[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000204

Length: 1,920

Sequence [FASTA format sequence]
GGTCAGGTGG GCTGGCCGCC TTGACCTTCC TCGCCGCTCG GCCATTTTGT CCCAGTCAGT
TCCAAGGCTG CGGCTGCAGA GGAGTCACCT GCGGAGGAGC TGCAAAGATG CTGTCAGTGC
GCATCGCTGC GGCTGTGGCC CGCGCCCTCC CTCGGCGGGC CGGGCTGGTC TCCAAAAATG
CTTTGGGATC GTCCTTTGTT GCTGCAAGAA ACCTCCATGC CTCTAACACT CGTCTTCAGA
AGACTGGCAC TGCTGAGGTT TCCTCTATTC TTGAAGAGCG AATTCTTGGC GCTGATACCT
CTGTTGACCT TGAAGAGACC GGGCGTGTTT TAAGTATTGG TGATGGTATT GCCCGTGTAC
ACGGGCTGAG AAATGTTCAG GCTGAAGAAA TGGTAGAGTT TTCTTCAGGT TTAAAGGGTA
TGTCTCTGAA CTTGGAACCT GACAATGTTG GTGTTGTCGT GTTTGGAAAT GATAAGCTAA
TTAAGGAAGG AGATATTGTG AAGAGAACTG GGGCCATCGT GGATGTTCCA GTTGGTGAGG
AGCTGTTGGG TCGTGTAGTA GATGCCCTTG GTAACGCCAT TGATGGAAAG GGTCCAATTG
GTTCCAAGAC CCGAAGGCGA GTTGGCCTGA AAGCCCCTGG GATCATTCCT CGAATCTCTG
TGCGGGAACC AATGCAGACT GGCATTAAGG CTGTGGACAG CCTGGTGCCA ATTGGTCGTG
GTCAGCGTGA GCTGATTATT GGCGACCGAC AGACTGGCAA AACGTCAATT GCTATTGACA
CAATCATTAA CCAGAAACGA TTCAATGATG GAACTGATGA AAAGAAAAAG CTGTACTGTA
TCTATGTTGC TATTGGTCAA AAGAGATCCA CTGTTGCCCA GTTGGTGAAG AGACTTACAG
ATGCAGATGC CATGAAGTAC ACCATTGTGG TTTCAGCTAC TGCGTCTGAT GCTGCCCCAC
TTCAGTACCT GGCTCCTTAT TCTGGATGTT CTATGGGAGA ATATTTTAGG GATAATGGCA
AACATGCTTT GATCATCTAT GATGACTTAT CCAAACAGGC TGTTGCTTAT CGTCAGATGT
CTCTGCTGCT CCGCCGACCC CCCGGTCGTG AGGCCTATCC TGGTGACGTG TTCTACCTAC
ACTCCCGTCT GCTGGAGAGA GCGGCCAAAA TGAACGATGC TTTCGGTGGT GGCTCCTTGA
CTGCTTTACC AGTCATCGAA ACACAAGCTG GTGATGTGTC TGCTTACATT CCAACCAACG
TCATTTCCAT CACTGATGGA CAGATTTTCT TGGAAACAGA ATTGTTCTAC AAAGGTATCC
GTCCTGCCAT TAACGTTGGT TTGTCTGTAT CTCGTGTGGG ATCTGCTGCC CAAACCAGGG
CCATGAAGCA GGTGGCAGGT ACCATGAAAC TGGAATTGGC TCAGTATCGT GAAGTTGCTG
CTTTTGCCCA GTTCGGTTCT GACCTGGATG CTGCCACTCA ACAACTCTTG AGTCGTGGTG
TTCGTCTGAC TGAGTTGCTG AAGCAAGGAC AGTATGCTCC CATGGCTATT GAAGAGCAAG
TAGCTGTTAT CTATGCGGGT GTCAGGGGCT ATCTTGATAA GCTGGAGCCT AGCAAGATCA
CAAAGTTTGA GAATGCTTTC TTGTCTCACG TTATCAGCCA ACACCAAGCC CTGTTGGGAA
AAATCAGGGC TGATGGAAAG ATCTCAGAAG AGACAGATGC AAAGCTGAAA GAGATTGTAA
CAAACTTCTT GGCTGGATTT GAAGCTTAAA CTCCTGTGGA TTAACGTTAA ATACCAGTTT
GGTTTTGTCA TTGTTTCTTC TGGTAATTTC CATTTGTAAT AGGATTACTC ATACTGCAGA
TGTACAGTGA CTGCCTTAAA ATAAAGGTTC CATAATGTTG AAAAAAAAAA AAAAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5A1ATP synthase subunit alpha, mitochondrial precursor [Homo sapiens]. 10140.0O
Contig/Assembly ProteinATP5A1ATP synthase subunit alpha, mitochondrial precursor [Homo sapiens]. 10140.0O
Contig/Assembly ProteinATP5BATP synthase subunit beta, mitochondrial precursor [Homo sapiens]. 1034e-22O
Contig/Assembly ProteinATP6V1B2V-type proton ATPase subunit B, brain isoform [Homo sapiens]. 1036e-22O
Contig/Assembly ProteinATP6V1B1V-type proton ATPase subunit B, kidney isoform [Homo sapiens]. 1004e-21O
Contig/Assembly ProteinATP6V1AV-type proton ATPase catalytic subunit A [Homo sapiens]. 67.83e-11


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAtp5a1ATP synthase subunit alpha, mitochondrial precursor [Mus musculus]. 10140.0O
Contig/Assembly ProteinAtp5bATP synthase subunit beta, mitochondrial precursor [Mus musculus]. 1051e-22O
Contig/Assembly ProteinAtp6v1b2V-type proton ATPase subunit B, brain isoform [Mus musculus]. 1035e-22O
Contig/Assembly ProteinAtp6v1b1V-type proton ATPase subunit B, kidney isoform [Mus musculus]. 99.49e-21O
Contig/Assembly ProteinAtp6v1aV-type proton ATPase catalytic subunit A [Mus musculus]. 67.83e-11


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5A1PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor isoform 2 [Canis familiaris]. 558e-159O
Contig/Assembly ProteinATP5A1PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor isoform 1 [Canis familiaris]. 545e-155O
Contig/Assembly ProteinLOC487689PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor [Canis familiaris]. 521e-148O
Contig/Assembly ProteinLOC476856PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor [Canis familiaris]. 431e-120O
Contig/Assembly ProteinLOC487915PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor [Canis familiaris]. 3411e-93O
Contig/Assembly ProteinATP5A1PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor isoform 4 [Canis familiaris]. 2351e-61O
Contig/Assembly ProteinATP5A1PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor isoform 3 [Canis familiaris]. 1881e-47O
Contig/Assembly ProteinLOC610919PREDICTED: similar to ATP synthase alpha chain, mitochondrial precursor [Canis familiaris]. 1842e-46O
Contig/Assembly ProteinATP5BPREDICTED: similar to ATP synthase beta chain, mitochondrial precursor isoform 1 [Canis familiaris]. 1043e-22O
Contig/Assembly ProteinLOC486137PREDICTED: similar to ATPase, H+ transporting, V1 subunit B, isoform 2 isoform 1 [Canis familiaris]. 1043e-22O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5A1ATP synthase subunit alpha, mitochondrial precursor [Bos taurus]. 10180.0O
Contig/Assembly ProteinATP5BATP synthase subunit beta, mitochondrial precursor [Bos taurus]. 1051e-22O
Contig/Assembly ProteinATP6V1B2V-type proton ATPase subunit B, brain isoform isoform 2 [Bos taurus]. 1035e-22O
Contig/Assembly ProteinATP6V1B2V-type proton ATPase subunit B, brain isoform isoform 1 [Bos taurus]. 1035e-22O
Contig/Assembly ProteinATP6V1B1V-type proton ATPase subunit B, kidney isoform [Bos taurus]. 1003e-21O
Contig/Assembly ProteinATP6V1AV-type proton ATPase catalytic subunit A [Bos taurus]. 67.83e-11


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5A1ATP synthase subunit alpha, mitochondrial [Sus scrofa]. 10280.0O
Contig/Assembly ProteinLOC100623706PREDICTED: hypothetical protein LOC100623706 [Sus scrofa]. 1581e-38O
Contig/Assembly ProteinATP5BPREDICTED: ATP synthase subunit beta, mitochondrial [Sus scrofa]. 1051e-22O
Contig/Assembly ProteinLOC100523998PREDICTED: v-type proton ATPase subunit B, brain isoform-like [Sus scrofa]. 1033e-22O
Contig/Assembly ProteinLOC100523368PREDICTED: v-type proton ATPase subunit B, kidney isoform-like [Sus scrofa]. 99.85e-21O
Contig/Assembly ProteinATP6V1AV-type proton ATPase catalytic subunit A [Sus scrofa]. 673e-11


Assembly Members: 278      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010028E09ADR01_0028_E09.bDB783972 
ADR010083B04ADR01_0083_B04.bDB788851 
AMP010003B07AMP01_0003_B07.bBW955138 
AMP010037D04AMP01_0037_D04.bBW957677 
AMP010046E10AMP01_0046_E10.bBW958262 
AMP010057E02AMP01_0057_E02.bBW959099 
AMP010061G02AMP01_0061_G02.bBW959452 
BFLT10004F10BFLT1_0004_F10.bFS640307 
BFLT10010H12BFLT1_0010_H12.bFS640833 
BFLT10012H08BFLT1_0012_H08.bFS640997 
BFLT10033C10BFLT1_0033_C10.bFS642694 
BFLT10079A09BFLT1_0079_A09.bFS646208 
BFLT10082E10BFLT1_0082_E10.bFS646491 
BFLT10090C04BFLT1_0090_C04.bFS647127 
BFLT10098E08BFLT1_0098_E08.bFS647824 
BFLT10107H09BFLT1_0107_H09.bHX202359 
BFLT10108E11BFLT1_0108_E11.bHX202418 
BFLT10112G01BFLT1_0112_G01.bHX202750 
BFLT10129G11BFLT1_0129_G11.bHX204143 
BFLT10144B08BFLT1_0144_B08.bHX205106 
BFLT10147B07BFLT1_0147_B07.bHX205271 
BKFL10007F04BKFL1_0007_F04.bFS648344 
BKFL10095C01BKFL1_0095_C01.bFS654804 AK390788
BKFL10106H03BKFL1_0106_H03.bFS655829 
BMWN10021E04BMWN1_0021_E04.bHX206851 
BMWN10041D06BMWN1_0041_D06.bHX208055 
CBLT10007E04CBLT1_0007_E04.bHX212279 
CBLT10022C05CBLT1_0022_C05.bHX213368 
CBLT10051H09CBLT1_0051_H09.bHX215269 
CBLT10075F04CBLT1_0075_F04.bHX217174 
CBLT10092F01CBLT1_0092_F01.b  
CLNT10032G11CLNT1_0032_G11.bFS659595 
CLNT10034F06CLNT1_0034_F06.bFS659734 
CLNT10038B10CLNT1_0038_B10.bFS660009 
CLNT10121H11CLNT1_0121_H11.bHX220818 
CLNT10132C10CLNT1_0132_C10.bHX221597 
CLNT10140G07CLNT1_0140_G07.bHX222247 
DCI010012F02DCI01_0012_F02.bDB791386 
DCI010018F06DCI01_0018_F06.bDB791918 
DCI010030H12DCI01_0030_H12.bDB793007 
DCI010042G08DCI01_0042_G08.bDB793965 
DCI010060F02DCI01_0060_F02.bDB794920 
DCI010118F04DCI01_0118_F04.bDB800049 
HTMT10008G09HTMT1_0008_G09.bFS664821 
HTMT10011H06HTMT1_0011_H06.bFS665035 
HTMT10015G05HTMT1_0015_G05.bFS665312 
HTMT10097B02HTMT1_0097_B02.bFS671045 
HTMT10113C02HTMT1_0113_C02.b  
HTMT10118E12HTMT1_0118_E12.b  
HTMT10125B06HTMT1_0125_B06.bHX224831 
ILNT10008B04ILNT1_0008_B04.bHX227310 
ILNT10025F06ILNT1_0025_F06.bHX228660 
ITT010020B05ITT01_0020_B05.bBW977774 
ITT010022C12ITT01_0022_C12.bBW977976 
ITT010024A12ITT01_0024_A12.bBW978136 
ITT010026F03ITT01_0026_F03.bBW978370 
ITT010031F08ITT01_0031_F08.bBW978812 
ITT010040D04ITT01_0040_D04.bBW979599 
ITT010041G04ITT01_0041_G04.bBW979723 
ITT010041G10ITT01_0041_G10.bBW979729 
ITT010048F06ITT01_0048_F06.bBW980261 
ITT010050G07ITT01_0050_G07.bBW980459 
ITT010067H03ITT01_0067_H03.bBW982005 
ITT010070E04ITT01_0070_E04.bBW982243 
ITT010076H10ITT01_0076_H10.bBW982810 
ITT010077A05ITT01_0077_A05.bBW982816 
ITT010091E05ITT01_0091_E05.bBW984091 
ITT010092G11ITT01_0092_G11.bBW984210 
ITT010103B06ITT01_0103_B06.bBW985146 
KDN010022A07KDN01_0022_A07.bFS672812 
KDN010027C06KDN01_0027_C06.bFS673229 
KDN010028F05KDN01_0028_F05.bFS673333 
KDN010032H10KDN01_0032_H10.bFS673675 
KDN010036D02KDN01_0036_D02.bFS673946 
KDN010039B03KDN01_0039_B03.b  
KDN010051G01KDN01_0051_G01.b  
KDN010052D07KDN01_0052_D07.bFS674595 
KDN010053G01KDN01_0053_G01.bFS674685 
KDN010062E06KDN01_0062_E06.bFS675382 
KDN010063D06KDN01_0063_D06.bFS675452 
KDN010075E12KDN01_0075_E12.bFS676418 
KDN010079H01KDN01_0079_H01.bFS676755 
KDN010090E07KDN01_0090_E07.bFS677593 
KDN010092G03KDN01_0092_G03.bFS677775 
LNG010016B01LNG01_0016_B01.bBP433990 
LNG010026E04LNG01_0026_E04.bBP437196 
LNG010027C01LNG01_0027_C01.bBP434977 
LNG010042B08LNG01_0042_B08.bBP434579 
LNG010045G11LNG01_0045_G11.bBP439812 
LNG010076C10LNG01_0076_C10.bBP435749 
LNG010103E05LNG01_0103_E05.bBP437336 
LNG010105H01LNG01_0105_H01.bBP440029 
LVR010105H12LVR01_0105_H12.bBP448144 
LVRM10002F06LVRM1_0002_F06.bBP140006 
LVRM10027D03LVRM1_0027_D03.bBP138988 
LVRM10038D02LVRM1_0038_D02.bCJ001665 
LVRM10096A09LVRM1_0096_A09.bBW963044 
LVRM10107D12LVRM1_0107_D12.bBP451342 
LVRM10183E06LVRM1_0183_E06.bBW963210 
LVRM10184G04LVRM1_0184_G04.bBW963219 
LVRM10187H06LVRM1_0187_H06.bCJ006081 
MLN010048E07MLN01_0048_E07.bCJ011368 
MLN010055B02MLN01_0055_B02.bCJ011935 
MLN010062D06MLN01_0062_D06.bCJ012509 
MLN010070D09MLN01_0070_D09.bBW963726 
MLN010076G03MLN01_0076_G03.bCJ013694 
MLN010077B04MLN01_0077_B04.bCJ013722 
MLTL10004B05MLTL1_0004_B05.bFS678739 
MLTL10027H11MLTL1_0027_H11.bFS680804 
MLTL10036B10MLTL1_0036_B10.bFS681512 
MLTL10044D03MLTL1_0044_D03.bFS682235 
MLTL10053G06MLTL1_0053_G06.bFS683063 
MLTL10054H05MLTL1_0054_H05.bFS683162 
MLTL10075F01MLTL1_0075_F01.bFS684121 
MLTL10080H12MLTL1_0080_H12.bFS684599 
MLTL10085C04MLTL1_0085_C04.bFS684980 
MLTL10085F05MLTL1_0085_F05.bFS685015 
MLTL10090B07MLTL1_0090_B07.bFS685428 
MLTL10092C02MLTL1_0092_C02.bFS685618 
OVR010006F06OVR01_0006_F06.bBP143673 
OVR010008G03OVR01_0008_G03.bBP144024 
OVR010018B08OVR01_0018_B08.bBP141954 
OVR010020D04OVR01_0020_D04.bBP142714 
OVR010022H03OVR01_0022_H03.bBP144480 
OVR010025A09OVR01_0025_A09.bBP141559 
OVR010025C06OVR01_0025_C06.bBP142339 
OVR010039E04OVR01_0039_E04.bBP143176 
OVR010041F03OVR01_0041_F03.bBP143583 
OVR010042H11OVR01_0042_H11.bBP144799 
OVR010047D04OVR01_0047_D04.bBP142736 
OVR010052A03OVR01_0052_A03.bBW964211 
OVR010062F06OVR01_0062_F06.bBW965162 
OVR010069B01OVR01_0069_B01.bBW965736 
OVR010072H10OVR01_0072_H10.bBW966084 
OVR010073E01OVR01_0073_E01.bBW966115 
OVR010076A03OVR01_0076_A03.bBW966342 
OVR010088E05OVR01_0088_E05.bBW967244 
OVR010099G02OVR01_0099_G02.bBW968091 
OVRM10007H01OVRM1_0007_H01.bBP153670 
OVRM10010F04OVRM1_0010_F04.bBP151446 
OVRM10022C09OVRM1_0022_C09.bBP148222 
OVRM10022D02OVRM1_0022_D02.bBP148761 
OVRM10028B01OVRM1_0028_B01.bBP146147 
OVRM10031E06OVRM1_0031_E06.bBP150419 
OVRM10037A04OVRM1_0037_A04.bBP454887 
OVRM10037G07OVRM1_0037_G07.bBP460900 
OVRM10039G11OVRM1_0039_G11.bBP461214 
OVRM10055A09OVRM1_0055_A09.bBP145717 
OVRM10056A07OVRM1_0056_A07.bBP145503 
OVRM10056H10OVRM1_0056_H10.bBP154697 
OVRM10066G06OVRM1_0066_G06.bBP152928 
OVRM10067F12OVRM1_0067_F12.bBP152320 
OVRM10087H02OVRM1_0087_H02.bBP153832 
OVRM10124F07OVRM1_0124_F07.bBP151842 
OVRM10125B07OVRM1_0125_B07.bBP146854 
OVRM10132G08OVRM1_0132_G08.bBP153203 
OVRM10136B08OVRM1_0136_B08.bBP146971 
OVRM10149F02OVRM1_0149_F02.bBP459496 
OVRM10167B01OVRM1_0167_B01.bBP455582 
OVRM10171F10OVRM1_0171_F10.bBP460192 
OVRM10189F08OVRM1_0189_F08.bBP460030 
OVRM10190E10OVRM1_0190_E10.bBP459205 
OVRM10191E03OVRM1_0191_E03.bBP458660 
OVRM10206E07OVRM1_0206_E07.bBP458993 
OVRM10208B01OVRM1_0208_B01.bBP455613 
OVRM10218H01OVRM1_0218_H01.bBP461435 
OVRM10219G05OVRM1_0219_G05.bBP460801 AK236714
OVRM10223F12OVRM1_0223_F12.bBP460396 
OVRT10006E06OVRT1_0006_E06.bFS686877 
OVRT10007B09OVRT1_0007_B09.bFS686938 
OVRT10026G10OVRT1_0026_G10.bFS688569 
OVRT10039B11OVRT1_0039_B11.bFS689562 
OVRT10050A03OVRT1_0050_A03.bFS690455 
OVRT10086G09OVRT1_0086_G09.bFS693444 
OVRT10096C06OVRT1_0096_C06.bFS694224 
OVRT10112C01OVRT1_0112_C01.bHX235761 
OVRT10115G03OVRT1_0115_G03.bHX236052 
OVRT10118F10OVRT1_0118_F10.bHX236304 
OVRT10139G06OVRT1_0139_G06.bHX237971 
OVRT10140A09OVRT1_0140_A09.bHX237996 
OVRT10146E09OVRT1_0146_E09.bHX238534 
PBL010027B08PBL01_0027_B08.bBW969928 
PBL010051G05PBL01_0051_G05.bBW971120 
PBL010096C03PBL01_0096_C03.bBW974584 
PBL010101G07PBL01_0101_G07.bBW975085 
PCT010004B05PCT01_0004_B05.bFS694843 
PCT010004F11PCT01_0004_F11.bFS694884 
PCT010009E01PCT01_0009_E01.bHX239075 
PCT010022H01PCT01_0022_H01.bFS696126 
PCT010035H05PCT01_0035_H05.bFS696987 
PST010026B10PST01_0026_B10.bFS699015 
PST010038C12PST01_0038_C12.bFS699798 
PST010047D03PST01_0047_D03.bFS700525 
PST010062D01PST01_0062_D01.bFS701728 
PST010067A12PST01_0067_A12.bFS702105 
PST010073F06PST01_0073_F06.bFS702597 
PST010078H02PST01_0078_H02.bFS703030 
PST010091B11PST01_0091_B11.bFS704025 
PST010095C03PST01_0095_C03.bFS704336 AK396809
PST010095E09PST01_0095_E09.bFS704357 
PST010098G04PST01_0098_G04.bFS704576 
PTG010034C07PTG01_0034_C07.bFS707384 
PTG010050A08PTG01_0050_A08.bFS708793 
PTG010052D06PTG01_0052_D06.bFS709000 
PTG010062G08PTG01_0062_G08.bFS709868 
PTG010072D03PTG01_0072_D03.bFS710560 
PTG010103B12PTG01_0103_B12.b  
SKNB10004F11SKNB1_0004_F11.bDB800315 
SKNB10016A07SKNB1_0016_A07.bDB800845 
SKNB10071B08SKNB1_0071_B08.bDB804303 
SMG010007C10SMG01_0007_C10.b  
SMG010023D11SMG01_0023_D11.bFS715277 
SMG010028E01SMG01_0028_E01.bFS715738 
SMG010039C05SMG01_0039_C05.bFS716678 
SMG010052B10SMG01_0052_B10.bFS717775 
SMG010068B01SMG01_0068_B01.bFS719118 
SMG010071A01SMG01_0071_A01.bFS719363 
SMG010072A06SMG01_0072_A06.bFS719453 
SMG010080E11SMG01_0080_E11.bFS720204 
SMG010093G08SMG01_0093_G08.bFS721333 
SMG010095A07SMG01_0095_A07.bFS721431 
SMG010103C12SMG01_0103_C12.bFS722090 
SMG010103D12SMG01_0103_D12.bFS722101 
SPL010008F12SPL01_0008_F12.bBP158684 
SPL010041G01SPL01_0041_G01.bBP158730 
SPL010053F05SPL01_0053_F05.bCJ017809 
SPL010084C06SPL01_0084_C06.bCJ020577 
TCH010001D09TCH01_0001_D09.bCJ022522 
TCH010054C12TCH01_0054_C12.bBW975903 
TCH010096A02TCH01_0096_A02.bCJ029426 
TES010001C09TES01_0001_C09.bCJ030043 
TES010009B09TES01_0009_B09.bCJ030580 
TES010015B10TES01_0015_B10.bCJ030994 
TES010017F10TES01_0017_F10.bCJ031159 
TES010030G06TES01_0030_G06.bCJ032011 
TES010031B10TES01_0031_B10.bCJ032040 
TES010032B05TES01_0032_B05.bCJ032103 
TES010035F06TES01_0035_F06.bCJ032324 
TES010052E10TES01_0052_E10.bCJ033340 
TES010057E03TES01_0057_E03.bCJ033640 
TES010059B06TES01_0059_B06.bCJ033755 
TES010063A05TES01_0063_A05.bCJ034024 
TES010077G07TES01_0077_G07.bCJ034976 
TES010079C05TES01_0079_C05.bCJ035074 
TES010085A11TES01_0085_A11.bCJ035469 
TES010085H04TES01_0085_H04.bCJ035522 
TES010087A12TES01_0087_A12.bCJ035607 
TES010088E02TES01_0088_E02.bCJ035697 
TES010088H10TES01_0088_H10.bCJ035730 
TES010096B06TES01_0096_B06.b  
TES010098A12TES01_0098_A12.bCJ036385 
THY010002E02THY01_0002_E02.bBP164433 
THY010003D01THY01_0003_D01.bBP163079 
THY010026F10THY01_0026_F10.bBP166532 
THY010034D05THY01_0034_D05.bBP163519 
THY010040E09THY01_0040_E09.bBP165189 
THY010041H01THY01_0041_H01.bBP168126 
THY010043A01THY01_0043_A01.bBP159395 
THY010043D08THY01_0043_D08.bBP163833 
THY010044C10THY01_0044_C10.bBP162802 
THY010045E04THY01_0045_E04.bBP164683 
THY010048H08THY01_0048_H08.bBP168887 
THY010051D05THY01_0051_D05.bBP163533 
THY010059C01THY01_0059_C01.bBP161877 
THY010088C05THY01_0088_C05.bBP162314 
THY010095E09THY01_0095_E09.bBP165232 
THY010105A01THY01_0105_A01.bBP159439 
THY010109F12THY01_0109_F12.b  
THY010110E01THY01_0110_E01.bBP164416 
THY010113H05THY01_0113_H05.bBP168615 
THY010119C06THY01_0119_C06.bBP162437 
THY010123A06THY01_0123_A06.bBP159961 
THY010202A07THY01_0202_A07.bBP160068 
UTR010035D07UTR01_0035_D07.bBP171265 
UTR010041C04UTR01_0041_C04.bBP170591 
UTR010045B08UTR01_0045_B08.bBP170239 
UTR010083H03UTR01_0083_H03.bCJ037699 
UTR010104D02UTR01_0104_D02.bCJ039503 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
123A13400.568WNATC/I
G64380.432GTC/V


Alignment:      TOP

20110601C-000204 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CBLT1_0007_E04.b :
OVRM1_0022_D02.b :
BFLT1_0129_G11.b :
PST01_0095_C03.b :
MLN01_0048_E07.b :
MLTL1_0053_G06.b : nnngggattannnnnnccgaaccntaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_G06.b :
TES01_0032_B05.b :
CBLT1_0051_H09.b :
SMG01_0072_A06.b :
THY01_0026_F10.b :
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b :
THY01_0003_D01.b :
OVR01_0022_H03.b :
THY01_0002_E02.b :
SMG01_0023_D11.b :
THY01_0044_C10.b :
SMG01_0093_G08.b :
SMG01_0007_C10.b :
TES01_0057_E03.b :
LNG01_0045_G11.b :
UTR01_0035_D07.b :
SMG01_0103_C12.b :
SMG01_0095_A07.b :
OVRT1_0118_F10.b :
OVRT1_0086_G09.b :
OVR01_0062_F06.b :
LNG01_0026_E04.b :
SMG01_0039_C05.b :
OVRT1_0115_G03.b :
PST01_0038_C12.b :
BFLT1_0107_H09.b :
OVRT1_0039_B11.b :
BFLT1_0012_H08.b :
THY01_0034_D05.b :
THY01_0088_C05.b :
PBL01_0101_G07.b :
OVR01_0020_D04.b :
CLNT1_0032_G11.b :
ITT01_0048_F06.b :
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b :
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b :
TES01_0087_A12.b :
PTG01_0072_D03.b :
SMG01_0080_E11.b :
OVR01_0047_D04.b :
KDN01_0053_G01.b :
PST01_0062_D01.b :
ITT01_0077_A05.b :
BFLT1_0082_E10.b :
KDN01_0052_D07.b :
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b :
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b :
CLNT1_0121_H11.b :
OVRT1_0026_G10.b :
PST01_0073_F06.b :
ITT01_0026_F03.b :
MLN01_0076_G03.b :
THY01_0045_E04.b :
THY01_0119_C06.b :
SKNB1_0004_F11.b :
PCT01_0035_H05.b :
PCT01_0009_E01.b :
KDN01_0090_E07.b :
PCT01_0004_B05.b :
PST01_0098_G04.b :
PST01_0078_H02.b :
PST01_0095_E09.b :
TES01_0096_B06.b :
LVRM1_0027_D03.b :
HTMT1_0118_E12.b :
BFLT1_0144_B08.b :
MLTL1_0054_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxx
BKFL1_0007_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxx
DCI01_0042_G08.b : nnnnccatactaaxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0004_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxx
LVRM1_0107_D12.b :
DCI01_0012_F02.b : nnnaacgatacaaxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_B09.b :
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b :
HTMT1_0125_B06.b :
DCI01_0030_H12.b : naaaggtactaaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_H06.b :
CBLT1_0092_F01.b :
HTMT1_0097_B02.b :
SPL01_0053_F05.b :
CBLT1_0022_C05.b :
HTMT1_0113_C02.b :
LNG01_0103_E05.b :
OVR01_0041_F03.b :
OVRT1_0006_E06.b :
OVR01_0039_E04.b :
ILNT1_0025_F06.b :
MLN01_0077_B04.b :
THY01_0105_A01.b :
AMP01_0003_B07.b : ttttccgatatctaaxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b :
AMP01_0037_D04.b : nnnttgatatatatagagatacttaxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0096_A02.b :
MLTL1_0027_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0018_F06.b : nnnaagatactaaxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_F10.b :
AMP01_0046_E10.b : atttagcgaatcttaxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_G03.b :
CLNT1_0132_C10.b :
BFLT1_0079_A09.b :
HTMT1_0015_G05.b :
THY01_0095_E09.b :
BMWN1_0021_E04.b :
LNG01_0027_C01.b :
LNG01_0016_B01.b :
ADR01_0083_B04.b :
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b :
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b :
SMG01_0068_B01.b :
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b :
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b :
SMG01_0071_A01.b :
OVRT1_0140_A09.b :
OVR01_0069_B01.b :
UTR01_0045_B08.b :
TCH01_0054_C12.b :
THY01_0051_D05.b :
BFLT1_0112_G01.b :
LVR01_0105_H12.b :
CLNT1_0140_G07.b :
BFLT1_0010_H12.b :
OVR01_0042_H11.b :
SPL01_0084_C06.b :
ITT01_0070_E04.b :
SPL01_0041_G01.b :
SMG01_0028_E01.b :
OVR01_0088_E05.b :
CLNT1_0034_F06.b :
BFLT1_0098_E08.b :
OVR01_0025_A09.b :
BFLT1_0090_C04.b :
OVR01_0052_A03.b :
ITT01_0091_E05.b :
BFLT1_0108_E11.b :
ITT01_0041_G04.b :
ITT01_0020_B05.b :
LNG01_0105_H01.b :
OVR01_0006_F06.b :
OVRT1_0096_C06.b :
UTR01_0104_D02.b :
THY01_0202_A07.b :
ITT01_0076_H10.b :
ITT01_0022_C12.b :
ITT01_0092_G11.b :
ITT01_0041_G10.b :
ITT01_0103_B06.b :
ITT01_0050_G07.b :
ITT01_0024_A12.b :
OVR01_0018_B08.b :
BMWN1_0041_D06.b :
PTG01_0062_G08.b :
OVR01_0025_C06.b :
TES01_0001_C09.b :
TES01_0009_B09.b :
UTR01_0041_C04.b :
CBLT1_0075_F04.b :
HTMT1_0008_G09.b :
PBL01_0051_G05.b :
LNG01_0076_C10.b :
AMP01_0057_E02.b : ttataggggtacttxxxxxxxxxxxxxxxxxxx
THY01_0043_D08.b :
OVRM1_0022_C09.b :
TES01_0088_H10.b :
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b :
BFLT1_0033_C10.b :
SPL01_0008_F12.b :
ITT01_0067_H03.b :
OVRT1_0050_A03.b :
ITT01_0040_D04.b :
ITT01_0031_F08.b :
TES01_0079_C05.b :
OVRT1_0139_G06.b :
TES01_0085_A11.b :
KDN01_0062_E06.b :
KDN01_0028_F05.b :
TES01_0052_E10.b :
PST01_0047_D03.b :
KDN01_0032_H10.b :
TES01_0017_F10.b :
PST01_0091_B11.b :
KDN01_0051_G01.b :
KDN01_0027_C06.b :
TES01_0098_A12.b :
SKNB1_0071_B08.b :
KDN01_0039_B03.b :
KDN01_0036_D02.b :
KDN01_0079_H01.b :
KDN01_0075_E12.b :
PST01_0026_B10.b :
PST01_0067_A12.b :
TES01_0077_G07.b :
SKNB1_0016_A07.b :
MLTL1_0085_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0147_B07.b :
ADR01_0028_E09.b :
DCI01_0118_F04.b :
KDN01_0022_A07.b :
MLTL1_0092_C02.b :
TES01_0088_E02.b :
LNG01_0042_B08.b :
SMG01_0103_D12.b :
TES01_0085_H04.b :
TCH01_0001_D09.b :
SMG01_0052_B10.b :
THY01_0041_H01.b :
AMP01_0061_G02.b :
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b :
DCI01_0060_F02.b :
PCT01_0004_F11.b :
MLTL1_0075_F01.b :
MLTL1_0090_B07.b :
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CBLT1_0007_E04.b : ttttnggcaggacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_D02.b : catxxxxxxxxxxxxxxxxxxxxx
BFLT1_0129_G11.b : nnnnccgtcgctgtagnatgttxxxxxx
PST01_0095_C03.b :
MLN01_0048_E07.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_G06.b :
TES01_0032_B05.b :
CBLT1_0051_H09.b : ntttacg
SMG01_0072_A06.b : nnnccggcttttttntt
THY01_0026_F10.b : tttttgttgactattagxxxxxxxxxxxx
OVRM1_0132_G08.b : nagttgt
OVRM1_0219_G05.b : nagttgtcxxxx
THY01_0043_A01.b : gggggcacxxxxxxxxxxxxxxxxxxxxx
THY01_0003_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0022_H03.b : tttgggctgxxxxxxxxxxxxxxxxxxxxx
THY01_0002_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_D11.b : nggcgttttantt
THY01_0044_C10.b : cttttgggtgcactxxxxxxxxxxxxxxxxxx
SMG01_0093_G08.b : nnnnnnnnnnnnn
SMG01_0007_C10.b : nnggtgta
TES01_0057_E03.b :
LNG01_0045_G11.b : tgttttttttttgcttagtgxxxxxxxxxxxxxxxxxxxx
UTR01_0035_D07.b : ggggacctattagxxxxxxxxxxxx
SMG01_0103_C12.b : ngggcttntnnnn
SMG01_0095_A07.b : nnnnnnnnnnnnn
OVRT1_0118_F10.b : nnnccgttcagcgaggx
OVRT1_0086_G09.b : nnggtcttnnnnggnnccgttcgcgnacgx
OVR01_0062_F06.b : nnnnggcttggactatgacxxxxxxxxx
LNG01_0026_E04.b : ccatttgcgtgxxxxxxxxxxxxxxxxxx
SMG01_0039_C05.b : nngggatttannnn
OVRT1_0115_G03.b : nnnnaacgtcagcgnacgx
PST01_0038_C12.b :
BFLT1_0107_H09.b : nntttactatagcgnagga
OVRT1_0039_B11.b : nccccacttcagcgnacga
BFLT1_0012_H08.b : nggattcgttagcgnacgx
THY01_0034_D05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0088_C05.b : cttatggtggxxxxxxxxxxxxxxxxxxxxx
PBL01_0101_G07.b : nn
OVR01_0020_D04.b : tggggtgaacctattagxxxxxxxxxxxxx
CLNT1_0032_G11.b : gattccgttcagcgnacgx
ITT01_0048_F06.b : nnnn
OVRM1_0066_G06.b : nagttgtc
THY01_0123_A06.b :
THY01_0040_E09.b : ggggtgcccttattaaaacaaagtxxxxxxx
OVRM1_0189_F08.b :
OVRM1_0010_F04.b : cxxxxxxxxxxxxxxx
OVRM1_0125_B07.b : nagttg
PTG01_0103_B12.b : gctttttnnttttgg
TES01_0087_A12.b :
PTG01_0072_D03.b : nnnnnnnnnnnnnnnn
SMG01_0080_E11.b : ngggattaann
OVR01_0047_D04.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_G01.b :
PST01_0062_D01.b :
ITT01_0077_A05.b : nnn
BFLT1_0082_E10.b : ttcgtcagcgnacg
KDN01_0052_D07.b :
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b :
OVRM1_0055_A09.b : agtt
OVRM1_0208_B01.b : cgtt
OVRM1_0031_E06.b : xxxxxxxxx
THY01_0048_H08.b : tgggggxxxxxxxxxxxxxxxxxxxxxx
PTG01_0050_A08.b : aaaa
CLNT1_0121_H11.b : nttttccgttagcgnacg
OVRT1_0026_G10.b : nnttttctatagcgnacg
PST01_0073_F06.b :
ITT01_0026_F03.b :
MLN01_0076_G03.b : tttttggtaggacttgacxxxxxxx
THY01_0045_E04.b : ccttttggtggxxxxxxxxxxxxxxxxxx
THY01_0119_C06.b :
SKNB1_0004_F11.b :
PCT01_0035_H05.b :
PCT01_0009_E01.b :
KDN01_0090_E07.b :
PCT01_0004_B05.b :
PST01_0098_G04.b :
PST01_0078_H02.b :
PST01_0095_E09.b :
TES01_0096_B06.b :
LVRM1_0027_D03.b :
HTMT1_0118_E12.b :
BFLT1_0144_B08.b : attttttnnnnnnccgttcgc
MLTL1_0054_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0007_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0004_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_D12.b : c
DCI01_0012_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_B09.b : nnnnccgtctc
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : nnnccgcttggactataac
HTMT1_0125_B06.b :
DCI01_0030_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_H06.b :
CBLT1_0092_F01.b :
HTMT1_0097_B02.b :
SPL01_0053_F05.b : nnnnggctagtgacttnacxxxxxxx
CBLT1_0022_C05.b :
HTMT1_0113_C02.b :
LNG01_0103_E05.b : nnnnnaagttggacttga
OVR01_0041_F03.b : aagaatcxxxxxxxxxxxxxxxx
OVRT1_0006_E06.b : nnnnncctata
OVR01_0039_E04.b : ggaccttttagtgxxxxxxxxxx
ILNT1_0025_F06.b :
MLN01_0077_B04.b : ttttgggtaggactat
THY01_0105_A01.b :
AMP01_0003_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : n
AMP01_0037_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0096_A02.b : tttttggcttggtacttn
MLTL1_0027_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_F10.b : ggaatact
AMP01_0046_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_G03.b : tagggggccctattttagxxxxxxxxxxxxxxx
CLNT1_0132_C10.b : nnnccccg
BFLT1_0079_A09.b : aatccgttagc
HTMT1_0015_G05.b :
THY01_0095_E09.b : ggttttttaagcatttgtgxxxxxxxx
BMWN1_0021_E04.b :
LNG01_0027_C01.b : gaggactttagtgxxx
LNG01_0016_B01.b : cxxxxxxxxxxxxxx
ADR01_0083_B04.b : nnnnnggtcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b :
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b :
SMG01_0068_B01.b :
OVRM1_0136_B08.b :
OVR01_0076_A03.b : tagcatttggtgxxxxxxxx
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : gggtgaacctxxxxxxxxxx
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : nnnnggcttggacta
SMG01_0071_A01.b : n
OVRT1_0140_A09.b : nnggatattnnnnnnnnccg
OVR01_0069_B01.b : nnnnggctaggactta
UTR01_0045_B08.b : tggctgacxxxxxxxxx
TCH01_0054_C12.b : nnnnagcttggactat
THY01_0051_D05.b : txxxxxxxxxxxxxxxxxxx
BFLT1_0112_G01.b : nnnnnnnnnnnnnnnnnn
LVR01_0105_H12.b : ggtttgtttggcttggtgxxxxxxxxx
CLNT1_0140_G07.b : nnnnn
BFLT1_0010_H12.b : ttttccgt
OVR01_0042_H11.b : gggaaxxxxxxxxxxxxxxxxxx
SPL01_0084_C06.b : nnnnggctaggactat
ITT01_0070_E04.b :
SPL01_0041_G01.b : ctctggcaggatttggtgcxxxxxxx
SMG01_0028_E01.b : nnng
OVR01_0088_E05.b : gctagtgatta
CLNT1_0034_F06.b : gggccg
BFLT1_0098_E08.b : ggactcg
OVR01_0025_A09.b : aggggcattaggggcxxxxxxxx
BFLT1_0090_C04.b : nggaaact
OVR01_0052_A03.b : nnnnggcttgtactta
ITT01_0091_E05.b :
BFLT1_0108_E11.b : nnnnccg
ITT01_0041_G04.b :
ITT01_0020_B05.b :
LNG01_0105_H01.b : nnttttgat
OVR01_0006_F06.b : ggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_C06.b : nnggtttnnnnggggncct
UTR01_0104_D02.b : nnnnnggctaggacta
THY01_0202_A07.b : taaggcxxxxxxxxxxxxxxxxxx
ITT01_0076_H10.b :
ITT01_0022_C12.b :
ITT01_0092_G11.b :
ITT01_0041_G10.b :
ITT01_0103_B06.b :
ITT01_0050_G07.b :
ITT01_0024_A12.b :
OVR01_0018_B08.b : ggggggaacctattagx
BMWN1_0041_D06.b : nggca
PTG01_0062_G08.b : nnnn
OVR01_0025_C06.b : ggggaatatatggtgxxxxxx
TES01_0001_C09.b :
TES01_0009_B09.b :
UTR01_0041_C04.b : tgxxxxxxxxxx
CBLT1_0075_F04.b :
HTMT1_0008_G09.b :
PBL01_0051_G05.b :
LNG01_0076_C10.b : nnnttac
AMP01_0057_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0043_D08.b : xxxxxxxxxxxxxxxx
OVRM1_0022_C09.b :
TES01_0088_H10.b :
OVR01_0073_E01.b : tagcxxxxxxxxxxxxx
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : n
BFLT1_0033_C10.b : aa
SPL01_0008_F12.b : cctttgggtgxxxxxx
ITT01_0067_H03.b :
OVRT1_0050_A03.b : nnnggtttnnnnnnnnn
ITT01_0040_D04.b :
ITT01_0031_F08.b :
TES01_0079_C05.b :
OVRT1_0139_G06.b : nnnaagatatacnnnnn
TES01_0085_A11.b :
KDN01_0062_E06.b :
KDN01_0028_F05.b :
TES01_0052_E10.b :
PST01_0047_D03.b :
KDN01_0032_H10.b :
TES01_0017_F10.b :
PST01_0091_B11.b :
KDN01_0051_G01.b :
KDN01_0027_C06.b :
TES01_0098_A12.b :
SKNB1_0071_B08.b :
KDN01_0039_B03.b :
KDN01_0036_D02.b :
KDN01_0079_H01.b :
KDN01_0075_E12.b :
PST01_0026_B10.b :
PST01_0067_A12.b :
TES01_0077_G07.b :
SKNB1_0016_A07.b :
MLTL1_0085_C04.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0147_B07.b :
ADR01_0028_E09.b :
DCI01_0118_F04.b :
KDN01_0022_A07.b :
MLTL1_0092_C02.b :
TES01_0088_E02.b :
LNG01_0042_B08.b :
SMG01_0103_D12.b :
TES01_0085_H04.b :
TCH01_0001_D09.b :
SMG01_0052_B10.b :
THY01_0041_H01.b :
AMP01_0061_G02.b :
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b :
DCI01_0060_F02.b :
PCT01_0004_F11.b :
MLTL1_0075_F01.b :
MLTL1_0090_B07.b :
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : ...........GGTCAGGTGGGCTGGCCGCCTTGACCTTCCTCGCCGCTCGGCCATTTTG
---------+---------+---------+---------+---------+---------+ 49
CBLT1_0007_E04.b : xxxxxxxxxxxGGTCAGGTGGGCTGGCCGCCTTGACCTTCCTCGCCGCTCGGCCATTTTG
OVRM1_0022_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCCGCTCGGCCATTTTG
BFLT1_0129_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcgCTCGCCGCTCGGCCATTTTG
PST01_0095_C03.b : nnnnngctgctgtggctatggcttgacttcCTCGCCGCTCGGCCATTTTG
MLN01_0048_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCCGCTCGGCCATTTTG
MLTL1_0053_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGCATTTTG
TES01_0030_G06.b : ccgctgtggctatGGCATTTTG
TES01_0032_B05.b : nccgcgttggctatGGATTTTG
CBLT1_0051_H09.b : caggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTTTG
SMG01_0072_A06.b : ggagtatagcagcggntcggntccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0026_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRM1_0132_G08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRM1_0219_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0043_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0003_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVR01_0022_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0002_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
SMG01_0023_D11.b : gggctaaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0044_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
SMG01_0093_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCATTTTG
SMG01_0007_C10.b : tannnnnggactaagcagcggnacggntccggattctcgagcacggttggcctCATTTTG
TES01_0057_E03.b : ttttcctacggtggctacggCATTTTG
LNG01_0045_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
UTR01_0035_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
SMG01_0103_C12.b : tagatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
SMG01_0095_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCATTTTG
OVRT1_0118_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRT1_0086_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVR01_0062_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
LNG01_0026_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
SMG01_0039_C05.b : nggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRT1_0115_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
PST01_0038_C12.b : gctatggctcccgctcggCATTTTG
BFLT1_0107_H09.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRT1_0039_B11.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
BFLT1_0012_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0034_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
THY01_0088_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
PBL01_0101_G07.b : ttagagaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVR01_0020_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
CLNT1_0032_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
ITT01_0048_F06.b : ggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTTTG
OVRM1_0066_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTG
THY01_0123_A06.b : ctgtcaaaacagcggtccggtcggaatcctcagcactgtggcctactggATTTTG
THY01_0040_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTTTTG
OVRM1_0189_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTG
OVRM1_0010_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttttttTTTTTG
OVRM1_0125_B07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTG
PTG01_0103_B12.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggaTTTTTG
TES01_0087_A12.b : ccggctgtggctatggATTTTG
PTG01_0072_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxgcTTTTTG
SMG01_0080_E11.b : nnggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgATTTTG
OVR01_0047_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTG
KDN01_0053_G01.b : gtaacgttggctatggATTTTG
PST01_0062_D01.b : nncctgctgtggctatggATTTTG
ITT01_0077_A05.b : nggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTG
BFLT1_0082_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaTTTTTG
KDN01_0052_D07.b : tgtggctatGGATTT
THY01_0113_H05.b : agttgtcaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTTTG
LVRM1_0183_E06.b : cctcatgcactgttggcctactggTTTTG
PBL01_0027_B08.b : nggatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
OVRM1_0055_A09.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
OVRM1_0208_B01.b : gtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
OVRM1_0031_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
THY01_0048_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
PTG01_0050_A08.b : nnnagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
CLNT1_0121_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
OVRT1_0026_G10.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
PST01_0073_F06.b : nnncctgacgtggctacggctTTTTG
ITT01_0026_F03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
MLN01_0076_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTG
THY01_0045_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTG
THY01_0119_C06.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTT
SKNB1_0004_F11.b : ttaccacagttgctatggcATTT
PCT01_0035_H05.b : nnnttgggttagtagnnnngctacgttgtgctcgcATTT
PCT01_0009_E01.b : ntttttgactacgttgcctggATTT
KDN01_0090_E07.b : nnnnnggctacggtggctatggATTT
PCT01_0004_B05.b : nnngggatatnnnnnnnccaacggtgtgcaATTT
PST01_0098_G04.b : nnnaactgcgttggctctggcTTTT
PST01_0078_H02.b : nnnncctgcggttgctatggATTT
PST01_0095_E09.b : nntttcctgcgtttgctatggATTT
TES01_0096_B06.b : ttttcctcactgtggctattggTTT
LVRM1_0027_D03.b : tanttcctcaagactgttggccactgG
HTMT1_0118_E12.b : tggatagtaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxgG
BFLT1_0144_B08.b : gttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcG
MLTL1_0054_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0007_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0004_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_D12.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_B09.b : agcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtg
THY01_0110_E01.b : cttgtcaaaacagcggtccggtcggaatcctcagcacgtggcctactgggcattt
OVRM1_0223_F12.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0149_F02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_H10.b : agtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0125_B06.b : ttttgcgatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_H06.b : ncccccataacaaggatttaatga
CBLT1_0092_F01.b : tgcgaagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0097_B02.b : ttttacgacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0053_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0022_C05.b : nnnnggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_C02.b : nnnncgatagtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0103_E05.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0041_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttta
OVRT1_0006_E06.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgttct
ILNT1_0025_F06.b : nnnggacgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_B04.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0105_A01.b : agtgtcaaaaacagctggtacggtccggaatcctcagcactgtggct
AMP01_0003_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_H10.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_F06.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0034_C07.b : ggcatctttttttggatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0096_A02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0027_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0018_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_F10.b : tcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0132_C10.b : ttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0079_A09.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtg
HTMT1_0015_G05.b : nnaatgcagagacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_E04.b : nnaaacgagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0027_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0016_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0083_B04.b : xxxxxxxxxxxxxxxxggtgggctggccgccttgaccttcctcgccgctcggccattttg
OVRM1_0039_G11.b : ttgtaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_B01.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_G04.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_F10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0035_F06.b : tttttcctacgttgc
LVRM1_0096_A09.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_A04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_D06.b : ngggttttttaanggactaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0068_B01.b : tttttgatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0136_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_B01.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0190_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0218_H01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_A07.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0059_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_E07.b : gatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0067_F12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_G07.b : cagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0124_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_G02.b : tgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_A01.b : ggctttannnntggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0140_A09.b : ttagcgttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_B01.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0054_C12.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0112_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_G07.b : ccttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0010_H12.b : tcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0084_C06.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0070_E04.b : nnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0028_E01.b : gggattttnttnnggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0088_E05.b : aacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0034_F06.b : ttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0098_E08.b : tcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0090_C04.b : tcagctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_A03.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0091_E05.b : nnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0108_E11.b : ttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_G04.b : nnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0020_B05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0105_H01.b : ggacatgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0006_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_C06.b : atagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0104_D02.b : tnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_H10.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0022_C12.b : nnnaagataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0092_G11.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_G10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0103_B06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0050_G07.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0024_A12.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0018_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0041_D06.b : ggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0062_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0025_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0001_C09.b : ttcccacgttggc
TES01_0009_B09.b : tttttttcactgtggct
UTR01_0041_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_F04.b : ttttagcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0008_G09.b : nnggcaatcaaagggattt
PBL01_0051_G05.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_C10.b : atggaaatgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0057_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0043_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_C09.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0088_H10.b : nttacgacggtg
OVR01_0073_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0007_H01.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0112_C01.b : ncccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0033_C10.b : tccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0008_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0067_H03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_A03.b : ncctatagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_D04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0031_F08.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0079_C05.b : nnnncccctgtt
OVRT1_0139_G06.b : nnccgttagcgttggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0085_A11.b : ntccgacggtgg
KDN01_0062_E06.b : nctgcgatg
KDN01_0028_F05.b : nttttggctgctgtg
TES01_0052_E10.b : tttttctaacggtgg
PST01_0047_D03.b : nttttcctactgtg
KDN01_0032_H10.b : nttggctgttg
TES01_0017_F10.b : ttctgcgtt
PST01_0091_B11.b : nnnccggctgttg
KDN01_0051_G01.b : agacgtgg
KDN01_0027_C06.b : nnnccttc
TES01_0098_A12.b : tttacta
SKNB1_0071_B08.b : nnnntcaac
KDN01_0039_B03.b : naacgc
KDN01_0036_D02.b : nnncctgcgt
KDN01_0079_H01.b : ttttggatgcg
KDN01_0075_E12.b : nncctgcg
PST01_0026_B10.b : ntttcctactgt
PST01_0067_A12.b : ntttcctgactt
TES01_0077_G07.b :
SKNB1_0016_A07.b : nggggttnnnnaaaatacg
MLTL1_0085_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0147_B07.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxx
ADR01_0028_E09.b :
DCI01_0118_F04.b : ngggcttaaaananaggatactaaxxxx
KDN01_0022_A07.b :
MLTL1_0092_C02.b :
TES01_0088_E02.b :
LNG01_0042_B08.b :
SMG01_0103_D12.b :
TES01_0085_H04.b :
TCH01_0001_D09.b :
SMG01_0052_B10.b :
THY01_0041_H01.b :
AMP01_0061_G02.b :
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b :
DCI01_0060_F02.b :
PCT01_0004_F11.b :
MLTL1_0075_F01.b :
MLTL1_0090_B07.b :
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
---------+---------+---------+---------+---------+---------+ 109
CBLT1_0007_E04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0022_D02.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0129_G11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0095_C03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLN01_0048_E07.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLTL1_0053_G06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0030_G06.b : TCC*AGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0032_B05.b : TCC*AGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CBLT1_0051_H09.b : TCCCANTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0072_A06.b : TCCCANTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0026_F10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0132_G08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0219_G05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0043_A01.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0003_D01.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0022_H03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAAAT
THY01_0002_E02.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0023_D11.b : TCCCCCTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0044_C10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0093_G08.b : TCCCANTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0007_C10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0057_E03.b : TCC*AGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0045_G11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
