccgacggtagaggxxxxxxxxxxxxxxxxxxx
BMWN1_0062_E11.b : cttagaacgaggcctttattatttatacgactc
BMWN1_0074_F01.b : taccatagtacacgxxxxxxxxx
BMWN1_0056_E05.b : ncactattxxxxxxxxxxxxxxxxx
BMWN1_0041_B02.b : ttgcagtgagacgxxxxxxxx
BMWN1_0085_E06.b : nnaaaggacgagtacacgxxxxxxxxxxxxxxx
BMWN1_0016_F09.b : ttttttggacggtagacgxxxxxxxxxxxxxxx
BMWN1_0097_G01.b : tttttggagagtagaggxxxxxxxxxxxxxxxx
BMWN1_0017_B12.b : gggaaacggnactcccnnncntnnnttntntttttttttttggcaggtacacgcantagn
BMWN1_0052_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0087_A11.b : ttttnncgagagtxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 50
BMWN1_0037_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0059_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0087_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGGCTC*CCTT*AGCACCATGG**AGA
BMWN1_0089_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0040_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTGACTCACCTG*GGCACCATGG**AGA
BMWN1_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxttTGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGCTCACCTGTGGCACCATGG**AGA
BMWN1_0030_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0091_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0013_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0062_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*AGAACCATGG**AGA
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0021_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCC*CTTACCATGG**AGA
BMWN1_0008_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GCCACCATGG**AGA
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0073_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACTTG*GGCACCATGG**AGA
BMWN1_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0024_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0058_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCCCACTTG*GGCACCATGG**AGA
BMWN1_0005_B12.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0084_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*TTCACCATGG**AGA
BMWN1_0062_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0090_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0074_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcccttaTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0012_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0090_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0012_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0022_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0077_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0028_G02.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0097_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0020_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0075_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0093_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0066_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*GGCACCATGG**AGA
BMWN1_0007_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0065_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0086_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0055_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaTGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0024_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTC*GGCTCCATGG**AGA
BMWN1_0030_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0062_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0044_B03.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GTGCCCATGG**AGA
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCCCTTT*GGCACCATGG**AGA
BMWN1_0069_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0039_D05.b : taaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0076_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0013_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0033_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0085_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0002_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0015_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0064_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0082_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0088_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0002_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0089_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0018_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0081_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0074_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCCCACTTG*GGCACCATGG**AGA
BMWN1_0047_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0050_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTGGGTCACCATGG**AGA
BMWN1_0070_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0041_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0048_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTT*AGCA*CATGG**AGA
BMWN1_0030_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCCCCTA*AGCACCATGG**AGA
BMWN1_0046_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0046_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTGGGCTCACCTT*GGCACCATGG**AGA
BMWN1_0078_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0047_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0057_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0075_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0016_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0063_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0019_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0021_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0061_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0044_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCCG*GGCACCATGG**AGA
BMWN1_0047_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTC*GGTTCCATGG**AGA
BMWN1_0028_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0056_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0017_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0090_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0064_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0054_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0072_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0068_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0007_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0020_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0036_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0037_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0071_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0017_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0003_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0069_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0099_A06.b : atttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCC*TTTAA*ATGG**AGA
BMWN1_0032_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0003_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0084_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0048_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0067_H03.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0064_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0065_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GTCACCATGG**AGA
BMWN1_0043_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTCCGCTTCCATGG**AGA
BMWN1_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0080_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTT*TTAACCATGG**AGA
BMWN1_0073_G04.b : tttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TTAACCATGG**AGA
BMWN1_0062_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0083_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GCCATTATGG**AGA
BMWN1_0036_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCT*TTCACCATGG**AGA
BMWN1_0046_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*CGTTCCATGG**AGA
BMWN1_0041_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*CTTACCATGG**AGA
BMWN1_0048_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0066_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0030_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0060_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCT*TGCACCATGG**AGA
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0053_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*GGCACCATGG**AGA
BMWN1_0002_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTG*TGCACCATGG**AGA
BMWN1_0065_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCCG*GTCACCATGG**AGA
BMWN1_0100_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCACCTC*GTTTACATGG**AGA
BMWN1_0030_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcattaGCTCACCTG*GGCACCATGG**AGA
BMWN1_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCACCTG*GGCACCATGG**AGA
BMWN1_0031_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0037_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*TGCACCATGG**AGA
BMWN1_0063_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCT*TTTAACGTGG**AGA
BMWN1_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0078_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0068_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0034_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0067_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0092_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTGGCACCATGG**AGA
BMWN1_0074_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0024_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CTCTCCATGG**AGA
BMWN1_0061_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0089_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0010_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0084_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CTTTATATGG**AGA
BMWN1_0070_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*GGCACCATGG**AGA
BMWN1_0091_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0009_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0001_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCT*TGCACCATGG**AGA
BMWN1_0066_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0082_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0032_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0060_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0013_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0047_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0062_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0090_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0090_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TTCACCATGG**AGA
BMWN1_0083_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0009_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0069_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0038_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0087_G08.b : tttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCC*GTCACCATGG**AGA
BMWN1_0018_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0050_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0060_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTA*TGAACCATGG**AGA
BMWN1_0095_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0051_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0054_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0020_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0057_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0089_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0025_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0040_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GCCACTATGG**AGA
BMWN1_0065_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0067_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0005_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*CGTACCATGG**AGA
BMWN1_0023_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0080_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTT*GGCACCATGG**AGA
BMWN1_0026_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0049_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GGCACCATGG**AGA
BMWN1_0028_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0023_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTTGCACCATGG**AGA
BMWN1_0098_B09.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*TTCACCATGG**AGA
BMWN1_0040_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*TTCACCATGG**AGA
BMWN1_0028_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0070_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTGTGGCACCATGG**AGA
BMWN1_0022_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0012_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0039_B02.b : taaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GCCACTTTGG**AGA
BMWN1_0026_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTC*GGCACCATGG**AGA
BMWN1_0026_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCCG*GTCACCATGG**AGA
BMWN1_0099_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GTCACCATGG**AGA
BMWN1_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0002_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0058_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0003_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0010_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0091_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0085_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0001_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*TGCACCATGG**AGA
BMWN1_0040_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttaagaTCACCTG*GGCACCATGG**AGA
BMWN1_0023_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0075_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACCTG*GGCACCATGG**AGA
BMWN1_0088_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCACCTG*GGCACCATGG**AGA
BMWN1_0092_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0032_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0100_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxcccctttaaagGACCTG*GGCATCANGG**AGA
BMWN1_0039_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCACTGGTAGA
BMWN1_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0073_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*CGCTCCATGG**AGA
BMWN1_0039_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*TGCACCATGG**AGA
BMWN1_0052_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GCGCCTATGG**AGA
BMWN1_0027_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCTG*GGCACCATGG**AGA
BMWN1_0096_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccattaatACCTG*GGCACCATGG**AGA
BMWN1_0062_E11.b : ccatagggaattaaatgatttccgccgccttttaggcctcCCTG*GGCACCATGG**AGA
BMWN1_0074_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcCCTTTGGCACCATGG**AGA
BMWN1_0056_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcatccCCTT*TACACCATGG**AGA
BMWN1_0041_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcaCCC*TTTCAAATGG**AGA
BMWN1_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0016_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACCATGG**AGA
BMWN1_0017_B12.b : tttanacgactcctatanggaatttaatgaattgaggctcacctgggcacCATGG**AGA
BMWN1_0052_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagagggnctgggaaagATGG**AGA
BMWN1_0087_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaacaataacccatcaaaccactggacgtg
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 110
BMWN1_0087_A11.b : aaaagccaacactgtgcctggggacgctggtcactgatggcttctgctgaCTGGGACTCA
BMWN1_0070_B05.b : tttgggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 169
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 227
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 286
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 346
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 405
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 463
BMWN1_0032_E12.b : CATCCCCTGCAATtgagttccaagtttcaggggaagtcccccctttctattgtaggccta
BMWN1_0017_B12.b : CATCACCTGCAATGAagtttcagggtgtcaggggagggtccccgttctattgaaagccta
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 523
BMWN1_0092_B11.b : AAGTTCTGCATacgatccatacaaaaaggacgcagccacatctcttttaacctcctagga
BMWN1_0032_E12.b : ggttctgccttcgtttccaaaaaggataaaggttccaaaggagggttttccccccccctt
BMWN1_0017_B12.b : agttctccttccggtttccaacaaagaataacgttttccaaggcaaggctttccctcccc
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 581
BMWN1_0031_C01.b : TTTTcccgggccaagttccgtcccctaatttttccgctccacctttcccgcccccacttt
BMWN1_0092_B11.b : cttgaataataaaaatattttatctcacccattagcaaatatactaaaccgcaagggccc
BMWN1_0032_E12.b : ttttccggggggccgtttttccttccccatattttttccccccccaccttttggggcccc
BMWN1_0017_B12.b : ccattttccccggggccagggtttcgcccccccaatttttccccccccccttttttcggc
BMWN1_0055_G01.b :
---------+---------+---------+---------+---------+---------+ 640
BMWN1_0031_C01.b : cggtccaccaggttccctaggtaaccgtgaatgatttgcttgcaacttccccaaaaggcc
BMWN1_0092_B11.b : atgattgtaatcaataatatttctcaactataataaaaaaaaaaaatagtttacaaagat
BMWN1_0032_E12.b : cactttttggtccccccaagtttcctggttaaaggggaagggtttttccggcaccccccc
BMWN1_0017_B12.b : cccacccttttggtcccccaaagggttccctgggtaaaagggtaaggatttttcggggaa
BMWN1_0055_G01.b : naagccgagagtaagaxx
---------+---------+---------+---------+---------+---------+ 696
BMWN1_0091_E05.b : aaggcttccgtacataaatcccaacaggagacctagctctgcttgcccagcccgctctgt
BMWN1_0016_F04.b : agaaggctttcngtacattaaaatccagcaagagacctaacatctgcttgcccaggccgc
BMWN1_0017_B03.b : CAGAAGGCTTTT*CG*TACATTAAAaatccagcagggagactagcatctgctttgcccag
BMWN1_0031_C01.b : ttccgttaattataacccagcaagggaaccttaactttttctttgccaagacccgcttct
BMWN1_0092_B11.b : agctcccgcgaatttatctaaacactaaatatatgtatacaaaattccatactcccttag
BMWN1_0032_E12.b : ccaaagggccttttgtttattttaatccccccgcaaggaaaaacttaattttcttttttt
BMWN1_0100_G01.b : aaaaggcttttcagacaattataaccccgcaaggaaaccttaacatcggctttgccttag
BMWN1_0062_E11.b : CCagaacgcctttcctgtcattaaaaccccaccaggagacctaagaatctgcttttcccc
BMWN1_0017_B12.b : cccccccccaaagggccttttttgtatcttataaaccccccccgagggaaaacaaaaaaa
BMWN1_0055_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAA*GCATCTGCTTT*G
---------+---------+---------+---------+---------+---------+ 754
BMWN1_0041_H11.b : CCCCGGCCCC*CTTCTGTCAAAATAATT*TCTtgtgaaccccgatatacatccataaaaa
BMWN1_0046_F03.b : CCCAGTCCCCCCATCTGTTaaataatttcttgttgacccctataaatcatatattttttt
BMWN1_0037_H03.b : CCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTtganccnnnnnnaanannaaaaaann
BMWN1_0036_H12.b : cccagccccgcatctgttcaaattaatttcttgttaaaccccctttaatattattaaata
BMWN1_0030_G11.b : GCCAGG*CCCGCATCTGTCAAATAAATT*CTTGTGaaaacaaaaaaaaaaaaaaaaaaa
BMWN1_0091_E05.b : aataaatctgtgaaccaaaaaaaaaaa
BMWN1_0016_F04.b : atctgtcaataatcttgtgaacaaaaaaaaaaaaaaaaa
BMWN1_0018_B10.b : CCCCAGCCCCGCATCTGTCAAATAATTT*CTTGgtgaacccnnnaaccttcccaaaataa
BMWN1_0030_E07.b : GCCCAG*CCCGCATCTGTCAAAT*AATT*CTTGTGaaacaaaaaaaaaaaaaaaaaaaaa
BMWN1_0031_F12.b : GCCCACGCCCCCCTCTTTCAAATAAATT*CTTGTGaaacccaattaaattaaaataaaaa
BMWN1_0017_B03.b : cccgatctgtcaaataattctgtgaaaacaaaaaaaaaa
BMWN1_0031_C01.b : gcaaaaaaattcttggtgaccccataaattcattatttataaataaaaatataaaattta
BMWN1_0063_D12.b : CCCAGG*CCCGCATCTGTCAAATAATTT*CTTGTGAcccccnnnaaaaattgataagcac
BMWN1_0092_B11.b : aaaattattaggatatatccttttataacacaatttttatttataataaaatttatcaat
BMWN1_0032_E12.b : cccccgccccccctttttaaaaaaaattctgttgtggaccccccaaaaaaaaaaaaaaaa
BMWN1_0100_G01.b : tccgcatctgttaaaaaattcttggtgaaccaaacaataacaactttaaaaattcttaca
BMWN1_0062_E11.b : agccccccttctgtcaaataatttcttgtgaaacctatccaccatatatataaattcatc
BMWN1_0017_B12.b : ttttttttttttctcccccccccccccctcttttaaaaaaaaattttcttttgagaaacc
20110601C-000186 : AAAAAAA.....................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aaaatcttagaactgaaaccttaattcaccctctgatattcagatcattgagtcatttcc
BMWN1_0065_A11.b : aaacattttcattcaactttaagtccttttttttcttggcctcccggcctttcttttccc
BMWN1_0041_H11.b : ctttaaacttttaatcacacacacaaatcccttcacaccgccacccacctcgcggcgaaa
BMWN1_0046_F03.b : aattcatttaaaattataatatgttccctctcccccttatccctcttagcgaattttaat
BMWN1_0037_H03.b : aaaaaaaanaaaannaaaannnaaananaannnnnnnnnnnnggnannnnnnaaaaaaan
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : gatctatatatatataatatactttttttccgggcgccgggcactccctttggttggctt
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : ctcaaataaaaaaatgtccccggcccccggtaccccctttgaggggggaatctccccccc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : aaaaanaannannnnannaaannaaannnaaaannnnnnnnnnnnnnnnnccccnccccc
BMWN1_0036_H12.b : taatataataattacttaatctgaattctctctattatcatattacttctacacaatctt
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : ccacataaaacaaatatttttcccttttttctcccngtggnccccggcctcccttttttg
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : nnannnnnnannnnnnnnnaannnnnannnnnnnnnaaaannnnnnnnnnnnccccccnn
BMWN1_0080_G07.b : nnnnnnnnnnnnnnnnnnnnnnnaanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_E03.b : nnnanaanaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : nnaaaaaaanaaaaaantttnnnnggggcccgaatcccccntatctcacgnttaattggg
BMWN1_0083_A07.b : aaaaaaaaaaaaaaaaaaaanaaanaaaaaaaaatannnaaanaaaaannnnaanaaaaa
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : tataagaaaaacaatggtaaataataaaaatttaagcctctcaagcgtccacggccccac
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : ttcctcacacccttcacatcattgtttctctttccccgcttctcacttctcctcaaccac
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : gacaatcatgacttctatacttatttactaccatcgatttcctagcgcgccgcggaacca
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : aaataaaaaaaannnaaaannnnnntnaananntaaananttatnnttnnttnnntttta
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : attaccaacttaaaaaattttatttttttcctctctctcacctatatcaatttctttttg
BMWN1_0069_G10.b : nnnnnnnccnnnnnaaaannaaaaaaaaaaaaanannannnnannnnnnnnnnnnnnnnn
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : taattaacattttttgttgatttatttttttacttttttatttttaccggggccgggatt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : actatagtagatggtatgagaaagaatgataagaggaagcgtagattttcccccggcccc
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : taaaaannannaanaaataatataaattaatatatcatttaatttttttttgccggggcc
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aaaaaaaaanannaaaaannnnnnanannnnnaaggcggggaaacncccnaaaaaaaagg
BMWN1_0048_E04.b :
BMWN1_0067_B02.b : a