UTR01_0035_D07.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0103_C12.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0095_A07.b : TCCCANTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0118_F10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0086_G09.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0062_F06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0026_E04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0039_C05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0115_G03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0038_C12.b : TCCCAGTCAGTTCCA*GGCTGCGGCTGCACATGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0107_H09.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0039_B11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0012_H08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0034_D05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0088_C05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PBL01_0101_G07.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0020_D04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CLNT1_0032_G11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0048_F06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0066_G06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0123_A06.b : TCC*AGTCAGTTC*AAGGCTGCGGN*GCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0040_E09.b : TCCCAGACAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0189_F08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0010_F04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0125_B07.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0103_B12.b : TCCCACTCAATTCCAATGCTGCGGCTGCAAAGGAGTCACCTGCGGAGGACCTGCAAAGAT
TES01_0087_A12.b : TCC*AGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0072_D03.b : TCCCANTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0080_E11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0047_D04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0053_G01.b : TC*CAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0062_D01.b : TCC*AGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0077_A05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0082_E10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0052_D07.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGTAGGAGCTGCAAAGAT
THY01_0113_H05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0183_E06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PBL01_0027_B08.b : TCCCAGTCAGTTCCAAGGCTGTGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0055_A09.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0208_B01.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0031_E06.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0048_H08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0050_A08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CLNT1_0121_H11.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0026_G10.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0073_F06.b : TCCAN*TCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0026_F03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLN01_0076_G03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0045_E04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0119_C06.b : GTCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SKNB1_0004_F11.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PCT01_0035_H05.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PCT01_0009_E01.b : GTCCANTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGACCTGCAAAGAT
KDN01_0090_E07.b : GTCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PCT01_0004_B05.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0098_G04.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGTAGGAGCTGCAAAGAT
PST01_0078_H02.b : GTCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0095_E09.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0096_B06.b : GTCCAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0027_D03.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0118_E12.b : TCCCAGTCAGTTCCAAGGCTCCCGTTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0144_B08.b : TCTCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLTL1_0054_H05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BKFL1_0007_F04.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
DCI01_0042_G08.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLTL1_0004_B05.b : TCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCCGCAAAGAT
LVRM1_0107_D12.b : xCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
DCI01_0012_F02.b : xCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCGAAGAT
OVRT1_0007_B09.b : gCCCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0110_E01.b : gtCCAGTCAGTTCCA*GGCTGCGGCTGC*GAGGAGTC*CCTGCGGAGGAGCTGCA*AGAT
OVRM1_0223_F12.b : xxGGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0149_F02.b : xxGGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0072_H10.b : xxCCAGTCAGTTCCAAGGCTGCGGCTGCCGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0125_B06.b : xgCCAGTCAGTTCCTAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
DCI01_0030_H12.b : xxxCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0011_H06.b : attGAGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGCATCTGCAAAGAT
CBLT1_0092_F01.b : xxxGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0097_B02.b : xxxGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SPL01_0053_F05.b : xxxGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CBLT1_0022_C05.b : xxxGAGTCAGTTCCAACGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0113_C02.b : xxxGAGTCAGTCTCTAAGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0103_E05.b : xggCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0041_F03.b : ctgGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGCCTCCTGCGGAGGAGCTGCAAAGAT
OVRT1_0006_E06.b : xxgCAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0039_E04.b : actGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ILNT1_0025_F06.b : xxxGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLN01_0077_B04.b : xxaGAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0105_A01.b : atggAGTCAGTTC*AAGGCTG*GGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
AMP01_0003_B07.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0187_H06.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0056_H10.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0002_F06.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0034_C07.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
AMP01_0037_D04.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TCH01_0096_A02.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
MLTL1_0027_H11.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
DCI01_0018_F06.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0004_F10.b : xxxtAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCTGAGGAGCTGCAAAGAT
AMP01_0046_E10.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0008_G03.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CLNT1_0132_C10.b : xxxaAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0079_A09.b : aattAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0015_G05.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0095_E09.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BMWN1_0021_E04.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0027_C01.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0016_B01.b : xxxxAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ADR01_0083_B04.b : tcccAGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0039_G11.b : xxxxxGTCAGTTCCAAAGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0028_B01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0184_G04.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0171_F10.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0035_F06.b : tatggGTCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0096_A09.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0037_A04.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0052_D06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0068_B01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0136_B08.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0076_A03.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0167_B01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0190_E10.b : xxxxxGTCGGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0218_H01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0056_A07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0059_C01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0087_H02.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0206_E07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0067_F12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0037_G07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0124_F07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0099_G02.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0071_A01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0140_A09.b : xxxxxGTCAGTTCCAAGGCTGCGGCCGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0069_B01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
UTR01_0045_B08.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TCH01_0054_C12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0051_D05.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0112_G01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVR01_0105_H12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGTTGCAAAGAT
CLNT1_0140_G07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0010_H12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0042_H11.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SPL01_0084_C06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0070_E04.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SPL01_0041_G01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SMG01_0028_E01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0088_E05.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CLNT1_0034_F06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0098_E08.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0025_A09.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0090_C04.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0052_A03.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0091_E05.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0108_E11.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0041_G04.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0020_B05.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0105_H01.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0006_F06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0096_C06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCGAAGAT
UTR01_0104_D02.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0202_A07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0076_H10.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0022_C12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0092_G11.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0041_G10.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0103_B06.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0050_G07.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0024_A12.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0018_B08.b : xxxxxGTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BMWN1_0041_D06.b : cattaaTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PTG01_0062_G08.b : nnnnnnTCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0025_C06.b : xxxxxxxCAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0001_C09.b : tatggagCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0009_B09.b : atggcanCAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
UTR01_0041_C04.b : xxxxxxxxAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
CBLT1_0075_F04.b : xxxxxxxgAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
HTMT1_0008_G09.b : aatgattgAGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGACGAGCTGCAAAGAT
PBL01_0051_G05.b : xxxxxxxxAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LNG01_0076_C10.b : xxxxxxxgAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
AMP01_0057_E02.b : xxxxxxxxAGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
THY01_0043_D08.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0022_C09.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0088_H10.b : gcttggagtAGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVR01_0073_E01.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
LVRM1_0038_D02.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0191_E03.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRM1_0007_H01.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0112_C01.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0033_C10.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SPL01_0008_F12.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0067_H03.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0050_A03.b : xxxxxxxxxGTTCCA*GGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0040_D04.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
ITT01_0031_F08.b : xxxxxxxxxGTTCCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0079_C05.b : gctatggatcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
OVRT1_0139_G06.b : xxxxxxxxxxGTTCAAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0085_A11.b : ctctggagtcGTTCCAGGCTGCGGCTGCAGAGGAGCCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0062_E06.b : gcactgnatcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0028_F05.b : gctcggagtcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0052_E10.b : ctctggagtcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0047_D03.b : gctcggagtcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0032_H10.b : ctatggagtcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0017_F10.b : gctatggatcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0091_B11.b : ctctggagtcGTTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
KDN01_0051_G01.b : cacggcagtcagTCCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGACCT*TAAAGAT
KDN01_0027_C06.b : tgttgctatgnatTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0098_A12.b : cgttgctatggatTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SKNB1_0071_B08.b : gttgcacagtcatTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCA*AGAT
KDN01_0039_B03.b : gttggctatgnatTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAC
KDN01_0036_D02.b : tgctatggatcgtTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCCAT*AT
KDN01_0079_H01.b : tggctagagtagtTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCC*ATAT
KDN01_0075_E12.b : ttggctatggagtTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0026_B10.b : ggctatggatcgtTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
PST01_0067_A12.b : ggctatgnatcntTCAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
TES01_0077_G07.b : CAGGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
SKNB1_0016_A07.b : tggcacgggtagttccaGCTGCGGCTGCAGAGGAGTCACCTGCGGAGGAGCTGCTA*GAT
MLTL1_0085_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTGCAGAGGAGTCACCTGCGGAGGAGCTGCAAAGAT
BFLT1_0147_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCGGAGGAGCTGCAAAGAT
ADR01_0028_E09.b : nttgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0022_A07.b :
MLTL1_0092_C02.b : nnnnnnnnnnnnnnnnnnnnnnnn
TES01_0088_E02.b :
LNG01_0042_B08.b :
SMG01_0103_D12.b :
TES01_0085_H04.b :
TCH01_0001_D09.b :
SMG01_0052_B10.b :
THY01_0041_H01.b :
AMP01_0061_G02.b :
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b :
DCI01_0060_F02.b :
PCT01_0004_F11.b :
MLTL1_0075_F01.b :
MLTL1_0090_B07.b :
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
---------+---------+---------+---------+---------+---------+ 168
CBLT1_0007_E04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0022_D02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0129_G11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0095_C03.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLN01_0048_E07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLTL1_0053_G06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0030_G06.b : GCTGTCAGTGCGCATCGCTGCGGCTGCGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0032_B05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CBLT1_0051_H09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0072_A06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0026_F10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0132_G08.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0219_G05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0043_A01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0003_D01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0022_H03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0002_E02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0023_D11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0044_C10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0093_G08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0007_C10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0057_E03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0045_G11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
UTR01_0035_D07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0103_C12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0095_A07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0118_F10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0086_G09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0062_F06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0026_E04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0039_C05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0115_G03.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0038_C12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0107_H09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0039_B11.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0012_H08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0034_D05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0088_C05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PBL01_0101_G07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0020_D04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CLNT1_0032_G11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0048_F06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0066_G06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0123_A06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0040_E09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0189_F08.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0010_F04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0125_B07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0103_B12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGGGCCCTCCCTCGGCGGGCCGGGTCTGG
TES01_0087_A12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0072_D03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0080_E11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0047_D04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0053_G01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0062_D01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0077_A05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0082_E10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0052_D07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0113_H05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0183_E06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PBL01_0027_B08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0055_A09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0208_B01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0031_E06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0048_H08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0050_A08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CLNT1_0121_H11.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0026_G10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0073_F06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0026_F03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLN01_0076_G03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0045_E04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0119_C06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SKNB1_0004_F11.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PCT01_0035_H05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PCT01_0009_E01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0090_E07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PCT01_0004_B05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0098_G04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0078_H02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0095_E09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0096_B06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0027_D03.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0118_E12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0144_B08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLTL1_0054_H05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BKFL1_0007_F04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
DCI01_0042_G08.b : GCCGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLTL1_0004_B05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0107_D12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
DCI01_0012_F02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0007_B09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0110_E01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGNCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0223_F12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0149_F02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0072_H10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0125_B06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
DCI01_0030_H12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0011_H06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CBLT1_0092_F01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0097_B02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SPL01_0053_F05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CBLT1_0022_C05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0113_C02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0103_E05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0041_F03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0006_E06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0039_E04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ILNT1_0025_F06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLN01_0077_B04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0105_A01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
AMP01_0003_B07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0187_H06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0056_H10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0002_F06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0034_C07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
AMP01_0037_D04.b : GCTGTCAGTGCGCGTCCCTGCGGCTGTGGCCCGCCCCCTCCCTCGGCGGGCCGGG*CTGG
TCH01_0096_A02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLTL1_0027_H11.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
DCI01_0018_F06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0004_F10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
AMP01_0046_E10.b : GCTGTCAGTGCGCGTCGCTGCGACTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0008_G03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CLNT1_0132_C10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0079_A09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0015_G05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0095_E09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BMWN1_0021_E04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0027_C01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0016_B01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ADR01_0083_B04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0039_G11.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0028_B01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0184_G04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0171_F10.b : GCTGTCAGTGCGCGTCGCTGCGGCCGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0035_F06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0096_A09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0037_A04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0052_D06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0068_B01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0136_B08.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0076_A03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0167_B01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCACGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0190_E10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0218_H01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0056_A07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0059_C01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0087_H02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0206_E07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0067_F12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0037_G07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0124_F07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0099_G02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0071_A01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0140_A09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0069_B01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
UTR01_0045_B08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TCH01_0054_C12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0051_D05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0112_G01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVR01_0105_H12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CLNT1_0140_G07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0010_H12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0042_H11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SPL01_0084_C06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0070_E04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SPL01_0041_G01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SMG01_0028_E01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0088_E05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CLNT1_0034_F06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0098_E08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0025_A09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0090_C04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0052_A03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0091_E05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0108_E11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0041_G04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0020_B05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0105_H01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0006_F06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0096_C06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
UTR01_0104_D02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0202_A07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0076_H10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0022_C12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0092_G11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0041_G10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0103_B06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0050_G07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0024_A12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0018_B08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BMWN1_0041_D06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PTG01_0062_G08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0025_C06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0001_C09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0009_B09.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
UTR01_0041_C04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
CBLT1_0075_F04.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
HTMT1_0008_G09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PBL01_0051_G05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LNG01_0076_C10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
AMP01_0057_E02.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
THY01_0043_D08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0022_C09.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0088_H10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVR01_0073_E01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
LVRM1_0038_D02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0191_E03.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRM1_0007_H01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0112_C01.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0033_C10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SPL01_0008_F12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0067_H03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0050_A03.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0040_D04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ITT01_0031_F08.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0079_C05.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
OVRT1_0139_G06.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0085_A11.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0062_E06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0028_F05.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0052_E10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0047_D03.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0032_H10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0017_F10.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0091_B11.b : GCTGTCAGTGCGCGTCACTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0051_G01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0027_C06.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0098_A12.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SKNB1_0071_B08.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0039_B03.b : GTTATAAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0036_D02.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0079_H01.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
KDN01_0075_E12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0026_B10.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
PST01_0067_A12.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
TES01_0077_G07.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
SKNB1_0016_A07.b : GCTGTCAGTGCGCGTCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
MLTL1_0085_C04.b : GCTGTCAGTGCGCATCGCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
BFLT1_0147_B07.b : GCTGTCAGTGCGCGTCTCTGCGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
ADR01_0028_E09.b : xxxGTCAGTGCGCATCGCTGTGGCTGTGGCCCGCGCCCTCCCTCGGCGGGCCGGG*CTGG
DCI01_0118_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0022_A07.b :
MLTL1_0092_C02.b : nnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0088_E02.b :
LNG01_0042_B08.b :
SMG01_0103_D12.b :
TES01_0085_H04.b :
TCH01_0001_D09.b :
SMG01_0052_B10.b :
THY01_0041_H01.b :
AMP01_0061_G02.b : nccgata
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b :
DCI01_0060_F02.b :
PCT01_0004_F11.b :
MLTL1_0075_F01.b :
MLTL1_0090_B07.b :
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
---------+---------+---------+---------+---------+---------+ 227
CBLT1_0007_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0022_D02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0129_G11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0095_C03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLN01_0048_E07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLTL1_0053_G06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0030_G06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0032_B05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CBLT1_0051_H09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0072_A06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0026_F10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0132_G08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0219_G05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0043_A01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0003_D01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0022_H03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0002_E02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0023_D11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0044_C10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0093_G08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0007_C10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0057_E03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0045_G11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
UTR01_0035_D07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0103_C12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0095_A07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0118_F10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0086_G09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0062_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0026_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0039_C05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0115_G03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0038_C12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0107_H09.b : TCTCCAAAAAATGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0039_B11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0012_H08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0034_D05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0088_C05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAGC
PBL01_0101_G07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0020_D04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CLNT1_0032_G11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0048_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCAGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0066_G06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0123_A06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0040_E09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0189_F08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0010_F04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0125_B07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PTG01_0103_B12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0087_A12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PTG01_0072_D03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0080_E11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0047_D04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0053_G01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0062_D01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0077_A05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0082_E10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0052_D07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0113_H05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0183_E06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PBL01_0027_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTGAC
OVRM1_0055_A09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0208_B01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0031_E06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0048_H08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PTG01_0050_A08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CLNT1_0121_H11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0026_G10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0073_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0026_F03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLN01_0076_G03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0045_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0119_C06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SKNB1_0004_F11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PCT01_0035_H05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PCT01_0009_E01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0090_E07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PCT01_0004_B05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0098_G04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0078_H02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0095_E09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0096_B06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0027_D03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0118_E12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0144_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLTL1_0054_H05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BKFL1_0007_F04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
DCI01_0042_G08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLTL1_0004_B05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0107_D12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
DCI01_0012_F02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0007_B09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0110_E01.b : TCTNCAAAAA*TGCTTTGGGATCCGTCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0223_F12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0149_F02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0072_H10.b : TCTCCAAAAA*TGCTTTGGGATCGGCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0125_B06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
DCI01_0030_H12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0011_H06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CBLT1_0092_F01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0097_B02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SPL01_0053_F05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CBLT1_0022_C05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0113_C02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0103_E05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0041_F03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0006_E06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0039_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ILNT1_0025_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLN01_0077_B04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0105_A01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
AMP01_0003_B07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0187_H06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0056_H10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0002_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PTG01_0034_C07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
AMP01_0037_D04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TCH01_0096_A02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLTL1_0027_H11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
DCI01_0018_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0004_F10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
AMP01_0046_E10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0008_G03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CLNT1_0132_C10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0079_A09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0015_G05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0095_E09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BMWN1_0021_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0027_C01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0016_B01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ADR01_0083_B04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0039_G11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0028_B01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0184_G04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0171_F10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0035_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0096_A09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0037_A04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PTG01_0052_D06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0068_B01.b : TCTCCAAAA**TGCTTTGGGATCGTCCTTTGTTGCTGGCAGAAACCTCCATGCCTCTAAC
OVRM1_0136_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0076_A03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0167_B01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0190_E10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0218_H01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0056_A07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0059_C01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0087_H02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0206_E07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0067_F12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0037_G07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0124_F07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0099_G02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCCCCATGCCTCTAAC
SMG01_0071_A01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0140_A09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0069_B01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
UTR01_0045_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TCH01_0054_C12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0051_D05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0112_G01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVR01_0105_H12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CLNT1_0140_G07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0010_H12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0042_H11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SPL01_0084_C06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0070_E04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SPL01_0041_G01.b : TCTCCAAAAA*TGCTTTGGGATCGTCTTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SMG01_0028_E01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0088_E05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CLNT1_0034_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0098_E08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0025_A09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0090_C04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0052_A03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0091_E05.b : TCTCCATAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0108_E11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0041_G04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0020_B05.b : TCTCCAAAAAATGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0105_H01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0006_F06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0096_C06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
UTR01_0104_D02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0202_A07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0076_H10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0022_C12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0092_G11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0041_G10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0103_B06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0050_G07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0024_A12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0018_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BMWN1_0041_D06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGGGACCTCCATGCCTCTAAC
PTG01_0062_G08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVR01_0025_C06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0001_C09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0009_B09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
UTR01_0041_C04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
CBLT1_0075_F04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
HTMT1_0008_G09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PBL01_0051_G05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LNG01_0076_C10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
AMP01_0057_E02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
THY01_0043_D08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0022_C09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0088_H10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCGCCATGCCTCTAAC
OVR01_0073_E01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
LVRM1_0038_D02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0191_E03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRM1_0007_H01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0112_C01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
BFLT1_0033_C10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SPL01_0008_F12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0067_H03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0050_A03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0040_D04.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ITT01_0031_F08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0079_C05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
OVRT1_0139_G06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0085_A11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0062_E06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0028_F05.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTCGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0052_E10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCC*TGCCTCTAAC
PST01_0047_D03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0032_H10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0017_F10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCC*TGCCTCTAAC