BMWN1_0053_H06.b : aaaaaaaaaaaaaaaaaaaaannnnnanaannnnnannnnnnnnnnnnnnnnnaanannn
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : AAAttattctactatccttttttgtttcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aaaaaaagaagaaaagaaaaantttnggggggcccccgagcgcccgttaggggggggtga
BMWN1_0046_D09.b : aaaaannaaaaaannnnaanaaaannaanaannnnannnannnnaaaaggtcccgggccc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b : aaa
BMWN1_0086_C07.b : aaaaaaaaaaaaaaaantxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0057_A12.b : AAA
BMWN1_0020_A11.b : aaaaataataaaatatnannaaaaaaaaaaatnnaaannannnccnngcctcccgcggtg
BMWN1_0075_D08.b : aaaataattatataaatanacaatattaaatttaattatattttttattagttttaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b : a
BMWN1_0019_D03.b : aaaa
BMWN1_0021_D09.b : aaaaaaaaaaaaaannaaaaaaananaaanaaaaaaaaaaaaaannaannaaananaaaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aaaaaaanaaaaaaaaaaaaanaaaaaaannaaannnnggtaccccggccgccgatctcc
BMWN1_0047_H02.b : aaaannaaaaaaanaaaaannnnnaaaaaaannnnnannnnaaaaaannnnannccnaaa
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ctatcaccctaacaaaaattttaattacccgggcccgcgaattccccttttggggagggt
BMWN1_0001_E04.b : aaaanaattaaannanannaaagtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b : a
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : atttaactaatattaacaattactacttagatctgtatcttattactcacattccttttc
BMWN1_0100_D04.b : annnnnnnnnnnnnnnnnnnnnnnaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : aaaaaaaaaaaaaaaaaaaaattaccncggacccaggttnccccttcgcggggggtcaat
BMWN1_0036_B10.b : aaaaaaaaaaaaaaaaaaannnnnnnnnggttccccgggcccggatttcccctttggggg
BMWN1_0037_E04.b : aaaagaaaaaggaagagnaaagngaaangannaagaaaannaaagttcccccgccgccgt
BMWN1_0071_B05.b : aaaaaaaaaa
BMWN1_0097_D05.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : aactattacataaatatacccccatcattttaacacttttattcctccttttcccccccc
BMWN1_0083_C04.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngaatnnnccn
BMWN1_0092_D05.b : naaaaanaaananaaaaaannnnaaannaannnaannaaaantttnnaanncctcccgct
BMWN1_0099_A06.b : taattatatattggtacttatttatattgttcccgggggccggtaatccctttaatgaag
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : taaatatcttatttaataattaattatctacttctatctatattttttttttccgggggc
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : tacacacactacaccattaaattcgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : atgaatatacttgtaaatcaacatatatttattgtcccggggcgcggaatctccctttgg
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : acaatagttattgtacatttaataaagcttttctagtctccttcctctctcgctcccccc
BMWN1_0046_F04.b : aannaaaaaaaaaaaaaaaaaaanaaaaaannnnnnnaaxxxxxxxxxxxxxxxxxxxxx
BMWN1_0041_E05.b : Acacnaaaaacacaaagaaaacgaaaaaaaanaggnaaaaacnnncgcccccgcgcccag
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : aaaaaaaaaaaaaanaaaaaaaaaannnnnnnnnnnnnnnnnnnnnngggaccccccccc
BMWN1_0001_D08.b : AAAaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : AAggaaaacnaagatncgnnaaccaatgcgggtagggaacagaaagaatccgtgaagttt
BMWN1_0002_D01.b : AAAA
BMWN1_0065_G06.b : aaaa
BMWN1_0100_G07.b : aaaaaaaaaaaaanattatannannttatnnttatnttntattttttttccccgggcccc
BMWN1_0030_E03.b : aaatcaacttttataaaatataataagttttaattttccttctgccctttcccccccttc
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : tctaacaaattttttttatctccattacttattcccatcattcatctgctctcttctctt
BMWN1_0037_C04.b : tacattattatttttttattttattcattataacttatatttttcccggttggcccgcta
BMWN1_0063_D12.b : caatatctccgaaccatacaaatattttcattttttcttctcccccctttttttttctgt
BMWN1_0022_D06.b : cactaataccccaattccgagtctaacctactataaccttatctttcccccgcccgcgta
BMWN1_0077_D02.b : nannnnnannnnnaaannnnnnnnnnnnnnnnaannnnnnnnnnnnnnggggaaaatnna
BMWN1_0078_D03.b : nnnnnnnnnnnnnnnnntnnnnnaagctacgaagccccgtatctgcctttaatgtgggtt
BMWN1_0081_F07.b : naanannnnannnnaaaannnannnnnnnnnnnnaannaaaaaaanaatagtcccgcgcc
BMWN1_0003_E09.b : nannannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccggggccg
BMWN1_0068_D05.b : aaaaataaaaattaatttaaaatttnaaaattttttttatttttcggaagtcaatattca
BMWN1_0034_G03.b : nnannannnnnnnntannnnnngcccgcgatccccccttnnnggaggtttattggttccc
BMWN1_0003_F08.b : nnaaaaananannannnnnngtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : aaatatttaataataattttccgcggccgcgatctccctttattgagggttattggatcc
BMWN1_0092_A04.b : acgaataaaaatatgataaactacaaaaagtggcagatacatatatccccaattcaatat
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ttcaaatactattttgaaagaataataactttcccccgcccgcgaatctccttttaatga
BMWN1_0070_F04.b : aaatttaataaacaaattttaaatatttgtcccccggccgcgaatcccctttaggggggg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : aaataattattattttattcttgttcctaccccctgctccctaacctaatatttgttggg
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : aaatataancctcagaattcccttagtcttgaagaggtcccgacccttcccttttgttaa
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : taagcattattcaaactcgacccctccggagaccctactaattgctaattatttggtttt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b : a
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : aaacacgggaagtataggtagaagtgaattgttgttgcgagcgggagtcccacaatgata
BMWN1_0005_H04.b : aattaaattttttcaaatcgttattattttaacttatttttttttcgctccgcccccgcg
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : aacaaanaaaaannggaaacaaangnaatttnaaanntttatgtttccgggggccxxxxx
BMWN1_0098_B09.b : aaannanaaanannnnttnnnagggcggcgaatttccctttttggggggggttggatccc
BMWN1_0040_E09.b : aaaaaaatananaaannaaangangttcccgcgggccgcggatctccctttggcggggtt
BMWN1_0028_H02.b : a
BMWN1_0070_E09.b : aatataatatattttaaattaaattattattatttttttttttttattttttttttcccg
BMWN1_0022_D07.b : aaa
BMWN1_0012_B02.b : aaaanaaaaaaaaaaatanttnnnnaaaannnnnnnnnnnnnnnnnattatttttttttg
BMWN1_0039_B02.b : aaaacnaacaacgacaccaaacaacaccacaccccaaaaagttccggggcccccgattcc
BMWN1_0026_E12.b : aa
BMWN1_0026_F03.b : aa
BMWN1_0099_A05.b : a
BMWN1_0059_D07.b : aaaaaaaaaaaaaaaaaaaataaaaaagaaaaggtgccgggccacgaactttccttgggg
BMWN1_0002_D08.b : aaaaanaaannaaannnananaaaanaanaaaaaaaaanggcccnnnnatcccccnnaaa
BMWN1_0058_C10.b : aaaaaaaaaaaaanaaaaaaaannnanannnnnnannnnnnnnnnnnncccccnccccaa
BMWN1_0003_F12.b : aa
BMWN1_0010_C11.b : aa
BMWN1_0091_E12.b : aa
BMWN1_0056_B04.b : aaaa
BMWN1_0068_B10.b : aaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaa
BMWN1_0085_H06.b : aaaaa
BMWN1_0001_A07.b : aaaaaaaaaaaaanaannnnanaaaanannnaaannnnannnaaannaannaannnnnnn
BMWN1_0040_B09.b : agaataaaacctcataactatctagatatctaccaatctcctaatgaccaaataattaag
BMWN1_0023_G01.b : aaaaa
BMWN1_0075_B12.b : aaaaaaananaaaannnnaaaaaaaannaannnanaannannnnnnnnannnnnnnnccc
BMWN1_0088_D09.b : aa
BMWN1_0092_B11.b : gaatacaacttttaataaaaagaatcattcccagtactctttaaatatcttttaatgaga
BMWN1_0032_E12.b : aaaaat
BMWN1_0100_G01.b : atcttcaaatcatttatccaaaaaaatcaaactttcccccataaagataccttacacaca
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tcattcatccaaaaaaaataaattttacttatcttccgggcgggtgggcgccccccccta
BMWN1_0062_E11.b : tctttaatttacacataatttatcctctatttcgcttggatttatttattcatgtttatt
BMWN1_0074_F01.b : ttactaatatgaatcctctattattttataaaatttaaaattttatttgatatgtgtccc
BMWN1_0056_E05.b : cataaaccatctattccttctataatccaaaattataatacctatattgtttcccggccc
BMWN1_0041_B02.b : cacatatttctgcctttctctttcttacccttctcttcgatctatagtgttcccccggcc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b : cccaaaaaaaaaaaaaaaaaaaaaaaaaaaa
BMWN1_0052_H09.b : ccaaaaatattaacatattgttataattgggatccccctcccactgaggtcttaaaaaaa
BMWN1_0087_A11.b : naannaaancnnaaaaaaaaaaaaaggcccctttcttttttctcgggggagggggtttgt
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aatttatttgtttctgggtgccgaattccctattttggggggtcaatttgctcccaaatt
BMWN1_0065_A11.b : tcttggggttggtttatttgctcccctccccccttaattttttgttgaggacggaaaaac
BMWN1_0041_H11.b : aaccccggccccctagcccacgttaccgtccattaccaagtcgtttactgtctacctcat
BMWN1_0046_F03.b : tctcccttcctcctacaaccctcttcgatctaggtagactgctcataacttaattaaaca
BMWN1_0037_H03.b : aaannnataatgggcgcggccgcaaacccctttgttaggggtgattttccccccaaaaaa
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : ttttggctcccaaaatgaaaaaaacttttatgggtttgactaacccccccaaaagccgat
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cgctcaaaaaaaccatttattttgttgggggaacctcccctccaagtgattgaaaaaaaa
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : cccctcaaacgggggtttattttgataaaataaaaaaaaaaaattgagtaatctggacaa
BMWN1_0036_H12.b : tttgtttgttgcgcgggccgggtattttcttttttggggggtgttttttcgctcccccaa
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : taatttatgtttcggtggcccccccctgaatccctttttggaatttatatcgacccccca
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ncccgggtaanagattctcagaaaaaaaaaaaaaaccaaatttgggatatccccacccca
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : tccccccgcccccaaattcattgaggagttgggtaattccgccccaacaatggcaagaaa
BMWN1_0083_A07.b : nnnnnnnnnnnnnnnnnccccccccccccaccacaaactcaataatgagagggcctcgca
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : acctctccggcccatttataacatatcaattggatttatttttaaaaatgaatatacatt
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : acactcttatatgcccgctgctccctttcccccctgattgggggtccactctactctcat
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : ccttttctcgtggattcccctcctcccccactttaaaaagtttaatgagatctaaccatc
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : atatcccggggcgggattccccttttgggggggtaattggcccccaaaagaaaaaaaatt
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : gccccccgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : nnnnnnnnnnngggaccgcgccccgaatttcctttgggggggtttttggccccaaaaaaa
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tcccctttggggagggttattgggtcccaaaccgaaaaaaatacttgagggagttgggac
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : cgaattccctttatggggggtaatttgttccccaacctaagaaaacctttttggattttg
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ggcgatctccctttagggggggttttttgttcccaaacaataaaaaatctttgtagagtt
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : ttttttccccccgccccgcattccccctttggggggttttgttggcccccaacataaaaa
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : nnnggtggggggcgcgggaatccccttttgtgggggttttttgttcccccccaataaaaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : ttggttccctcccagcaaaataaattggtgggtttgggacaaccacccccaaagggcggg
BMWN1_0046_D09.b : cggaatttccttttggggggttattgggtcccaaatgaaaaaacacttgggtgattggga
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : tcggaccggcgcccatcatttccttttttggggggtcattggttccacgccttgaaaaaa
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : nagctttttttgtggtgtggggcggcgcccccttttctggcgtggaggggggtgcccaca
BMWN1_0075_D08.b : ttgtcccccgcgcccggtattcctttttggggggttatttccccccacttaaaaaaattc
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaannnaaaaacccccccgcccgccccttcctttggggggggttatttccccccaacaaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : ctttagggaggggtaattggatcccgacctgaaaaaaacattggtgagtgggaccacccc
BMWN1_0047_H02.b : naaattnnnnnaagggaatgtataaatttacaagnacatttttaacttttttttttcttt
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ttatttgcttccaaactggaaaaaaacattttgttgatttgggaccaaccccccccttca
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : ataatttttattctatatatataaatatttacatctaatctgctcacataatttttatta
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : ttcaccctaaaaggaagaaaatgcggcccggagttggaaaaaccaattggttggattcgg
BMWN1_0036_B10.b : gggttatttgatatccaaatggaaaggaccccttgatttttttgggaaaaaccccatttt
BMWN1_0037_E04.b : attccctttagggaggttaattggatcccaaactaaaaaaaaactttgtttattttgaca
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ctcctctattttttttgctcttttcactcctctcctcccattttccttcttctttgtatt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : nnnnnnnngattatttnnatnttgaggtaaaaaaaacctttaatgaatgggaaaaaagaa
BMWN1_0092_D05.b : ccccctttccccttttattgggtctaataatcaaaaaaaaaaaaatatttggaaaatcca
BMWN1_0099_A06.b : gttaattttataccaaaattataaaatatccttagatttgggaaatacccactttttaat
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : cgcaaattcctttttgggggggtattttgaacccccactgaataaaaaactgtgttgatt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : gggggtttaattggatcccaaactgaaaaaaatctttgttgattttgggacaactcccac
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : attatttttttatgatgcggggcggcggattcccttttgggtggggttaatttgtgcccc
BMWN1_0046_F04.b : xxggggggggtcatgggttccctaagggggaggatattggatcagtttgaaaaacaccct
BMWN1_0041_E05.b : ggtacccgtgtggggcggttgacatgtaatcaaatttgctgtccccccccgcctctcttt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : cggagacccctttttggggcgtaacttgaaatcaaaacttgtaaaattcggaaaacattt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : tcccgggcccaaaaatcctcctttttgtggggggttattggtttttagaagtggataaaa
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : aaattcccctttgggggggtttttgggttcccaatttaaaaaaaccttggttggtttgga
BMWN1_0030_E03.b : atacatcttatagatgtttcccggcgggccatttcctttttaggggggtttttttcctcc
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : cctattactcttttatatagttgataatcctatctaaatctatatattttgattctttac
BMWN1_0037_C04.b : atttccttttttaattagtattatttggctcctcaccacgataatttcccttttagcggt
BMWN1_0063_D12.b : tttttttttttcctcgggcacgcaaccctttttatggggggtaattcgacccacatttta
BMWN1_0022_D06.b : ctccccttaggggtgggtatttcgtctccgcctcgaaaacaacttttggtgagtcgggac
BMWN1_0077_D02.b : aanaaaaaaggagggggcccggccccattctcctttaaggggggttgttgggcccccaaa
BMWN1_0078_D03.b : aattggattccaaaatgattggatacgttggggaatttcggaccaccacggctaggaagg
BMWN1_0081_F07.b : cccgaattccctttttgggggggttaattggactccaaacagaaaaaaaactttgtggtg
BMWN1_0003_E09.b : gggatcccccttttcggagggttaatgggccccccgcttgaaaaaataatttgtgagttt
BMWN1_0068_D05.b : cttacatattttttttccgggccccgcggtctcctttgtgggggggttttgggcccccac
BMWN1_0034_G03.b : ggaccggaaataccctttgaagaagttgaaaaagcccccccccggaagcattaaattaat
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : aaactgaaaaaatacttggatgaattgggacaacccccaattgaatgcatggaaaaaatc
BMWN1_0092_A04.b : tgagttcccgtcgcccgacccccccttgggagggtttattccccacacagtaataaaatt
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : gggttaatgggatccaaaaacgaaaaaaatacttgaagaatttggaccaacccaatctaa
BMWN1_0070_F04.b : taattgatccaaaatgataaaaaccttgaggtatttggacaaccccaaactaagggatgg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : gggcgcgggaatcctattttagtggggttaatttgattcgaacaccaaaacaaaaacttt
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : ggaataacgttaattagactctaaatagtatcaatcattatccaaaatttggcacgccct
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : cccgggcccgaaatctcctttttgggggtgtaattggacccaccaaataaaaaaaaattt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : tgttagttgcccgcccccgcgtttccccttaagggggggttttgggctcccaaaagaaaa
BMWN1_0005_H04.b : catttccctttggtgggggttaattttatcccacccagattgaaatcttttgtgaattcg
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : ccttagtggggttatttgctgactaacttgaaaaaacactggtgggtgtggaaaaaaacc
BMWN1_0040_E09.b : tatttgcatccctatagagagggttccttggccgattttggacacaaacagggggaattc
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ggcgcgggaattccttttaggggggtgtaattgtcccaaacataaaaaaaaacctttttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : tccggggcccggttttccctttttgggggttttattggcccccaaagaaaaaaaactttt
BMWN1_0039_B02.b : cccttttgggggggttaattggtctccaaccgaaaaaaatccttggaggattttggacca
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : ggaggttgattggacccaaactgaaaaaatcctttgttgaggttggacaaccccaacttg
BMWN1_0002_D08.b : aaggtttaatggggtcgtaacttgattaaaaaggttaataatttttgacaaatttaaaaa
BMWN1_0058_C10.b : cacccccccccaagaacaccaaaacaccacaaaccccccccccccccccccccccccctc
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : nggtgcgccggggcgcgggtacccccttgggggggtggtttgaaacaaaagctaaaattg
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_B09.b : tttcccgcgcgccgcaattcctccctttaagggggagttaagtttctgccaactaaaaaa
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : ccccccgcccgtaatttggttttatgggggctaaattgaatcaaaaacttgaaaaatttt
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : ttactaccgactcaatataattagacagtattatctccaatataaacctcaacatacgca
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : gggattttttcccaactcctcttaatatttttaggtattacatatcaactattaaaatta
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tttttattgaatagaaaataataatttttattaggagcctcccccccacccctttttttt
BMWN1_0062_E11.b : cacttaccttctctcttctaaccaccatcatttatatttcccggctaaactacacaagtt
BMWN1_0074_F01.b : ggggcagcgattctcccttttggggggggttttttcgctccccaataaaaaaatatcttg
BMWN1_0056_E05.b : gccaaatttcctttttggattgctaaattgaactccacacgaaaaaaactcctttattat
BMWN1_0041_B02.b : cggaatcccccctttagggagggttaattggttcccaaactgaaaaaaaacctttgataa
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : cattttttatttgtgaccgtcgccccccttttcttttttttggaaggtttttagccgaaa
BMWN1_0087_A11.b : ttttaccgggggggggatttttttttttgggggggtgggggtggccccaaaataaaaagg
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : aaactacatactttttggtttgggacaacccacctttatttcccgtaaaaacaactcttt
BMWN1_0065_A11.b : catacctaaattaaaatgttatatccctacacttggaaatctgagggacttttttataac
BMWN1_0041_H11.b : actaccaacattaccaaggtcgcgctgtgcaacaaccccacaactacaatccaagggaca
BMWN1_0046_F03.b : attcctttttataaatcccgacaccaattgttatttgccaaacaatatcccatattaaaa
BMWN1_0037_H03.b : aaaaaaactttgtggtgtgttggcaccacccccgcagagtggggggaaaaaaagtttttt
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : taaaaacgctatatataaaatttttgtatgctctcctttcttaaacttatcaacacccaa
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cctttcttggaaaaaaaaaaaaaagatttcttttttttgtaaaattttacaacgccctaa
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : acaccccgctaaaaacagggaaaaaggggatcaatgggattctggtgtacctttccctct
BMWN1_0036_H12.b : aaaaaaaataatttttgagtttttggcccacccacaccccatataatgggtaaaaaaaaa
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : aactaaaaatcctttttaattggaccccccccccattggctgagtaaaaaaaactttttt
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : aagtagggaaaaaaaagacattgttaaatgggaagtggtgggttttttttctcaccccac
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagctgcataaaaaattaa
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : aggatggttttatggcctaatttgggaaagttggggcgtaatttttcttttttaacccta
BMWN1_0083_A07.b : cacacacaaccattataaaattttaagcttccccacaacccatttaaagttgagaacacc
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_A02.b : taaaattacaaaaaaaacaccaataatatgcatctcatctgctttttaataattttaaat
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : acaaataaaaaatattgcccctttttgccaacactccctcctctactgcccttaaacaac
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : aactcaaattattccgatgaaaaataacatttatttaatacctagaagcataatctttta
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : tgttgttttggaaaaccccacttgattggctgaaaaaaagtcttttttgtgaaaatttga
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : aaaaaattttgggttgggacaccccacccgaagggggaaaaaaatgttttttttggaaat
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : acaccccaacttaaaggcgggaaaaaaaggtctttttggaaaaattggggaacctttggt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gaaacaccacaattaaaagcggtaaaaaaatgctttttttttaaaattttgtaaccctgt
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ggaccacccccccataaatgcgggaaaaaaatgcttttttgtaaaatttggaaccctttc
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aatcttgggggggtggggaacaccccaccattggaggggggagaaaaaatgttttttttt
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaatttttgatggttggaaaacaccccttttattggggggaaaaaaacctctttttggaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aaaaaaggctatattgtggaaatatgagggcgttgttttattttttaccataaagcccgg
BMWN1_0046_D09.b : cacccccccctaaaaggcgggaaaaatgtgtttttgggaaatttgggggctttgctttat
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttttttttgtggaattcccccgcctttgctttttaaaaaaattcttattttgaaaatg
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : gacaaaaaaaaaaaagagatgtttgggggatatgcaccaccccagggggaagaggagtga
BMWN1_0075_D08.b : ttttaggtttgtggcaacccccccttaatggggtgaaaaaaacttttttttttgaaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaaaaatctttgtgggtttagaacaccccactaaaagggaaaaaaaaatgctttttttaa
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aactcgaaggcaaggaaaaaaagctttttttggaaaattggaaagccttggctttatttg
BMWN1_0047_H02.b : ttttccccacctccttttagaaagcaaaaaaaagactccctttgaaaaaagtacttccca
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : agtggcggaaaaaaaagtccttttttttgagaaattttggaggctcttttctttttttgg
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : atatacatcataaaatatacaaacatattattttcatccactatttgatatacttactta
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : ccacaaaccaaactataaatgacaaaaagaaggtgctttatacctaacttgaaaccgata
BMWN1_0036_B10.b : taatggccaaaaaaaaaaaagtttttttttggaaaatttgggaagcccctctccttattt
BMWN1_0037_E04.b : aaccccccctaaaattcgggtgaaaaaagtcctttttttaaaatttttgaaccctttgct
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : tttacacttcaccccttccgtatataactatttcaactccctttaaccccccattttctt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : aaatttggagaaatgaaaaaagggtggtttgggaaaaattgtaatgtttggatttgaaaa
BMWN1_0092_D05.b : acaacacagtaaaaaaaaagggaaaatgggtaaattttggaaattttggagatttttcct
BMWN1_0099_A06.b : gccaaaaaaaaaagcttttttttgaaatttgggctacctttctttttttaactcataacc
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tgacacacccccaccatatatcgggaaaaaaaatccctattttgataaattgggaaacgt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : ttagaatgcagggaaaaaaggctttatttgaaaaattggggatgccttgtttttttttga
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : accaaaaaacaaaattttttttgtttgtaaaaaccccccatattttggcggagaaaaaag
BMWN1_0046_F04.b : tgagggttggaaaaaacaccttttttgggaaaaagaaagtctttgtttttatttaccata
BMWN1_0041_E05.b : ttttaagggggggattttcagtgccccaaaagaaaatgttttctttgtggaagcttggaa
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : gggaaaaccccatccaaaaaggcgtttaaaaaatgaaattttttagaaatctggtttatt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : aaccccgaggaattttgaacccacccctaattggttggggttaacaaaaattgctctttt
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : aaacccccactttaattggggaaaaaaagggctttttggaaaattggggagcttttgcct
BMWN1_0030_E03.b : ccaaaaaaaaaaaaacacttgtgtgagtgagaacccaccacaattttcgttctgaaaaac
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : atctcttatatcccatatcttttactattcgtatttattttttatattactctatatctt
BMWN1_0037_C04.b : gttgggtgactctcacccctaaaatgcataatgaatatagttttttttccttctaaattg
BMWN1_0063_D12.b : caaattcatgttgaacttgcacccacactttatatatagggtgtaaaaaccctttttttt
BMWN1_0022_D06.b : accccaaactacattgccctaaaaaacatgcttatccgataattcgcgaccctctctttt
BMWN1_0077_D02.b : acaaaatatatttttgaaaattgggggcccccttcctttaagggcgagaaaaaacttttt
BMWN1_0078_D03.b : aatgaaaaaatgcttaaatttgggaagttgtgaagcattggtttctttgtaaccttcaaa
BMWN1_0081_F07.b : tttggaaaacccccccctaataggctggaaaaaatcgttttttttgaaaaattggagggc
BMWN1_0003_E09.b : gggaacacccaaacagaaattcttggaaaaaatgctttaatctgacaattggaaacccat
BMWN1_0068_D05.b : accataaattattttgtgatgtggggcccccctccactataagaggaaaaaaaatgtttt