PST01_0091_B11.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0051_G01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0027_C06.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0098_A12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SKNB1_0071_B08.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0039_B03.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0036_D02.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0079_H01.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0075_E12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0026_B10.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
PST01_0067_A12.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
TES01_0077_G07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
SKNB1_0016_A07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
MLTL1_0085_C04.b : TCTCCAAAAG*TGCTTTGGGATCGTCCTTTGTTGCTGTAAGAAACCTCCATGCCTCTAAC
BFLT1_0147_B07.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
ADR01_0028_E09.b : TCTCCAAAAA*TGCTTTGGGATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
DCI01_0118_F04.b : xxxxxxxxxxxxxxxxxxxxATCGTCCTTTGTTGCTGCAAGAAACCTCCATGCCTCTAAC
KDN01_0022_A07.b : nttttncctgcgttggctctggctttgtgctgcagAACCTCCATGCCTCTAAC
MLTL1_0092_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0088_E02.b :
LNG01_0042_B08.b : gcattaggtgcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_D12.b : nggccctttnnn
TES01_0085_H04.b :
TCH01_0001_D09.b : nnnccta
SMG01_0052_B10.b :
THY01_0041_H01.b : attttgggg
AMP01_0061_G02.b : aannnttaggacacttggggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0070_D09.b :
KDN01_0063_D06.b :
MLTL1_0080_H12.b : nnnttccataaaatatatggtactcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0060_F02.b : cgttcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_F11.b :
MLTL1_0075_F01.b : nnnnnnnnnnnnnnnnn
MLTL1_0090_B07.b : nnnnnnnnnnn
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
---------+---------+---------+---------+---------+---------+ 286
CBLT1_0007_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0022_D02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0129_G11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0095_C03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLN01_0048_E07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0053_G06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0030_G06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0032_B05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CBLT1_0051_H09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0072_A06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0026_F10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0132_G08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0219_G05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0043_A01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0003_D01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0022_H03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0002_E02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0023_D11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0044_C10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0093_G08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0007_C10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0057_E03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0045_G11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
UTR01_0035_D07.b : AC*TCGTCTCCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0103_C12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0095_A07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0118_F10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0086_G09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0062_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0026_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0039_C05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0115_G03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0038_C12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0107_H09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTTAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0039_B11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0012_H08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0034_D05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0088_C05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PBL01_0101_G07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0020_D04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CLNT1_0032_G11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0048_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0066_G06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0123_A06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0040_E09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0189_F08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0010_F04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCCTGAAGAGCGAATTCT
OVRM1_0125_B07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PTG01_0103_B12.b : ACATCATCATCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAATAGCGAATTCT
TES01_0087_A12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PTG01_0072_D03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0080_E11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAACGAATTCT
OVR01_0047_D04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0053_G01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0062_D01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0077_A05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0082_E10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0052_D07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0113_H05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0183_E06.b : AC*TCGTCTTCACAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PBL01_0027_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0055_A09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0208_B01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0031_E06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0048_H08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PTG01_0050_A08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CLNT1_0121_H11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0026_G10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0073_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0026_F03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLN01_0076_G03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGGGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0045_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0119_C06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SKNB1_0004_F11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PCT01_0035_H05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PCT01_0009_E01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0090_E07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCCCTATTCTTGAAGAGCGAATTCT
PCT01_0004_B05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0098_G04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0078_H02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0095_E09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0096_B06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0027_D03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0118_E12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0144_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0054_H05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BKFL1_0007_F04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
DCI01_0042_G08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0004_B05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0107_D12.b : AC*TCGTCTTCAGAAGATTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
DCI01_0012_F02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0007_B09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0110_E01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCCTGAAGAGCGAATTCT
OVRM1_0223_F12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0149_F02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0072_H10.b : AC*TCGTCTTCCGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0125_B06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
DCI01_0030_H12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0011_H06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CBLT1_0092_F01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0097_B02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SPL01_0053_F05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CBLT1_0022_C05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0113_C02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0103_E05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0041_F03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0006_E06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0039_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ILNT1_0025_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLN01_0077_B04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCTTCTATTCTTGAAGAGCGAATTCT
THY01_0105_A01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
AMP01_0003_B07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCCTGAAGAGCGAATTCT
LVRM1_0187_H06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0056_H10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0002_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PTG01_0034_C07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAACGAACTCT
AMP01_0037_D04.b : AC*TCGTCTTCAAAAGACTGGCACTGCTGAGGTTTCCTCTATTCCTGAAGAGCGAATTCT
TCH01_0096_A02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0027_H11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
DCI01_0018_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0004_F10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
AMP01_0046_E10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0008_G03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CLNT1_0132_C10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0079_A09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0015_G05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0095_E09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BMWN1_0021_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAACGAATTCT
LNG01_0027_C01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0016_B01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ADR01_0083_B04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0039_G11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0028_B01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0184_G04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0171_F10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0035_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0096_A09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0037_A04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PTG01_0052_D06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0068_B01.b : AC*TCGTCTTCAGAAGAATGGCACTGCTGAAGTTTCCTCTATTCTTGAAGAACGAATTCT
OVRM1_0136_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0076_A03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0167_B01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0190_E10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0218_H01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0056_A07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0059_C01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0087_H02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0206_E07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0067_F12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0037_G07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0124_F07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0099_G02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0071_A01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0140_A09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0069_B01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
UTR01_0045_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TCH01_0054_C12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0051_D05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0112_G01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVR01_0105_H12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CLNT1_0140_G07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0010_H12.b : AC*TCATCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0042_H11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SPL01_0084_C06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0070_E04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SPL01_0041_G01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SMG01_0028_E01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0088_E05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CLNT1_0034_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0098_E08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0025_A09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0090_C04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0052_A03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0091_E05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0108_E11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0041_G04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0020_B05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0105_H01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0006_F06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0096_C06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
UTR01_0104_D02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0202_A07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0076_H10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0022_C12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0092_G11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0041_G10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0103_B06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0050_G07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0024_A12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0018_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BMWN1_0041_D06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAACGAATTCT
PTG01_0062_G08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0025_C06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0001_C09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0009_B09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
UTR01_0041_C04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
CBLT1_0075_F04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
HTMT1_0008_G09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PBL01_0051_G05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LNG01_0076_C10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
AMP01_0057_E02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
THY01_0043_D08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0022_C09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0088_H10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVR01_0073_E01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
LVRM1_0038_D02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0191_E03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRM1_0007_H01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0112_C01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0033_C10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SPL01_0008_F12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0067_H03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0050_A03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0040_D04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ITT01_0031_F08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTCCCTCTATTCTTGAAGAGCGAATTCT
TES01_0079_C05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
OVRT1_0139_G06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0085_A11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0062_E06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTAAAGAGCGAATTCT
KDN01_0028_F05.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0052_E10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0047_D03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0032_H10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0017_F10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0091_B11.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0051_G01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0027_C06.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0098_A12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SKNB1_0071_B08.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0039_B03.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCGATTCTTGAAGAGCGAATTCT
KDN01_0036_D02.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0079_H01.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0075_E12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0026_B10.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
PST01_0067_A12.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0077_G07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
SKNB1_0016_A07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0085_C04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
BFLT1_0147_B07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
ADR01_0028_E09.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
DCI01_0118_F04.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
KDN01_0022_A07.b : AC*TCGTCTTCAGAAGACTGGCACTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
MLTL1_0092_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxTGCTGAGGTTTCCTCTATTCTTGAAGAGCGAATTCT
TES01_0088_E02.b : tttcctactgtggctctggctgctgaGTTTCCTCTATTCTTGA*GAGCGAATTCT
LNG01_0042_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCTTGAAGAGCGAATTCT
SMG01_0103_D12.b : ntggatcaagcagcgtgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAATTCT
TES01_0085_H04.b : nnntctctgttgctctggttttgagagcAATTCT
TCH01_0001_D09.b : ggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0052_B10.b : ttttttgctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_H01.b : ggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0070_D09.b : nnnggctaggactatgacxxxxxxxxxxxx
KDN01_0063_D06.b :
MLTL1_0080_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0060_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_F11.b :
MLTL1_0075_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0090_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
PCT01_0022_H01.b :
MLTL1_0044_D03.b :
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
---------+---------+---------+---------+---------+---------+ 345
CBLT1_0007_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0022_D02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0129_G11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0095_C03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLN01_0048_E07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0053_G06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0030_G06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0032_B05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CBLT1_0051_H09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0072_A06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0026_F10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0132_G08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0219_G05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0043_A01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0003_D01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0022_H03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0002_E02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0023_D11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0044_C10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0093_G08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0007_C10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0057_E03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0045_G11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
UTR01_0035_D07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0103_C12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0095_A07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0118_F10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0086_G09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0062_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0026_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0039_C05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0115_G03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0038_C12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0107_H09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0039_B11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0012_H08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0034_D05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0088_C05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PBL01_0101_G07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0020_D04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CLNT1_0032_G11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0048_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0066_G06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0123_A06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0040_E09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0189_F08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0010_F04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0125_B07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0103_B12.b : TGGCGCTGATACCTCTGTTGACCTTGAACAGACCGGGCGTGTTTT*AAGTATTGATGATG
TES01_0087_A12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0072_D03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0080_E11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0047_D04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0053_G01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0062_D01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0077_A05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0082_E10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0052_D07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0113_H05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0183_E06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PBL01_0027_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0055_A09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0208_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0031_E06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0048_H08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0050_A08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CLNT1_0121_H11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0026_G10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0073_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0026_F03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLN01_0076_G03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0045_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0119_C06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SKNB1_0004_F11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PCT01_0035_H05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PCT01_0009_E01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0090_E07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PCT01_0004_B05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0098_G04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0078_H02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0095_E09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0096_B06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0027_D03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0118_E12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0144_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0054_H05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BKFL1_0007_F04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
DCI01_0042_G08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0004_B05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0107_D12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
DCI01_0012_F02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0007_B09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0110_E01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0223_F12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0149_F02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0072_H10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0125_B06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
DCI01_0030_H12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0011_H06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CBLT1_0092_F01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0097_B02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SPL01_0053_F05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CBLT1_0022_C05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0113_C02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0103_E05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0041_F03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0006_E06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTCTT*AAGTATTGGTGATG
OVR01_0039_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ILNT1_0025_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLN01_0077_B04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0105_A01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
AMP01_0003_B07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0187_H06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0056_H10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0002_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0034_C07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAAACCGGGCGTGTTTT*AAGTATTGGTGATG
AMP01_0037_D04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TCH01_0096_A02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0027_H11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
DCI01_0018_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0004_F10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
AMP01_0046_E10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0008_G03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CLNT1_0132_C10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0079_A09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0015_G05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0095_E09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BMWN1_0021_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0027_C01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0016_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ADR01_0083_B04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATAGGTGATG
OVRM1_0039_G11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0028_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0184_G04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0171_F10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0035_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0096_A09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0037_A04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0052_D06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0068_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAAACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0136_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATGGTGGATG
OVR01_0076_A03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0167_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0190_E10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0218_H01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0056_A07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0059_C01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0087_H02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0206_E07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0067_F12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0037_G07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0124_F07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0099_G02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0071_A01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0140_A09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0069_B01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
UTR01_0045_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TCH01_0054_C12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0051_D05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0112_G01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVR01_0105_H12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CLNT1_0140_G07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0010_H12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0042_H11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SPL01_0084_C06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0070_E04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SPL01_0041_G01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0028_E01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0088_E05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CLNT1_0034_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0098_E08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0025_A09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0090_C04.b : TGACGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTTTAAGTATTGGTGATG
OVR01_0052_A03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0091_E05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0108_E11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0041_G04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0020_B05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0105_H01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0006_F06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0096_C06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
UTR01_0104_D02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0202_A07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0076_H10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0022_C12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0092_G11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0041_G10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0103_B06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0050_G07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0024_A12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0018_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BMWN1_0041_D06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PTG01_0062_G08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0025_C06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0001_C09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGG*****TTTT*AAGTATTGGTGATG
TES01_0009_B09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
UTR01_0041_C04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
CBLT1_0075_F04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
HTMT1_0008_G09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PBL01_0051_G05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0076_C10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
AMP01_0057_E02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0043_D08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0022_C09.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0088_H10.b : TGGTGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVR01_0073_E01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LVRM1_0038_D02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0191_E03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRM1_0007_H01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0112_C01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0033_C10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SPL01_0008_F12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0067_H03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0050_A03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0040_D04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ITT01_0031_F08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0079_C05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
OVRT1_0139_G06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0085_A11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0062_E06.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0028_F05.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0052_E10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0047_D03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0032_H10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0017_F10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0091_B11.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0051_G01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0027_C06.b : TGGCGCTGATACCCCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0098_A12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SKNB1_0071_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0039_B03.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0036_D02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0079_H01.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0075_E12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0026_B10.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
PST01_0067_A12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0077_G07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SKNB1_0016_A07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0085_C04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
BFLT1_0147_B07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
ADR01_0028_E09.b : TGGCGCTGCTACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
DCI01_0118_F04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
KDN01_0022_A07.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
MLTL1_0092_C02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0088_E02.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
LNG01_0042_B08.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0103_D12.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TES01_0085_H04.b : TGGCGCTGATACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
TCH01_0001_D09.b : xxxxxxxxxTACCTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
SMG01_0052_B10.b : xxxxxxxxxxxxxTCTGTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
THY01_0041_H01.b : xxxxxxxxxxxxxxxxxTTGACCTTGAAGAGACCGGGCGTGTTTT*AAGTATTGGTGATG
AMP01_0061_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTT*AAGTATTGGTGATG
MLN01_0070_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTGGTGATG
KDN01_0063_D06.b : nnccagctgtggctctggttttagtTTGGTGATG
MLTL1_0080_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGATG
DCI01_0060_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_F11.b : nnngggtgaannnnnnccta
MLTL1_0075_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0090_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0022_H01.b :
MLTL1_0044_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
---------+---------+---------+---------+---------+---------+ 405
CBLT1_0007_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0022_D02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0129_G11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0095_C03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLN01_0048_E07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0053_G06.b : GTATTGCCCATGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0030_G06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0032_B05.b : GTATTGCCCGTGTACACGGGCTGAGAGATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CBLT1_0051_H09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0072_A06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTNNTCT
THY01_0026_F10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0132_G08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0219_G05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0043_A01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0003_D01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0022_H03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0002_E02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0023_D11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0044_C10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0093_G08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0007_C10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0057_E03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0045_G11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
UTR01_0035_D07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0103_C12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0095_A07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGCTTTCTT
OVRT1_0118_F10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0086_G09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0062_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0026_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0039_C05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0115_G03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0038_C12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0107_H09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0039_B11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0012_H08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0034_D05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0088_C05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PBL01_0101_G07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0020_D04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CLNT1_0032_G11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0048_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0066_G06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0123_A06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0040_E09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTATAGTTTTCTT
OVRM1_0189_F08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0010_F04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0125_B07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0103_B12.b : GTATTGCCCGTGTACACGGGCTGATAAATGTTCACGCTGAACAAATGGTAGAGTTTTCTT
TES01_0087_A12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0072_D03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0080_E11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0047_D04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0053_G01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0062_D01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0077_A05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0082_E10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0052_D07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0113_H05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0183_E06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PBL01_0027_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0055_A09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0208_B01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0031_E06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0048_H08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0050_A08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CLNT1_0121_H11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0026_G10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0073_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0026_F03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAGATGGTAGAGTTTTCTT
MLN01_0076_G03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0045_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0119_C06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SKNB1_0004_F11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PCT01_0035_H05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PCT01_0009_E01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0090_E07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PCT01_0004_B05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0098_G04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0078_H02.b : GTACTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0095_E09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0096_B06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0027_D03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0118_E12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0144_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0054_H05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BKFL1_0007_F04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0042_G08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0004_B05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0107_D12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0012_F02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0007_B09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0110_E01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0223_F12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0149_F02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0072_H10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0125_B06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0030_H12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0011_H06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CBLT1_0092_F01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0097_B02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SPL01_0053_F05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CBLT1_0022_C05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0113_C02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0103_E05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0041_F03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0006_E06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0039_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ILNT1_0025_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLN01_0077_B04.b : GTATTGCCCGTGTACACGGGCTGAGGAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0105_A01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
AMP01_0003_B07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0187_H06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0056_H10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0002_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0034_C07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
AMP01_0037_D04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TCH01_0096_A02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0027_H11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0018_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0004_F10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
AMP01_0046_E10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0008_G03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CLNT1_0132_C10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0079_A09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0015_G05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0095_E09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BMWN1_0021_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0027_C01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0016_B01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ADR01_0083_B04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0039_G11.b : GTATTGCCCGTGTACACAGGCTGAGAAATGTTCAAGCTGAACAAATGGTAGAGTTTTCTT
OVRM1_0028_B01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0184_G04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0171_F10.b : GTATTGCCCGTGTACACGGGCTGAGACACGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0035_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0096_A09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGGAATGGTAGAGTTTTCTT
OVRM1_0037_A04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0052_D06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0068_B01.b : GTATTGCCCGTGTACACGGGCTGAAAAATGTTCAGGCTGAAAAAATGGTAGAGTTTTCTT
OVRM1_0136_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAGTGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0076_A03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0167_B01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0190_E10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0218_H01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0056_A07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0059_C01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0087_H02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0206_E07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0067_F12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0037_G07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0124_F07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0099_G02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0071_A01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0140_A09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0069_B01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
UTR01_0045_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGGAATGGTAGAGTTTTCTT
TCH01_0054_C12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0051_D05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0112_G01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVR01_0105_H12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CLNT1_0140_G07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0010_H12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0042_H11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SPL01_0084_C06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0070_E04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SPL01_0041_G01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0028_E01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0088_E05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CLNT1_0034_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0098_E08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0025_A09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0090_C04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0052_A03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCCT
ITT01_0091_E05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0108_E11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0041_G04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0020_B05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0105_H01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0006_F06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0096_C06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
UTR01_0104_D02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0202_A07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0076_H10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAGGAAATGGTAGAGTTTTCTT
ITT01_0022_C12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0092_G11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0041_G10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0103_B06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0050_G07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0024_A12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0018_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BMWN1_0041_D06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PTG01_0062_G08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0025_C06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0001_C09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAACAAATGGTAGAGTTTTCTT
TES01_0009_B09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
UTR01_0041_C04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
CBLT1_0075_F04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
HTMT1_0008_G09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PBL01_0051_G05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0076_C10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
AMP01_0057_E02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0043_D08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0022_C09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0088_H10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVR01_0073_E01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LVRM1_0038_D02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0191_E03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRM1_0007_H01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0112_C01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0033_C10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SPL01_0008_F12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0067_H03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0050_A03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ITT01_0040_D04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAG*TTTCTT
ITT01_0031_F08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0079_C05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
OVRT1_0139_G06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0085_A11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0062_E06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0028_F05.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0052_E10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0047_D03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0032_H10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0017_F10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0091_B11.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0051_G01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0027_C06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0098_A12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SKNB1_0071_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0039_B03.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0036_D02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0079_H01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0075_E12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0026_B10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PST01_0067_A12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0077_G07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SKNB1_0016_A07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0085_C04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
BFLT1_0147_B07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
ADR01_0028_E09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0118_F04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0022_A07.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0092_C02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0088_E02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
LNG01_0042_B08.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0103_D12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TES01_0085_H04.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
TCH01_0001_D09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
SMG01_0052_B10.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
THY01_0041_H01.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
AMP01_0061_G02.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLN01_0070_D09.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
KDN01_0063_D06.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
MLTL1_0080_H12.b : GTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
DCI01_0060_F02.b : xTATTGCCCGTGTACACGGGCTGAGAAATGTTCAGGCTGAAGAAATGGTAGAGTTTTCTT
PCT01_0004_F11.b : cgttggcttggatcgtaccggctgagAATGTTCAGGCTGAAG*AATGGTAGAGTTTTCTT
MLTL1_0075_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGCTGAAGAAATGGTGGAGTTTTCTT
MLTL1_0090_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatgggtgttcacttgtgt
PCT01_0022_H01.b : nnntttggttttngnnnncctacgt
MLTL1_0044_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_B10.b :
OVRT1_0146_E09.b :
MLTL1_0085_F05.b :
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
---------+---------+---------+---------+---------+---------+ 464
CBLT1_0007_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0022_D02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0129_G11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0095_C03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLN01_0048_E07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0053_G06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0030_G06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0032_B05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CBLT1_0051_H09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0072_A06.b : CAGGTTNAAGGGGTATGTCTCTGAACTTGGAACCctgacatgttnggtgtgtcgtggttg
THY01_0026_F10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0132_G08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0219_G05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0043_A01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0003_D01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0022_H03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0002_E02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0023_D11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0044_C10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0093_G08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0007_C10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0057_E03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0045_G11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
UTR01_0035_D07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0103_C12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0095_A07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0118_F10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0086_G09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0062_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0026_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0039_C05.b : CAGGGTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0115_G03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0038_C12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0107_H09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0039_B11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0012_H08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0034_D05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0088_C05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PBL01_0101_G07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0020_D04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CLNT1_0032_G11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0048_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0066_G06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGCCGTGTTT
THY01_0123_A06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0040_E09.b : CAGGTTTACAGGGTATGTCTCTGAACTTGGAATCTGACAATGTTGGCG*TTGTCGTGTTT
OVRM1_0189_F08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0010_F04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0125_B07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0103_B12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCCTGTTT
TES01_0087_A12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0072_D03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0080_E11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0047_D04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0053_G01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0062_D01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0077_A05.b : CAGGCTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0082_E10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0052_D07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0113_H05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0183_E06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PBL01_0027_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0055_A09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0208_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0031_E06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0048_H08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0050_A08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CLNT1_0121_H11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0026_G10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0073_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0026_F03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLN01_0076_G03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0045_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGAG*TTGTCGCGTCT
THY01_0119_C06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SKNB1_0004_F11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PCT01_0035_H05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PCT01_0009_E01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0090_E07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PCT01_0004_B05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0098_G04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0078_H02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0095_E09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0096_B06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0027_D03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0118_E12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0144_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0054_H05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BKFL1_0007_F04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0042_G08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0004_B05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0107_D12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0012_F02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0007_B09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0110_E01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0223_F12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0149_F02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0072_H10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACCATGTTGGTG*TTGTCGTGTTT
HTMT1_0125_B06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0030_H12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0011_H06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CBLT1_0092_F01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0097_B02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SPL01_0053_F05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CBLT1_0022_C05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0113_C02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0103_E05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0041_F03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0006_E06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0039_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ILNT1_0025_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLN01_0077_B04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0105_A01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
AMP01_0003_B07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGGCAATGTTGGTG*TTGTCGTGTTT
LVRM1_0187_H06.b : CAGGTTTAAAGGGTATGTTTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0056_H10.b : CAGGTTTAAAGGGTATGTCTCCGAACTTGGAACCAGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0002_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0034_C07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
AMP01_0037_D04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGGCAATGTTGGTG*TTGTCGTGTTT
TCH01_0096_A02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0027_H11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0018_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0004_F10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
AMP01_0046_E10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0008_G03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CLNT1_0132_C10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0079_A09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0015_G05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0095_E09.b : CAGGTTTAAAGGGTATGTCTCTGAGCTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BMWN1_0021_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0027_C01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0016_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ADR01_0083_B04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0039_G11.b : CAAGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCATGTTT
OVRM1_0028_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTCGGAACCTGACACTGTTAAAA*AAGTCGAGTCT
LVRM1_0184_G04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0171_F10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0035_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0096_A09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0037_A04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0052_D06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0068_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0136_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0076_A03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0167_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0190_E10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0218_H01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0056_A07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0059_C01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0087_H02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0206_E07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0067_F12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0037_G07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCCGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0124_F07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0099_G02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0071_A01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0140_A09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0069_B01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
UTR01_0045_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TCH01_0054_C12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0051_D05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0112_G01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVR01_0105_H12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CLNT1_0140_G07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0010_H12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0042_H11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SPL01_0084_C06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0070_E04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SPL01_0041_G01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0028_E01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0088_E05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CLNT1_0034_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0098_E08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0025_A09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0090_C04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0052_A03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0091_E05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0108_E11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0041_G04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0020_B05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0105_H01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0006_F06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0096_C06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
UTR01_0104_D02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0202_A07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0076_H10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0022_C12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0092_G11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0041_G10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0103_B06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0050_G07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0024_A12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0018_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BMWN1_0041_D06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PTG01_0062_G08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0025_C06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0001_C09.b : CACGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0009_B09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
UTR01_0041_C04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
CBLT1_0075_F04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
HTMT1_0008_G09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PBL01_0051_G05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0076_C10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
AMP01_0057_E02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0043_D08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0022_C09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0088_H10.b : CAGGTTTAAAGGATATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVR01_0073_E01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LVRM1_0038_D02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0191_E03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRM1_0007_H01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0112_C01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0033_C10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SPL01_0008_F12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0067_H03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0050_A03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0040_D04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ITT01_0031_F08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0079_C05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
OVRT1_0139_G06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0085_A11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0062_E06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0028_F05.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0052_E10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0047_D03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0032_H10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0017_F10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0091_B11.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0051_G01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0027_C06.b : CAAGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0098_A12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SKNB1_0071_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0039_B03.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0036_D02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0079_H01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0075_E12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0026_B10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PST01_0067_A12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0077_G07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTGGTTGTCGGGTTT
SKNB1_0016_A07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0085_C04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
BFLT1_0147_B07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
ADR01_0028_E09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0118_F04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0022_A07.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0092_C02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0088_E02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
LNG01_0042_B08.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0103_D12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TES01_0085_H04.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
TCH01_0001_D09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
SMG01_0052_B10.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
THY01_0041_H01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
AMP01_0061_G02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLN01_0070_D09.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
KDN01_0063_D06.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0080_H12.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
DCI01_0060_F02.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PCT01_0004_F11.b : CAGGTT*AAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0075_F01.b : CAGGTTTAAAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0090_B07.b : cttttgtatAGGGTATGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
PCT01_0022_H01.b : ttggctctggaaggtTGTCTCTGAACTTGGAACCTGACAATGTTGGTG*TTGTCGTGTTT
MLTL1_0044_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0038_B10.b : tggttccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_E09.b : nnnnaactatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0085_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b :
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
---------+---------+---------+---------+---------+---------+ 523
CBLT1_0007_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0022_D02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0129_G11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0095_C03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLN01_0048_E07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0053_G06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0030_G06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0032_B05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CBLT1_0051_H09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0072_A06.b : ggaaantgatagctanttaaggaanggaaatatggtgaaaaaaacttggggcatcntgga
THY01_0026_F10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0132_G08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0219_G05.b : AGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0043_A01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGGAGAGAACTGGGGCCATCGTGGA
THY01_0003_D01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0022_H03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0002_E02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0023_D11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0044_C10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0093_G08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0007_C10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0057_E03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0045_G11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
UTR01_0035_D07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0103_C12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0095_A07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0118_F10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0086_G09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0062_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0026_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0039_C05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0115_G03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0038_C12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0107_H09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0039_B11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0012_H08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0034_D05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0088_C05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PBL01_0101_G07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0020_D04.b : GGAAATGATAAGCTAATTAAGGAAGGAGGTATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0032_G11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0048_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0066_G06.b : GGAAATGAcaacctacattcatgaaggagatatcgtgacaaaaactgaatccttcgagga
THY01_0123_A06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0040_E09.b : GGAAATGATAATCTAATTAAGGAAGGAGATATTTGTGAAGAGATCTGGGGCCATCGTGGA
OVRM1_0189_F08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0010_F04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0125_B07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0103_B12.b : GGAAATGATAATCTAATTAATGAAGGAGATATA*GTGAATAGAACTGGGGCCATCGTGGA
TES01_0087_A12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0072_D03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0080_E11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0047_D04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0053_G01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0062_D01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0077_A05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0082_E10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0052_D07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0113_H05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0183_E06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PBL01_0027_B08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0055_A09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0208_B01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0031_E06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0048_H08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0050_A08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0121_H11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0026_G10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0073_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0026_F03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLN01_0076_G03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0045_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGCGGA
THY01_0119_C06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SKNB1_0004_F11.b : GCACCCCCCAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PCT01_0035_H05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PCT01_0009_E01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0090_E07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PCT01_0004_B05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0098_G04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0078_H02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0095_E09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0096_B06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0027_D03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0118_E12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0144_B08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0054_H05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BKFL1_0007_F04.b : GGAAATGATAAGCTAATTAAGGAGGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
DCI01_0042_G08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0004_B05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0107_D12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAGGAGAACTGGGGCCATCGTGGA
DCI01_0012_F02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0007_B09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0110_E01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0223_F12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0149_F02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0072_H10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0125_B06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
DCI01_0030_H12.b : GGAAATGATAAGCTAATTAAGGAAAGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0011_H06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CBLT1_0092_F01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0097_B02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SPL01_0053_F05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CBLT1_0022_C05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0113_C02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0103_E05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0041_F03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0006_E06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0039_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ILNT1_0025_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLN01_0077_B04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0105_A01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
AMP01_0003_B07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0187_H06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0056_H10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0002_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0034_C07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
AMP01_0037_D04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TCH01_0096_A02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0027_H11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
DCI01_0018_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0004_F10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
AMP01_0046_E10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0008_G03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0132_C10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0079_A09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0015_G05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0095_E09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BMWN1_0021_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0027_C01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0016_B01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ADR01_0083_B04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0039_G11.b : GGAAATGACAAGCTAATTAAAGAAGGATATATT*GTGcatataattagaggcttcttgga
OVRM1_0028_B01.b : GCAAATGATACCCATATTAAGGAAGGAGATATT*GTGAATAGAACcgtcgccacccagca
LVRM1_0184_G04.b : GGCAATGATAAGCTAATTAATGAAGGAGATACC*GCGCAAAGAACTGGGGCCATCcgtgg
OVRM1_0171_F10.b : GGAAATGATAAGCTAATTAAGGAACGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0035_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0096_A09.b : GGAAATGATAAGCTAATTAAGGAACGAGATATT*GTGAAAAGAACTGGGGCCATCATGGA
OVRM1_0037_A04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0052_D06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0068_B01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAAAGAACTGGGGCCATCGTGGA
OVRM1_0136_B08.b : GGAAATGATAAGCTAATTCAGGAAGGAGATATT*GTGCAGAGAACTGGGGCCATCGTGGA
OVR01_0076_A03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0167_B01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0190_E10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0218_H01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0056_A07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0059_C01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0087_H02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0206_E07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0067_F12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0037_G07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0124_F07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0099_G02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0071_A01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0140_A09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0069_B01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
UTR01_0045_B08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TCH01_0054_C12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0051_D05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0112_G01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVR01_0105_H12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0140_G07.b : GGAAATAATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0010_H12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0042_H11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGGAGAGGACTGGGGCCATCGTGGA
SPL01_0084_C06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0070_E04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SPL01_0041_G01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0028_E01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0088_E05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0034_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGACATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0098_E08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0025_A09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0090_C04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0052_A03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0091_E05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0108_E11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0041_G04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0020_B05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0105_H01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0006_F06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0096_C06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
UTR01_0104_D02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0202_A07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0076_H10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0022_C12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0092_G11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0041_G10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0103_B06.b : GGAAATGATAAGCTAATTAAGGAAGGAGACATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0050_G07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0024_A12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0018_B08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BMWN1_0041_D06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PTG01_0062_G08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0025_C06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0001_C09.b : GGAAATGATGAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0009_B09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
UTR01_0041_C04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CBLT1_0075_F04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
HTMT1_0008_G09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PBL01_0051_G05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0076_C10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAAGTGGGGCCATCGTGGA
AMP01_0057_E02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0043_D08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGG
OVRM1_0022_C09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0088_H10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVR01_0073_E01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LVRM1_0038_D02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0191_E03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRM1_0007_H01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0112_C01.b : AGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0033_C10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SPL01_0008_F12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0067_H03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0050_A03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0040_D04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ITT01_0031_F08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0079_C05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0139_G06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0085_A11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0062_E06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0028_F05.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0052_E10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0047_D03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0032_H10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0017_F10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0091_B11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0051_G01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0027_C06.b : GGAAATGATAAACTAATTAAAGAAGGAGATATT*GAGAAGAGAACTGGGGCCATCGTGGA
TES01_0098_A12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SKNB1_0071_B08.b : GGAAATGATAAGCTAATTAAGGAAGGATATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0039_B03.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0036_D02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0079_H01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0075_E12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0026_B10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PST01_0067_A12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0077_G07.b : GGGAATGATAAGCCTAATAAGGAAGGAGATATTGTTGAAGAGAACTGGGGgcctccgtgg
SKNB1_0016_A07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0085_C04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
BFLT1_0147_B07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
ADR01_0028_E09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
DCI01_0118_F04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0022_A07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0092_C02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0088_E02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
LNG01_0042_B08.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0103_D12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TES01_0085_H04.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
TCH01_0001_D09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
SMG01_0052_B10.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
THY01_0041_H01.b : GGAAATGATAAGCTAATTAAGGAAGGGGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
AMP01_0061_G02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLN01_0070_D09.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
KDN01_0063_D06.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0080_H12.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
DCI01_0060_F02.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PCT01_0004_F11.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0075_F01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0090_B07.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
PCT01_0022_H01.b : GGAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0044_D03.b : xxAAATGATAAGCTAATTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
CLNT1_0038_B10.b : xxxxxxxxxxxxxxxxxTAAGGAAGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
OVRT1_0146_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxGGAGATATT*GTGAAGAGAACTGGGGCCATCGTGGA
MLTL1_0085_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_F12.b :
UTR01_0083_H03.b :
MLTL1_0036_B10.b : nnnnnnnnnnnnnnnnnnnnnnnn
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
---------+---------+---------+---------+---------+---------+ 581
CBLT1_0007_E04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0022_D02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0129_G11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0095_C03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLN01_0048_E07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0053_G06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0030_G06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0032_B05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CBLT1_0051_H09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0072_A06.b : atgttccaattggtgaggagcctttggggccntggaattaaatgcccttggtaacccctt
THY01_0026_F10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTCGTGTTACTACATGCCCTTGGTAACGCCATT
OVRM1_0132_G08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0219_G05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0043_A01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0003_D01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0022_H03.b : TGTTCC*AGTTGGTGAGGGGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0002_E02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0023_D11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0044_C10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0093_G08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0007_C10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0057_E03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0045_G11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
UTR01_0035_D07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0103_C12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0095_A07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0118_F10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0086_G09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0062_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0026_E04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0039_C05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0115_G03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0038_C12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0107_H09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0039_B11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0012_H08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0034_D05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0088_C05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PBL01_0101_G07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0020_D04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0032_G11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0048_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0066_G06.b : tggtgaatttattaaatacctgtagtcttctgtacctacatccccctgctacccatttta
THY01_0123_A06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*CTGTAtaaatccccttgtaacccattgat
THY01_0040_E09.b : TGTTCCCAGTTGGTGACGATCTGTTGGGTCCGTGAAGAACATGCCCTTGGTAACGCCATT
OVRM1_0189_F08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0010_F04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0125_B07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGNTACGCCATT
PTG01_0103_B12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTATTACATGCCATTGGTAACGCCATT
TES01_0087_A12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PTG01_0072_D03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0080_E11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0047_D04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0053_G01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0062_D01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0077_A05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0082_E10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0052_D07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0113_H05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTCCCTGTA*TANATGCCCTTGGTAACCCCCTT
LVRM1_0183_E06.b : TTTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PBL01_0027_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0055_A09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGNGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0208_B01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGCAGATGCCCTTGGTAACGCCATT
OVRM1_0031_E06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0048_H08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PTG01_0050_A08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0121_H11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0026_G10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0073_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0026_F03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLN01_0076_G03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0045_E04.b : TGTTCCCAGCTGGCGAGGAGCTGTTGGGTC*CTGTAGTACACGCCCTTGCTAACCCCATT