BMWN1_0034_G03.b : ggtttttgaagaaaaatttgaaaggccttggcgttattttgaccttttttaaacttccta
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0067_F02.b : gcttttttggaaattttggaggcattggtttattttaaccctttaaaccgccaaaaaaat
BMWN1_0092_A04.b : tatattgtttcgccaaaccaaattatagcgtggaaaaagtcttattttaaaaatatatcc
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : atggcccggaaaaattgccttatttgggaaattgggaagcaatgctttttttgaacccat
BMWN1_0070_F04.b : aaaaaatgctttttttggaaatttgggaggcattgttttaattgaaaccttaaaagccgc
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : ctttttttgggccaacccacactataattgaaatgaaaaataagcttttctttttaattt
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : tggctcttcgaaccaaaataacgttatagacttttttctctttcgacattttgtttaccc
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : gttaatttgggacaaccccatttaagaatcctcgaaaaaaaagcctttttttgaaaaatt
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : ataatattggtggttgtgggaacacccaaacatgcggagggaaaaaaagtgtttttttgg
BMWN1_0005_H04.b : gacccaccacacctagatggaagggaaaattgcctccttgggaattttggtagctattgc
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : cctttattgaaataaaaaaagccttttttttatattttctaagaaaaccgcttttatcaa
BMWN1_0040_E09.b : ggggacaaaacaccttaaatgtggaataaggggggccctcttctttttttagcaattaaa
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : gtttgggaaaacccaccttttatttgccgaaaaaaaagtttctttttaaaaaattggaac
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : gtgggtttgaaaaacccccttttttgggggtaaaaactttttttttttaaaaatttggaa
BMWN1_0039_B02.b : cccccaccagaaaggcgtggaaaaattgccttttttggaaatttgggaggcccttggttt
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : aattgaaagaaaaaatgcttttttagtaaattgggagcccttgcttttttcaaccctaca
BMWN1_0002_D08.b : aacggcggtgaaaagaagcctaaaaaaggaatttttgaaaaaaattgctttttttaaatt
BMWN1_0058_C10.b : taaaaacaaccaaaatcttccccaaaaacaaacatcttttttttttttattggcccccct
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : ccatgtttgggttgcgacaccctattttgaacggtagaaacagcagtttttttttaaaat
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : xxxxxxxxxxxxxxxxxxxxxxxccccttaaggcgggaaaaaaggcttttttttaaaatt
BMWN1_0040_B09.b : aaaaaactatgtgaaagtttggggaaaaacccccacatataaaatgctttaacaaaaata
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : gaaaaaccttgcaaaaaacccaagaaaaaaaacggggaaaaaagggctttttttgggaaa
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aaataaaaaaaacaaaatataatatcagtattgtaacacaaaccatattcaccttaaaaa
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : taaaaaaatttgtttcactttaatattggctactatactatattccaactaatcagcacc
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : atatttcaatgcatatcaaaaaaaaaaaaaatataaatttcttttctctccaaattattt
BMWN1_0062_E11.b : tcgtttaatcgcatatatctttattcataatgctttcacaataagcaccatctattcatt
BMWN1_0074_F01.b : tatgagttagaaacccccacacttgatggggtgaaaaaaatgtctttttttaaaatttgg
BMWN1_0056_E05.b : ttggcacaaccccccatctaatacaccgtaacaaattcctatttttcaaatatttgatct
BMWN1_0041_B02.b : gtttgggaaaaccccccacctaaaagggcgggaaaaaaaagccttttttttggaaatttt
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : aaaaaaataaaaaactgagtatgggtttatatataaccccaaataaaggggaagtaaaaa
BMWN1_0087_A11.b : gtttggttgaacttccccccaacccccaaagtgggggggggaaaaaatattttttttttt
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : ttttggacatttctcatcttcttttttttctttttaaccctttcaaccccttcaaataaa
BMWN1_0065_A11.b : ctttcctattccactatggaagtaaaaaatttacaacttacatttctttttcctacatct
BMWN1_0041_H11.b : cttactcccccctcctcacaaaaatcggccaaccaactcgcgactacctactaacacaat
BMWN1_0046_F03.b : ttttaaaattaacttttaattaatcaataatcccctcaaaaaaattcaaacaaatttctt
BMWN1_0037_H03.b : tttttaaaaaagttgagcactctgctttttaaaaaccccatttaccccccataaaaaaat
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : aaaatttaataaaagaatccctcctttttttttcaaatcggggggggggagggttttttt
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : aaaatacaaacccccaaagggccccccctttcgttttttgctttctcggcgcaagttggg
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : attgcaccccctacaccccccattaacacaataaaaaaaccacttccttttctttttctt
BMWN1_0036_H12.b : aacctctttttttataaaaattgtgaagctctttttctttttattcacacaatttaacgc
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : ttcgtaaattagaagattttctttatttaaccctaaaaacccaaaaaaagataaaacacc
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : acccccagcagaaaagaacaaccccacacctctctttttttttttcttttgggggggggg
BMWN1_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0096_D04.b : cacaccatgctttttttttttttcggtgggggaaggtggaaggtttttccctaaagattc
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G08.b : aatgaacgctttaactttttaataccctatttcccttcttcaagttccggagaagggggg
BMWN1_0083_A07.b : ttccctcttctaataaaatagtaaatttatattttttccttcacaccttaacgaataaac
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccg
BMWN1_0073_A02.b : tctcttttaaaaaaatattaccccaaatttatacttttccttaattcttaaataaatata
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : cctctttcctcttgatttttctagcccaattccgccctatgtttccccctatacattttc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : ttttctttcttcaatatatatagtaatttcataactataccatttacattctttacttaa
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : aaccttttcttttttttaacccatacaccccaaaaaaaaattaaaaactatttttttttt
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_G10.b : gggaggctttttttttttgaaacttttaacgccaaaaaaatttaaacccaattttttttt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : ttttttgaaaccatatagcgcgcaaaaaaaattttaaccaaacattttgttttttttttt
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gcctttttttgtaaacattaaaccccccaaacaaactttaaaaccaacatttcgctcttt
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : ttttttttcaaccctttaagccgcaaaaaaaaattacaaaacatatttcttttcttttat
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : gaaaatttggggagcgttttttttatttaaaaccctaatacagcgcaaaaaaagatttaa
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaattggaaccctttccttttttttccccacttaaacccgcaaaaaaattttaaaacaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0046_A02.b : aggaaaaaattaaaaccaccaagctttcttttttttttcgggtgcggggggggggggggg
BMWN1_0046_D09.b : ttgaacctttaaggcggcaaaaaagttaaacacaacttttcttttttttttttccgggtg
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ggggttacatccctttttttctaacctttaaacccccatttaaggggtagaccggaatgt
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : caattcttttttttttgaaaatttcgagccttttgtcatcttttaaaaccccccgaaaac
BMWN1_0075_D08.b : gggagctcctgctttagttaaacattaaaatctggaacaaaatttaacacaccatttttt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : aaaattgaaacccctcttttatttcaccaataccccacaaaaaaatttaaaacacattct
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : tacccttaaaaccggcaaaaacaagttaaaacaacatttcctttctttttctttcaggtc
BMWN1_0047_H02.b : tgccaaactttaggcgaaaaaatataataggcaacaaaactaattctccaccctctcttt
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : aacccctttacaaccccgcaaaaaacaaattaaacaccacccactttgtcttttctttta
BMWN1_0001_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : cattattcttacaaattataattttatctcattaattctgaatctactctattttctttt
BMWN1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : taactcttatgtaaaatttaaaacaacaaaaacttttattttattttacacttatatggt
BMWN1_0036_B10.b : tggaacaaaaaaaaacctgcgaaaaaaaaattaaacacacaaaaatgtgtttttttttat
BMWN1_0037_E04.b : tttttgaaaccattaaacccgaaaaaaacatttaacacaaaatttccttttttttttttt
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : actaccccttttttttattttttctcccctcattttattaacccttaccatacctctttt
BMWN1_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : aaaaattttaaaatggaaattgatataattttaattttnggttttagtttaggtttgggt
BMWN1_0092_D05.b : aatttaaccctttaaaccttttaaacattaacacccttttttttttttttttttcgagtt
BMWN1_0099_A06.b : ggctataacttctatacacatcttttactttttatctttcttagcctcggaggaaagttg
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tgtgtttttttgtaacatttaagccgggaaaaaattttataaaacccaattgcttatttt
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0073_G04.b : acccttaaggccggaaaaaaaagttttaaaacacattttcttttttttatttttcggtct
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : tcttttatttgggaaatttggtaacgtttcttcttttttgaaaaatataaacgcttcaaa
BMWN1_0046_F04.b : aaagccctttataaaattaaaacccccttgtattttttaacttccggttcgggggatgtt
BMWN1_0041_E05.b : cccccccatatttgatgcaaaaaaaagacgcctccaataacaaaagtacggcagcagctt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : tatgaccttttttggccccaataaaaccggaaaaaaacatttaacccccaaatttggttt
BMWN1_0001_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : tgtaaaaaattgtcgtcgtattgcatttatttgaacngtttagagccccccaagaacaag
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : ttttttaacccctttaccccgcaaaaaaattttaacaacaccttttcttttttttttttt
BMWN1_0030_E03.b : actttttttttataaattttaatcaacatcttttttttttcacaaactatatccctcaaa
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : tctaattatcaactattttttaaatccttctaatcctatttccatatttttataattgac
BMWN1_0037_C04.b : agatagaatgattgtttatcttgtactccatttagactacatctaacctataatatactt
BMWN1_0063_D12.b : tggaaattggagatgtttctctcttttctaccccatttaggccaaaataaaattttcaac
BMWN1_0022_D06.b : tttcaaccataattgcgccacacacacagtaacaacacccacttatcttttatccttcca
BMWN1_0077_D02.b : ttttgaaaaattggcacccttttttttttttcaccttcttcccctctaaatcattcaacg
BMWN1_0078_D03.b : accccataaacaacttaacagcactattgctttcttttggttttgggtcggggggaggtt
BMWN1_0081_F07.b : attgcgtttatttgacacctttaagccccaaaaaacattttaaaccaaactttgcttttt
BMWN1_0003_E09.b : tgatttttttttaaacaataaaagtccaaaaaaaaatttaaaatcaaaacttcaattttt
BMWN1_0068_D05.b : tttttaaaatggggcgcattttttttttcacccacttaaggcctaataaaatgtttcccc
BMWN1_0034_G03.b : gaaacaatttgacaaaaaaaatccatttatatttaattttaaggttttgggaaaattgtt
BMWN1_0003_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaaggggggtagtt
BMWN1_0067_F02.b : ttaaaaccacaattccttttttttttttttcagtccggggggaggggggaagttttttcc
BMWN1_0092_A04.b : tcactccccttttaaaaaaccatcgccgcaataatattctaatcctacaccgtttttttt
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : taagacccgaaaaaaaaaatgacaccccaccttgccttcattttttatttaagttcgggg
BMWN1_0070_F04.b : aaaaaaaattaaaacactcattcctttttttttttccaggtgggggagggggggaagttt
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : aacaatttccaccgccctttttttaaacaaaacacccttcaccttaaaaatttcacccca
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : gggccccttctaaaccacaattaaatgagacaaactccttttctttttatttcctttctc
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : tggaagccctttcgtttttttgaaaccataaaacctcccataaaacaatataaaaacaaa
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : aaaatgtggcgaccttgctttttttgaaacattggacccaaaaaactaattacaaagaca
BMWN1_0005_H04.b : tttttttaaaaccataaaagccgaataaaactatataaatcccaccatttgctctttttt
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0098_B09.b : cacaacaaaaccccaaatacattttttttcccacattcccgggatttttgtatgattttt
BMWN1_0040_E09.b : accccccttttagaaggttaaacgcaccctgcctcctttttattttccccctccccgggg
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ccttctctttttttgaacacatttaaccccgaaaaatatttaaccaccacttttcttttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : gctttttttattcaaaaataaaacccgtcaaaaaattttaacacccctttgctttttttt
BMWN1_0039_B02.b : atttggaacctttaaagccccaaaaaaaaatttaaaccacatttcctttctttttttttt
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : accggaaaaaatagttaaaaacaccttcctttttttttttttcagggtggggggggggag
BMWN1_0002_D08.b : tttgaaccccaaaaaaatgtttaaaaaaaaattcccctacatttattttccagttcggtg
BMWN1_0058_C10.b : cctttcttctattataaaaaaaaaatcccctctaaaaaaaattcaaaccactcttcttct
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : tgggagtgctttcttttttgttcacgttaaggcgagaaaaggaggttaacccacgttttt
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : tggaagccattctttttttgcaccctaataaccggcaaaacaattttaaccccactttcc
BMWN1_0040_B09.b : tcttttttttaaaaaaatcttgccaaacattaatgtatattttataaaacaaacaaactc
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : atgtgcagtccttaacccttttaagaacccaaaaaaaccctacaaaaacatttttcacct
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aaaataaatataataccgatacgacataataaattaataatgacttaataaatataatac
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : cattaatttttatcaccattcttcccttctttatattacatcaggagaaaatttaagttt
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : tttaaaacatatttaacaaccattttcatattttttaaaaaaataaatattatttgtgct
BMWN1_0062_E11.b : tccatcactcaacatgaatattctatacttaatatagcttagcaaatatctttacttcat
BMWN1_0074_F01.b : agtcatgtttttttttttcacaatataagctgtaaaaaatttataaaaatactctttttt
BMWN1_0056_E05.b : atttctttattttcaaccactatatccgtaataaataatttacaaaaccctttccctttt
BMWN1_0041_B02.b : ggaaagccattgcttttttttgaaaccatataaagccgcgcaaaaaaactttaacacaca
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : aattttttttttatttataaattagagatccatttccttattaacaaccctttaatactt
BMWN1_0087_A11.b : tttatttttggcccccctttttttttttcccccctcccacccccaataaaaaggtataca
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tgctctaaccccattttgtctcttttttttctccgctcagggggagtgaggaggattttt
BMWN1_0065_A11.b : acaggaaaggggagactgttttattttttttttaaatataaaagaagggcatcatatatg
BMWN1_0041_H11.b : aaaccccccatcaaccgatctctcacaaacccactcctccttccttctctatcactacgc
BMWN1_0046_F03.b : ttcttttatcatccccaccacagaaaaagacctttcttacttaacttttcactcactcac
BMWN1_0037_H03.b : tatacacaagatttttttgtttttttttttcccgtttcggggagagttggaagtgttttt
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : ccctttacaccccccaccaccgggagagggggggggataggtgtcttttatattctatct
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cagtcttttcttctaaaaaaaattcccaacctactatcaaacttagttttgaggtttggc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : catggtcttggggagggggggggaaggtttttcttacttatataaacacccaaacccccc
BMWN1_0036_H12.b : gcccaaataacaatattaaaacccacacgttgtctttcttttttttttctctacccccag
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : cccttctttttttcctttaccgcggggaggagagtaaaattcctcaccacacacgccaaa
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : gggaagggtttttttttttaaataccccaccccccccaagcgagggggtgtattgggttt
BMWN1_0080_G07.b : xttatttatttccagcgggggaaaggggttgttttgggcctttcacccccccccaagaaa
BMWN1_0096_D04.b : ccaacccccggaaaagggtttgtattgggttctttccttcccaaaaaacccgtgcctggt
BMWN1_0010_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaagggtttccgaagggggcccttcccttcc
BMWN1_0021_G08.b : gggttttttttttcttttccgaacaaggaaggcggggaaaattttttttagcaaaatgga
BMWN1_0083_A07.b : ataaactacacccctcttttttttcttttctagggagaggggaggggtatgtgtttttct
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : cattaagaaacccccaacccccggaaaagcggttgccaatggggcctttcgtttccttca
BMWN1_0073_A02.b : aagagtttcgcttttttctcacaaaaccagtaaagagaacttctcctactttttattcca
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : tcaaaatccactgaaaaaccgccacgtgcctttctttttactcaatctccgccgtgcgcc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : caattatatgtgaattgctataactattaaattgcaaacaattaaatcattttcaataca
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : tttttttttcgggcagggggaaggggagagagttttcccctaaaaaaccacccccccggg
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgataaaaaaccacccaccc
BMWN1_0069_G10.b : tttttccgggggggggggggggattttttttaaaaaaaaccccaccgggggaaggggttt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tttccgggtgggggaggggggtgggagggtttttcccaaaaaaacccgccacccgcgggg
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : ttattttcgaggtcgggggagaggtttgaacctttttttacatctataacccccccaccc
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : tttctcgggcgggggggggggggggagttttttctcactaaaaaaacccccccccggggg
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : aaaaacatttttttttttttttttttttctgtggggggggggggggggggggtttttttc
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : cttctgtcttttttttttttttccgcccccggggagaggggggaagtttttttccaaata
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : xxxxxxxxxxxccttaaaaaaccgcaaccccccgggaaaagggttttcatattgggcctt
BMWN1_0046_A02.b : tttttttccattaaaaacgcccacccgccgggaaaagagttttttttttgggccgtttct
BMWN1_0046_D09.b : ggggggaggtggggaggttttttcgccaaaaaaccccccacccccgggaagagggttttc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttttttttttttctcgtctggggggggtgggggagtttttcttatataaaattccccc
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : cctatatatataattcaccatcccctgttttttcttttatattttttcggggcggggggg
BMWN1_0075_D08.b : tttttttttttcagggcgggggggagggggagttttttatcataaaaaaacgcccacccg
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : ttttttttattttcggggcgggggaggggggaatttttttcaaaaaacccccacccgggg
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : aggggaggggggggagttttttcctcataaaaaacccccccaccgcggggaggagggttt
BMWN1_0047_H02.b : ttcttcttttttttccccccccaggaggggaaacggtagaattttcttttttaaaacacc
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : ttctttcccgcctcagggggaggggggggggagagtttctcttccacttaagaaaccccg
BMWN1_0001_E04.b : xxxccgattataaaaacccccaccccccggggaaagcgttttcctattgggcccttcccc
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : cattttacaaactcaataaaatacaataaaaagattatccactatcatacttttttttta
BMWN1_0100_D04.b : xxxxxxxxxxxxxaagaaaacgccaacccccgggaaaggggtttcatttgcccctttccc
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : tataggaaagaagatttcgcggatgtgttattttttttttcccagaaaaaggggatctgc
BMWN1_0036_B10.b : attttccaggttcaggggaaaagtggggggaattttttcctcctttatatacccccccca
BMWN1_0037_E04.b : ccgttcggggaagttttaaaaatttttccacatataaaaccccccccccctaaagaactt
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : ctaagaaccgccaacccccgggaaaggcggtttgcttttgggccccttcccttcccccca
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : attctaatttccctctattatctgatttttcactattatttcccactccctttctcttcg
BMWN1_0083_C04.b : xccgcataattattctctaactccgggaaagggggtggctatggcccttttcgtttcaaa
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : tttgggtgaaggaagggaggggtttgggaaaggaatttgggttagagagagaaagttttt
BMWN1_0092_D05.b : agggggaaattgggagatatttcaacaatacaaccccgccacaccgaggaaggctttgtg
BMWN1_0099_A06.b : ggtgttttttcgcttattaatattcacctccccggggattggttatttatattatcacat
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : tttttcaggctgaggggggggtgggaaattttttataatatataaacacccacccgcagg
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : xxxxxxxxxxxxxxxctcttcttaaaaattcccccaccccccgggaaaagcggtgttgca
BMWN1_0073_G04.b : gggggaaggtgggaggttttttcccctaaatgaatccccaacccccgggaaaaggggttt
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : taaattttaataaacatcttgcgttttattttttattctcgccacggggggagtgggaag
BMWN1_0046_F04.b : gggaaggtttttggcaaaaaggaaagctcccccccaaaaaaaagcgttctcattgggggg
BMWN1_0041_E05.b : tcttttttttcacactctaccgcgcacgggaggaagggtgaatgctttttccgtcatttt
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : ccttttttattaagtcctgggggggtttttcgaagtttttttcccttaaaaaaaccgcct
BMWN1_0001_D08.b : xxxxxxxgaacccgcccaccccccggaaaaagtggtttttttttgggccttttccacttc
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : ttaacgagacaattagctttctttaaatttctcgttccggggaagtgttggagggttgtc
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : tccggtctggggggagggagggggtttttttctcataaaaaccccccaccccggggggag
BMWN1_0030_E03.b : attaatattaccaccacgtgtttcttctttttttcttcatgcgaaggggaagagaggata
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : attcctaccaattgtcattttcttctaaaagcatagaactgaatatttatttaatcattt
BMWN1_0037_C04.b : tctcaacactacaatttattttttattttatattatcacgggaacggggaggagttgttt
BMWN1_0063_D12.b : ccattctttcttttttttttttttttcccggcacggggaggaagtggggattttcttata
BMWN1_0022_D06.b : agggacggggcgggggtgaggtttttttccacatatacagtcaccctcacctccaggagg
BMWN1_0077_D02.b : gccggtgggtttgttttttttcctcggagagggagggggggattttttgcgatttttttt
BMWN1_0078_D03.b : tggtagtttttcggattatcaaccccaaaaccggggaaggggttggatattttgcctttt
BMWN1_0081_F07.b : ttttttttcggtcggggggagggggggggggttttttcacttaaaaaccccccccccggg
BMWN1_0003_E09.b : ttaaattttaggtcacggggaagggggggaggtttttccctaatataggaacagcacttc
BMWN1_0068_D05.b : cacctttgtttttttttttttcgggaggggggaggtgggggttttttcttttaaaatccc
BMWN1_0034_G03.b : gcattttttttttggttaaaggtcggggaagagttttagatttttctttttttatggagc
BMWN1_0003_F08.b : ttttctccaaaaaaagggccaagcgcaggttttccgttttaaaatgggccccctccgtta
BMWN1_0067_F02.b : ccttttaaaaccccccaccccgggaaaagcggtttttatttggagcccttcccttttccc
BMWN1_0092_A04.b : tttttatacgatataggaagatgaatgcacaatttatcatcattatcaaaacatctacca
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ggagggggaaagtttttctctccttataaacagcccccccccggggaaaggggtttgcca
BMWN1_0070_F04.b : ttcccctataataacccccccccggaaaaggggtttcttttggtcttctctctccgcaaa
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : acctccccttgtctttttttttttctctcccggggagaggggaggagtgttttttttatc
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : ttttgcttctctttcgggactacctttaacatcctttaacaatctccacaaggatatgtg
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : atcccttctttttaattttcccgttcggggggggggggggaaaattttctcccaataaaa
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : tttttttttttttttttacgttcggggagagggaggaattttttcccatataaactcgca
BMWN1_0005_H04.b : tattttcaagaatggggaagggtgggaattttttttataacaaaaaatacccaaccccct
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaaataaaaaaaccc
BMWN1_0098_B09.b : tagcaaaaaagaaaaaatttttcccgcataaaaaaagttacacaagggggaactccgttc
BMWN1_0040_E09.b : gagtgagggaaggtttctcggcggttgtgttattttctcttccccgaaagaggggggggg
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : tttttttttcagtccgggggagaggggaagtttttcctccataaaaaacccccccacccg
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : ttttacatgccgggggaggggggaatttttttccaaaaaaaaaccaccaccgggagaaag
BMWN1_0039_B02.b : ccggccgcgggggggggggggaattttttcccccctaaaaaaccccccccccccggggaa
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : ggagttttttttctaatagaaccccccccggcgggaaggggttttttatgggccctttcc
BMWN1_0002_D08.b : ggggttggggaattttttggaatttttaaaagacaaaatttttccaaaactgatataaat
BMWN1_0058_C10.b : tttttttctatatgaggtggaggaggagagggtggagcacttttttttctcctttatttc
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : tttcttttattttgcgggaggggggagggggaagtttttttccaaaaaaaacccccaccc
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : tttttttttttttcggtcgggggaggggggggagtttttctcaataaaaacccaccaccc
BMWN1_0040_B09.b : cccgaaaaaacaatctttaaaaaaacaatcctgtcattattttttatctttctctcaatc
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : ccttttgttttctttttattagggcgaggttggggggaattttctctatttttttttcca
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : aagttcaaaattaagtatacacaaatagatctaaaaataactaagaacaaatcaaaacat
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : ttttccataaaataccaaacctcatgattgttaatcttacaagattctttctaaacatca
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : ctgtccaatttatgatctactaaaaatagaaacttaataaaatgagatggattcttgact
BMWN1_0062_E11.b : tcttttcctttcacacaagtccttctctaccaaaaaagatcaccatatttatccattaaa
BMWN1_0074_F01.b : ttttttttctaagcccgggggaggtgagggaatttttctcctaaaaatataccccccccc
BMWN1_0056_E05.b : tttattttccaccctccgggaagatggcgagattttcttctatataacacccccaccccc