THY01_0119_C06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SKNB1_0004_F11.b : TGTTCC*CATTGGTGAGGAGCTGTTGGGTC*GTGTAATAAATGCCCTTGGTAACGCCATT
PCT01_0035_H05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PCT01_0009_E01.b : TGTTCC*AGTTGGTGAGGAGTTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0090_E07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PCT01_0004_B05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0098_G04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0078_H02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0095_E09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0096_B06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LVRM1_0027_D03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTACATGCCCTTGGTAACGCCATT
HTMT1_0118_E12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0144_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0054_H05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BKFL1_0007_F04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0042_G08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0004_B05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LVRM1_0107_D12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0012_F02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0007_B09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0110_E01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTA*TAGAATCCCTTGGTAACCCCATT
OVRM1_0223_F12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTATCGCCATT
OVRM1_0149_F02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0072_H10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
HTMT1_0125_B06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0030_H12.b : TGTTC**AGTTGGTGANGAGCTGTTGGGTC*GTGTANTAAATGCCCTTGGTAACGCCCTT
HTMT1_0011_H06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAAATGCCCTTGGTAACGCCATT
CBLT1_0092_F01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
HTMT1_0097_B02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SPL01_0053_F05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CBLT1_0022_C05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
HTMT1_0113_C02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0103_E05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0041_F03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0006_E06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0039_E04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ILNT1_0025_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLN01_0077_B04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0105_A01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
AMP01_0003_B07.b : TGTTCC*AGTTGGTGAAGAGCTGTTGGGTC*CTGTATTAGATGCCCTTGGTAACACCTTT
LVRM1_0187_H06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0056_H10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LVRM1_0002_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PTG01_0034_C07.b : TGTTCC*AGTTGGTGAGGAACTGTTGGGTC*GTGTAATAAATGCCCTTGGTAACGCCATT
AMP01_0037_D04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTANTAAATGCCCTTGGTAACGCCATT
TCH01_0096_A02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0027_H11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0018_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGC*ATT
BFLT1_0004_F10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
AMP01_0046_E10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAATACATGCCCTTGGTAACGCCATT
OVR01_0008_G03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0132_C10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0079_A09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
HTMT1_0015_G05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0095_E09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BMWN1_0021_E04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0027_C01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0016_B01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ADR01_0083_B04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0039_G11.b : agttccaaataaacaatcatgtcacacattgtatcacaggcctctccaaacaacatgtag
OVRM1_0028_B01.b : tgcaccactatgacgatgatctgatagctcccgattaacatgcacttggtaacgcccacg
LVRM1_0184_G04.b : aagttaaatttagtgaggaactgttgggtctagatattaaattcctaggtaacaacaatt
OVRM1_0171_F10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTACCAGATGCCCTTGGTAACGCCCAT
TES01_0035_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAATAAATGCCCTTGGTAACGC*ATT
LVRM1_0096_A09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTACATGCCCTTGATAACGCCATT
OVRM1_0037_A04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAAATGCCCTTGGTAACGCCATT
PTG01_0052_D06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAATAAATGCCCTTGGTAACGCCATT
SMG01_0068_B01.b : TGTTCC*AGTTGGTGAAGAGCTGTTGGGTC*GTGTAACAAATGCCCTTGGTAACGCCATT
OVRM1_0136_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGGCCTTGGTAACGCCATT
OVR01_0076_A03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0167_B01.b : TGTTCC*AGTTGGTGAGAAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0190_E10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0218_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0056_A07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0059_C01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTACTATATGCCCTTGGTAACGCCATT
OVRM1_0087_H02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0206_E07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0067_F12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0037_G07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0124_F07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0099_G02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTCGGTAACGCCATT
SMG01_0071_A01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0140_A09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0069_B01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
UTR01_0045_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TCH01_0054_C12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0051_D05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0112_G01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LVR01_0105_H12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0140_G07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0010_H12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0042_H11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SPL01_0084_C06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0070_E04.b : TGTTCC*AGTTGGTGGGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SPL01_0041_G01.b : TGTTCC*AGCTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0028_E01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0088_E05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0034_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0098_E08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0025_A09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0090_C04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0052_A03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0091_E05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0108_E11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0041_G04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0020_B05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0105_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0006_F06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0096_C06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
UTR01_0104_D02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0202_A07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0076_H10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0022_C12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0092_G11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0041_G10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0103_B06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0050_G07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0024_A12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0018_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BMWN1_0041_D06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PTG01_0062_G08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0025_C06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0001_C09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0009_B09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
UTR01_0041_C04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CBLT1_0075_F04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
HTMT1_0008_G09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PBL01_0051_G05.b : TGTTCC*AGTTGATGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0076_C10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
AMP01_0057_E02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTACATGCCCTTGGTAACGCCATT
THY01_0043_D08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0022_C09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0088_H10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVR01_0073_E01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LVRM1_0038_D02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0191_E03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRM1_0007_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0112_C01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0033_C10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SPL01_0008_F12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0067_H03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0050_A03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0040_D04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ITT01_0031_F08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0079_C05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0139_G06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0085_A11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0062_E06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0028_F05.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0052_E10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0047_D03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0032_H10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0017_F10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0091_B11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0051_G01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0027_C06.b : AGTTCC*AAATGGTGAAGAGCTGTTGtgtgcaagagagatgccataatagaagaatacat
TES01_0098_A12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SKNB1_0071_B08.b : TGTTCC*AGTTGGTGAGGAGTTGTTGGGTC*GTGTACTAGATGCCCTTGGTAACGCCATT
KDN01_0039_B03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0036_D02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0079_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0075_E12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PST01_0026_B10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGACGCCCTTGGTAACGCCATT
PST01_0067_A12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0077_G07.b : aatgttccatgttggagaggaaactgttgggtcgtgtagtaaaatgccccttgggaaacg
SKNB1_0016_A07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0085_C04.b : TGTTCC*AGTTGGTGA*GAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
BFLT1_0147_B07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
ADR01_0028_E09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0118_F04.b : TGTTCC*AGTTGGTGAGGGGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0022_A07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0092_C02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0088_E02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
LNG01_0042_B08.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0103_D12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TES01_0085_H04.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
TCH01_0001_D09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
SMG01_0052_B10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
THY01_0041_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
AMP01_0061_G02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLN01_0070_D09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
KDN01_0063_D06.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0080_H12.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
DCI01_0060_F02.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PCT01_0004_F11.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0075_F01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0090_B07.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
PCT01_0022_H01.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0044_D03.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
CLNT1_0038_B10.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
OVRT1_0146_E09.b : TGTTCC*AGTTGGTGAGGAGCTGTTGGGTC*GTGTAGTAGATGCCCTTGGTAACGCCATT
MLTL1_0085_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_F12.b : gtgtcaaaacaggctggtccggtcggaatcctcagcact
UTR01_0083_H03.b : nnntttttn
MLTL1_0036_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
---------+---------+---------+---------+---------+---------+ 637
CBLT1_0007_E04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0022_D02.b : *GATGGAAAGGGTCCAATTGGCTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0129_G11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0095_C03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCAAAGGCGAGTTGG*CCTGAAA**GCCCC
MLN01_0048_E07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0053_G06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0030_G06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0032_B05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CBLT1_0051_H09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0072_A06.b : tgaaggaaagggcccaattgggtcaaaacccaaagggaatttggctaaaaacccctggaa
THY01_0026_F10.b : CGATGGAAAGGGTCCcaatttgattccatagaccccgaaggccagtaggtctgaaagccc
OVRM1_0132_G08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0219_G05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0043_A01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0003_D01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0022_H03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGGCCCTGAAA**GCCCC
THY01_0002_E02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0023_D11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0044_C10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0093_G08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0007_C10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0057_E03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0045_G11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
UTR01_0035_D07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0103_C12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0095_A07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0118_F10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0086_G09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0062_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTGGG*CCTGAAA**GCCCC
LNG01_0026_E04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0039_C05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0115_G03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0038_C12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0107_H09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0039_B11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0012_H08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0034_D05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0088_C05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PBL01_0101_G07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0020_D04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0032_G11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0048_F06.b : *GATGGAAAGGGTCCAATTGGTTCTAAGACCCGAAGGTGAGTTGG*CCTGAAA**GCCCC
OVRM1_0066_G06.b : tggacccctctacatcctccccatcccactatggcggctactcattgacagtccgcagcc
THY01_0123_A06.b : gaaagggttcatggttcaaaaccaaagcaattggcctaaaccttgggttttt
THY01_0040_E09.b : *GATGGAcaaggcactcatttggttcccacaaccctaagggcaatttgcccttaaaaccc
OVRM1_0189_F08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAACGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0010_F04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0125_B07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGGGCCTGAA***GCCCC
PTG01_0103_B12.b : *GATCGGAAGGGTCCAATTGGTTACAAGACCCTAAAGCGAGTTGG*CCTGAGA**GCACC
TES01_0087_A12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PTG01_0072_D03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0080_E11.b : *GATGGAAAGGGTCCAATTGGTTCCAGGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0047_D04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0053_G01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0062_D01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0077_A05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0082_E10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0052_D07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0113_H05.b : *GATGGAAAGGGTCCANTTGGTTCCCAAAACCCAAGGCAATTTGG*CCgaaaccccctgg
LVRM1_0183_E06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAATGCGAGTTGG*CCTGAAA**GCCCC
PBL01_0027_B08.b : *GATGGAAAGGGNTCAATTTGGTTCAAGAACCGAANGCGAGTTGG*CCTGGAA**GCCCC
OVRM1_0055_A09.b : *GATGGAAAGGGTCCAATTGGTTCCCAGACCCGCAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0208_B01.b : *GACGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCCAGTTGG*TCTGAAA**GCCCC
OVRM1_0031_E06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0048_H08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PTG01_0050_A08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0121_H11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0026_G10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0073_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0026_F03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLN01_0076_G03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0045_E04.b : *GACGGAAAGGGcccccatctgggccccaacacccaaaagccagctggtcctgaaacccc
THY01_0119_C06.b : *GATGGAAAGGGTCCAATTGGTTCCCAGACCCGAAGGCGAGTTGG*CCCTGAA**GCCCT
SKNB1_0004_F11.b : *GATGGAAAGGGGTCCAATGGTTCCAAAAACCGAAGGGGAATTGG*CCTGAAA**GCCCC
PCT01_0035_H05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PCT01_0009_E01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0090_E07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PCT01_0004_B05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0098_G04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0078_H02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0095_E09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0096_B06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LVRM1_0027_D03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0118_E12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0144_B08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0054_H05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BKFL1_0007_F04.b : *GATGGGAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
DCI01_0042_G08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTNGAA**GCCCC
MLTL1_0004_B05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LVRM1_0107_D12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAAGCGAGTTGG*CCTCGAA**GCCCC
DCI01_0012_F02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0007_B09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0110_E01.b : *GATGGAAAGGGTCCAttgggtccanaacccaaggcaaatggcctaaacccctggatttt
OVRM1_0223_F12.b : *GATGGAAAAGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0149_F02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0072_H10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0125_B06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
DCI01_0030_H12.b : *GATGAAAAGGGTCAATTTGGTTCaagaccgaaagcgagttggcctgaaacccctgggga
HTMT1_0011_H06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CBLT1_0092_F01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0097_B02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SPL01_0053_F05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CBLT1_0022_C05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0113_C02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0103_E05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0041_F03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0006_E06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0039_E04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ILNT1_0025_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLN01_0077_B04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0105_A01.b : *GATGGAAAGGGTCCAATTGGTTTCCAGACCCCAAAGCGAagttgccctaa
AMP01_0003_B07.b : *GATGGAAAGGGTCCAATTGGCTCCAAaaaccgtaatgcaaattggcctgaaaaccctcg
LVRM1_0187_H06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAAGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0056_H10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LVRM1_0002_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PTG01_0034_C07.b : *GATGGGAAGGGTCCAATTGGTTCCAAGACCCGAAAGCGAGTTGG*CCTGAAA**GCCCC
AMP01_0037_D04.b : *GATGGGAAGGGTCCNATTGGTTCCAAGACCCGAANGCGAGTTGG*CCTGAAA**GCCCC
TCH01_0096_A02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0027_H11.b : *GATGGAAAGGGTCCAATTGGTTCCCAGACCCGAAGGCGAGTTGG*GCTGAAA**GCCCC
DCI01_0018_F06.b : *GATGGAAAGGGTCCAATTGGTTCCCAGACCCCAAAGCGAGTTGG*GCTGAAA**GCCCC
BFLT1_0004_F10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCAGAAGGCGAGTTGG*CCTGAAA**GCCCC
AMP01_0046_E10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCCAAAGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0008_G03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0132_C10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0079_A09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0015_G05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0095_E09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BMWN1_0021_E04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0027_C01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0016_B01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ADR01_0083_B04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0039_G11.b : gatccgccccccctctaaactacaatactgctactttaacgaactaaactttcaccgttt
OVRM1_0028_B01.b : atggaaaggcacttcttggtttctcccttgccagtgagttcctcttgtatccccagcgtt
LVRM1_0184_G04.b : acgcgattggacctaatagtttttacaacctatccgctaacaaaaaaaatcaaaaagaaa
OVRM1_0171_F10.b : *GATGGAAAAGGCCCAATTGGCTtccaaaatctaatgggagctggcctgaaatccctggg
TES01_0035_F06.b : *GATGGAAAGGGTCCAATTGGNTTCCAGACCCGAAAGCAA*TTTG*CCTGAAA**CCCCC
LVRM1_0096_A09.b : *AATAACAAGGATCCAATCGGCTCCAATACCCCACAGCCAATTAG*CCTGAAA**GCACC
OVRM1_0037_A04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PTG01_0052_D06.b : *GATGGAAAGGGTCCAAT*GGTTCCCAGACCCGAAGGCGAGTTGG*CCTGAAA**ACCCC
SMG01_0068_B01.b : *GATGGAAAGGGTCCAATTGGTTCCCAGACCCGAAAGCGAGTTGG*GCTGAAA**GCCCC
OVRM1_0136_B08.b : *GATGGAAAGGGTCCCATTGGTTCCAAGACCCGAAGGCGAGTTGG*GCCTGAA**GCCTC
OVR01_0076_A03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0167_B01.b : *GATGGAAAGGGTCCAACTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0190_E10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAAGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0218_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0056_A07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0059_C01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0087_H02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0206_E07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0067_F12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0037_G07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0124_F07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTNGAA**GCCCC
OVR01_0099_G02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0071_A01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTNGAA**GCCCC
OVRT1_0140_A09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0069_B01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
UTR01_0045_B08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TCH01_0054_C12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0051_D05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0112_G01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LVR01_0105_H12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0140_G07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0010_H12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0042_H11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SPL01_0084_C06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0070_E04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SPL01_0041_G01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0028_E01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0088_E05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0034_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0098_E08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0025_A09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0090_C04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0052_A03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0091_E05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0108_E11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0041_G04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0020_B05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0105_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0006_F06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0096_C06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
UTR01_0104_D02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0202_A07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0076_H10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0022_C12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0092_G11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0041_G10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0103_B06.b : *GATGGAAAGGGTCCAATTGGCTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0050_G07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0024_A12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0018_B08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BMWN1_0041_D06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PTG01_0062_G08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0025_C06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0001_C09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0009_B09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
UTR01_0041_C04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CBLT1_0075_F04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
HTMT1_0008_G09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PBL01_0051_G05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0076_C10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
AMP01_0057_E02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0043_D08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCCAAGGCGAGTTGG*CCTGAAAAGCCCCC
OVRM1_0022_C09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0088_H10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVR01_0073_E01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LVRM1_0038_D02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0191_E03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRM1_0007_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0112_C01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0033_C10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SPL01_0008_F12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0067_H03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0050_A03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0040_D04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ITT01_0031_F08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0079_C05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0139_G06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0085_A11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0062_E06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0028_F05.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0052_E10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0047_D03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0032_H10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0017_F10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0091_B11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0051_G01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0027_C06.b : tactatagaaaacatttttcccaaattaaaagaatacataacaatcgataccaattcatc
TES01_0098_A12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SKNB1_0071_B08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0039_B03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0036_D02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0079_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0075_E12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0026_B10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PST01_0067_A12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0077_G07.b : ccatttgaatggaaaaggggtccaaatttggttcccaaaaaccccaaaaggcaaatttgg
SKNB1_0016_A07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0085_C04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
BFLT1_0147_B07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
ADR01_0028_E09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
DCI01_0118_F04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0022_A07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0092_C02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0088_E02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
LNG01_0042_B08.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0103_D12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TES01_0085_H04.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
TCH01_0001_D09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
SMG01_0052_B10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0041_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
AMP01_0061_G02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLN01_0070_D09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
KDN01_0063_D06.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0080_H12.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
DCI01_0060_F02.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PCT01_0004_F11.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0075_F01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0090_B07.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
PCT01_0022_H01.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0044_D03.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
CLNT1_0038_B10.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
OVRT1_0146_E09.b : *GATGGAAAGGGTCCAATTGGTTCCAAGACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
MLTL1_0085_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxACCCGAAGGCGAGTTGG*CCTGAAA**GCCCC
THY01_0109_F12.b : gtggctactgatatggaaagggtcatggttccatgacccgaaagcaattggcctgaaacc
UTR01_0083_H03.b : nnnnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0036_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0096_C03.b :
TES01_0031_B10.b :
TES01_0063_A05.b :
MLN01_0062_D06.b :
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
---------+---------+---------+---------+---------+---------+ 695
CBLT1_0007_E04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0022_D02.b : TGNGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0129_G11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0095_C03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLN01_0048_E07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0053_G06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAC*AATGCAGACTGGCATTAA*GCTGTG
TES01_0030_G06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0032_B05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CBLT1_0051_H09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0072_A06.b : tatttcccaaatccctggggggaaaccatggcaaagggatttaaggggggggaaacccgg
THY01_0026_F10.b : cgtacgatcattcctcctatatcccttgtgctagaaccccatgcccacttgacctaatcg
OVRM1_0132_G08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTNAAGCTGTG
OVRM1_0219_G05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCA*TGCAGACTGGCATTAAAGCTGTG
THY01_0043_A01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAAGCTGTG
THY01_0003_D01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0022_H03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0002_E02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0023_D11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0044_C10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0093_G08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAACCATGCAGACTGGCATTAAGGCTGTG
SMG01_0007_C10.b : TGTGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0057_E03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0045_G11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
UTR01_0035_D07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0103_C12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0095_A07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0118_F10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0086_G09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0062_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0026_E04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0039_C05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0115_G03.b : TGGGA*TCACTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0038_C12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0107_H09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0039_B11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0012_H08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0034_D05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0088_C05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PBL01_0101_G07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0020_D04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0032_G11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0048_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0066_G06.b : gtatatcaaataattcatgttcactactccacaccgcgttctgatccctgaccaataact
THY01_0123_A06.b :
THY01_0040_E09.b : cccttgggaatattcctccaaatctctgtctcctggtaacccaatggcaaactgggccat
OVRM1_0189_F08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAACAATGCAGACTGGCATTAAAGCTGTG
OVRM1_0010_F04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0125_B07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PTG01_0103_B12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGAGAACCAATGCACACTGACATTAAAGCTGTG
TES01_0087_A12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAAGCTGTG
PTG01_0072_D03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAACCATGCAGACTGGCATTAAGGCTGTG
SMG01_0080_E11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0047_D04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0053_G01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0062_D01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0077_A05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0082_E10.b : TGGGA*TCATTCCTCGAATCTCTGAG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0052_D07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0113_H05.b : atattcctccattttttgggggagaaatatgaaggggtttgggggtggaaacttgtttta
LVRM1_0183_E06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGAAAACAATGCAAACTGGCATTAATGCTGTG
PBL01_0027_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAC*AATGCAGACTGGCATTAAG*CTGNT
OVRM1_0055_A09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTTAAGCTGTG
OVRM1_0208_B01.b : TGGGA*TCATTCCTCGAATCTCTGTGTCGGGAACCAATGCAGACTGGTATTAAGGCTGTG
OVRM1_0031_E06.b : TGNGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0048_H08.b : TGNGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PTG01_0050_A08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0121_H11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0026_G10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0073_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0026_F03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLN01_0076_G03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0045_E04.b : ctgccaatcattccctccaaacctctctgcgggaaccccctccccactcggctttatgct
THY01_0119_C06.b : TGGattattcccaaattttgtgnggaaccattgnaaagggattaggt
SKNB1_0004_F11.b : TGGGA*TCATTCCTCCAAACCCTGTG*CGGAAACCAATGGAAAATGGCAATTAAGATGTG
PCT01_0035_H05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PCT01_0009_E01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0090_E07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PCT01_0004_B05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0098_G04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0078_H02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0095_E09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0096_B06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LVRM1_0027_D03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGCAACAATGCAGACTGGCATTAAGGCTGTG
HTMT1_0118_E12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0144_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0054_H05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BKFL1_0007_F04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGA*CCAATGCAGACTGGCATTAAAGCTGTG
DCI01_0042_G08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0004_B05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGGCCNAATGCAGACTGGCATTAAGGCTGTG
LVRM1_0107_D12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAAGCTGTG
DCI01_0012_F02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTTAGGCTGTG
OVRT1_0007_B09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0110_E01.b : ttttaatttttttg
OVRM1_0223_F12.b : TGGGA*TAATTCCTCGAAACTCCGTG*GCGGCACCAATGGCCACTGGCAATAAGGCTGTG
OVRM1_0149_F02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0072_H10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CCGGAACCCATGCCNACTGGCATTAAGGCTGTG
HTMT1_0125_B06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
DCI01_0030_H12.b : tcattctcgaatctcgtggcggaaacaatgccaacggcattaaagctggggaagccctgt
HTMT1_0011_H06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CBLT1_0092_F01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCATACTGGCATTAAGGCTGTG
HTMT1_0097_B02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SPL01_0053_F05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CBLT1_0022_C05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
HTMT1_0113_C02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0103_E05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0041_F03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGTTGTG
OVRT1_0006_E06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0039_E04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ILNT1_0025_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLN01_0077_B04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0105_A01.b :
AMP01_0003_B07.b : gggatctttcctcaacacactgtgtcgataccattttctaactgggatttaaggttgtcg
LVRM1_0187_H06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0056_H10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LVRM1_0002_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PTG01_0034_C07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAAACTGGCATTAAAGCTGTG
AMP01_0037_D04.b : TGGGA*TCATTCCTCCAATCTCTGTG*CGGGAACCCATGCAGACTGGCATTAAAGCTGTG
TCH01_0096_A02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0027_H11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGGAACAATGCAGACTGGCATTAAGGCTGTG
DCI01_0018_F06.b : TGGGA*TCATCCNTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0004_F10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
AMP01_0046_E10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0008_G03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0132_C10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0079_A09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
HTMT1_0015_G05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0095_E09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BMWN1_0021_E04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0027_C01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0016_B01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ADR01_0083_B04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0039_G11.b : aaaaccgtaccctgataaattactgattgcatccacccctaattccgtgtgtacccatca
OVRM1_0028_B01.b : ccctcctatatcctttccgcttatacaacgttaactgtccataagtatgacggaacactg
LVRM1_0184_G04.b : caaccgaccaaactctgacttaacaataaaaaaatattattcataatttaatntaacatc
OVRM1_0171_F10.b : ataatccaccaattctctgcccaaattattgtaaccgcataacgctcttgaagcgcacta
TES01_0035_F06.b : TGGGA*TCATTCCCTCAATCTCTGTG*CGGGAACCAATGCAActggcttaaggctgggga
LVRM1_0096_A09.b : TGAGA*TCATTCCTCCAATCacaaggcggaaccactacagacagacctagagcctacgaa
OVRM1_0037_A04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTCAAGCTGTG
PTG01_0052_D06.b : CTGGA*TCATTCNTCCAATCTCTGTG*CGGGAACCAATGCCAACTGCCTTTAAGGTTGGG
SMG01_0068_B01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGGACCAATGCAGACTGGCATTAAAGCTGTG
OVRM1_0136_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CTGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0076_A03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGGAACAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0167_B01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAAACTGGCATTAAGGCTGTG
OVRM1_0190_E10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0218_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAANGCTGTG
OVRM1_0056_A07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0059_C01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGTATTAAGGCTGTG
OVRM1_0087_H02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0206_E07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0067_F12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0037_G07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0124_F07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0099_G02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTTAAGCTGTG
SMG01_0071_A01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCA*TGCAGACTGGCATTAAGGCTGTG
OVRT1_0140_A09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0069_B01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
UTR01_0045_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TCH01_0054_C12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0051_D05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0112_G01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LVR01_0105_H12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0140_G07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0010_H12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0042_H11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SPL01_0084_C06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0070_E04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SPL01_0041_G01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0028_E01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0088_E05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0034_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0098_E08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0025_A09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0090_C04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0052_A03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0091_E05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0108_E11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0041_G04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0020_B05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0105_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0006_F06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0096_C06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
UTR01_0104_D02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0202_A07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0076_H10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0022_C12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0092_G11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0041_G10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0103_B06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0050_G07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0024_A12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0018_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BMWN1_0041_D06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTTAAGCTGTG
PTG01_0062_G08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVR01_0025_C06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0001_C09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0009_B09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
UTR01_0041_C04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CBLT1_0075_F04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
HTMT1_0008_G09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PBL01_0051_G05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0076_C10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
AMP01_0057_E02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0043_D08.b : TGGGAATCTTTCCTCGAATCTCTGTG*CGGGAACCCATGCAGACTGGCATTAAAGgttgt
OVRM1_0022_C09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATCAACGCTGTG
TES01_0088_H10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTTAAGCTGTG
OVR01_0073_E01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LVRM1_0038_D02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0191_E03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRM1_0007_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0112_C01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