BMWN1_0041_B02.b : ccgtttcctcttcttttatgttttccggctccgggggaaggggggggaagttttttcccc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : cggaaaacatataagtaccctacaaaaatgtcttttttttatttattaggggggagggag
BMWN1_0087_A11.b : aaaaagttctttttttttttcccccccccccaccgcaaaggagaaaattttttctccaaa
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tccctttaaaaaccccccctttctcggaataacattttctactcgcgtcctctcccctct
BMWN1_0065_A11.b : cttttttcttttataactaaaaaacttctccctactcaacataaagttcgggactctaaa
BMWN1_0041_H11.b : tcccggcacaaatacctctgcgatttcttcacatcctaataactcatccgccacccccca
BMWN1_0046_F03.b : aaaatctcataccttttgtctcttctcctatcttatcacaattcataatcttttgtagat
BMWN1_0037_H03.b : tccaaatatatacgcccaccctcggggaaaacgttttttgtatttaagctcccttcttct
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : aactctcatagataatattttggggggagtgttctctctctatggggagaatgtttctat
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cattctaccctttttcaaatacaattccttcccccctaagcactattgttaaggaatgta
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : ggaagagacgagtggatacttgcttctcttttattcttctccccccacactccgtaatcc
BMWN1_0036_H12.b : ggggataggtttaataggttttcttctctaaaataataaaatccccaccaacactgcaag
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : cctatttacctcattctccctctcccacaaactcccccccacactatttcattccctaaa
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ttttatttctctcctaacgcaaaaaatcaagtaccatgtgtttggggtgggaatacttcc
BMWN1_0080_G07.b : agggttgttttttggcccccaacggttcacctccaaggggttttgttttccggggggggt
BMWN1_0096_D04.b : tttggttgggaagtttttctcttaaaggggttcgtttcccaatgggggaaaccaaaaaaa
BMWN1_0010_E03.b : ccctaactactcctgccccggtcttcgggtgggggaaggatcacttcctcaaggggtaat
BMWN1_0021_G08.b : aacttccccttttagaaaactattcattacccgggcccccccccccccaaggtatcccca
BMWN1_0083_A07.b : ttttctcgaaacacccccgccaccatattggatcattgtttttttcatccccctctcatc
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : attaaccctcccccgccttggggggggagggtttccctctcggggggtaagggtttccca
BMWN1_0073_A02.b : tacctcataaaattctctatcataaacacctctttactattttataaatgatatttttgt
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : ggcgtcgacgccctttctccctaaatatatcttttcaaattatggactacacattattca
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : attcatattattgaaatcgcattttctatatttaataatgataatttatcccatcttatc
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : gaaagtggttttttattcgccctccctcctccccacataaccttaccactcatcttatga
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : ggggagagaggttattattgggccccttccacttcccataaagaatctgttctatgtttg
BMWN1_0069_G10.b : ttattggccttctctctcccaaaaaaaaccgtctggtttgggggggaatttttttcgagg
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : aaagggtgttttttagaggccttctcccttcccccaaaaaaaaactaggccagagtttgg
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : gcgcgagaaatcgttatttgatttggacgctttcaagataaccaatgatagacatgcctg
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : aaaagggttttttatttggctcttttcccttcttcctaaaaacacactgctgtgttttct
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : gtcaaaaaaaaagcgccaccccgcgggagggggcggttttttgttgggcccctctcctcc
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaaaccccccccccggggaaaagggtttttcttttgagacctttctccttctcacaaaa
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : tctttttcccaccatgaaatatatctcaggtgttcggatgtgacaatgttacatccccaa
BMWN1_0046_A02.b : ctctctccttccaaaaaagacccccgcaagtcgcgcggggggggtgtggctcctcgagag
BMWN1_0046_D09.b : ttattggccctctccttcccccaacaaacatgcggccaggggtgggcggggcaaggtatc
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : accccgggaaaaagggttggtttatgggtctttcgcttacgaaaaaaaccaaaggggtgt
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : gaggtttttttctttttttaggataaatataagccctcacngggcgggcggacacctatt
BMWN1_0075_D08.b : gggaaatggttttgtttaggggtctttctctcccaccaaaaacaagtcaatatattttgg
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : agaaggtttttctttgccctccttcctctccaaaaaaacccccaaatgtttgtgggggga
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : taaaatcgcccccctccccctcccaataaaaaacctcggccggtttttggcgcgcggaag
BMWN1_0047_H02.b : caccccccaacgaggaaatggatattttttaaataaaatcattttcactccactatcact
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : cccccccccgcgggaaagcgggtttttcattttggggcctttttcctttttcctcaccaa
BMWN1_0001_E04.b : tccccccaaaagaacctagccctgggttttggtgtgggaagggtttacccttctcaaggg
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : ctatccaataacaaaaaatcaaatcaatacactattaatctttatctttcatactcctta
BMWN1_0100_D04.b : ttccccacaaaaacccccgcccggtttttggtggggaggggttttcccctaaggggtatt
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : gaagggtattttttctttatatatgccccccatccggctcacagtgtttcagtcggggcg
BMWN1_0036_B10.b : cccggggagaaggggtttttttttttttcccccttttccctcccaccccacaagaacggg
BMWN1_0037_E04.b : ttttttatagacccctccattcgtctcaaagaattgcgaatcaggtttgccagaaggaat
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : cagaatcctgcgcccggtttttgttgggggaggggttctcccccccaggggggtaagggt
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ccataattcgcccatttttttattaatttcctccacactttttattgtcattaatctcac
BMWN1_0083_C04.b : tcaagaccccgggaatggtgtttgtttggggagcgttttttcccaagggggataggtttc
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : gggttaaagaanttttttntttggggtaaattttgtggggtgaggtttnttggggggggg
BMWN1_0092_D05.b : tattttcaatttcctcaacacaaagaaatcaatttctagtatacggcggatatagtacaa
BMWN1_0099_A06.b : taatattacccctatctagtatactgattttactacaatcctacattcttaaacaaataa
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : aaagagtgatttattgttgactaatcatcatcatccatattattcttacgatattattat
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : atgtggcccctttctctttttctcacaaaaatccagccccctgtaatttgggtggggaga
BMWN1_0073_G04.b : tctattgggtctcttacttttcttaataaaataatgtgccttggttttcgtgggggaggt
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : agttttttctccaaatagaaacaccccctccgcgggaaaaacctttttttatattaaatc
BMWN1_0046_F04.b : aatttttttcatagagaacatcccctcccggctttggcggggggaggttttttcgtggga
BMWN1_0041_E05.b : tcttcccacccacggcgcgggggagaggggtgtgtatttcttgttatttctaaagaacgc
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : aagcgcggtttaaaaaggttgcctttttgtgtcctttcccattctctcctccaaattntc
BMWN1_0001_D08.b : cccccaaaagaaaccttcactttttcttttggtgccgccaacttttatactctataaaag
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : atccatataaacagccccgccccacagaaatgagtgttcgatgagaggctctatcgtttg
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : agggtttgcttttgggcccccttctcctcctcccaataaccccgcccgggtttttggtgg
BMWN1_0030_E03.b : ttttatttaatataataatccacacactcccggaagaggtttattttaatgtggtcccct
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : taaatcactcttaaacattttaccttatgactatctatttttttatacctttcttacatc
BMWN1_0037_C04.b : tattctcttacaaaacatatagaattcacctgcggaaaatatttacttgttttaattaat
BMWN1_0063_D12.b : atataatacccacaccctgaggaatgtgttattttcttataccttctttccccatcctaa
BMWN1_0022_D06.b : ggttatcataagtgacaccctctcttcctcctcatagctatagcgccagcgtcattgggg
BMWN1_0077_D02.b : ctccccccccaccacaccctttttataatgagcctctctttttcctccacaaaagggtgt
BMWN1_0078_D03.b : ccttctacccagaaccggggcttggtgtgggggggtaagcttccccgcgtaaggggttcg
BMWN1_0081_F07.b : gaaggggttttttattgggcctttctccttctcccaaaaaaccccccccgggttttgggg
BMWN1_0003_E09.b : cccgaataaagccctttatcatttgggcattttcctctcccgcctatataataatggccc
BMWN1_0068_D05.b : ccccccggggaaaggtgtttttttgccctcttcctcccccccacaaaacctctccttctt
BMWN1_0034_G03.b : gcgggggcgttagaaaatctttataaaggattccctctactataaggaaaattttggtga
BMWN1_0003_F08.b : cagtatttaaatttggcccctttctttcttgcaaaaggatcccctcttaaggggtaaagg
BMWN1_0067_F02.b : tataattaactcccctctgttattcttgggggaagggtacctcctccaggccgtaatgtt
BMWN1_0092_A04.b : gtaaaaacctacaaaaaaaagacctaccactaaattaatagaaatgataataaataaata
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ttgggcctctttcccttcttccaaaataaatctcccctggatatttcttgcgggagggtg
BMWN1_0070_F04.b : aaaataccccctgtcttggggggaggagtttctctcctggggggaatttttctcaagagg
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :
BMWN1_0001_B08.b : ttaaaactctcccccaccgggacaagagcgtgtcgcttatgataacatctcctcctataa
BMWN1_0066_H07.b :
BMWN1_0082_A09.b :
BMWN1_0032_D09.b :
BMWN1_0060_A03.b :
BMWN1_0013_B05.b :
BMWN1_0047_E05.b :
BMWN1_0062_B10.b :
BMWN1_0090_A02.b :
BMWN1_0090_A07.b :
BMWN1_0083_D03.b :
BMWN1_0009_A07.b :
BMWN1_0069_D11.b :
BMWN1_0038_B05.b :
BMWN1_0087_G08.b : cctctccctttttccctatccctcctcttccccttatcgtgtattctattttttaggaga
BMWN1_0018_H11.b :
BMWN1_0050_G03.b :
BMWN1_0060_F12.b : aaacccccaaaaaccgcaggaaagggggttttataaatggcccctctcccctctccccta
BMWN1_0095_F07.b :
BMWN1_0021_D02.b :
BMWN1_0051_C04.b :
BMWN1_0054_G03.b :
BMWN1_0020_E06.b :
BMWN1_0057_A08.b :
BMWN1_0089_B01.b :
BMWN1_0025_H06.b :
BMWN1_0040_F07.b :
BMWN1_0065_A07.b :
BMWN1_0067_B01.b :
BMWN1_0091_A06.b : ccacgaggaaaccctttgatatgacccccttccctttcgacaaagctaaccacctttgat
BMWN1_0005_H04.b : ggagaaggtgattggttattacgtattatattctactacctacgcaacattcccgtcgct
BMWN1_0023_A08.b :
BMWN1_0080_F01.b :
BMWN1_0091_H02.b :
BMWN1_0026_G01.b :
BMWN1_0049_B11.b :
BMWN1_0028_C11.b :
BMWN1_0023_A12.b :
BMWN1_0028_E07.b :
BMWN1_0077_E11.b : ccccaccccgcggggaagagaggtttgctttggggccctcttccctcccctccacaaaaa
BMWN1_0098_B09.b : tttaattgaaacccccccccccctctcataggtggcgcgggagtgatttttcttgagggg
BMWN1_0040_E09.b : gaaatgtttgtcaaaccttgtatactacccacaccaaccctggaattctggttttttatt
BMWN1_0028_H02.b :
BMWN1_0070_E09.b : ggggaagaggtttttatatgggcccttttccttctcacaataatatttcgccacttgttt
BMWN1_0022_D07.b :
BMWN1_0012_B02.b : cgtttttttttttgccctctttctttcttcctaaataaatcgcagcttttttctggtggg
BMWN1_0039_B02.b : agggtgttttctattggcccctctcctccctccccagaaaagagccacccctgatcttgg
BMWN1_0026_E12.b :
BMWN1_0026_F03.b :
BMWN1_0099_A05.b :
BMWN1_0059_D07.b : tttccaaaaaaaaaaacctatcttgttgtttggcgggggggggtttctccttgagggggt
BMWN1_0002_D08.b : tttgcgcttttagaatttttttcttaaaccctccctcccccttcccctgggccggcggcc
BMWN1_0058_C10.b : tccctcgaggggggagggggtggggggattttttgtatatacatcccccccccccccacg
BMWN1_0003_F12.b :
BMWN1_0010_C11.b :
BMWN1_0091_E12.b :
BMWN1_0056_B04.b :
BMWN1_0068_B10.b : ggggaaggggtttttttttgggccctttctctcctcccaaaaagcatccctttttttttg
BMWN1_0085_H06.b :
BMWN1_0001_A07.b : ggggaagagggtttcttatgggccttttccctcccccccaaaaaccacccccatatattg
BMWN1_0040_B09.b : tcaaggagagaaatgatgagaaacaattaattccgacacaatattccaatttccaaataa
BMWN1_0023_G01.b :
BMWN1_0075_B12.b : aaaccaaaacacaggaaaagcgcggtgaaaaagtggtttcccctttaggccccctccccc
BMWN1_0088_D09.b :
BMWN1_0092_B11.b : ccaaaaaagtgtgtctcacacgcgcgtagatagatgagcattaaactacactaatatacc
BMWN1_0032_E12.b :
BMWN1_0100_G01.b : tgataaaaccaccctaagttattttccttacatttcactacctctcttagacaatacatt
BMWN1_0039_C10.b :
BMWN1_0012_G10.b :
BMWN1_0073_H03.b :
BMWN1_0039_B11.b :
BMWN1_0052_A05.b :
BMWN1_0027_G06.b :
BMWN1_0096_E03.b : ttattctgtctccgataaaacatacttacacatttatccctcttaggcttactactatct
BMWN1_0062_E11.b : tatcgattcttcatcctctatatactcagtctacatgaacttaaattttttacgattctc
BMWN1_0074_F01.b : agtaggaaacgtgttttttttatgaccccttactctatacaaaaaaaacttgaactctgt
BMWN1_0056_E05.b : ggaaaaaatctttctataggaacattttccttaccccccaaaattccctcctccctattc
BMWN1_0041_B02.b : ccttaacaaaacgccccccccccccgcagaaaaagttgttttccaaatgaggcccccctc
BMWN1_0085_E06.b :
BMWN1_0016_F09.b :
BMWN1_0097_G01.b :
BMWN1_0017_B12.b :
BMWN1_0052_H09.b : agaggggtatgagtttttattagctgtataaaaaattacccacgacacgggggatgaatc
BMWN1_0087_A11.b : aaaaaaaaaaacctttgtgtggagaccccctttaaaaaccccccccccaaaaaaaaaaaa
BMWN1_0070_B05.b :
BMWN1_0055_G01.b :
20110601C-000186 : ............................................................