BFLT1_0033_C10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SPL01_0008_F12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0067_H03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0050_A03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0040_D04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ITT01_0031_F08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0079_C05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0139_G06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0085_A11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0062_E06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0028_F05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0052_E10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0047_D03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0032_H10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0017_F10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0091_B11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0051_G01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0027_C06.b : aagatcaaaaccacgataatagtacagacaaaacgtaaacacaaaagcgactcacaaaaa
TES01_0098_A12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SKNB1_0071_B08.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0039_B03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0036_D02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0079_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0075_E12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0026_B10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PST01_0067_A12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0077_G07.b : cccttgaaacccccctggggaatatttcctccgaattctctttgtgcgggaatccctatt
SKNB1_0016_A07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0085_C04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAAACCATGCAGACTGGCATTAAGGCTGTG
BFLT1_0147_B07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
ADR01_0028_E09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
DCI01_0118_F04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0022_A07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0092_C02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0088_E02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
LNG01_0042_B08.b : TGGGA*TCATTCCTCGAATCTCAGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0103_D12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TES01_0085_H04.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
TCH01_0001_D09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
SMG01_0052_B10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0041_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
AMP01_0061_G02.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLN01_0070_D09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
KDN01_0063_D06.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0080_H12.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
DCI01_0060_F02.b : TGGGA*TCATTCCTCGAATCTCTGgtgccgggacccaattgccaaactgggttttaaagg
PCT01_0004_F11.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0075_F01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0090_B07.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
PCT01_0022_H01.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0044_D03.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
CLNT1_0038_B10.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
OVRT1_0146_E09.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0085_F05.b : TGGGA*TCATTCCTCGAATCTCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
THY01_0109_F12.b : cctgcgatATTCCTCAAATCTCTGTG*CGGGAACCAATGCATACTGAGGTTAAGGCTGTG
UTR01_0083_H03.b : xxxxxxxxxxxxxxxxxxxxxCTGTG*CGGGAACCAATGCAGACTGGCATTAAGGCTGTG
MLTL1_0036_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACCAATGCAGACTGGCATTAAGGCTGTG
PBL01_0096_C03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
TES01_0031_B10.b : ctgttggctctgg
TES01_0063_A05.b : ttccgctgttgctatgg
MLN01_0062_D06.b : nnggct
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
---------+---------+---------+---------+---------+---------+ 750
CBLT1_0007_E04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0022_D02.b : GACAGCCTGATG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0129_G11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0095_C03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLN01_0048_E07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0053_G06.b : GACAGCCTGNNT*GCCAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0030_G06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0032_B05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CBLT1_0051_H09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0072_A06.b : ggcccattgggccggggccccgggacgtttattttgggaacccaaaaaaggggaaaaacc
THY01_0026_F10.b : ctcgtgaccactcctatatgctccagacgcttgggcctctcagcacgaaatgagactcat
OVRM1_0132_G08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0219_G05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGT**CGACCGAC
THY01_0043_A01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0003_D01.b : GGCAGCCTGGTG*GCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0022_H03.b : GACAGCCTGGTG*CCAAT*TGGTCGCGGTCACCGTGAGCT*GATTATTTGGCGAACCGAC
THY01_0002_E02.b : GGCAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0023_D11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0044_C10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0093_G08.b : GACAGCCTGGTG*C*AAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0007_C10.b : GACAGCCTGGTG*CCNAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0057_E03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0045_G11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
UTR01_0035_D07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0103_C12.b : GACAGCCTGNTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGN**CGACCGAC
SMG01_0095_A07.b : GACAGCCTGNNT*GCCAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0118_F10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0086_G09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0062_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0026_E04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0039_C05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0115_G03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0038_C12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0107_H09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0039_B11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0012_H08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0034_D05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0088_C05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PBL01_0101_G07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0020_D04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0032_G11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0048_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0066_G06.b : ttcactcctaacaatcagatgtaatcttgtttttaccccatgtctaacacagtcgctaag
THY01_0123_A06.b :
THY01_0040_E09.b : aaatggtctctggcacagacctgggtcgccatttggtcgcgggtccaaccgttcgcctct
OVRM1_0189_F08.b : GACAGCCTGGTG*CCAAT*TGATCGTGGTCAACGTGAGCT*GATTATTGG**CGACCGAT
OVRM1_0010_F04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0125_B07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACGGAC
PTG01_0103_B12.b : GACAGCCTGTTG*ACACT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGATCGAC
TES01_0087_A12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PTG01_0072_D03.b : GACAGCCTGGTG*CCNAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0080_E11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0047_D04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0053_G01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0062_D01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0077_A05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0082_E10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0052_D07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0113_H05.b : ttgt
LVRM1_0183_E06.b : GACAGCCCGCTG*CCAttggtcctggtccacgatgactgattatggcctactgacgactg
PBL01_0027_B08.b : GACAGGCTGGTG*CCNAT*TGGTCGTGGTTCACGTGAGCT*GATTATTN***CGACTGAC
OVRM1_0055_A09.b : GACAGCCTGGTG*CCCAT*TGGTCGTGGTCAGCGTGAGCT*GA*TATTGG**CCACCGAC
OVRM1_0208_B01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0031_E06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0048_H08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PTG01_0050_A08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0121_H11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATCGG**CGACCGAC
OVRT1_0026_G10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0073_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0026_F03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLN01_0076_G03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0045_E04.b : cacgcccgccctgcccccatttttcccctcgccacctcgtccctactactgcccaacccc
THY01_0119_C06.b :
SKNB1_0004_F11.b : Ggacaccccggtgccaaattgccgtgggcaacggtgagctgattatttggcaacccacaa
PCT01_0035_H05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PCT01_0009_E01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0090_E07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PCT01_0004_B05.b : GACAGCCTGNCG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0098_G04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0078_H02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0095_E09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0096_B06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LVRM1_0027_D03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGCTCAGCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0118_E12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0144_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0054_H05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GAATATTGG**CGACCGAC
BKFL1_0007_F04.b : GACAGCCTGGTG*CCA*T*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
DCI01_0042_G08.b : GACAGCCTGNTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0004_B05.b : GACAGCCTGNTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LVRM1_0107_D12.b : GACAGCCTGGTG*CCAAT*TGTTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
DCI01_0012_F02.b : GACAGCCTGGTG*CCCAT*TGGTCGTGGTCAGCGTGAGCT*GATTACTGG**CGAACGAC
OVRT1_0007_B09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0110_E01.b :
OVRM1_0223_F12.b : GAAAGCCTGGCG*CCAAA*TGGTCGTGGTCAcgatgacctgatcatatgggacacaacaa
OVRM1_0149_F02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAACT*GATTATTGC**CGACCGAA
OVR01_0072_H10.b : GACAGCCTGGTG*CCCAT*TGGTCGTGGTCCCCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0125_B06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
DCI01_0030_H12.b : ggccaatgtccgggtcaccgggaccgaataatggcaaccaaaaaatgccaaaagccattg
HTMT1_0011_H06.b : GACAGCCTGGTG*C*AAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGN**CGACCGAC
CBLT1_0092_F01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0097_B02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SPL01_0053_F05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CBLT1_0022_C05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0113_C02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0103_E05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0041_F03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0006_E06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0039_E04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ILNT1_0025_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLN01_0077_B04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0105_A01.b :
AMP01_0003_B07.b : acaacctttctgcctaatagtcctttgtcaactgtaacttaattattgtcaacccaatta
LVRM1_0187_H06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGGACT*GATTATTGG**CGACCGAC
OVRM1_0056_H10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LVRM1_0002_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PTG01_0034_C07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAACGTGAGCT*GAATATTGG**CGACCGAC
AMP01_0037_D04.b : GACAGCCTGGTG*CCAATTGGGTCGTGGCCAGCGTGAGCT*GATTATTGG**CCACCGAC
TCH01_0096_A02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0027_H11.b : GACCGCCTGGTG*CCAATTTGGTCGTGGTCAGCGTGAACT*GATTATTGG**GCAACGAC
DCI01_0018_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GAATATTGG**CAACCGAC
BFLT1_0004_F10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
AMP01_0046_E10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0008_G03.b : GACAGCCTGGTG*CCAAT*TGGTCCTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0132_C10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0079_A09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0015_G05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0095_E09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BMWN1_0021_E04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0027_C01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0016_B01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ADR01_0083_B04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0039_G11.b : ccaaaagacagcggcattactcacacacttttttctataaaatcccacacattaccttta
OVRM1_0028_B01.b : accactcatactcacagtcagcttaactcaatttcagagtcacaacgatttccgacgttc
LVRM1_0184_G04.b : gaccgcctacataatatgtggcccgcctttcacaacaaatcactataaaaaaaccacaat
OVRM1_0171_F10.b : accacaaccgcgttgcattgagcggaaaagtatacccatatcagctgcgcgtttctgaga
TES01_0035_F06.b : cgactgggtgccaatggtcctggtcacgttgactaattatgggcaaccaaaaaatgggaa
LVRM1_0096_A09.b : caacagcatacaattaatcgtgaacaaccggaactaactgattgcgaacgaattgccaaa
OVRM1_0037_A04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAACT*GATTATTGcgaacgacgga
PTG01_0052_D06.b : GAAAGCTGGTTG*CAATT*GGGTCGGGGTCAACGGGAGCT*AATTATTGGgcaaccaaaa
SMG01_0068_B01.b : GACAACCTGGTG*CCCAT*TGGTCCTGGTCAGCGTGAGCT*GATTATGTG**CGACCaca
OVRM1_0136_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAACCTGAGCT*GATTATTGG**CGACCGAC
OVR01_0076_A03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTG
OVRM1_0167_B01.b : GACAGCCTGCTG*CCAAT*TGGTCGTGGTCAGCGCGAGCT*GATTACTGG**CGACCGAC
OVRM1_0190_E10.b : GACAGCCTGGTG*CCAAT*TGCTCGTGGGTCACGTGAGCT*GACTATTGG**CGAC*GAC
OVRM1_0218_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0056_A07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0059_C01.b : GACAGCCTGGTGCCCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0087_H02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0206_E07.b : GACAGCCTGGTG*CCCAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0067_F12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0037_G07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAACGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0124_F07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0099_G02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0071_A01.b : GACAGCCTGGTG*CCAAT*TGNTCGTGGTCAGCGTGAGCT*GATTATTGG**CGAACGAC
OVRT1_0140_A09.b : GACAGCCTGTTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0069_B01.b : GACAGCCTGGTG*CCCAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CCACCGAC
UTR01_0045_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TCH01_0054_C12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GAATATTGG**CGACCGAC
THY01_0051_D05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0112_G01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LVR01_0105_H12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0140_G07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0010_H12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0042_H11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SPL01_0084_C06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0070_E04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SPL01_0041_G01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0028_E01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0088_E05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0034_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0098_E08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0025_A09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACAGAC
BFLT1_0090_C04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0052_A03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0091_E05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0108_E11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0041_G04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGCGAGCT*GATTATTGG**CGACCGAC
ITT01_0020_B05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0105_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0006_F06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0096_C06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
UTR01_0104_D02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGCCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0202_A07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0076_H10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0022_C12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0092_G11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0041_G10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0103_B06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0050_G07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0024_A12.b : GACAGCCTGGCG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0018_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BMWN1_0041_D06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGGG*CCACCGAC
PTG01_0062_G08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0025_C06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0001_C09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0009_B09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
UTR01_0041_C04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CBLT1_0075_F04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
HTMT1_0008_G09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PBL01_0051_G05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0076_C10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
AMP01_0057_E02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0043_D08.b : ggaacaccctggtgccaaattggtccgtggccagcgtgagcttgatttattgccaaaccg
OVRM1_0022_C09.b : GACAGCCTGGTG*CCAAT*TTGTCGAGGTCAGCGTGAGCT*GATTATTGG**CGACCGAa
TES01_0088_H10.b : GACAGCCTGNTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVR01_0073_E01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LVRM1_0038_D02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0191_E03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRM1_0007_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGAGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0112_C01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0033_C10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SPL01_0008_F12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0067_H03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0050_A03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0040_D04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
ITT01_0031_F08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0079_C05.b : GACAGCCTGNTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0139_G06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCTTGATTATTGG**CGACCGAC
TES01_0085_A11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0062_E06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0028_F05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0052_E10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0047_D03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0032_H10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0017_F10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0091_B11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0051_G01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0027_C06.b : ccaccgtaatagcacacagaactaaaactaagacaattacaaaagaaatatcacatagca
TES01_0098_A12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SKNB1_0071_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0039_B03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0036_D02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0079_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0075_E12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0026_B10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PST01_0067_A12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0077_G07.b : gcaaaatgggccctttaaagggtgggggaaaaaccccgtgttgccccatttggtcccaag
SKNB1_0016_A07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0085_C04.b : GACAGCCTGGTN*GCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
BFLT1_0147_B07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTTATGG**CGACCGAC
ADR01_0028_E09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
DCI01_0118_F04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0022_A07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0092_C02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGCGAGCT*GATTATTGG**CGACCGAC
TES01_0088_E02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
LNG01_0042_B08.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0103_D12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0085_H04.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TCH01_0001_D09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
SMG01_0052_B10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0041_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
AMP01_0061_G02.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLN01_0070_D09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
KDN01_0063_D06.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0080_H12.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
DCI01_0060_F02.b : gtgtggggaacacccccctgggggggccccccacanatgtnnggcccgcgggccccgggg
PCT01_0004_F11.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0075_F01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0090_B07.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PCT01_0022_H01.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0044_D03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
CLNT1_0038_B10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
OVRT1_0146_E09.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0085_F05.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
THY01_0109_F12.b : GACAGTCTGGTG*CCAAT*TGGTCATGGTCAGCGTAAGCT*GATTATTGG**CGACCGAC
UTR01_0083_H03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLTL1_0036_B10.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
PBL01_0096_C03.b : GACAGCCTGGTG*CCAAT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0031_B10.b : ggaAGCCTGGTG*CC*AT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
TES01_0063_A05.b : ggaAGCCTGGTG*CC*AT*TGGTCGTGGTCAGCGTGAGCT*GATTATTGG**CGACCGAC
MLN01_0062_D06.b : aggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0015_B10.b :
TES01_0059_B06.b :
KDN01_0092_G03.b :
MLN01_0055_B02.b :
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
---------+---------+---------+---------+---------+---------+ 804
CBLT1_0007_E04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRM1_0022_D02.b : AGACTG*GC**AAACGT*CCATT*GCTA*TTGACACAATCATTA*ACCAGtacgattcat
BFLT1_0129_G11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCTTTA*ACC*GAAACGATTCA
PST01_0095_C03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLN01_0048_E07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGNACACATCATTA*ACCAGAAACGATTCA
MLTL1_0053_G06.b : AGACTG*GCAAAAACGT*CATTT*GCTA**TGACANCATCATTAACCCAGAAACGA*TCA
TES01_0030_G06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0032_B05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCC
CBLT1_0051_H09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0072_A06.b : ctttttttttttggccccaccttttccccaaaaaaaaattttggggggaggcggggaaaa
THY01_0026_F10.b : ggtgcccacaaacccgcgcctatacttactcacatcttaccatcacatgtcccctactaa
OVRM1_0132_G08.b : AGACTG*GCA*AACCGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGn
OVRM1_0219_G05.b : AGACTG*GCN*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAAAAACGAATCA
THY01_0043_A01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACATTCATTA*CCCAGAAACGATTCA
THY01_0003_D01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGAATTC
OVR01_0022_H03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTAACCCACAAACCATTTC
THY01_0002_E02.b : AGACTG*GGC*AAACCG*TCAAT*GCTA*TTGACACNATCATTA**CCCAGAACGATTTC
SMG01_0023_D11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCANAAACGATTCA
THY01_0044_C10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACCCATCCTTAA**CCAAAAACGATTCA
SMG01_0093_G08.b : AGACTG*GCA*AAACGT*CCATT*GGCT*ATGGACACATCTTA**ACCCAGAACGAATTC
SMG01_0007_C10.b : AGACTG*GNC*AAACGT*CAATT*GCTA*TTGACACGATCATTAACCANGAAACGATTCA
TES01_0057_E03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
LNG01_0045_G11.b : AGACTG*GCA*AAACGT*CAATTCGCTA*TTGACACAATCATTA*ACCAGAAACGAATCA
UTR01_0035_D07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0103_C12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTTGACACATCATTA*ACCAGAAACGATTTC
SMG01_0095_A07.b : AGACTG*GGC*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0118_F10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGAATCA
OVRT1_0086_G09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0062_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0026_E04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0039_C05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGAATTC
OVRT1_0115_G03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACANCATCATTA*ACCAGAAACGATTCA
PST01_0038_C12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0107_H09.b : AGACTG*GGC*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0039_B11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0012_H08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0034_D05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0088_C05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PBL01_0101_G07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0020_D04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
CLNT1_0032_G11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0048_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRM1_0066_G06.b : catcatccatatgttatggcgcgccccaacttatcaaaacacacaacggatgctaacaca
THY01_0123_A06.b :
THY01_0040_E09.b : tcattatttggcaacctccacaattgcccacaagtttatttgtttttccccccatccatt
OVRM1_0189_F08.b : AAACTG*GCA*AAACTT*C*ATT*GCTA*TTGAAACCATCACTAACCAGAAAgattcaat
OVRM1_0010_F04.b : AGACTG*GCG*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAGACGATTCA
OVRM1_0125_B07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGAC*CAATCATTA*ACCAGAAACGATTC*
PTG01_0103_B12.b : AGACTG*GCA*AAACAT*CAATT*GCTA*GTGACTCAATCATTAAGCTGCAAACGATTCA
TES01_0087_A12.b : AGACTG*GCA*AAACGT*CCATT*GCTA*TTGACACAATCTTAA*ACAGAAAACGATTCA
PTG01_0072_D03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0080_E11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTTGACACATCATTA*ACCAGAAACGAATCA
OVR01_0047_D04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0053_G01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0062_D01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0077_A05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0082_E10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0052_D07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0113_H05.b :
LVRM1_0183_E06.b : gccaaacatcgagtgccattgacccaatg
PBL01_0027_B08.b : AGACTG*GCA**AACGT*CAATT*GCTA*TTGACccattctttaacagaaacgattaatg
OVRM1_0055_A09.b : AAACTG*GCA*AAAC*T*CAATT*GCTA*TTGA*ACAATCattaaccaaaacgattcatg
OVRM1_0208_B01.b : AGACTG*TCA*CAACGC*CAATT*GCTA*TTGACACGACCATTAg
OVRM1_0031_E06.b : AGACTG*GNC*AAACGT*CAATT*GCTA*TTGACACAATCATT**ACCAGAAACGATTCA
THY01_0048_H08.b : AGAATG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PTG01_0050_A08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA**ACAGAAACGATTCA
CLNT1_0121_H11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0026_G10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACANCATCATTA*ACCAGAAACGATTCA
PST01_0073_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0026_F03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLN01_0076_G03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0045_E04.b : ccccacctggcacaccccccacctcgccttctccctccccccctcaacccataaaacaac
THY01_0119_C06.b :
SKNB1_0004_F11.b : aatgggaaaaaggccaattggctatttgacaaaatcattaacccaaaaaccatttccatg
PCT01_0035_H05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
PCT01_0009_E01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
KDN01_0090_E07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PCT01_0004_B05.b : AGACTG*GCN*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0098_G04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0078_H02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0095_E09.b : AGACAG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0096_B06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LVRM1_0027_D03.b : AGACTG*GCA*AAACGT*CCATT*GCTA
HTMT1_0118_E12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0144_B08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGNACACATCATTA*ACCAGAAACGATTCA
MLTL1_0054_H05.b : AGACTT*GGC*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
BKFL1_0007_F04.b : NGACTG*GCA*AAACGT*TCATT*GCTA*TTGACACATTCATTA*ACCANAAACGATTCA
DCI01_0042_G08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACANCATCATTA**ACAGAAACGATTCA
MLTL1_0004_B05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACCATCATTA*ACCAAGAACGATTCA
LVRM1_0107_D12.b : AGACTG*GCA*AAACGT*CA*TT*GCTA*TTGACACAATCAT
DCI01_0012_F02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCCTTT*ACCAGAAAACGATCC
OVRT1_0007_B09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
THY01_0110_E01.b :
OVRM1_0223_F12.b : ctccccaaactcaagttctattgacacaacaatcacctaaacgatccctcgacggaaagt
OVRM1_0149_F02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGAC
OVR01_0072_H10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACCCCATCCTTTAACCAAAAACCATTCA
HTMT1_0125_B06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
DCI01_0030_H12.b : gttttgaaccttccttaaccaaaacaatcctggagggaccgatgaaaaaaaaaaccgtac
HTMT1_0011_H06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACCACATCATTAAACCAGAAACGATTCC
CBLT1_0092_F01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACTATCATTA*ACCAGAAACGATTCA
HTMT1_0097_B02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SPL01_0053_F05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
CBLT1_0022_C05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
HTMT1_0113_C02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0103_E05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0041_F03.b : AGACTG*GCG*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0006_E06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGAATTC
OVR01_0039_E04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ILNT1_0025_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLN01_0077_B04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0105_A01.b :
AMP01_0003_B07.b : atttcctctaaacccccttttgctttttgacccttccccttattcaatttacaaattaaa
LVRM1_0187_H06.b : AGACTG*CC**AAACGT*CAATT*GCTA*TTGAACAatcattaccagaa
OVRM1_0056_H10.b : AGACTG*GGC*AAACGT*CCATT*GCTA*TTGACACCATCATTA*ACCANAAACGATTCA
LVRM1_0002_F06.b : AGACTG*GCC*AAAACG*TCATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PTG01_0034_C07.b : AGACTG*GCA*AAACGT*CCATT*GCTA*TTGACACAATCTTTA*ACCAAAAACGATTCC
AMP01_0037_D04.b : GGACTG*GCA*AAACGT*CAATT*GCTT*TTGACCCAATCTTTACCCAAAAcccattcat
TCH01_0096_A02.b : AGACTG*GGT*AAACGT*CCATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0027_H11.b : AGACTG*GCA*AAACGT*CCATT*GCTA*TTGACACATCCTTAA**CCAAAAACAATTTC
DCI01_0018_F06.b : AGACTG*GCC*AAACGT*CATTT*GCCT*ATGACCCCATCTTTA*CCCAGAACCAATTCA
BFLT1_0004_F10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
AMP01_0046_E10.b : AGACTG*GCA*AAACGT*CAATT*GCTT*ATGACCCAATCTTTA*ACCAAAAACGATTCA
OVR01_0008_G03.b : AGACTG*GCC*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAAAAACGATTCA
CLNT1_0132_C10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0079_A09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
HTMT1_0015_G05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0095_E09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BMWN1_0021_E04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0027_C01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0016_B01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ADR01_0083_B04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCGGAAACGATTNC
OVRM1_0039_G11.b : catatatgtcagacaaccccaatgtttacaccaacaagctccacccn
OVRM1_0028_B01.b : tctcgcacttacaatatataaccaccacaccgcctatcaattgcacattcacaacataat
LVRM1_0184_G04.b : tcctataaattgcacacagtcc
OVRM1_0171_F10.b : taaataatatcacgccgctaaatcttatagtcctata
TES01_0035_F06.b : aaattcattttttttggccccatctttaaccccaaaacattccttgtgggactgaataaa
LVRM1_0096_A09.b : gcacccgacacttcatatgccagatacaaaaccaccaaacgatgg
OVRM1_0037_A04.b : ctggcaaaacgtaattgctgatgacaaaatcttaccat
PTG01_0052_D06.b : aaatggcaaaaacttcaattggttttggccccatcttttacccaaaaaccatttcttggg
SMG01_0068_B01.b : aaatggcaaaagtcaattggtttttgcaccatccttaaccagaaacgaattcatgatggg
OVRM1_0136_B08.b : gactggcaaaacgccattgctattggcacaactttaccca
OVR01_0076_A03.b :
OVRM1_0167_B01.b : AGACTG*GTC*AAACGT*CAATT*GCTG*TTGACACAATCATTAAtccttaatt
OVRM1_0190_E10.b : AGAATG*GCT*AAACGT*CAATT*GCTA*TTGACACAATCATCA*ACACCAAAA*AATCA
OVRM1_0218_H01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACCATCATTA*ACCAGAAACGATTCA
OVRM1_0056_A07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
THY01_0059_C01.b : AGACTGTGCAAAAACGTTCAATT*GCTA*TTGACACTATCATTA*ACCATAAAacgattc
OVRM1_0087_H02.b : AGACTG*GNCAAAACGT*C*ATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRM1_0206_E07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACNATCATTA*ACCAGAAACGATTTC
OVRM1_0067_F12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAACCGATTCA
OVRM1_0037_G07.b : AGACTG*GCA*AA*CGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTC*
OVRM1_0124_F07.b : AGACTG*GNC*AAACGT*CAATT*GCTA*TTTGACACATCATTA*ACCAGAAACGATTCA
OVR01_0099_G02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACCCAATCATTTACCCGAAAACAATTCC
SMG01_0071_A01.b : AGACTG*GCA*AAACGT*CCATT*GCTA*TTGACACATTCTTTA*CCCAAAAACCATTCA
OVRT1_0140_A09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0069_B01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACCATCTTA**ACCAGAAACGATTCA
UTR01_0045_B08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TCH01_0054_C12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0051_D05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0112_G01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LVR01_0105_H12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
CLNT1_0140_G07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCTTTA*ACCAGAAACGATTCA
BFLT1_0010_H12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0042_H11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SPL01_0084_C06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0070_E04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
SPL01_0041_G01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0028_E01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0088_E05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTAACCCAGAAACGATTCA
CLNT1_0034_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACGATCATTA*ACCAGAAACGATTNC
BFLT1_0098_E08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0025_A09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTAACCAGAAAACGATTCA
BFLT1_0090_C04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGAATTC
OVR01_0052_A03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0091_E05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0108_E11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0041_G04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0020_B05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0105_H01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0006_F06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACCATCATTA*ACCAGAAACGATTCA
OVRT1_0096_C06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
UTR01_0104_D02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTTC
THY01_0202_A07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0076_H10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0022_C12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0092_G11.b : AGACTG*GNC*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0041_G10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0103_B06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
ITT01_0050_G07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0024_A12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVR01_0018_B08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BMWN1_0041_D06.b : AGACTG*GCA*AAACGT*CA*TT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PTG01_0062_G08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTTGACACATCATTA*ACCAGAAACGATTCA
OVR01_0025_C06.b : AGACTG*GCA*AAACGT*CAATT*GCTATTTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0001_C09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0009_B09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
UTR01_0041_C04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
CBLT1_0075_F04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
HTMT1_0008_G09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PBL01_0051_G05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0076_C10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
AMP01_0057_E02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0043_D08.b : acaaatggcaaaacctccattgctatttgacaccaattcattaaccaaaaacattcaatg
OVRM1_0022_C09.b : gattggcaaacgtcaattgtattgacccatcattaaccgtaacgattcaacgagggactt
TES01_0088_H10.b : AGACTG*GCA*AACCGT*CA*TT*GCTA*TTGACACAATCTTTACCCAAAAAgattccat
OVR01_0073_E01.b : AGACTG*GCA*An
LVRM1_0038_D02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACTATCATTA
OVRM1_0191_E03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACGATCATTA*ACCAGAAACGATTCA
OVRM1_0007_H01.b : AGACTG*GCA*AAACGG*TAATT*GCTA*TTGACACAATCATTAACCCAGAACGGATTCA
OVRT1_0112_C01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
BFLT1_0033_C10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SPL01_0008_F12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0067_H03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0050_A03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0040_D04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
ITT01_0031_F08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0079_C05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAAAAACGATTCA
OVRT1_0139_G06.b : AGACTG*GGC*AAACGT*CATTT*GCTA*TTGACACCATCATTA*ACCAAAAACGAATCN
TES01_0085_A11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0062_E06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0028_F05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0052_E10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTNC
PST01_0047_D03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0032_H10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0017_F10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0091_B11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0051_G01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0027_C06.b : ttaacaaatataaaaaaccattatgtgaaaattaagaaaacaaagccagatatactaata
TES01_0098_A12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCCGAAACGATTCA
SKNB1_0071_B08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0039_B03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0036_D02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0079_H01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0075_E12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0026_B10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PST01_0067_A12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0077_G07.b : ggacccaccgttggaccttaaatttttgttcgcaaccctaccaaatgtggcaaaaaatgt
SKNB1_0016_A07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0085_C04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACANCATCATTA*ACCAGAAACGATTCA
BFLT1_0147_B07.b : AGACTG*GCA*AAACGT*CCAAT*GCTA*TTGACACATTC*TTAACCAAGAAACGATTCA
ADR01_0028_E09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
DCI01_0118_F04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0022_A07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0092_C02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCGGAAACGATTCA
TES01_0088_E02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
LNG01_0042_B08.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0103_D12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0085_H04.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TCH01_0001_D09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
SMG01_0052_B10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0041_H01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
AMP01_0061_G02.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLN01_0070_D09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
KDN01_0063_D06.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0080_H12.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
DCI01_0060_F02.b : ggcttattatttgggccaacccaaaaaatggggaaaaaccctatttgtttttttggccca
PCT01_0004_F11.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0075_F01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0090_B07.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PCT01_0022_H01.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0044_D03.b : AGACTG*GCA*AAACGT*CAATT*GCTG*TTGACACAATCATTA*ACCAGAAACGATTCA
CLNT1_0038_B10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
OVRT1_0146_E09.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0085_F05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
THY01_0109_F12.b : GGATTG*GAA*AAACAT*CAATT*GCTA*TTGACACAATCATTA*ACCATAAACGATTCA
UTR01_0083_H03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLTL1_0036_B10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
PBL01_0096_C03.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0031_B10.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0063_A05.b : AGACTG*GCA*AAACGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
MLN01_0062_D06.b : xxxxxxxxxxxxxxCGT*CAATT*GCTA*TTGACACAATCATTA*ACCAGAAACGATTCA
TES01_0015_B10.b : nnnnttcgctgtggctctggtATCATTA**CCAGAAACGATTCA
TES01_0059_B06.b : nnntttctgctgttgctctggattaccanAACGATTCA
KDN01_0092_G03.b :
MLN01_0055_B02.b : nnnnnggcatggactatnacagtttgta
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
---------+---------+---------+---------+---------+---------+ 859
CBLT1_0007_E04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRM1_0022_D02.b : gatggn
BFLT1_0129_G11.b : TT*GAGGGAA*C*GATGAAAA*AAAAAAGCTGTACTGTACCTATGTT*GCTA*TGGGTCA
PST01_0095_C03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0048_E07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0053_G06.b : AT*GATGGGA*CTGATGAAAG*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0030_G06.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0032_B05.b : TT*GATGGAA*CTGATGAAAA*GAAAAAACTGTACTGTATCTATGTT*GCTA*TTGGCCA
CBLT1_0051_H09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0072_A06.b : aaaaaaaattttggtggttttttttttttttttttgggaaaaaaaaaaacattctgtggt
THY01_0026_F10.b : cactcccgcataccaaatcattagcaattcgcatggacaactacctatgttaatctcccc
OVRM1_0132_G08.b :
OVRM1_0219_G05.b : AT*Gg
THY01_0043_A01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAACTGTAactgtatctatgttgcttattgggca
THY01_0003_D01.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGCACTGGATCTATGgtgcctattggcaaa
OVR01_0022_H03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGCCA
THY01_0002_E02.b : AT*GATGGGA*CTGATGAAAA*GAAAA*GCTGGACTGAATCTAGGTT*GCTA*TTGGTCA
SMG01_0023_D11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGAATCTATGTT*GCTA*TTGGCCA
THY01_0044_C10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGTTGTACTGAATCTATGTT*GCTA*TTGGTCA
SMG01_0093_G08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTACCTATTTT*GCTA*ATGGCCA
SMG01_0007_C10.b : AT*GATGGAA*CTGATGAAAA*GAAAAA*CTGTACTGTATCTATGTT*GCTA*ATGGCCA
TES01_0057_E03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGGTC
LNG01_0045_G11.b : AT*GATGGAA*CTGATGAAAAGAAAAAAGCTGTACTGTATCTATGTT*GCTATTTGGTCA
UTR01_0035_D07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0103_C12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0095_A07.b : AT*GATGGAA*CTGGATGAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0118_F10.b : AT*GATGAAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0086_G09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTC*
OVR01_0062_F06.b : AT*GATGGAA*CTGATGAAA**GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0026_E04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0039_C05.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0115_G03.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0038_C12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0107_H09.b : AT*GATGGAA*CTGATGAAAA*G*AAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0039_B11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0012_H08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0034_D05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0088_C05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PBL01_0101_G07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0020_D04.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CLNT1_0032_G11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0048_F06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRM1_0066_G06.b : tcaccg
THY01_0123_A06.b :
THY01_0040_E09.b : taactcccaatcacaatttcacttgcccaaatcttattcaaaaaaaaaaacctccgtatt
OVRM1_0189_F08.b : gaagg
OVRM1_0010_F04.b : AT*GA
OVRM1_0125_B07.b : AT*GATGGAA*CTGATGAAAA*G
PTG01_0103_B12.b : ATGATCGAAC*CTGATGAAAaagaaaaagctgtactgaacccatcgtgctaattgcccaa
TES01_0087_A12.b : ATGAATGGAC*CTGATGAAAAAAAAAAAGCTGGACTGAATCTATGTT*GCCA*TTGGTCA