---------+---------+---------+---------+---------+---------+ 761
BMWN1_0086_B05.b : tacaataaaaatacaatataatttactgtgggaatgatatctctttccttgtggatgtta
BMWN1_0065_A11.b : gctacacacctctcttattatatatatatatggtaggtgggaagtctactcccaaaaata
BMWN1_0041_H11.b : aattagatctccctcctcctattttccacactcttcaccctcattcccctcgatgcctcc
BMWN1_0046_F03.b : tcacatctttttatatatgtcctactaccttacataaataataatattctttgaattcta
BMWN1_0037_H03.b : tcgcatcaagaaaaaagaatcaatgtgtggtgagaagaatactttccactagaattagag
BMWN1_0037_F10.b :
BMWN1_0099_B07.b : tatttggataatggaaaaacatattgaaatcaccacactccgaaatagatctcgctctgg
BMWN1_0059_A09.b :
BMWN1_0087_G11.b : cacccccccccggcggatcagatactccactaatatgggtatccgggaaataatacttcc
BMWN1_0089_G05.b :
BMWN1_0040_F12.b : atccattactggtgtgctcacccttgctacctctccaaagcggttatatctctttcccaa
BMWN1_0036_H12.b : tagagcctcttttatttgagaaattctttctatttttctcacatagataaaaaccatata
BMWN1_0088_G05.b :
BMWN1_0030_G11.b :
BMWN1_0091_E05.b :
BMWN1_0016_F04.b :
BMWN1_0018_B10.b : atacttttttcttccccgcatatattttcttatctccagcaccttcactctttctacaac
BMWN1_0013_G12.b :
BMWN1_0062_F12.b : ctctgggtgatatgtttctcttatccggtggagcggaaagaaaacgactgtttaaatctg
BMWN1_0080_G07.b : accccgaaaaaggttaaaagcccaaaggggaaaaaaaggcttttggtttttttagccccc
BMWN1_0096_D04.b : ttgaaaaggcaaaagccaaaaaaaaaggcttggggttttttattcccccccaaacaaaat
BMWN1_0010_E03.b : cggtttcccaaatcgggataacgggaaaaattttaacaagccccaaaggccgaacctaaa
BMWN1_0021_G08.b : tcccggcgttgggggttccggttccccgatataggggaaatgttttaccaaggcaggacg
BMWN1_0083_A07.b : tcttcaaaacaagcctcccgctctgcgaagaatggacaatcctctttcctattagaggag
BMWN1_0008_D09.b :
BMWN1_0057_F04.b : aatgggggaaccgggaaaattttaaaaggcgaaaagccgaacctaaaaggggttgggttt
BMWN1_0073_A02.b : cgtataatattctcaatagaaaaaaaaacatattaaagaagattatgaatgattttatta
BMWN1_0050_G06.b :
BMWN1_0024_G05.b :
BMWN1_0058_B01.b : tattgaaaccttcttccccatccaaacaccatccctatacgcctcgctcccgtttagagc
BMWN1_0005_B12.b :
BMWN1_0084_D12.b :
BMWN1_0100_F02.b :
BMWN1_0050_H04.b :
BMWN1_0099_E08.b : atctatcgtactaaatctacccattgaagaacctactatcatttatttggtgataactct
BMWN1_0062_E04.b :
BMWN1_0050_H05.b :
BMWN1_0090_G05.b :
BMWN1_0074_F02.b : ccgaaaatctatccacatatggtatatgttccctacacgggaatcaagaattctatttaa
BMWN1_0012_A09.b :
BMWN1_0090_H02.b :
BMWN1_0018_H10.b :
BMWN1_0100_G09.b :
BMWN1_0012_C04.b :
BMWN1_0022_E01.b :
BMWN1_0077_E01.b :
BMWN1_0088_A02.b :
BMWN1_0028_G02.b :
BMWN1_0097_H08.b :
BMWN1_0020_C01.b :
BMWN1_0011_B10.b :
BMWN1_0020_G02.b :
BMWN1_0075_D01.b :
BMWN1_0093_B07.b :
BMWN1_0066_G03.b :
BMWN1_0007_B05.b :
BMWN1_0065_G11.b :
BMWN1_0086_H10.b :
BMWN1_0055_A03.b :
BMWN1_0024_C07.b :
BMWN1_0083_C12.b :
BMWN1_0030_G02.b :
BMWN1_0062_G07.b :
BMWN1_0044_B03.b :
BMWN1_0061_B06.b : tggggggggggttttctctctcctggggggtttttttctcacaagggggaacacgaaaat
BMWN1_0069_G10.b : gggttattttccaaaagggaaaccgaaaaattgaaagcccgggggcaataaggcttttgt
BMWN1_0039_D05.b :
BMWN1_0076_C01.b :
BMWN1_0100_A01.b :
BMWN1_0013_C07.b :
BMWN1_0050_G07.b :
BMWN1_0053_E08.b :
BMWN1_0088_A06.b :
BMWN1_0033_C08.b :
BMWN1_0072_G07.b :
BMWN1_0085_C04.b :
BMWN1_0002_H12.b :
BMWN1_0015_G06.b :
BMWN1_0064_G07.b :
BMWN1_0082_A08.b : tgagggggagttttctctctctgaggggtattatgtttctccctatgtggaatccggaaa
BMWN1_0088_A05.b :
BMWN1_0002_G04.b : atgatcaaccggaagaaatagttactgctttatagattgtatgcggtgtaaacaagagaa
BMWN1_0089_D12.b :
BMWN1_0018_D07.b :
BMWN1_0081_A06.b :
BMWN1_0074_A10.b : gcgggggggagtatacctccctcaggggggtgaatgtttccaccaaaggtgataaaccga
BMWN1_0047_C08.b :
BMWN1_0050_E03.b :
BMWN1_0070_C01.b :
BMWN1_0041_D04.b : tctccccaaagaaaacgcgcccactggagggtgggggggggagtgttctcccccttgggg
BMWN1_0048_E04.b :
BMWN1_0067_B02.b :
BMWN1_0053_H06.b : aaaacagcagtgtgttttttgtgggggaggttattttttcccaaggggggtttatgtttc
BMWN1_0030_E07.b :
BMWN1_0062_A03.b : agcggtaaacggtttccccaaatcgggtataccagaaaaatttgtaaaagccccaaatag
BMWN1_0046_A02.b : gggaggtggtttcccacccgtgggaaggcagggaaaaaagtagcaagagcgaggagcagg
BMWN1_0046_D09.b : tcctcgaggggggttatcgttccccaaacgggggaaccggaaaaattgggaaaaggccca
BMWN1_0078_A05.b :
BMWN1_0047_A12.b :
BMWN1_0086_C07.b : ttttggggctccaagttttgtccccacgggggtattttttttccccatttggggctaccc
BMWN1_0057_A12.b :
BMWN1_0020_A11.b : ttcgcataacccctctttccttccaagcgtacgaacagcataatgtgtctgccggtgtcg
BMWN1_0075_D08.b : gtgggagatgtatccttctccggggtatttgtcctccaacaggtgaaacgcgaaaaattt
BMWN1_0016_C10.b :
BMWN1_0063_E12.b :
BMWN1_0019_D03.b :
BMWN1_0021_D09.b : gggttttctctggggggttttttccctcccatgggcaaaccaaaaaaatttaaacggcgc
BMWN1_0061_H11.b :
BMWN1_0044_B07.b : gtattcctctccaggggggtgtgtttcccccaatcggagaacgagaaaaatttttaaaaa
BMWN1_0047_H02.b : ttaatcactaccctatcttttatttctttccctaagaaaacactcctctcttactatggg
BMWN1_0028_C08.b :
BMWN1_0056_G01.b : aaaatccagctccccgagttatgggcgtggggaaagggttatctcccccccagaggggtg
BMWN1_0001_E04.b : gttatcgtttccccaaaaccgggaaacccggaaaaaatttttaaaacccacaaaggccaa
BMWN1_0048_C04.b :
BMWN1_0041_C12.b :
BMWN1_0031_F12.b : attatttttctacctactaatctttattcatgtctgaattaatctatctttactcacaat
BMWN1_0100_D04.b : ggtttccccaatggggacccccaaaaatttgaaaagcccaaagcgcaacaaaaggcggtt
BMWN1_0048_D11.b :
BMWN1_0017_C11.b :
BMWN1_0090_F08.b :
BMWN1_0064_F10.b :
BMWN1_0054_A06.b :
BMWN1_0046_C03.b :
BMWN1_0048_G11.b :
BMWN1_0072_A10.b :
BMWN1_0068_B06.b :
BMWN1_0007_C09.b :
BMWN1_0020_D11.b : gcttttctcctctataagggttatccgctcaatggggtgggagggaatcccactataccg
BMWN1_0036_B10.b : cgcttttgtttttcgccccgcctgtgcttttatctccataagggggttaatttttttccc
BMWN1_0037_E04.b : ttcaataaagaaaaaaataaattttcacatacaggagtatcaaaagaatagatataaggg
BMWN1_0071_B05.b :
BMWN1_0097_D05.b : ttcccaaatccgggaaccccgaaaaaattttgaaaaagcccaaaagccaaaaacttaagg
BMWN1_0017_B03.b :
BMWN1_0003_D01.b : ccgattctttttattattattatatattcccactaccttctactcctatactatctcttt
BMWN1_0083_C04.b : caagagggggaaaggagaaaaattggaaaaaggctaaacccaaaagaaagccggggggtt
BMWN1_0069_E06.b :
BMWN1_0083_E04.b : gtgttttgtttaggggggttttggttgggagaaaatggttaacanaggggaattttggaa
BMWN1_0092_D05.b : gagcttgtattgtgaaactcttcgctaacgacacaatatataaacataatgaaagagggg
BMWN1_0099_A06.b : aaggtgaactacatttctaatttctgatatcttatgaaaatatgtcatatgttcccctgg
BMWN1_0032_D01.b :
BMWN1_0003_C12.b :
BMWN1_0080_A07.b :
BMWN1_0084_F08.b :
BMWN1_0048_F01.b :
BMWN1_0067_H03.b : atactgataattaatattcttttcggtgagattcatttctacatatctgtgaattaataa
BMWN1_0064_B01.b :
BMWN1_0065_H08.b :
BMWN1_0043_C11.b :
BMWN1_0093_F03.b :
BMWN1_0080_B12.b :
BMWN1_0028_F10.b :
BMWN1_0056_A09.b : ggataccccccttacgcgggttatttgtttctcccaaatcgggagaatccagaataatct
BMWN1_0073_G04.b : tttctcccctgagagggattattgtttcccctatattgggatcacctaaaatattttaaa
BMWN1_0062_B07.b :
BMWN1_0083_H10.b :
BMWN1_0036_E02.b : tctctcccctcccatctagagaaacacgacatattctctccggcgggaagattgtatatt
BMWN1_0046_F04.b : gggtttcttttcccggggggggtgttccaaaaactgggaaaagggaaaaagggtaaagga
BMWN1_0041_E05.b : cgccacgccggcatgcgagctttctgtttgtgtcgcccccacactctaccctcctagaca
BMWN1_0048_G12.b :
BMWN1_0066_G07.b :
BMWN1_0030_B05.b :
BMWN1_0060_A01.b : ctccttgcgcttggttgtggccgagatatgtttattaagggttacaccgattctgcaaat
BMWN1_0001_D08.b : ggttaatggttttccccagaacgggggaaaactcaaaaaaaattggtaaaaagccgccaa
BMWN1_0053_A04.b :
BMWN1_0031_D09.b : taatgaagtataaagctgtcgatgagatgagtacaaaggttgtcagctcgacttggggaa
BMWN1_0002_D01.b :
BMWN1_0065_G06.b :
BMWN1_0100_G07.b : ggagaggtttctcctcccggggggtgataggtttctccaaaacagggatagccagaaata
BMWN1_0030_E03.b : accctattcacataataaaacatgtaacattataagggggaagaaaagtatactctttta
BMWN1_0035_G03.b :
BMWN1_0031_C01.b : caatgtcttcacacttcattcctccttccattcatactacttcttttcatctgatataaa
BMWN1_0037_C04.b : atactctctctctcagagcactatacttcatactagcgtttcctttttatgtcttcgaaa
BMWN1_0063_D12.b : cttttatatacctttgaagtttggttgaggaatatcttcatctatagaaggattatacct
BMWN1_0022_D06.b : ccagcgggcttatccccccaaggagtataccgtttctcaccaccggcaaatcccgaaaaa
BMWN1_0077_D02.b : cttttttttgggggggggggttcttccccagggggggaaaggctacacaaggggaaaaaa
BMWN1_0078_D03.b : gtttccggaacgggaaacagaaaactgagaaagggccaagcgaaagcaaggcggttgttt
BMWN1_0081_F07.b : ggggaggttttcctctctaaggggtaatggtttccccaaacgggaaaacggaaaaatttt
BMWN1_0003_E09.b : tgcaatcgcgaggcggaagggatttcttttctagaggggaaagggtctccctctccgggg
BMWN1_0068_D05.b : ggggggggggttgtttctcctgggggggaatttttcctaaaaaggaaacagaaaatattt
BMWN1_0034_G03.b : atagagagttaagttggttgagcatagtgttaattcggtgttaaatgttacacattatac
BMWN1_0003_F08.b : gttccccaactcgggaaacaagaaaattctaaaaaagggaaaaagcaaaaccttaaaggc
BMWN1_0067_F02.b : ttctccatatggggaaaccgaaaaattttttaacgcaccctacgattaataataaagcgt
BMWN1_0092_A04.b : tctttcagaaccgacacgcaggagagtctgttgcattgcatatcggaacataaaaggcag
BMWN1_0074_G11.b :
BMWN1_0024_C12.b :
BMWN1_0061_H03.b :
BMWN1_0089_F07.b :
BMWN1_0010_D11.b :
BMWN1_0084_E05.b : ttcttttcttaggggtaatggtttccccatatgggttaaccccgaataatgtggaaaagg
BMWN1_0070_F04.b : gagaaacgaaaatattaaaaaaccccaaagcaaaaaaaagcccttttgtttttttccccc
BMWN1_0091_E10.b :
BMWN1_0091_A12.b :
BMWN1_0009_G09.b :