PTG01_0072_D03.b : AT*GATGGGA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0080_E11.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TGGGTCA
OVR01_0047_D04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0053_G01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0062_D01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0077_A05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0082_E10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0052_D07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : aggaactgatgaaagaaaagctgtaccgatccaagttgcatggccaaaaaaatccctgtt
OVRM1_0055_A09.b : gatga
OVRM1_0208_B01.b :
OVRM1_0031_E06.b : AT*GATGGAA*CTGATGAACA*GAAAn
THY01_0048_H08.b : AT*GATGGAA*CTGATTAAAA*GAAAAAGCTGTAactgaatctatgttgttattgggcaa
PTG01_0050_A08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CLNT1_0121_H11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0026_G10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0073_F06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0026_F03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0076_G03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0045_E04.b : ccttccagcgaacttaccttaaacaccaaaacaccccctccccctccctcttcttcccct
THY01_0119_C06.b :
SKNB1_0004_F11.b : aagggaactgaaaaaaaaaaaaaaccggtacaggaatcataggtgggaattgggccaaaa
PCT01_0035_H05.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PCT01_0009_E01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0090_E07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PCT01_0004_B05.b : AT*GATGGAAACTGATGAAA***GAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0098_G04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0078_H02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0095_E09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0096_B06.b : AT*GATGGAA*CTGATNGAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : AT*GATGGAA*CTGATG*AAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGGCA
BFLT1_0144_B08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCCA*TTGGTAA
MLTL1_0054_H05.b : AT*GATGGGA*CTGATGnannaaannnnnnnnnnnnnnnnnnnnncttgtcggccgcctc
BKFL1_0007_F04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
DCI01_0042_G08.b : AT*GATGGAAACTGATGAAAG***AAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0004_B05.b : AT*GATGGGA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LVRM1_0107_D12.b :
DCI01_0012_F02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGAATCTATGTT*GCTA*TTGGTTC
OVRT1_0007_B09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0110_E01.b :
OVRM1_0223_F12.b : atcataaaat
OVRM1_0149_F02.b :
OVR01_0072_H10.b : TT*GATGGAA*CCGATGAAAA*GAAAAAACTGTcctggaactatggtgcctatgggtcaa
HTMT1_0125_B06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGT*A
DCI01_0030_H12.b : ggaaccaggttgccatggggcaaaaaaatccccggtttcccccttgggaaaaaactttca
HTMT1_0011_H06.b : ATGGATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CBLT1_0092_F01.b : AT*GATGGAA*CTGATGAAAAGAAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
HTMT1_0097_B02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SPL01_0053_F05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CBLT1_0022_C05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
HTMT1_0113_C02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TGGGTCA
LNG01_0103_E05.b : AT*GATGGAA*CTGATGAAAA*G*AAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTC*
OVR01_0041_F03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0006_E06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0039_E04.b : AT*GATGGAA*CTGATGAAAAGAAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ILNT1_0025_F06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0077_B04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0105_A01.b :
AMP01_0003_B07.b : ttagttacatgtctactcataatccacctggaccggtacacactacttcatattggatta
LVRM1_0187_H06.b :
OVRM1_0056_H10.b : AT*GATGGAA*CTGATGGAAA*GAAAAA*CTGTACTGTATCn
LVRM1_0002_F06.b : NT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGc
PTG01_0034_C07.b : AT*GATGGGA*CTGATGAAAA*AAAAAAACTGTACTGAATCCATGTT*GCTA*TGGGTCA
AMP01_0037_D04.b : ggatgaactgatgaaaaaaaaacctgtcctgttttcttgttgcttttggcaaaaaaaatt
TCH01_0096_A02.b : AT*GGAGGAA*CTGATGAAAA*GAAA*AGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0027_H11.b : AT*GATGGAAtgatgaaaggaaaaaccgtaccggatctaggttgctattggccaaaaaaa
DCI01_0018_F06.b : TT*GATGGAA*CTGAATGAAA*AAAAAAGCTGactgaaacaaggttgccatgggccaaaa
BFLT1_0004_F10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
AMP01_0046_E10.b : AT*GATGGAA*CTGATGAAAA*AAAAAAGCTGTACTGGATCTATGTT*GCTA*TTGAGCA
OVR01_0008_G03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CLNT1_0132_C10.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGT*A
BFLT1_0079_A09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
HTMT1_0015_G05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0095_E09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCN
BMWN1_0021_E04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0027_C01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0016_B01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ADR01_0083_B04.b : AT*GATGGAA*CTGATGAAAA*G*AAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRM1_0039_G11.b :
OVRM1_0028_B01.b : catccatctt
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : aaaaaaaacctgaccgggaccattgtgccattgggcaaaaaaaaaaccctggttccccat
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : ggaaatgaaaaaaaaaaaaaacttttctgttttttttttttatttgggacaaaaaaaaac
SMG01_0068_B01.b : actgaagaaaaaaaaaaaccggaccggatccatgttgccattgggtcaaaaaaaatcccc
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b : AT*GATGGAA*Ctgataaaagcaaaactgtatt
OVRM1_0218_H01.b : AT*GATTGGA*CT
OVRM1_0056_A07.b : AT*GATGGAA*CTG
THY01_0059_C01.b : aattgatgggaacctgatgaaaacaaaaaactcgtactgtatcttttgttgctatttgtc
OVRM1_0087_H02.b : AT*GATGGAA*CTGATG
OVRM1_0206_E07.b : AT*GATGGAA*CTGATG
OVRM1_0067_F12.b : AT*GATGGAA*CTGATGAAAA*G
OVRM1_0037_G07.b : AT*GATGGAA*CTGATGAAAA*GAt
OVRM1_0124_F07.b : TT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTA
OVR01_0099_G02.b : AT*GATGGAAACTGATGAAAA*AAAAaaagctggactggaatctaagttggccattgggc
SMG01_0071_A01.b : AT*GGATGAA*CTGATGAAAAAGAAAAACCTGTACTGTATCCATGTT*GCTT*ATGGGCC
OVRT1_0140_A09.b : AT*GATGGAC*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*ATGGTtc
OVR01_0069_B01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCCA*TTGGTCA
UTR01_0045_B08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTC*GCTA*TTGGTCA
TCH01_0054_C12.b : AT*GATGGGA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0051_D05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0112_G01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LVR01_0105_H12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CLNT1_0140_G07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*ATGGTCA
BFLT1_0010_H12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0042_H11.b : AT*GATGGAAACTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SPL01_0084_C06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0070_E04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SPL01_0041_G01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0028_E01.b : AT*GATGGAA*CTGATGAAAA*AGAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0088_E05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGGCA
CLNT1_0034_F06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0098_E08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0025_A09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0090_C04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0052_A03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0091_E05.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0108_E11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0041_G04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0020_B05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0105_H01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0006_F06.b : AT*GATGGAA*CTGATGAAAA*GACAAAGCTGTACTGTATCTATGTT*GCTA*TCGGTCA
OVRT1_0096_C06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
UTR01_0104_D02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0202_A07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0076_H10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0022_C12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0092_G11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0041_G10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0103_B06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0050_G07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0024_A12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0018_B08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BMWN1_0041_D06.b : AT*GATGGAA*ATGATGAAAA*GAAAAAGCCGTACTGTATCTATGTT*GCTA*TTGGTCA
PTG01_0062_G08.b : AT*GATGGAA*CTGATGAAAA*GA*AAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVR01_0025_C06.b : AT*GATGGAA*CTGATGAAAA*AAAAAAGCTGTACTGTATCTATGTTtgctattgggtca
TES01_0001_C09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0009_B09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
UTR01_0041_C04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CBLT1_0075_F04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
HTMT1_0008_G09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PBL01_0051_G05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0076_C10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
AMP01_0057_E02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*T*GGTCA
THY01_0043_D08.b : aatggaaactgtgaaaaaaaaaaactgtactgtatttctattttgttattggcccaaaaa
OVRM1_0022_C09.b : gagaaaagaaaactttcctgtattatgtcgctataggaagaan
TES01_0088_H10.b : tgatgaacctgagaaaagaaaaaactggactggatctaggtggctattggtcaaagaaat
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b : AT*GATGG
OVRM1_0007_H01.b : AT*GATGGAA*CTTGATGAAA*GGAAAAGCTGTACTGT
OVRT1_0112_C01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
BFLT1_0033_C10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAACTGTACTGTATCTATGTT*GCTA*TTGGTCA
SPL01_0008_F12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0067_H03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0050_A03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
ITT01_0040_D04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATTTATGTT*GCTA*TTGGTCA
ITT01_0031_F08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGGTC
TES01_0079_C05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0139_G06.b : AT*GGAGGAA*CTGAATGAAG*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0085_A11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0062_E06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0028_F05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0052_E10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0047_D03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCN
KDN01_0032_H10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0017_F10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0091_B11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0051_G01.b : AT*GATGGAA*CTGATGAAAA*AAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0027_C06.b : aaagtcctttacctatgaaatccaaagtttcaaaaaattaacacataagaagatctacaa
TES01_0098_A12.b : AT*GATGGGA*CTGATGAAAAGAAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SKNB1_0071_B08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0039_B03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCG
KDN01_0036_D02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0079_H01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0075_E12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0026_B10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PST01_0067_A12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0077_G07.b : aaaattttggtaatttggacacatattttttttactccaaaaaatttttccttttggttg
SKNB1_0016_A07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0085_C04.b : AT*GATGGAA*CTGATGAAAA*G*AAAAGCTGTACTGTATCTATGTTTGCTA*Tggtcaa
BFLT1_0147_B07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TGGGTCA
ADR01_0028_E09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
DCI01_0118_F04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0022_A07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0092_C02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0088_E02.b : AT*GATGGAA*CTGATGAAAA*GAAAAGGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
LNG01_0042_B08.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0103_D12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0085_H04.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TCH01_0001_D09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
SMG01_0052_B10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0041_H01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
AMP01_0061_G02.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0070_D09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0063_D06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0080_H12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
DCI01_0060_F02.b : ccattttttccccacaaaaatatttttngggggggggcgccccgtgggaaaaaaaaaaac
PCT01_0004_F11.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0075_F01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0090_B07.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PCT01_0022_H01.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0044_D03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
CLNT1_0038_B10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
OVRT1_0146_E09.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0085_F05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
THY01_0109_F12.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTTCTGTATCTATGTT*GCTA*TTGGTCA
UTR01_0083_H03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLTL1_0036_B10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
PBL01_0096_C03.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0031_B10.b : TT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0063_A05.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0062_D06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0015_B10.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
TES01_0059_B06.b : AT*GATGGAA*CTGATGAAAA*GAAAAAGCTGTACTGTATCTATGTT*GCTA*TTGGTCA
KDN01_0092_G03.b : nnnnggctgcggtggctctggactgtCTGTATCTATGTT*GCTA*TTGGTCA
MLN01_0055_B02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*TTGGTCA
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
---------+---------+---------+---------+---------+---------+ 912
CBLT1_0007_E04.b : GAG*AGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACGG*AAGCAGA*TGCCA
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : AAA*AAA**ATCCCTGTT*GCCC**AGTTGGTGGAAAAACTTACAA*ATGCAAA*TGCCT
PST01_0095_C03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLN01_0048_E07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0053_G06.b : AAGAGAT**Cactggtgcccagtgggtgagagacttangaagcagatgcctgaggtacac
TES01_0030_G06.b : AAAGAGA**TCCACTGTT*GCCC**CATTGGTGAAGAGACTTACAG*AAGCAGA*TGCCA
TES01_0032_B05.b : AAAAAGA**TCACTGGT**GCCC**AGTTGGTGGAAAAACTTA*AG*AAGCCGA*TGCCA
CBLT1_0051_H09.b : GAAAAGA**TCCACTGTTTGCCC**AGTTGGTGAAGAGACTTTACA*AATCCAA*TGCCA
SMG01_0072_A06.b : gcctcgtggggggaaaaaaattttagggggggggggggcgggggaaaaacccccttggtg
THY01_0026_F10.b : actaatctggcgttacccttcccttcgtcatcttatctttattctctattcgtgatctat
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : aaaaaaacccactgtttgccacattgttggaaaaaactaacaaaggccaatgccctgaaa
THY01_0003_D01.b : aaaaatcactgttggccacgtgggtgaagaacctaccgaatgcaatgccatgaagacccc
OVR01_0022_H03.b : AAtacaatccctgttgcccagctgcggaaaacactaccaatgcccaagccctgaagaacc
THY01_0002_E02.b : AAGAGAT**Cactgttgcccattggtggagagacttacgatgcgaagcctgaagtacaca
SMG01_0023_D11.b : AAAGAGA**TCCACTGTTGCCCA**TTTGGGaaaaaaatttaagatgcaaaaggcatgga
THY01_0044_C10.b : AAAAAAA***CCACTGTTGCCCcattggggaaaaaaacttacagatgcaaatgcccatga
SMG01_0093_G08.b : AAAAAAA**ATCCCTGGT*GCCC**AATTGGTGAAAAAACTTACCG*ATGCcaatcccgt
SMG01_0007_C10.b : AAAAAAA**TCCACTGTT*GCCC**AATTGGTGAAAAAGACTACAG*ATGCAAA*TGCat
TES01_0057_E03.b : AAAGAGA**ATCACTGTT*GCCC**ATTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCC
LNG01_0045_G11.b : AAAAAGA**TCCCCTGTTTGCCC**AGTTGGTGAAGAGACTTACAGAATGCGAA*TGCCT
UTR01_0035_D07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SMG01_0103_C12.b : AAAGAGA**TCCACTGGT*GCCC**AGTTGGTGAAGAGACTTACAA*ATGCAGA*TGCCA
SMG01_0095_A07.b : AAAGAGA**TTCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0118_F10.b : AAAGAGA**TNCACTGTTGGCCA**GTTGGTGGAAGAGACTTACAA*ATGCAGA*TGCCA
OVRT1_0086_G09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0062_F06.b : AA*GAGA**TCCACTGTT*GGCC**AGTTGGTGAAGAGACTTAACG*ATGCAGA*TGCCA
LNG01_0026_E04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SMG01_0039_C05.b : *AAGAGA**TCCACTGGNTGC*C**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0115_G03.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAAGACTACAG*ATGCAGA*TGCCA
PST01_0038_C12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0107_H09.b : GAAGAAG**ATCACTGTTTGC*C**AGTTGGTGGAGAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0039_B11.b : GAAGAGA**TCACTGNNT**GCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0012_H08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0034_D05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0088_C05.b : AAAGAGA**TCCACTGTT*GCTC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PBL01_0101_G07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0020_D04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
CLNT1_0032_G11.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0048_F06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : tttatcatgtttctttttttgtctataaaaaaaataccactagttacctcatctggtgaa
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : aataaattcgatggtgccccgtttgggaaaaagacttacggacgcaaatgccctggaata
TES01_0087_A12.b : AAAAAAA**TCCACTGTTGCCCA**GTTtgttggaaaaaacttacacaatgccaaatgcc
PTG01_0072_D03.b : AAAGAGA**TCCACTGTT*GCCC**AATTGGGTGAAAGACCTACAA*ATGCAGA*TGGCA
SMG01_0080_E11.b : AAAGGAT**CCCACTGTG***CC**CATTGGTGAAGAAGACTACAG*ATGCAGA*TGCCA
OVR01_0047_D04.b : AAAGAGA**TCCACTGTTGCCCA**GNTGGGTGAAGAGACTTACAG*ATGCAGA*TGCCC
KDN01_0053_G01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0062_D01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0077_A05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0082_E10.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAAAAACTTACAG*ATGCAGA*TGCCA
KDN01_0052_D07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : gccattggtaaaaaacatcaatgcaaaccctgaattcaccttggggttccacaaggggct
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b : aaaaatcccctgttgcccatttgg
PTG01_0050_A08.b : AAAGAAA**TCCACTGTT**GCC**CATTTGGGGAAAAACTTTCAA*ATGCAAA*TGCAA
CLNT1_0121_H11.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAAGACTACAG*ATGCAGA*TGCCA
OVRT1_0026_G10.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGTTGAAGAGACTTACAG*ATGCAGA*TGCCC
PST01_0073_F06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0026_F03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLN01_0076_G03.b : AA*GAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0045_E04.b : ctctcccaaccaaaaaccccccctcctcccccccccccgccgaccaccctctcctacccc
THY01_0119_C06.b :
SKNB1_0004_F11.b : aaaatcccctggttgccccatttggtggaaaaaaaatttcactaatgccaaagccctggc
PCT01_0035_H05.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PCT01_0009_E01.b : AAAGAAA**TCCCTGTT**GCCC**AGTTGGTAAAAAAACTTACAA*ATGCCGA*TGCCC
KDN01_0090_E07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PCT01_0004_B05.b : GAAGAGA**TCCACTGNTTNGCC**AGTTG*TGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0098_G04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAAA*TGCCA
PST01_0078_H02.b : AAAGAGA**TCCACTGTT*GCCC**AGCTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0095_E09.b : AAAGAAA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0096_B06.b : AAAGAGA**TCCACTGTT*GCCC**CATTGGTGAgagacttaccgatgcagatgcctgaa
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : AAAAAAA**TCCACTGTT**GCC**CGTTGGTGAAAAAACCTTAAA*ATGCAGA*TGCCA
BFLT1_0144_B08.b : AAAAAAA**TCACTGGTT**GCC**CATTGGGGAAAGAACTTACAG*ATGCCAA*TGCCA
MLTL1_0054_H05.b : cgccttcaaaagccttctagaccatcctttgggcgcgggcccataaggtatgaactggcc
BKFL1_0007_F04.b : AAAAAT***TCCACTGTT*GGCC**AGTTGGTGGAGAGACTTACgaatgcgatgccttgg
DCI01_0042_G08.b : AAAAAGA**T*CACTGTT*GCCC**AGTTGGTGAANAAGACTACAG*ATGCAGA*TGCCA
MLTL1_0004_B05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTTGAAAGACTTACAG*ATGCAGA*TGCCA
LVRM1_0107_D12.b :
DCI01_0012_F02.b : AAAGAGA**TCCACTGGTGCCCAttgggtaaaaaactaccgatgccaatccctggagtac
OVRT1_0007_B09.b : AAAGAGA**TCCACTGTTGCCCA**GTTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : aaaaaatcccctggtggcccccgttggggaagaaacctttccaatgccccatgcccctga
HTMT1_0125_B06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAGGAGACTTACAG*ATGCAGA*TGCCA
DCI01_0030_H12.b : aagccaaccccgggaaaaacccttggggtttccccctgggcccgaagcggccccccttta
HTMT1_0011_H06.b : AAAAAAA**TCCACTGGT*TGCC**AGTTGGTGAAAAAACTTACAG*ATGGCAA*TGCCA
CBLT1_0092_F01.b : AAAAAGA**TCCACCGTT*GCCC**CATTGGGGAAGAGACTTACCG*ATGCCAA*TTCTT
HTMT1_0097_B02.b : AAAAGAA**TCCACTGT**GCCC**AGTTGGTGAAGAGACTTACAA*ATGCAGA*TGCCA
SPL01_0053_F05.b : AA*GAGA**TCCACTGGTGCCCA**ATTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCC
CBLT1_0022_C05.b : GAAAAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*AAGCAAA*TGGCA
HTMT1_0113_C02.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0103_E05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0041_F03.b : AAAAAGA**TCCACTGTT*GCCC**AGTTGGTGAAAAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0006_E06.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0039_E04.b : AAAGAGA**TCCACTTGTTGCCCCAATTGGGTGAAAAAACTTACAG*ATGCAGAATGCCA
ILNT1_0025_F06.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGGAGAGACTTACAA*ATGCAAA*TGCCA
MLN01_0077_B04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0105_A01.b :
AMP01_0003_B07.b : tataaatctcttcttttcccttatttcaagtaaatcaaatttactcttaacatatctctt
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : AAAGAAA**ATCACTGTTGGCCC**ATTGGTGAAAaaactttcagaagcaaaatgcccga
AMP01_0037_D04.b : ccctcgtgcccccttggggaaaaaactttcaaacccaatgcctgaaatcccccattgggg
TCH01_0096_A02.b : AAAGAAA**TCCACTGGTGGCCC**GTTGGGTGAAaaactttcaaatgcaaatcccggaa
MLTL1_0027_H11.b : atccccggttgcccatttggggaaaaaacttcaaatgccaaagcctggaatacccattgt
DCI01_0018_F06.b : aaatatccctgttgcccagttggggaagaaacttacaatgcaaatgccttgaataacccc
BFLT1_0004_F10.b : AAAGAGA**TCCACTGTT*GTCC**AGAGCAAAAANANNACTACAG*ATGCAAA*TGCCA
AMP01_0046_E10.b : AAAGAAAatccccgttgccccgttggggaaaaaaaccttacgaagccaatgcctggaagt
OVR01_0008_G03.b : AAAGAGA**TCCCCTGTT*GCCC**CCTTGGTGAAGAGACT*ACCG*ATGCAGA*TGCCC
CLNT1_0132_C10.b : AAAGAGA**TCCACTGTTNG*CC**AGTTGGGTGAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0079_A09.b : GAAGAGA**TCCACTGTT*GCCC**CAGTGGTGAAGAGACTTACAG*ATGCAAA*TGCCA
HTMT1_0015_G05.b : GAAGAGA**TCCACTGTTNG*CC**AGTTGGTGAAGAAACT*ACAG*ATGCAGA*TGCCA
THY01_0095_E09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BMWN1_0021_E04.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0027_C01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGCTGAGGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0016_B01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ADR01_0083_B04.b : AAAGAGA**TCCACTGTTTGC*C**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : tgggggaaaaaatttccaaaggccaaggcccggaaaaaaccccttgtggttttccacccc
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : cccggggtgcccctttggggaaaaaaactttcagaaggggaagccccggagaaaccccct
SMG01_0068_B01.b : tgttgcccccttgggggaaaaacttacagaatcccaatgccctgaagtaaccccctgggg
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : cataaataaatctattgttatcccaatttggttaatagactttcataatgcaaatgcctt
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : caaaaaaaattccctggttgccccctttgggggaaaaaaccttaccgaatgccaaaatcc
SMG01_0071_A01.b : AAAAAAAatcccctgttgcccaggtgggtgaaaaaacttacggatgcaaaagccctgaaa
OVRT1_0140_A09.b : aaaaaaaatccccggttgcccaattggggaagagaccttacagatgccaatgccatggaa
OVR01_0069_B01.b : AAGGAGA**TCCCTGTTtgcccagttgtgaagaaactttaaaatgccaatgccatgaagt
UTR01_0045_B08.b : AAAGAGA**TCCACTGTTGC
TCH01_0054_C12.b : AAAAAGA**TTCACTGTTGCCCA**GTTTGGTGAagaaaactaccagatgccaaatgccc
THY01_0051_D05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAa
BFLT1_0112_G01.b : GAAGAGA**TCCACTGTTGGCCA**ATTGGTGGAAGAGACTTACAG*ATGCAGA*TGCCA
LVR01_0105_H12.b : AAAGAGA**TCCCCTGTTTGCCC***GTTGGTGAAGAGACTTACAG*ATGCAAA*TGCCA
CLNT1_0140_G07.b : AAAGAGA**TTCACTGTT*TCCC**AGTTGGTGAAGAGACCTTCAG*ATGCAAA*TGCCA
BFLT1_0010_H12.b : AAAGAGA**TCCACTGTTGCCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0042_H11.b : AAAGAGA**TCCACTGTT*GCCC**AGGTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SPL01_0084_C06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTTGAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0070_E04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGGTGAGAGACTTACAG*ATGCAGA*TGCCA
SPL01_0041_G01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SMG01_0028_E01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAAAGACTTACAG*ATGCAGA*TGCCA
OVR01_0088_E05.b : AAAGAGA**TCCACTGTTGCCCA**GTTGGTGAAAAAGACTTACAA*ATGCAGA*TGCCA
CLNT1_0034_F06.b : GAAGAGA**TCCACTGGT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0098_E08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0025_A09.b : AAAAGAGATTCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0090_C04.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0052_A03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCC
ITT01_0091_E05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGAACTACAG*ATGCAGA*TGCCA
BFLT1_0108_E11.b : AAAGAGA**TC*ACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0041_G04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0020_B05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0105_H01.b : AA*GAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0006_F06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGGAAAGACTTACCG*ATGCAGA*TGCCC
OVRT1_0096_C06.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCC
UTR01_0104_D02.b : AAAGAGA**TCCACTGGT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0202_A07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0076_H10.b : AAAGAGA**TCCACTGTT*GCCC**AGTGGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0022_C12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0092_G11.b : *AAGAGA**TCCACTGTTTGCCC**A*TTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0041_G10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0103_B06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0050_G07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0024_A12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0018_B08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BMWN1_0041_D06.b : AAAAAAA**TCCACTGTTTGCC***AATTGGTGAAAAAACTTACAA*ATGCGAA*TGCCT
PTG01_0062_G08.b : AAAGAGA**TC*ACTGTT*GCCC**CATTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVR01_0025_C06.b : aaagagatccactggttgccccaggtggtgaagagacttacagaagcagaatgcccatga
TES01_0001_C09.b : AAAGAAA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0009_B09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
UTR01_0041_C04.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
CBLT1_0075_F04.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGGCA
HTMT1_0008_G09.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PBL01_0051_G05.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0076_C10.b : AA*GAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
AMP01_0057_E02.b : AAAGAGA**TCCACTGTT*GCCC**AGTGGGTGAAGAAGACTACAG*ATGCAGA*TGCCA
THY01_0043_D08.b : aaaaccccccctgttgccccatttggggaaaaaacttccaaatggcaaaatagcgcccaa
OVRM1_0022_C09.b :
TES01_0088_H10.b : tccccggttgcccattgggtgaagggactttccaatccaaatgccctgaaattacaccat
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BFLT1_0033_C10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTTGGGAAAA*ACTTACAG*ATGCAGA*TGCCA
SPL01_0008_F12.b : AAAGAGA**TCCACTGTTTGCCC**AGTTGGTGAAGAGACTTACAG*ATGCAAA*TGCCC
ITT01_0067_H03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0050_A03.b : AAAGAGA**TC*ACTGTT*GCCC**AGTTGGTGAAGAAGACTACAG*ATGCAGA*TGCCA
ITT01_0040_D04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
ITT01_0031_F08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0079_C05.b : AAAGAGA**TTCACTGTTTGCCA**GTTGGTtgaaaagactttacgaatgcgattgccct
OVRT1_0139_G06.b : AAAAGCA**CCACTTGT**GCCC**AGTTGGTGAAaagaacttagaatgcaaatgccatg
TES01_0085_A11.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGGTGAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0062_E06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0028_F05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0052_E10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAAA*TGCCA
PST01_0047_D03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0032_H10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0017_F10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0091_B11.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0051_G01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0027_C06.b : gaaaacaaacaaaaaaattcaatctaaacaatcaaaatctcaaaacaaaaaaaaaatgat
TES01_0098_A12.b : AAAGAAA**TCCACTGTT*GCCC**AGTTGGTGgagaaaccttacaaatgccgaagccat
SKNB1_0071_B08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAAA*TGCCC
KDN01_0039_B03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0036_D02.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0079_H01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0075_E12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0026_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PST01_0067_A12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0077_G07.b : gatacctgtgttataacaaaaaaaaactgcctatcctgggcttctttttgttccatttat
SKNB1_0016_A07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAAAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0085_C04.b : agaagatcactgttgcccagtgggtgagagacttcagatgcagatgcattgagtacacca
BFLT1_0147_B07.b : GAAAAAT**TCCCCTGTTGCCCAatttggggaaaagatttccaaagccaaagccatgaat
ADR01_0028_E09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
DCI01_0118_F04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0022_A07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0092_C02.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0088_E02.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
LNG01_0042_B08.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SMG01_0103_D12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0085_H04.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TCH01_0001_D09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
SMG01_0052_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0041_H01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
AMP01_0061_G02.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLN01_0070_D09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0063_D06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0080_H12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
DCI01_0060_F02.b : acaccccccgccnccgcnnttcntnnnnnnnnnnnnnnnnnnnccgcnctgcttggtggg
PCT01_0004_F11.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0075_F01.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0090_B07.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PCT01_0022_H01.b : GAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0044_D03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
CLNT1_0038_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
OVRT1_0146_E09.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0085_F05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
THY01_0109_F12.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
UTR01_0083_H03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLTL1_0036_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
PBL01_0096_C03.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0031_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0063_A05.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGGCTTACAG*ATGCAGA*TGCCA
MLN01_0062_D06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0015_B10.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
TES01_0059_B06.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
KDN01_0092_G03.b : *AAGAGA**TCCACTGTT*GCCC**ATTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
MLN01_0055_B02.b : AAAGAGA**TCCACTGTT*GCCC**AGTTGGTGAAGAGACTTACAG*ATGCAGA*TGCCA
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
---------+---------+---------+---------+---------+---------+ 969
CBLT1_0007_E04.b : TGGATTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACCTCAGTACC
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : TGAAATACCC*CATTGT*GGGTTtcacctactgccttggaaggcggccccattctatacc
PST01_0095_C03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCA*CTCAGTACC
MLN01_0048_E07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0053_G06.b : catggtgtttcgctacgcgtcggtgctgcccactcagtactggctcttatctggagttca
TES01_0030_G06.b : TGAAGTACAC*CAATGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAATACC
TES01_0032_B05.b : TGAAAGTCAC*CATTGT*GGTTTCAGCTAACTGCTCGGATG*CTGCCCCACTTTAGTACC
CBLT1_0051_H09.b : TGAAATACAC*CATTGT*GGTTTCAACTACTGCGTCTGATG*CTGCCCCACTTCAATACC
SMG01_0072_A06.b : ttgtttccaccggggcgggggaggggccccccccccaaaaaagggggcccttttttttgg
THY01_0026_F10.b : cacaatcgccctgccctcctcatgccactcgaattactcttatcactttatctcacgtct
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : aaaccccattggggtttcaacctccggcgcttggatgctgcccccccttccaaaaccggg
THY01_0003_D01.b : attgg
OVR01_0022_H03.b : ccattgcggttccacctactgcgtctgaatgctccccccccttcatcccccgccctcctt
THY01_0002_E02.b : ttgggtn
SMG01_0023_D11.b : gtaaaccattggggttcaactactgcgtcggagcctgccccaattcagtacctggcttct
THY01_0044_C10.b : aaaaccccatttggggtttccacttactgggtcttaatggtgcccccctttcaaaaccct
SMG01_0093_G08.b : gaataaaccattgggttccaacctacggttcgaaagcggcccactttaaacccggcccct
SMG01_0007_C10.b : gaaatacccaatgtgggtcagctactgcgtctgaagctgccccacttcataactggctcc
TES01_0057_E03.b : TGGAGTACAC*CATTGT*GGTTTC*GCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
LNG01_0045_G11.b : GGAAGTACAC*CATTGT*GGTTTCCGCTACTGCctcctgatgctggcccccctttattac
UTR01_0035_D07.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTC
SMG01_0103_C12.b : TGAAATACCC*CATTG**GGTTTCAGCTACTGCGTCTGAAG*CTG*CCCAATTCAGTACC
SMG01_0095_A07.b : TGAAATACAC*CATTTT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCC*CTTCAATAAC
OVRT1_0118_F10.b : TGAAATACAC*CATTGT*GGTTTCAGCTACTGGGTCTGAAG*CTGCCCCACTTCAGTACC
OVRT1_0086_G09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVR01_0062_F06.b : TGAAGTACAC*CATTGTTGGTTTCAGCTACTGCGTCTGAAG*CTGCCCCACTTCAGTAAC
LNG01_0026_E04.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
SMG01_0039_C05.b : TGAAGTACNA*CAATGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVRT1_0115_G03.b : TGAAATACAC*CATGGG*GGTT*CAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0038_C12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BFLT1_0107_H09.b : TGAAGTACAC*CATTGG*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTCCAGTACC
OVRT1_0039_B11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAATACC
BFLT1_0012_H08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0034_D05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0088_C05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCAC*TCAGTACC
PBL01_0101_G07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTNGCCCACTTCAGTACC
OVR01_0020_D04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
CLNT1_0032_G11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CNTGCCCACTTCAGTACC
ITT01_0048_F06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : caaacacattccccactccaacaacccccctccaacactccacccccatcttcgcgcttt
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : cccccttggggtttcagctaccgcgatcgaaagtggcccaattcaaaaccgggcctctta
TES01_0087_A12.b : ctgaaataacccccattgggggtttccgcctaccgggcgccagaaagctgcccccccttt
PTG01_0072_D03.b : TGAAATACAC*CATTGG*GGTTTCAGCTACTGCGTCTGATG*CGGCCCCATTTCAtactt
SMG01_0080_E11.b : TGAATTACCC*CATTGT*GTTTTCAGCTACGGCGTCTGAAT*GCTGCCCACTTCAGTAAC
OVR01_0047_D04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0053_G01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0062_D01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0077_A05.b : TGAAATACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BFLT1_0082_E10.b : TGAAATAAAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTAAC
KDN01_0052_D07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTTGCCCACTTCAGTACC
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : aaagcgcccactcaaaccgggtcttattggaggttttggaaaaattttggaaagggaaaa
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : TGAAATACCC*CATTGT*GGTTTCAGCTACGGCGTCGGAAG*CTGCCCCcattcataacc
CLNT1_0121_H11.b : TGAAGTACAC*CATTGT*TGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVRT1_0026_G10.b : ATGAGTACAC*CATTGGTGGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0073_F06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCAACTCAGTACC
ITT01_0026_F03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLN01_0076_G03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0045_E04.b : ccacactccccctacaccctctcctctctcctttttctcccccctccccccttcccttct
THY01_0119_C06.b :
SKNB1_0004_F11.b : aaatatcccctatgtggtttttcaacacatggggatcggaaagatggcccaccattttta
PCT01_0035_H05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PCT01_0009_E01.b : TGAAATACAC**ATTGG*GGTTTCAGCTACTGGGTCTGAAT*GTGCCCCACTTTCATACC
KDN01_0090_E07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PCT01_0004_B05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0098_G04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACT*CAATACC
PST01_0078_H02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0095_E09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0096_B06.b : gtacacattgttgtttcagctactgcgtctgaagctgccccattcaatacctgctcctta
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : TGAAGTACCC*CATTGT*GGTTTCAGCCACTGCGTCTGATG*Cgccccccttcaatacct
BFLT1_0144_B08.b : TGAAGTACcaccttggtggtttcagctactgcgtcggaatgctgccccacttcattacct
MLTL1_0054_H05.b : aagctgttccaaggatatctggacagacaaggcttgattcccacaaaaaaaccccggggc
BKFL1_0007_F04.b : agtaacccattggggtttcactactgcgtcggaagcggcccacttccgtactgggctcct
DCI01_0042_G08.b : TGAAGTACAC**ATTGT*GGTTNCAGCTACTGCGTCTGATG*CTGCCC*ACCTCANTACC
MLTL1_0004_B05.b : TGAAGTACA**CAATGG*GGGTTCAGCCACTGCGTCTGATG*CTGCCCCACTTCAtaact
LVRM1_0107_D12.b :
DCI01_0012_F02.b : accatgggggttcagctacggcgtcggagctgcccccatcaatactggcccccttttcgg
OVRT1_0007_B09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCANTACC
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : aagtaccccccttttggggtttcccctactggcgtctgaaggccggccccccctttcagt
HTMT1_0125_B06.b : TGAAGTACAC*CATGTT*GG*TTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
DCI01_0030_H12.b : aaaccgggccctttcttggaggttcctgggggaaaatttttgggaaaagggcaaaacggc
HTMT1_0011_H06.b : TGAATTCCAC*CATgtggttttcactactgcgtctgagctgccccacttcataacgggct
CBLT1_0092_F01.b : TGAAGTACAC*CATTGTTGGTTTCAGCCACTGCTTCTGAAG*CTGCCCCACTTCAATACC
HTMT1_0097_B02.b : TGAAGTACAC**ATTGT*GGTTTCAACTACGGCGTCTGAAG*CTGCCCCACT*CAATACC
SPL01_0053_F05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTC*GTACC
CBLT1_0022_C05.b : TGAAATAC*C*CATTGT*GGTTTCAGCTACTGCNTCTGATG*CTGCCCCACTTCATTACC
HTMT1_0113_C02.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCCGATG*CTGCCCCACTTCAGTAAC
LNG01_0103_E05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACT*CAGTACC
OVR01_0041_F03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGAACC
OVRT1_0006_E06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTCCAGTACC
OVR01_0039_E04.b : TGAAGTACAC*CTTTGT*GGTTTCAGCTACTGCTTCTGATGCTGGCCCCACTTCATTACC
ILNT1_0025_F06.b : TGAAGTACAC*CATTGT*GGTTTCAACTAATGGGTCTGAAGGCTGCCCAACTTCAAAAAC
MLN01_0077_B04.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCCACTCAGTACC
THY01_0105_A01.b :
AMP01_0003_B07.b : ctctctttcttcatctctacttctcttccttgaattaccatttttacaatatttaccact
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : agaacacccttgggggtttcaactactgcgtccgaagggtggcccccctttcaaacctgg
AMP01_0037_D04.b : tttccgctaagggggtggagccgccccccattcgaaaccgggttcctttttcggggggtt
TCH01_0096_A02.b : tacaccttggggtttcaccactgcgtctgatgctgccccacttcagtacctggccccttt
MLTL1_0027_H11.b : gggtttccctacgggtcggaagcgcccccatttcaaaccggggtccttttcgggatgtct
DCI01_0018_F06.b : ttgggttcaccctcggcgccagaggcgccccatttaacccgggccctttttcgggatgtc
BFLT1_0004_F10.b : TGAAGT
AMP01_0046_E10.b : accccgttgggggttcaagcacggggtctgaagccgcccccctttcagacccggcttcct
OVR01_0008_G03.b : TGAAGTACCC*CATTtgtggttccccctactgcctctgatgccgccccccttccctacct
CLNT1_0132_C10.b : TGAAGTACAA*CCATGT*TGGTTCAGCTACTGCGTCGGATG*CTGCCCCACCTCAGatac
BFLT1_0079_A09.b : TGGAAAACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACCTCAATAAC
HTMT1_0015_G05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0095_E09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAATACC
BMWN1_0021_E04.b : TGAAAGTACA*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTCCAGTACC
LNG01_0027_C01.b : TGAAGTACAC*CATTGT*GAGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
LNG01_0016_B01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ADR01_0083_B04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCAACTTCAGTACC
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : gggctggaagggccccccttttaaaaacggggcccttttttgggaggtttttgggggaaa
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : tgggggtttccccacgggggggaaaagggccccccctttaaaaacgggggccttttttgg
SMG01_0068_B01.b : tttcacctaacgggctcggaaggtgccccacttcattaccggggccccttttttggaagg
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : tgaattaatcctttgtggttttcacttctgccgttctaatcttgcccccttttcattctt
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : catggaattccccccattttggggtttccacccacctgggcgttcggaaaggctggcccc
SMG01_0071_A01.b : tacaccatttggggttccacctacggggttcgaaagctgccccctttcaaaaccgggtcc
OVRT1_0140_A09.b : gtacccccttggtggtttcacctacggcgtcggaatgctgccccatttcaatcccggcct
OVR01_0069_B01.b : accccaatggggttttagccactggcgtctgaaggctgccccatttcagtaccgggcttc
UTR01_0045_B08.b :
TCH01_0054_C12.b : atgaaagtacacccattgtggggtttccaactaactgcgttctgaaatgctgccccccct
THY01_0051_D05.b :
BFLT1_0112_G01.b : TGAAGTACAC*CATTGgtgttttcaaccactgccgtcggatgctgccccacttcattacc
LVR01_0105_H12.b : TGAAGTACACCCATTGT*GGTTTCAGCTACCGCGTCTGAAG*CTGCCCCcccttcattaa
CLNT1_0140_G07.b : TGAAGTACAC*CATTGT*GGTTTTCACCACTGCGTCTGAAG*CTGCCCCACTTCAATACC
BFLT1_0010_H12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCGGATG*CTGCCCCACTTTAGAACC
OVR01_0042_H11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
SPL01_0084_C06.b : TGAAGTACAC*CATTGG*GGTTCCAGCTACTGCGTCTGATG*CTGCCCCACTTCCGTACC
ITT01_0070_E04.b : TGAAGTACCA*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCC*ACTTCAGTACC
SPL01_0041_G01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGAACT
SMG01_0028_E01.b : TGAAGTACAC*CATTGG*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCCATTTCGTACC
OVR01_0088_E05.b : TGGAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTTAGTACC
CLNT1_0034_F06.b : TGAAGTACAC*CATTGT*GGNTTCAGCTACTGCGTCTGATG*CTNGCCCACTTTAGTACC
BFLT1_0098_E08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVR01_0025_A09.b : TGAAGTACAC*CATTGTGGGTTTCAGCTACTGCGTCTGAAG*CTGCCCCACTTCAGTACC
BFLT1_0090_C04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTAAC
OVR01_0052_A03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0091_E05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BFLT1_0108_E11.b : TGAAATACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAATAAC
ITT01_0041_G04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0020_B05.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
LNG01_0105_H01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVR01_0006_F06.b : TGAAGTACCC*CATTGT*GGTTTCCGCTACGGCGTCTGATG*CTTGCCCCCTTCCGTACC
OVRT1_0096_C06.b : ATGAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
UTR01_0104_D02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACNTCAGTACC
THY01_0202_A07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0076_H10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0022_C12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0092_G11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAATACC
ITT01_0041_G10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0103_B06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTNGCCCCACTCAGTACC
ITT01_0050_G07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0024_A12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVR01_0018_B08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BMWN1_0041_D06.b : GGAAGTACAC*CTTGTT*GGTTTCACCTAacgggtccgaaggccgcccccctttaatacc
PTG01_0062_G08.b : TTGAATACAC*CATTGT*GGTTCCA*CTACTGCGTCTGAAG*CTGCCCCAttcaataact
OVR01_0025_C06.b : aagaaacccatttgtggttttcagcttactggcgtctgaagctgccccactttagaacct
TES01_0001_C09.b : TGAAATACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTACCCCACTTCAGTACC
TES01_0009_B09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
UTR01_0041_C04.b : TGAAGT
CBLT1_0075_F04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
HTMT1_0008_G09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PBL01_0051_G05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
LNG01_0076_C10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
AMP01_0057_E02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCCACTCAGTACC
THY01_0043_D08.b : aaaaaaccccatctgggggttttcccccaacctgctcttaatctgcccccccctctcaaa
OVRM1_0022_C09.b :
TES01_0088_H10.b : tggggttttacccacgggggttggaagcttccccccttttaaaacctgggtcccttattc
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : TGGAGTACAC*CATTGGTGGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BFLT1_0033_C10.b : TGAAATACAC*CATTGG*GGGTTCAGCTACTGCGTCTGAAG*CTGCCCCACTTCATTACT
SPL01_0008_F12.b : TGAAGTACAC*CATTGT*GGTTTCACCTACTGCGTCTGATG*CTGCCCCACTTCAATACC
ITT01_0067_H03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTAAC
OVRT1_0050_A03.b : TGAAGTACAC*CATTGT*GGTTNCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0040_D04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
ITT01_0031_F08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0079_C05.b : gaataaccccattgtggtttcagctactgcctctgaagctgccccactttcagaacttgg
OVRT1_0139_G06.b : aataacccctttggggttttaccacgggctccagaagctgccccccttaataccgggccc
TES01_0085_A11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTtcatacc
KDN01_0062_E06.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0028_F05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0052_E10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACT*CAGTACC
PST01_0047_D03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCGGTACC
KDN01_0032_H10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0017_F10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0091_B11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0051_G01.b : TGAAATACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCATAACC
KDN01_0027_C06.b : ctgtcatcgaaatattaccttacaaataggaaaataacatctaaaaaacaataaattaaa
TES01_0098_A12.b : gaaagtaccccatggtggtttcaactaatggcgtctgaagctggccccatttcataactg
SKNB1_0071_B08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0039_B03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*NCTGCCCACTTCAGTACC
KDN01_0036_D02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0079_H01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0075_E12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0026_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PST01_0067_A12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0077_G07.b : ggccaaaaaaaaaaacccccctgttgcccccccatgtgtggaaaaaaaaatttttcaaat
SKNB1_0016_A07.b : TGAAGTACACCCATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACCTCAGTACC
MLTL1_0085_C04.b : tgtggttcagctactgcgtcgatgctgcccacttcagtactgcctcctattctggagttc
BFLT1_0147_B07.b : tacaccatttgggtttcacccaccgggtcggaagcctccccaattaattaaccgggccct
ADR01_0028_E09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCC*ACTTCAGTACC
DCI01_0118_F04.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0022_A07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0092_C02.b : TGAAGTACAC*CATTGT*GGGTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0088_E02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
LNG01_0042_B08.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
SMG01_0103_D12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0085_H04.b : TGAAATACAC*CATTGT*GTTTTCAGCTACTGCGTCTGATG*CTTGCCCACTTCAATACC
TCH01_0001_D09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
SMG01_0052_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0041_H01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
AMP01_0061_G02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLN01_0070_D09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0063_D06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0080_H12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
DCI01_0060_F02.b : gatctac
PCT01_0004_F11.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0075_F01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0090_B07.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PCT01_0022_H01.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0044_D03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
CLNT1_0038_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
OVRT1_0146_E09.b : TGAAGTACAC*CATTGT*GGTTTCAGCTGCTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0085_F05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACCGCGTCTGATG*CTGCCCCACTTCAGTACC
THY01_0109_F12.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCACTACC
UTR01_0083_H03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLTL1_0036_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
PBL01_0096_C03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0031_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0063_A05.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLN01_0062_D06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0015_B10.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
TES01_0059_B06.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
KDN01_0092_G03.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
MLN01_0055_B02.b : TGAAGTACAC*CATTGT*GGTTTCAGCTACTGCGTCTGATG*CTGCCCCACTTCAGTACC
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
---------+---------+---------+---------+---------+---------+ 1025
CBLT1_0007_E04.b : *TGGCTCTTTA*TTCTGGATGTTCTAGGGG*AGAATATTTT*AGGaaatgggcaaaatgc
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : gggcccctttttcggaagttttaggggaaaattttttggggaaatggaaaaatggcttgg
PST01_0095_C03.b : *TGGCTC*CTA*TTCTGNATGTTCTATGGG*AAAATATTTA*GGGATA**TG*GCAACAT
MLN01_0048_E07.b : *TGGCTCCTTA*TTCTGGATGTCCTATGGGGAGATTATTTA*AGGATAATGG*CAAACAT
MLTL1_0053_G06.b : atggaaaaatttaaggaaaggcaactgctttgtctcttgaaattatcaaccggtgtgctt
TES01_0030_G06.b : *TGGCTCTTAA*TTCGGGATGGTCCATGGGAAATTATTTTA*AGGAAAAGGG*AAAACAT
TES01_0032_B05.b : cgggtcccttattcgggaggttcatggggaaaaatttttgggaaaatggaaaaatgcttt
CBLT1_0051_H09.b : ggctccctattctggagttctatggaaaaatatttagggaaaaggcaaaaagccttgatc
SMG01_0072_A06.b : gggtggttggggggggagaaaattttttttggggggggggcgggcccttttttttttttc
THY01_0026_F10.b : aatctatgaactctattcgacacctcacccctctcctccctcttcttagctcacaaccgc
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : ctcccttttttttgaatgttttatggggaaaaatattttttaggaaaaatgggcaaaaat
THY01_0003_D01.b :
OVR01_0022_H03.b : attctcgaagcccccctcgccaacactttacgggaacatcccaaaaccgcccctccatcc
THY01_0002_E02.b :
SMG01_0023_D11.b : tattcgggaagttctagggggaaaattttagggaaaatggcaaacaggctttgaatcctc
THY01_0044_C10.b : gggctcctttattttggaaatgttcattggggaaaaattttttaaggggaaaatggggaa
SMG01_0093_G08.b : tatctggaagtcctagggaaaaaatttttgggaaaagggcaaattgctttgaccctcaaa
SMG01_0007_C10.b : taatctggatgtccaatggaaaaaattttagggaaagggcaaaatgctttgatctttttg
TES01_0057_E03.b : *TGGCTTCTTA*TTCggaagttctagggaaaaaattttaggaaatggcaaccagccttga
LNG01_0045_G11.b : ctggcttcccttttccgggagttccatgggaaaaattttttagggaaaagggcaaaaatg
UTR01_0035_D07.b :
SMG01_0103_C12.b : *TGGCTCCTTA*Tctggaagtccagggaaaaaattttaaggaaatggcaaactgcttgaa
SMG01_0095_A07.b : *TGGCTCCTTA*TTCtggaggtctatgggaagaaatttttaggataatggcaacatggct
OVRT1_0118_F10.b : *TGGCCCCTTTATTTGGGATGTTCTAgggaaaaaattttaagggaaattgcgcaacaagc
OVRT1_0086_G09.b : *TGGCTCCTTA**TCTGAATGTTCCATGGGAGAtattttagggataatggccaacctgct
OVR01_0062_F06.b : *TGCCTCCTTA*TTCTGGAAGTTCTATGGAAGAATATTTTAGGGgattaaggcaaaccat
LNG01_0026_E04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAAAATAATTTAGGGATAATGGG*CAAacat
SMG01_0039_C05.b : *TGCCTCCTTA*ATCTGGATTGTCTATGGAAAATAATTTAA**GGAAAATGC*CAAAATG
OVRT1_0115_G03.b : *TGGCTCCTTA*ATCTGAATGTTCTATGGGAAAAATTTTTT*AGGAAATATG*CAAACAT
PST01_0038_C12.b : *TGGCTCCTTA*TTCTGGATGNTCTATGGGAGAATATTTTA*GGGATAATGG*GCAACAT
BFLT1_0107_H09.b : *TGGCTCCTAA*TTCTGGAATGTCTATGGGAAAATATTTTA*AGAATAATGC*CAA*CAT
OVRT1_0039_B11.b : *TGGCTCCTTA*ATCTGGATGTTCTATGGGAAAATATTTTA**GGAATAAGG*CAAACAT
BFLT1_0012_H08.b : *TGGCTCTTTA*TTCTG*ATGTTCTATGGAAGAATTTTTTA*GGGATAAGGG*CAAAACT
THY01_0034_D05.b : *TGGCTCCTTAATTCTGGATGTTCTATGGGAGAATATTTTTAGGGATAATGG*CAAACAT
THY01_0088_C05.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTAGGGAATAATGG*CAAACAT
PBL01_0101_G07.b : *TGGCTCCTTA*TTCTGGAATGTCTATGGGAGAATATTTTT*AGGATAATGG*NCAACAT
OVR01_0020_D04.b : *TGGCTCCTAA*TTCTGGATGGTCTATGGGAAGAATATTTTAGGGATGATGC*CAAACAT
CLNT1_0032_G11.b : *TGGCTCCTTA*ATCTGGATGTTC*ATGGGAAGATATTTTA*GGAATAATGG*CAAACAT
ITT01_0048_F06.b : *TGGCTCCTTN*ATCTGGNATGTCTATGGGAGAATATTTTA*NGGNATATGG*CAA*CAT
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : ctcacatatcgccgtcttcagtcttttcccccatccccagaacatatgggctccctttat
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : ttccgaatgttgcaaggcaaaaatttttggggaaaagggcaaattgcttttggtccttat
TES01_0087_A12.b : taaaaaccgggccccctttatttcgggaaggtttctaggggaaaaaaatttttttagggg
PTG01_0072_D03.b : ggtccctaatcgggaagttctatggaaaaatatttagggataaggccaaactgccttgat
SMG01_0080_E11.b : *TGGCTCCTTA*TTCggaagttcaatgggaaaaaatttagggaaatggcaaaatgctttg
OVR01_0047_D04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAAAATATTTTA*GGGATAATGG*GAAACAT
KDN01_0053_G01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
PST01_0062_D01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA**GGGATATGG*CAAACAT
ITT01_0077_A05.b : *TGGCTCCCTT*ATCTTGGATGTCTATGGGAGAATATTTA**GGNATTATGG*CAAACAT
BFLT1_0082_E10.b : *CGGCTCCCTT*ATCTGGAAGTTCCATGGGGAAATTATTTTAGGGATAATGG*GCAAAAT
KDN01_0052_D07.b : *TGGCTCCCTA*TTCTGGATGTTCTATGGAAGAATATTTTA*GGGATAAAGG*CAAAAAT
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : ggcttgtcttcctaagatttcaaaggggttgtttatcaaaatttcggtccccacccccgc
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : ggggtcccttatccggaaagtccttggggaaaaatttttagggaaaatggcaaaatgcct
CLNT1_0121_H11.b : *TGCCTCTTTA**TCTGGATGTTCTATGGAAGAAAATTTagggaaatggcaacatgcctt
OVRT1_0026_G10.b : *TGGCTCCTTA*ATCTGGATGTTCTATGGGAGGATAATTTAAGAAATATGGC*AAGCAGT
PST01_0073_F06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
ITT01_0026_F03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGAATATGG*CAAACAT
MLN01_0076_G03.b : *TGGCTCCTTA*ATCTGGNATGTCTATGGGGAGATATTTTTAGGGAT*ATGG*CAAACAT
THY01_0045_E04.b : tccccccccatccctctcccccgttcccccctacccccctctctcctcccacccacaaca
THY01_0119_C06.b :
SKNB1_0004_F11.b : tataaccggggtccttatactccgggatttcctatggaagaaaaaaattttttaggcgaa
PCT01_0035_H05.b : ctggctctttattctgatgttctatgggagatatttttaggaaatggcaacatggcttga
PCT01_0009_E01.b : *CGGCTCCTTA*ATCTGGAAGTTCTATGGGAaaaatattttaggaaaaagggaaaaatgc
KDN01_0090_E07.b : *TGGCTCCTTA*TTTCTGGATGTCTATGGNAGAATATTTTA*GGGATAATGG*GCAACAT
PCT01_0004_B05.b : *TGGCTCCCTT*ATCTGNATGNTCTATGGGAGAAATATTTA*GGGATAATGG*CAAACAT
PST01_0098_G04.b : *TGCCTCCTTA*TTCGGGATGTTCTATGGGAAAATATTTTA*GGGACAATGG*CAAAAAT
PST01_0078_H02.b : *TGGCTCCTTA*TTCTGGATGTCCTATGGGAGAATATTTAA**GGATAATGG*CAAACAT
PST01_0095_E09.b : *TGGCTCCCTT*ATCTGGATGNTCTATGGGAGAATATTTTA*NGGATAATGG*GCAACAT
TES01_0096_B06.b : atcggaagttcttggaaaataatttagggaaatggcaaacagccttgatcccccaggaag
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : gggctccttatttggaaggttctatgggaaaatatttaagggaaaagggcaaactgcttt
BFLT1_0144_B08.b : ggctcctttttccgggagtttctatgggaagaaaattttaggggataagggcaaacatgc
MLTL1_0054_H05.b : aaccaagtttgaaaaatccgaggattctaagtctttgggttttccaaggaacccaccagc
BKFL1_0007_F04.b : aatccggagttctatggaaaaaatttagggaaagggcaacatgctttgttttcatggagg
DCI01_0042_G08.b : *TGGCTCCTattccggatgntctaggggaaaatattttagggaaatggcaaactggcttt
MLTL1_0004_B05.b : ggctcctattccgggaggtcaagggaaaaaattttaggaaaatgggaacttgccttgatc
LVRM1_0107_D12.b :
DCI01_0012_F02.b : gatgtccagggaaaatatttaggaaaatggcaactgcttggatatcttgatgactatcca
OVRT1_0007_B09.b : *TGGCTTCTTT*ATCTGGAATGTCTATGGGAAGAAATTTTA*GGGATAATGG*CAAACAT
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : aacccggccccccttaatcccggaatggttccatggggagaaaatttttttaggggaaaa
HTMT1_0125_B06.b : *TGGCTCCT*A*TTCTGGATG*TCTATGGGAGAATATTTagggatatggncaacatgctt
DCI01_0030_H12.b : tttttttccctaagaaacttcccaaaggggggtgtttttcccaaaaaatttttggtttcc
HTMT1_0011_H06.b : cctttatctggaaagttcaaggggaaaatattttagggaaaatggcaaaaaggctttgaa
CBLT1_0092_F01.b : *TGGCTCCCTT*ATtttggagtttccagggaagaattttttatggattagtggcaacttt
HTMT1_0097_B02.b : *TGGCTCCTTA*Tctggatgtctatgggaaaaatttaaggaataaggcaaacagctttga
SPL01_0053_F05.b : *TGCCTCCTtattcggaagttctaggggagaaattttaggataatggcaacagggcttga
CBLT1_0022_C05.b : *GGGCTCCT*A*TTCCGGATGTTCTATGGGAAAATTTTTAA*GGGATAATGG*CAAACAG
HTMT1_0113_C02.b : *TGGCTCCCTA*TTCTGGAATGTCTATGGAAAAAATTTT***AGGAATAATG*GCAACAT
LNG01_0103_E05.b : *TGGCTCTTTA*ATCTGGATGTTCTAGGGGAAAATTTTTA**GGGATAATGG*CAAcatg
OVR01_0041_F03.b : *TGGTTCCTAA*TTCTGGATGTTCTATGGGAAAAAATTTTA*AGGATAATGG*CAAAAAT
OVRT1_0006_E06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGATATTTT***AGGGATATGG*CAAACAT
OVR01_0039_E04.b : *TGGCTCCTTA*TTCTGGATGGTTCATGGGAAAATATTTA**GGGAAAATGG*CAAACAT
ILNT1_0025_F06.b : *TGGCTCCTTA*TTCTGGAAGTTCTAGGGGAAAAAAATTTTAGGAAAAATGG*AAAAATG
MLN01_0077_B04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGNAGAAATATTTTAGGGATAATGGGCAAACAT
THY01_0105_A01.b :
AMP01_0003_B07.b : atacgttttcctcattctgattatattcttactattactccatctactcttacatgaaca
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : gtccttattttggaggttttttgggagaaaattttttgggaaaaggggaaaacagccttt
AMP01_0037_D04.b : ccagggaaaaatttttgggggaaaggccacacggctttgatccccatgaggccttcccca
TCH01_0096_A02.b : tctggattgtctttgggaaaatatttttaggataagggcaaaatgggttggtttactttg
MLTL1_0027_H11.b : ttggggaaaattttaggggaaaggcaaaacggtttgattcttctgaagacttacccaacg
DCI01_0018_F06.b : aggggaaaatttttagggaaatggcaaactgctttgatccctttgatacttttcaaaagg
BFLT1_0004_F10.b :
AMP01_0046_E10.b : tatttgggatgttccagggggaaaaatttttaagggaaaagggccaacgtgcctttaatc
OVR01_0008_G03.b : gcctcccttatcctggatgttcctatggaaaatatttttagggataatgggcaacctttc
CLNT1_0132_C10.b : tggcctctttatttgggaagttcatgggaaaaattttaagaatatggcaaacctgctttg
BFLT1_0079_A09.b : *TGGGCTCCTT*ATCTGGATGGTCTAatggaaaaaattttaggaaaaatgccaaaaatgc
HTMT1_0015_G05.b : *TGGCTCCTTTATTCTGGATGTTCTATGGGAAAATTATTTTAGGGATAATGG*CAAACAT
THY01_0095_E09.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAAAAATATTTaggggataatggcaaacatg
BMWN1_0021_E04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGAAAATGG*CAACATG
LNG01_0027_C01.b : *TGGCTCCTTT*ATCTGGATGTTCTATGGGAGAATATTTTTAGGCATAATGG*CAAACAT
LNG01_0016_B01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
ADR01_0083_B04.b : *TGGCTCCTTT*ATCTGGATGTTCTATGGAAGGATATTTTA*GGGATAATGG*CAAACAT
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : aaatttttggggaaaggggaaacgggtttgttctcccttaaaaagatttcccccaaaggg
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : gggggtttttggggaaaatttttggggaaagggggaaaaagtgtttttttcctcagggaa
SMG01_0068_B01.b : ttttttggaaaaaattttatgggaaatgggcaaaaagcttttttttcctttgaaaacctt
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : ggcttcctttttctggaagttttattggtgaaaattttttcagggattaaatgtccaaaa
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : ccccttttcagtaaccctggggccccctttatttccgggaagggttctctatgggggaaa
SMG01_0071_A01.b : cttattcgggaggtttaggggaaaaaattttaggggaaaagggcaaaatggtttggatct
OVRT1_0140_A09.b : ccttttctggagtttcaggggaaaaattttaggggaaatgggaaactggtttgttcttct
OVR01_0069_B01.b : ctaattcgggaggttccaagggaaaaaaattttagggataaatggcaaaactggctttga
UTR01_0045_B08.b :
TCH01_0054_C12.b : ttcaattacctgggcctcctttatttctgggaatgttccttagggggaagaaaatatttt
THY01_0051_D05.b :
BFLT1_0112_G01.b : ggcctccctatttcggaaggttctatgggaaaaaattttagggatatggcaaaaaaggct
LVR01_0105_H12.b : ctggcttccttattctgggaggttttatggggaaaatattttttggggaaaaggggcaaa
CLNT1_0140_G07.b : *TGGCTCCTTA*TTCgaaagttccaggaaaaaattttagggaaaaggcaaacaggcttta
BFLT1_0010_H12.b : *TGGCTCTTTA*Tctggatggtctaggggaaaaaaatttagggaaaatggcaaaatgctt
OVR01_0042_H11.b : TGGGCTCCTTA*TTCTGGAGGTTCTATGGGAaaaatattttaagggataagggcaaacat
SPL01_0084_C06.b : *TGGCTCCTTA*TTCTGGAAGGTCTATTGGAGAATATTTTAagggataatgggcaaaaat
ITT01_0070_E04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGAGAATATTTTAA**GGATTATGG*CAAA*AT
SPL01_0041_G01.b : TGGGCTCCTTA*TTCTGGATGTCCTATGGGAAAATATTTTAGGGAataatggaaaaaatg
SMG01_0028_E01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAAAATATTTTT*AGGATAATGG*CAAACAG
OVR01_0088_E05.b : *TGGCTCCCTA*TTCCGGAAGTTCTATGGGAAAAAA*TTTA*AGGAAAAGGG*CAAACAT
CLNT1_0034_F06.b : *TGGCTCCTAA*TTCTGGATGTTCTATGGGAGATATTTTA**GGAATAATGG*CAAACAT
BFLT1_0098_E08.b : *TGGCTCCTTA*TTCTGAATGTTCTATGGAAGAATATTTAA***GGATATGG*CAAACAT
OVR01_0025_A09.b : TGGGCTCCTTA*TTCGGGATGGTCTATGGGAGAAAATTTTA*GGGATAATGG*CAAAatt
BFLT1_0090_C04.b : *TGGCTCCCTT*ATCTGGATGTTCTATGGA*AAAATATTTA*GGGATAATGG*CAA*CAT
OVR01_0052_A03.b : *TGGCTCCTTA*ATCTGGATGTTCTATGGGGAAATATTTTAGGGGAAATGGG*CAACAGG
ITT01_0091_E05.b : *TGCCTCCTTA**TCTGGATGGTCTATGGGAGGATATTTTA*GGGNATATGG*CAAACAT
BFLT1_0108_E11.b : *TGGCTC*TTA*ATCCGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAA*CAT
ITT01_0041_G04.b : *TGCCTCCTTA*TTCTGGAATGTCTATGGGAGAATATTTTA***GGGATATG*GCAACAT
ITT01_0020_B05.b : *TGGCTCCTAT*TCCTGGATG*TCTATGGGAGAATATTTA**GGGATAATG***CAACAT
LNG01_0105_H01.b : *TGGCTCCNTA*TTCTGGATGGTCTATGGGAGAATATTTTA**GGGATAATG*CAAACAT
OVR01_0006_F06.b : CTGCCTCCTTA*TTCTGGATGTTCTATGGGAAAATATTTAA*GGGAAAATGG*CAAACAT
OVRT1_0096_C06.b : *TGGCTCCTTT*ATCTGGATGTTCTATGGGAGAATATTT***AGGGATATGG*CAAACAT
UTR01_0104_D02.b : *TGGCCTCTTA*TTCTGAATGNTCTATGGGAGAATATTTTA*GGGATAATGG*CAAAC*T
THY01_0202_A07.b : *TGGCTCCTTT*ATCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CCAACAT
ITT01_0076_H10.b : *TGGCTCCTTA**TCTGGATGGTCTATGGGAGAATATTTTA**GGGATAATG*CAAACAT
ITT01_0022_C12.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTT*AGGATAATGG*CAAACAT
ITT01_0092_G11.b : *TGGCTCCCTT*ATCCGGATGTTCTATGGGAAAATATTTTA**GGAAAAAGG*CAAACAT
ITT01_0041_G10.b : *TGGCTCCTTATTTCTGGATG*TCTATGGGAGATATTTTA***GGNATAATG*GCAACAT
ITT01_0103_B06.b : *TGGCTCCCTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
ITT01_0050_G07.b : *TGGCTCCTTT*ATCTGGATGTTCTATGGNAGAATATTTAN**GGNATAATG*GCAACAT
ITT01_0024_A12.b : *TGGCTCCNTT*ATCTGGATGNTCTATGGGGAGAATATTTANGGNATNNATG*GCAACAT
OVR01_0018_B08.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
BMWN1_0041_D06.b : cgggcctcctatttcgggaatttttatgggaaaaaatttttaggaaaaagggcaaacagc
PTG01_0062_G08.b : ggttccttatccggaagttcatggggaaaaattttagggaaaaaggaaacatgctttgac
OVR01_0025_C06.b : ggactccttattctggatttttttatgggaaaaaatttttagggaaaatgggaaaaatgc
TES01_0001_C09.b : *TGGCTCCTTATTCTGGGATGTTCTATGGGAagaatattttagggaataatggcaaagca
TES01_0009_B09.b : *TGGCTCCTTA*ATCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
UTR01_0041_C04.b :
CBLT1_0075_F04.b : *TGGCTCCT*A*TTCTGGATGTTCTATGGGAGAATATTTAgggataatgcaaacatgctt
HTMT1_0008_G09.b : *TGGCTC*TTA*TTCTGGATGTTCTATGGGAAAAATTTTTA**GGGATATGG*CAAACAT
PBL01_0051_G05.b : *TGGCTCCTTNNATCTGGATG*TCTATGGGAGAATATTTTA**GGNATAATG*GCAACAT
LNG01_0076_C10.b : *TGGCTCCTTTTATCTGGATG*TCTATGGGAGAATATTTTA*GGGATAATGG*CAANCAT
AMP01_0057_E02.b : *TGCCTCCTTA*TTCTGGATGNTCTATGGGAGAATATTTTAAGGGATAATGG*CAAACAT
THY01_0043_D08.b : cctgggttccttattctgagagttttaaggaaaaaaattttcaggaaaaacgggaaaaaa
OVRM1_0022_C09.b :
TES01_0088_H10.b : gggaatgttcttggggaaaaatttttttggggaaaatggggaaaagggcctttgaacccc
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : ggctcccttatccggatgttccatggggaaaaatttttagggaaaagggcaacatgcttt
BFLT1_0033_C10.b : *GGGCTCCTAA*TTC*GGAAGTTCCATGGGAAAATATTTTAGGGAaaaggcaaaaatgcc
SPL01_0008_F12.b : TGGCTTCCTTA*TTCTGGATGTTCTATGGGAAAATATTTTAagggataatggcaa
ITT01_0067_H03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*AGGATAATGG*CAAACAT
OVRT1_0050_A03.b : *TGGCTCCTTT*ATCTGGATNGTCTATGGGAGAATATTTA**GGGATAATGG*CAA*CAT
ITT01_0040_D04.b : *TGGCTCCTTT*ATCTGGNATGTCTATGGGAGAATATTTTA**GGGATATGG*CAAACAT
ITT01_0031_F08.b : *TGGCTCCCTT*ATCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0079_C05.b : tctctattttggatgttcttgggaaaaaatttttaggaaaatggcaaaaagggctttaat
OVRT1_0139_G06.b : ctttttcggaatttttatgggaaaaatttttgggaatagggcaaacggctttgatcttct
TES01_0085_A11.b : tgggctccttattctggaagttctattgggaaaaattttttagggaaaatgggcaaacat
KDN01_0062_E06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA**GGGATAATG*GCAACAT
KDN01_0028_F05.b : *TGGCTCCTTT*ATCTGGNATGTCTATGGGAGAATATTTTA*GGNNATATGG*CAAACAT
TES01_0052_E10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTAN***GGATATGG*GCAACAT
PST01_0047_D03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*GCAACAT
KDN01_0032_H10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0017_F10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
PST01_0091_B11.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
KDN01_0051_G01.b : *TGGCTCCTTA*TTCTGGAgttccaagggaagaaaattttaggggaataaggcaaacatg
KDN01_0027_C06.b : atctcacatgaatataactcataaaaattaccattcagatcctaaaataaaaaaaaaaat
TES01_0098_A12.b : ggctccttattctggatgttctaggggaaaaaatttttagggaatagggcaaaacggcct
SKNB1_0071_B08.b : *TGGCTCCCTA*TTCTGGATGTTCAATGGGAGAATATTTAAGaatatggccaacatgcct
KDN01_0039_B03.b : TGNCCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*AGGATAATGG*GCAACAT
KDN01_0036_D02.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTT*AGGATAATGG*CAAACAT
KDN01_0079_H01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGGAGATATTTTA*GGGATAATGG*CAAACAT
KDN01_0075_E12.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGNAGAATATTTAA**GGAATATGG*CAAACAT
PST01_0026_B10.b : *TGGCTCCTTATTTCTGGATG*TCTATGGGAGAATATTTA**GGGATAATGG*CAAACAT
PST01_0067_A12.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0077_G07.b : tataatatacccctagaatataccccctttgggggtttttacacctaattgatttaaaag
SKNB1_0016_A07.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTAGGGATAATGGG*CAAACAT
MLTL1_0085_C04.b : atgggaaaaattttaggaaaatgcaaaatgctttgttccctagaagacttccaaacggct
BFLT1_0147_B07.b : ttattcggaaagtttctgggaaaaaatttttaggaaaaagggaaaattgctttgattctc
ADR01_0028_E09.b : *TGGCTCCTTA**TCTGGATG*TCTATGGGAGATATTTT***AGGGATATGG*CAAACAT
DCI01_0118_F04.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGNNNATATG*GCAACAT
KDN01_0022_A07.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0092_C02.b : *TGGCTCCTTA*TTCTGGGATGTCTATGGGAGAATATTTTA*GGGATATGGG*CAA*CAT
TES01_0088_E02.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACCT
LNG01_0042_B08.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
SMG01_0103_D12.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0085_H04.b : *TGGCTCCCTATTTCTGGATGTTCTATGGGAAAATATTTTANGGgataatgccaaacatg
TCH01_0001_D09.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
SMG01_0052_B10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
THY01_0041_H01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
AMP01_0061_G02.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLN01_0070_D09.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
KDN01_0063_D06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0080_H12.b : *TGGCTCCTTA*TTTCTGATGTTCTATGGGAGAATATTTTA*GGNATAATGG*CAAACAT
DCI01_0060_F02.b :
PCT01_0004_F11.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0075_F01.b : *TGGCTCCTTA*TTCTGAATGTTCTATGGGAGAATATTTTA*NGGATAATGG*CAAACAT
MLTL1_0090_B07.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
PCT01_0022_H01.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0044_D03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
CLNT1_0038_B10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
OVRT1_0146_E09.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0085_F05.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
THY01_0109_F12.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAAAATATTTTA*CGGATAATGG*CAAACAT
UTR01_0083_H03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLTL1_0036_B10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
PBL01_0096_C03.b : *TGGCTCCTTA*TTCTGGACGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0031_B10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0063_A05.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLN01_0062_D06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0015_B10.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
TES01_0059_B06.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
KDN01_0092_G03.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
MLN01_0055_B02.b : *TGGCTCCTTA*TTCTGGATGTTCTATGGGAGAATATTTTA*GGGATAATGG*CAAACAT
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
---------+---------+---------+---------+---------+---------+ 1081
CBLT1_0007_E04.b : tttgatcctcatgaaacttacccaacgggttgtggtttagtcagaagttctggtgtcccc
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : tctctctagagggacttcccaaaggggggtttgtttacgcaaaaagtgttgggggctccc
PST01_0095_C03.b : GCTTT*GATCATCTATGATGACTTA*TCCAA*CAGGCTG*TTGCTatcgtcagatgctct
MLN01_0048_E07.b : GCTTT*GATCATCTATGAAGACTTA*TCCAAACAGGCTG*TTGCTTAA*CGTCAGATGTC
MLTL1_0053_G06.b : actcaaaattctgcggtcccaaccccggtgggggctaccggggaggttcaccacccccgc
TES01_0030_G06.b : GCTTT*GATCATCCTAGAAGAATTA*TCCAAACAGGCTG*TTGCTTAatctagaaggttc
TES01_0032_B05.b : gatcccctagaagacttatccaaacgggcgttggttttcgcaaaattttctgtggtcccc
CBLT1_0051_H09.b : tccataatgacttaccaaaaaggggtttcttaccatagaatttttgcggtcccccaaccc
SMG01_0072_A06.b : cttaaaaaaaaaaaaacaaacccgggggggggggtgttttaaaaaaaaaaaaaaagcgcc
THY01_0026_F10.b : cataatgcgctcgcaactctcgctcacgtcctccgcccgttcctctctttattctgtccc
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : tgttttttatttttttcattgataccttttccccacaaggggttgtttttttattctccc
THY01_0003_D01.b :
OVR01_0022_H03.b : cctaatatccccttacccaacccagtctcgtcctcttacccgcccacaatctccctcccg
THY01_0002_E02.b :
SMG01_0023_D11.b : tggaaggactttccaaaaaggcgtttgcttatgttaaaaagttcttgtggtccccccaaa
THY01_0044_C10.b : aaaattgttttttatcatttttttaaaaaatttttctcaaaacagggttgtttttttttt
SMG01_0093_G08.b : aagcctttccaaaagggggttttttaccaaaaaagttttggggccccccaaccccggggt
SMG01_0007_C10.b : aaaaattacccaaagggtgttgctttcttcaaaatttttgtggtcccccacccccggtgg
TES01_0057_E03.b : accccttgaagactttcccaaacgggctgttgctacctcaagggttttgctgttctccca
LNG01_0045_G11.b : cttttgattcttctttaaatgatttttccaaaccagggtggtttcttaatcgtcaaaaat
UTR01_0035_D07.b :
SMG01_0103_C12.b : caccatgaggactatcaaacagctgtgcttatgttaaagttttggtggtccccaaccccc
SMG01_0095_A07.b : tgatcatcatggagaacttaacaaacgggctggtgcttacggtaaaagttttggtggtcc
OVRT1_0118_F10.b : ttttatccccctagaaggaatttcccaaaacgggggttgcttttccccaaaaggtcttgg
OVRT1_0086_G09.b : tggatcatctaggaggactaacccaaacggctgttggctatctgtaaaatgttttgctgc
OVR01_0062_F06.b : gctttgaatctccatgnagaacttatccaaacagggtggttgcttaatcgtcgaatgtct
LNG01_0026_E04.b : gcttttgatcctctatgatgacctaatccaaccggctggttgcttatcgtccgaatgtcc
SMG01_0039_C05.b : CCTT**GATCATCTAgaagaacttatcaaacaggctgttgcttacgtcaaaggctttgtg
OVRT1_0115_G03.b : GCTTT*GATCATCaagaaggattatcaaacggggtgtttgcttatctcaaaagttttggt
PST01_0038_C12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
BFLT1_0107_H09.b : GCTTT*GATCATCCATGATGACTTA*CCAAACgggcttttgtttaacgaaaagtttttgt
OVRT1_0039_B11.b : GCCTT*GATCATCTATGAAGACTTA*TCAAACcgggttgttgctaacgccaaatgttttt
BFLT1_0012_H08.b : GCTTT*GATCATCTATGATGAACTA*TCAAAACAGGCTG*Tgcttaatcgtagatgttct
THY01_0034_D05.b : TGCTTTGATCATCTATGATGACTTA*TCCAAAacaggctggttgcttatcgtccaaatgt
THY01_0088_C05.b : GCTTTTGATCATCTATGATGACTTA*TCCAAAacaggctgttgctttatcgccagatgtt
PBL01_0101_G07.b : GCTTN*GATCATCTATGATGACTTA*TCCAAACAAGGCT*GTGCTTAT*CGTCAGATGTC
OVR01_0020_D04.b : GGCTTTGATCATCTATGATGACTAA*TCCCAACAGGCTGGTTGCTTATTCGTCAAATGTC
CLNT1_0032_G11.b : GCCTT*GATCATCTATGAAGACTTT*ATCAAACAGGCTG*GTGGCTAA*CGTCAAATGTT
ITT01_0048_F06.b : GCNTT*GATCATCTATGATGACTTA*T*CAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : ttctagctgatttttactgggaaaaatatattttatagtgaaaaaagtctcctaaataca
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : gaggacttttccaaaaggggggttggttttggccaaaatgttttggtttcccccgaaacc
TES01_0087_A12.b : ataaaggggcaacaagggcctttgaaaacccccaagaaaaaactttttcccaaacaacgg
PTG01_0072_D03.b : cacccaagaaagactacccaaaaggggtgttgtttaagtaaaaagttttgggggttcccc
SMG01_0080_E11.b : atctctatgatgactaccaaaacggcgtttggttaangtaaagtttctggtgttccccca
OVR01_0047_D04.b : GGTTTTGATCATCTTTAATGACTTA*TCCAAACAGGgttgttgcttatcgtcaaatgttc
KDN01_0053_G01.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
PST01_0062_D01.b : GCTTT*GATCATCTATGATGACTTA*TCCAA*CAGGCTG*TTGGCTAT*CGTCAGATGTC
ITT01_0077_A05.b : GCTTT*GATCATCTATGATGACTTT*ATCAAACAGGCTG*TTTGCTAT*CGTCAGATGTT
BFLT1_0082_E10.b : GCTTT*GATTATCTATGATGACTTA*TCCAAACAGGTTG*TTGGCTTA*CGTCAAAAGTT
KDN01_0052_D07.b : GCTTT*GATCATCTATGATGACTTA*TCCAAAC*GGCGT*GTGCTTAT*CGTCAAATGTC
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : tgaggcaaccgggaaggtcccccaccctttccggaaagcccaaaaaaacttcggggcctt
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : tgatccctataaagaactacccaacaggggggtgcttatagtaaaaagtttttggggtcc
CLNT1_0121_H11.b : gatcatctggatgacttatcaaaacagctgttgcctaacgcggagtctttgctgctcgcc
OVRT1_0026_G10.b : GCTT**GATCATCAAGGAAGACTTA*TCCCAACGGGCTG*TTtgctaacgtaaaatgttc
PST01_0073_F06.b : GCTTT*GAACATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAA*CGTCAAATGTC
ITT01_0026_F03.b : GCTTT*GATCATCTAAGATGACCTA*CTCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLN01_0076_G03.b : GCTTT*GATCATCCATGATGACTTA*TCCAA*CAGGCTG*GTGCTTAT*CGTCGGAAGTC
THY01_0045_E04.b : cctcctcatcaccaacatccttaacccccccctcctccctcctactctccttacccctct
THY01_0119_C06.b :
SKNB1_0004_F11.b : taaagggcaacacaatgcctttaaaacaccccaacaacagaactttataaccaaacccag
PCT01_0035_H05.b : tcatcatgatgactatcaaacaagctgttgcttacgtcaaatgtctgctgctcgccgacc
PCT01_0009_E01.b : cttttatcacctttaaagacttacccaaaagggtgtttgctttactgcaaaagttttgtg
KDN01_0090_E07.b : GCTTT*GATCATCTATGATGACTTT*ATCCAACAGctgttgcttatcgtcagagtctctg
PCT01_0004_B05.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAAGCTG*TTACTTAT*CGTCggagtct
PST01_0098_G04.b : GCTTT*GATCATCTATGAAGACT*A*TCCAAACAG*CTG*TTGCTTAA*CGTCAAAAGTC
PST01_0078_H02.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*GTGCTTAT*CGTCAGATGTC
PST01_0095_E09.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0096_B06.b : acttatccaaaaggttgtggctaacgcagaaagtcttgcgggtccccaaacccccggtgg
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : gatccctctaaaaaacctatccaaaagggttgtgttttatcgtaaaaatgttttggtggt
BFLT1_0144_B08.b : cttggatcctctatgaaggactttctcaaaaggggggttgcttaatccgtaaaagtgttt
MLTL1_0054_H05.b : caattcatttccccccctgcccctcccgaagggttttcattaaattcgccaggggaaccc
BKFL1_0007_F04.b : attaccaaaaagggtgttctttctcaaaatttctgctgcccccaaccccggtgggaggca
DCI01_0042_G08.b : ggatatctatgatgacttacccaaacgggcggttgttatcttaaaaatttttgtggtccc
MLTL1_0004_B05.b : ttcttgatgacctttccaacgggtgtgcttatcgccaaagttttggggtcccccaacccc
LVRM1_0107_D12.b :
DCI01_0012_F02.b : aacggctgtgcttatcttcaatgtttgctgttcccgaaccccggtgtgagctaccggggg
OVRT1_0007_B09.b : GCctggatccactatgagaattaacaaaacgggttgttgcttactaagaagttcttgctg
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : aagtgggcccaacctgcccttttgactccctcctatggagagaaccttatccccaacacg
HTMT1_0125_B06.b : gatcatnatgatgactatcaaacaggctgtgcttacgtcgatgtcctgctgctcgccgac
DCI01_0030_H12.b : ccacacccccggggggggagctactgggggggggtttcccaccaccccccgccggggaaa
HTMT1_0011_H06.b : tctccatgaagaactaaccaaaaaggggttgtgcttacgtcaaaagtttcggcgggcccc
CBLT1_0092_F01.b : cctttgatcatccaggagaatttattcaaaaaggctgttgcttaacgcaaaattactctc
HTMT1_0097_B02.b : tcacctagagaacttatcaacagggtgttgcttacgtcaaagttttgctggtccccaaac
SPL01_0053_F05.b : tcctctagaagaactatccaacagggctgtgctttccgcagaagttcttggtggcccccg
CBLT1_0022_C05.b : GCTTgattctccatgaaaaactaaccaaaaggctgttgctaacgtcaaatttcctgctgg
HTMT1_0113_C02.b : GCTTTGATtctcttgagaacttaccaaagggcggtgcttatcctcaaatgtttgctgtcc
LNG01_0103_E05.b : ctttgatatctatgagacttatcaaacaggctgttgcttatgccgaattcctgctgctcc
OVR01_0041_F03.b : GGTTTtgatattctttgatgaattatcccaaacaggttttttgtttatcctcaaaatgtc
OVRT1_0006_E06.b : GCTTT*GATCTTCTATGATGACTaacccaccaggctggtgtcttacgtcaaatgttctcg
OVR01_0039_E04.b : GCTTT*GATCATCcaaaatgactattccaaaacagggctgttggcttatctcaaaaagtc
ILNT1_0025_F06.b : CTTTT**ATCATCCAGGAAGACTTA*TACAAACAGGCTG*TTGCTTAA*CGTCAGAAGTC
MLN01_0077_B04.b : GCTT**GATCATCTATGATGACTTA*TCCAA*CAGGCTG*TTGCTTAT*CGTCAGATGTC
THY01_0105_A01.b :
AMP01_0003_B07.b : tatgtatcttgaccctaattctactcttcattccaataatccgcgctctttcttactata
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : ggtttctctatgaagaattttcccaaaaagggggttggttttctccaaaagttcccggtg
AMP01_0037_D04.b : cgggggtttggcataacccaaagtttccccgccccccccaaccccggggggaggcccatc
TCH01_0096_A02.b : aggcctttccaaacgggttgtgcctatacgcaaattccttgcggtcccccaacctccggt
MLTL1_0027_H11.b : ggtgttgcttatataaaatgtttgttggtccccaacccccggttgggggccatctgggaa
DCI01_0018_F06.b : ctgttgcttaccccaaagttttggtggccccgaaaccccggttggggcaatccgggggac
BFLT1_0004_F10.b :
AMP01_0046_E10.b : ctccaagaagacccttccccaaacgggcggtttgcttaaacgcacaaaaggttttggggg
OVR01_0008_G03.b : ttttgatccttctataatgacttatcccaacccgggctgtttgcttttccccaacatgtc
CLNT1_0132_C10.b : atctcctagaagacttaccaaacggctggtgcttatgtaaaaagttttggtgttccgcca
BFLT1_0079_A09.b : tttgattctcattgaggaactaatcaaacaggctgtttgctaacgtaaaagtttctggtt
HTMT1_0015_G05.b : GCCTTGAatcacctagaagaacttaccaaacaggctggtgctttacggccaaaggttctt
THY01_0095_E09.b : gttttgattttcttataatggtttatcccaacaggctgttgctttatcgtcagaatgtct
BMWN1_0021_E04.b : CCTT**GATCATCTATGATGACTTA*ACCAAcggctgttgcttaacgtcgaatttcttgc
LNG01_0027_C01.b : GGCTTTGATCATCTATGATGACTTA*ATCAAACAaggctgtttgcttatcctccaaatgt
LNG01_0016_B01.b : GCTTT*GATCATCTATGATGACTTA*TCCCAACAGGCTGgtggcttatcgtcagaatgtc
ADR01_0083_B04.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTTGCTAT*CGTCAGATGTC
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : gtggttttatttcaaaaattttctctcggtcccccaaaaccccccggggggggggcctcc
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : aatttcccaaaggggggttttttataaaaaaattttttgggccccccacccccccggggg
SMG01_0068_B01.b : tcccaaccgggggtttttttttttcaaagtttttggtggtcccccaaccccccggcggag
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : attccttattattttatcttgtaattacttattccatacattgttgtctcctttaatctt
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : aaaaaaatttttttaggggaataaaagggggccaaaaacaagggccctttgggatacacc
SMG01_0071_A01.b : ccataaagaatttcccaaaagggtttttttttatcaaaaaggtttttgggggtcccccca
OVRT1_0140_A09.b : ggaaaaactacccaacagggttttgtttacgtaaaagtttttgcggccccccaaaccccg
OVR01_0069_B01.b : tcccccttggatgacttaccccaacccggctgttgcttatccgccgaaggtccctgctgg
UTR01_0045_B08.b :
TCH01_0054_C12.b : taaggggaattaatgt
THY01_0051_D05.b :
BFLT1_0112_G01.b : ttgatcccctatgaagaattttcccaaacgggtggttgcttacgtaaaaagtttttggtg
LVR01_0105_H12.b : acatgcctttaatttattcaattaagaacttatcccaaaccagggctgtttgctttattc
CLNT1_0140_G07.b : tcatctagaagaattatcaaaagggttttgcttactctaaatttttgcggccccccaaac
BFLT1_0010_H12.b : tgatcaccatgaagaacttatccaaccgggtggtgcttaacgccaaatgtttttggtggt
OVR01_0042_H11.b : tggttttgatcttctattaatgaactttatccaaaccagggccaaagggaaatttaattt
SPL01_0084_C06.b : gctttgaatcatccatgaagaacttttccaaaacaggctggttgcttaaccccccgaaag
ITT01_0070_E04.b : GCTTTGATCctcaagaagaactatccaacaagcgtgtgcttatcgtcagatgtctctgct
SPL01_0041_G01.b : cttttgatcatctatgaatgaactatccaaaaagggctggttgcttattcgccaaaatgt
SMG01_0028_E01.b : GCTTTGAatcactcagaagacttatccaaaaagggtggtgcttaacctcaaatgtcttgg
OVR01_0088_E05.b : Ggcttgaacctcttagaagaatttcccaaacgggtggtgcctatccccaaaagtttctgc
CLNT1_0034_F06.b : GCTTTGgatctctatgatgactatcaaaccagtctgtgctatcgtcagatgttttggctg
BFLT1_0098_E08.b : GCTTTGATCtctaagatgacttaccaaacaggtgttgcttacgcagaagtcttgctggtc
OVR01_0025_A09.b : gcttttgttcatctttgatgaacttattccaaaaagggctggttgcttaatccttcagaa
BFLT1_0090_C04.b : GCTTT*GATCATCTAgaggacttatcaaaccggctgtggctaacttaaaagttctgtggt
OVR01_0052_A03.b : CTTTGATCctccatgaaggacctaccccaacagggctggtggcttaccgtccgaagt
ITT01_0091_E05.b : GCTTT*GATCACCTATGATGACTTA*TCCAAACAGGCTGnttgctaacgtcagatgttct
BFLT1_0108_E11.b : GCTTT*GATCATCTATGATAACTTAccaacaggcctttgcttaacctccaattttctgct
ITT01_0041_G04.b : GCTTT*GATCATCTATGATGACTTA*T*CAAACAGGCTG*TTGCTatcgtagatgtctct
ITT01_0020_B05.b : GCTTT*GATCATCTATGATGACTTA**CCCAACAGGCTG*TTGCTatcgtcagagtctct
LNG01_0105_H01.b : GCCTT*GATCATCTATGAAGACTTA*CCAAACAGGCctgtgcctatcgtcagagtctctg
OVR01_0006_F06.b : GCCTT*GATCCTCTATtaatgacttatcccaacccggctgttgctttttcccccaaagtc
OVRT1_0096_C06.b : GCTTT*GATCATCTATGATGACTTA*TCCAA*CAGGCTG*Tgcttatcgcagatgtctct
UTR01_0104_D02.b : GCTTT*GATCATCTATGAAGACCTA*TCCAACCAGGCTG*TTGCTTAT*CGTtagaagtt
THY01_0202_A07.b : GCTTT*GATCATCTATAATGACTTA*TCCCAACAGGCTG*TTGCCTAT*CGTtcaaagtt
ITT01_0076_H10.b : GCTTT*GATCATCCATGATGACTTA*TCCCAACAGGCTG*TTGCTTAT*CGTCAGATGTC
ITT01_0022_C12.b : GCTTT*GATCATCTATGATGACTTA*TCAAAACAG*CTG*TTGCTTAT*CGTCAGATGTC
ITT01_0092_G11.b : GCTTT*GATCATCTATGAAGAATTA*TCCAAAACGGGCTGTTGCTTAT*CGTCAAAAGTC
ITT01_0041_G10.b : GCTTT*GATCATCTATGATGACTTA*T*CAAACAAGCTG*TTGCTTAT*CGTCAGATGTC
ITT01_0103_B06.b : GCTTT*GATCATCTATGATGACTTA*TCCCAACAGGGCT*GTGCTTAT*CGTCAGATGTC
ITT01_0050_G07.b : GCCTT*GATCATCTATGATGACTTA*T*CAAACAGGCTG*NTGCTTAT*CGTCAGATGTC
ITT01_0024_A12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
OVR01_0018_B08.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
BMWN1_0041_D06.b : ctttgatcccccaggaagacttacccaaaggggcgtttcttaacccataaaattttgggg
PTG01_0062_G08.b : ctccagaaggattatccaaaaggtgtttgttatcgtaaaagtttttggggccccccaaac
OVR01_0025_C06.b : tttgaatcttttttgaagaatttaatccaaaacaggttgtttgtttattcgtaaaaaggt
TES01_0001_C09.b : tgcttttgatcctctatgatgacttaacccaaccgggcggttgcttatcgtcaaatgtca
TES01_0009_B09.b : GCTTT*GATCATCTATGATGACTTA*TCCCAACAGGCTG*TTGCTTAT*CGTCAGATGTC
UTR01_0041_C04.b :
CBLT1_0075_F04.b : gatcatcaatgatgacttatcaaacagctggtgctttactccgatgttctgctgctcggc
HTMT1_0008_G09.b : GCTTT*GATCATCTATGAAGACTTA**CCAAACAGGCTG*TTGCTatcgcagatgtcttt
PBL01_0051_G05.b : GCTTT*GATCATCTATGATGACTTA*TCCNAACAG*CTG*GTGCTTAT*CGTCAGATGTC
LNG01_0076_C10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAG*CTG*TTGGCTAT*CGTCAGACGTC
AMP01_0057_E02.b : GCTTTtgatcctccaggatgaactaccccaacgggttgttggcttatcntaggatgttct
THY01_0043_D08.b : ttctttttttattttattaaatactttattcaaaaacgcttggttgccttcctcaaaaaa
OVRM1_0022_C09.b :
TES01_0088_H10.b : cttagaaagaattttcccaaaagagggggtttggttttttcccccaaaatttttttggtg
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : gatactcaaggaagacatatccaaaaggctggtgcttacggtaaaagttttggtggcccg
BFLT1_0033_C10.b : tttatcatctaggaagaattatccaacaaggtgttgcttaaccttaaagttttgggggtc
SPL01_0008_F12.b :
ITT01_0067_H03.b : GCTTT*GATCATCTATGATGACCTA*TCCAAACAGGCTG*TTGCTTAT*Cccagatgtct
OVRT1_0050_A03.b : GCTTT*GATCATCNATGATGACTatccaaacagctgtggcttatcgtaaaatgttctgtg
ITT01_0040_D04.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
ITT01_0031_F08.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTTGCTAT*CGTCAGATGTC
TES01_0079_C05.b : ccctcctggagaactttccaaaaaggggtgttgttttacgccaaaatttttttgtgtccc
OVRT1_0139_G06.b : ggagacttttcaaaaaggcggttgttttcctaaaagttctgcgggtcccccaaaccccgg
TES01_0085_A11.b : gccttgaatcatccaatgaggaactatacccaacaaggctgttgcttatccccccaaaag
KDN01_0062_E06.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGGCT*GTGCTTAT*CGTCAAATGTC
KDN01_0028_F05.b : GCTTT*GATCATCTATGATGACTTA*TCCAA*CAGGCTG*GTGCTTAT*CGTCAGATGTC
TES01_0052_E10.b : GCTTT*GATCACCTATGATGACTTA*TCCAA*CAGGCTG*TTGCTTAT*CGTCAAATGTC
PST01_0047_D03.b : GCTTT*GATCATCTATGATGACTTT*ATCCAACAGGCTG*TTGCTTAT*CGTCAGATGTC
KDN01_0032_H10.b : GCTTT*GATCATCTATGATGACCTA*ATCAAACAGGCTG*GTGCTTAT*CGTCAGATGTC
TES01_0017_F10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
PST01_0091_B11.b : GCTTT*GATCATCTATGAAGACTTAATCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
KDN01_0051_G01.b : ctttggacatctataaagactttcccaaaaggctggttgcttatcctaaaaaggtttttg
KDN01_0027_C06.b : aaattaataaaatcaaaaacaaaataaatcctttaataaaaattgacatttatctgatat
TES01_0098_A12.b : tgatcccccatgaagactttcccaaacgggctttttgcttttcgcggaaagtttcttgtg
SKNB1_0071_B08.b : tgaatctctatgatgacttatcccaacggctttttcttatcctcaaagtctccgctgctc
KDN01_0039_B03.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTTGCTAT*CGTCAAAAGTC
KDN01_0036_D02.b : GCTTT*GATCATCTATGAAGACTTA*TCCAACCAGGCTG*GTGCTTAT*CGTCCAATGTT
KDN01_0079_H01.b : GCTTT*GATCATCTATGATGACTTA*ATCCAACAGGCTG*TTGCTTAT*CGTCAGAAGTC
KDN01_0075_E12.b : GCTTT*GATCATCTATGATGACTAA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGAAGTC
PST01_0026_B10.b : GCTTT*GATCATCTATGATGACTTA*T*CAAACAGGCTG*GTTGCTAT*CGTCAGATGTC
PST01_0067_A12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCCTAT*CGTCAGATGTC
TES01_0077_G07.b : gtcccccccatatactaattaaggtctccctttttagtgaggagctccttgggagaaaat
SKNB1_0016_A07.b : GCTTTTGATCATCTATGATGACTTA*TCCCAACAGGCTGGTTGCTTAT*CGTCAGAGGTC
MLTL1_0085_C04.b : ttgcttctccaaaggttcttggtccgccaacccccggcgggggctaccccgggagggtct
BFLT1_0147_B07.b : ataggagaattacccaaacggggtttgtttaacccaaaatgtgtttgggggccaccaaac
ADR01_0028_E09.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG**TGCTTAT*CGTCAGATGTC
DCI01_0118_F04.b : GCTTT*GATCATCTATGATGACTTA*TCCNAACANNGCT*GTGCTTAT*CGTCAGATGTC
KDN01_0022_A07.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0092_C02.b : GCTTT*GATCATCTATGATGACTTA*T*CAAACANGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0088_E02.b : GCCTT*GATCATCTATGATGACTTA*TCCCAACCGGCTG*TTGCTTAT*CGTCCGATGTC
LNG01_0042_B08.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
SMG01_0103_D12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0085_H04.b : cctttgatcctccatgaaggacctaacccaaacaggcttggttgcttaccctcaaaatgt
TCH01_0001_D09.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
SMG01_0052_B10.b : GCTTT*GATCATCTATGATGACTTT*ATCCAACAGGCTG*TTGCTTAT*CGTCAGATGTC
THY01_0041_H01.b : GCTTT*GATCATCTATGATGACTTA*TCCCAACAGGCTG*TTGCTTAT*CGTCAAATGTC
AMP01_0061_G02.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLN01_0070_D09.b : GCTTT*GATCATCTATGATGACTTA*TCACAACAGGCTG*TTGCTTAT*CGTCAGATGTC
KDN01_0063_D06.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0080_H12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
DCI01_0060_F02.b :
PCT01_0004_F11.b : GCTTT*GATCATCTATGATGACTTA*TCCCAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0075_F01.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0090_B07.b : GCTTT*GATCATCTATGATGACTTA*TCCNAACANGCTG*TTGCTTAT*CGTCAGATGTC
PCT01_0022_H01.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGACTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0044_D03.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
CLNT1_0038_B10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
OVRT1_0146_E09.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0085_F05.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
THY01_0109_F12.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CATCAAATGTC
UTR01_0083_H03.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLTL1_0036_B10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
PBL01_0096_C03.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0031_B10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0063_A05.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLN01_0062_D06.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0015_B10.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
TES01_0059_B06.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
KDN01_0092_G03.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
MLN01_0055_B02.b : GCTTT*GATCATCTATGATGACTTA*TCCAAACAGGCTG*TTGCTTAT*CGTCAGATGTC
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
---------+---------+---------+---------+---------+---------+ 1140
CBLT1_0007_E04.b : caaccccggttgggaggctatcgggggacggttccctaacctcctctgcgggaaaacggc
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : caaacccccggtggggaggcaaccgggggaagttttacccacactccccttgggggaaag
PST01_0095_C03.b : gctgctccgccgacccccggtcgggaggctacctggggacggttcacctaactcccgttg
MLN01_0048_E07.b : TCGGCTGCTCCGCCGAACCCCCGG*TCGTGAGGCtatcccggtgacgtggtctactaacc
MLTL1_0053_G06.b : gcgggaaaagcccaaaaaaaagtttcgggggcccttgccttacacccaaaaacggggggt
TES01_0030_G06.b : ctgcgggtcccccaaacccccgttcgggaggccctatctggggaacggtttttacctaac
TES01_0032_B05.b : caacccccggtggggaggccatcccggggaacggttctacttcacccccccccgcgggaa
CBLT1_0051_H09.b : ccggtgtgaagcctaaccggggaaatgtttaccaaccaccccctcgcggagaaaaggcaa
SMG01_0072_A06.b : gcgccccccccccccccccccccccgggggggggagaaaaggggggggggtttttttcct
THY01_0026_F10.b : cctgccaccatgcctcaactcctagccacgccccaatcctcttgttctgcatttcatttt
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : aaaattgttttcggttttcccccccccccccccccccccgcgctgggagggggccaatca
THY01_0003_D01.b :
OVR01_0022_H03.b : cctcccc
THY01_0002_E02.b :
SMG01_0023_D11.b : ccccgggtgtgaaggctaaccgggggacgggttaccccaacccccctctggcgaaaaaga
THY01_0044_C10.b : tcctcaaaaaatttctctttttgtcctccccccccccccccccccgcggccggagg
SMG01_0093_G08.b : ggagccaatccggggaggggttcacaaaccccccgccgctaaaaaggccaaaaaaaaaac
SMG01_0007_C10.b : agggctatcggggaaggtttaactaatcccctttcgggaaaaaaggcaaaaaaacaagtt
TES01_0057_E03.b : accccggttgtgaggcctacccgggaacggttcccccaaacccccgcccccgggaaaaac
LNG01_0045_G11.b : tttccttcctgcctccccccaaccccccccgggtccgggagggccctatttcctgggggg
UTR01_0035_D07.b :
SMG01_0103_C12.b : ggtctggggcaacctgggaaggtttacccaatcccctcggggaaaaacggcaaaataaaa
SMG01_0095_A07.b : cccaacccccgggtggggggccaaaccgggggacgggtccacctaccccccctctgcgga
OVRT1_0118_F10.b : cggcccccccaacaccccgggttggaggcctattcgggggaaatgtttaccccaaccccc
OVRT1_0086_G09.b : tccgccaaccccccggtcgggaggcctttctggggactgttctacctaccccccgtggct
OVR01_0062_F06.b : ttggctgctccgccgaaccccccgggtggggaggcctaattgtgggggaagggttttacc
LNG01_0026_E04.b : cctcctgctccccccaaacccccccggtccgggagggccctatcccggggggaccggggt
SMG01_0039_C05.b : ctccgccaacccccggtcggaagctatccggggacaggttcaactaaactccgttcgctg
OVRT1_0115_G03.b : gccccccgaaccccgggcgggagcctatccggggactgttcacccacccccccgttgggg
PST01_0038_C12.b : TCTGCTGCTCCGCCGATCCCCGGncgtgaagcctatcctgggaagtgttctactaacctc
BFLT1_0107_H09.b : tggtccccaaacccccggtgtggaggcaatccggggaacgttccacccacacccccctcg
OVRT1_0039_B11.b : gctggttcgccgaacccccgggcgggagcctatccgggggacgggtctcaccaacctccc
BFLT1_0012_H08.b : gctgttccccgaaccccgggtgggaggcctatcctgggacgtgtctacttacccccctct
THY01_0034_D05.b : ctctggctgctcccccaaacccccccggccgggagggccttttcctgtggggaacgggtt
THY01_0088_C05.b : ctctgctgcctccgccgaccccccccggtgtgagggcctaatcctggtggacgtggtttc
PBL01_0101_G07.b : TCTGCTGCTCCGCCGACCCCCGGT*Cgggaggcctatccggggactgttctacctaactc
OVR01_0020_D04.b : TCTGCTGCTCCGCCGACCCCCCGGgtcggggaggccattccgggtggaacgggttctacc
CLNT1_0032_G11.b : TCTGCTGCTCCGCCCAACCCCCGG*TCGTGAGGCCTATCCTGtggagggtttaacctaac
ITT01_0048_F06.b : TCTGCTGCCTCGCCGAACCCCCCG*TCGTGAGGCTTATCCCGGTGACCTGGTCTACCTAC
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : ctactttcacttcttctctatttacaccactatatcctcatcaccggtactcggttgtgt
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : ccgtttagaagcctacccctggaactttttaaaaaaaaccccatctggggaaaaagagcc
TES01_0087_A12.b : ggtttttgctcatatctccccaaaaagttcttgtggggtgttcccgcccaaaacccccgc
PTG01_0072_D03.b : aacccccgggcggggggcctacccggggaaggtttttccaccaccccccccggcgaaaaa
SMG01_0080_E11.b : acccccggtgggaggccatccggggaaggttccacaaacctcccttcgggggaaaaaccg
OVR01_0047_D04.b : tctgttgttcccccgaaccccccggtcggggaggccatttccgggggaccgggttctacc
KDN01_0053_G01.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGGTCTACCTAC
PST01_0062_D01.b : TCTGCTGCT*CGCCGAACCCCCGG*TCGGGAGGCTTATCCTGGTGAACGGTTCTACCTAC
ITT01_0077_A05.b : TCTGCTGCTCCNCCGACCCCCCGG*TCGgaaggccatcctggtgacgtgtcaactaaact
BFLT1_0082_E10.b : TCTGGTGGTTCGCCAAACCCCCGG*TCGTGAGGCCTATCCTGGgaacggttttaactaac
KDN01_0052_D07.b : TCTGGTGCTCCGGCAACCCCCCGG*TCTGGAGGCCTATCCTGGTGACGTGTTCTACCTAA
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : ttgtttcaaataaaaaagggggggtgtttttacaacttttttttgggaattttaaaaatt
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : cccaaacccccgggtgtgaggcaatcggggggaaggttcccataccaccccgggccggga
CLNT1_0121_H11.b : aaccccccgttggagggcataccggggactgttctaccacaccccgtctgctggaaaaaa
OVRT1_0026_G10.b : ttgctggtccgccgaaccccgggtctgaaggcctaatctgtggacaggtttcaaccaacc
PST01_0073_F06.b : TCTGCTGCCTCGCCCAACCCCCGG*TCGTGAGGCCTAcccggtgaagttgtctacctacc
ITT01_0026_F03.b : TCTGCTGCTCCGCCGACCCCCGGG*TCGTGAGGCCTATCtggntgacggtgtctactaca
MLN01_0076_G03.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCaacctggggacgggtctaccaacctc
THY01_0045_E04.b : caccacccacacctcttcctctcttcatccttcacaatctcctctccttcttctccccct
THY01_0119_C06.b :
SKNB1_0004_F11.b : gatcgggttgacttaaacccctagagttcctctgttaatgcctacaaccaa
PCT01_0035_H05.b : cccggtcggaagctatccggggactggtctactaactccgccgctgaaaaacgccaaaag
PCT01_0009_E01.b : tgttccgccaaaccccgggttggaaggcattctgggagaggttttcacctaaactcccgt
KDN01_0090_E07.b : ctgctcggcgaaccccggtcgtgagcctatcctgtgacgggtctactaccctccctctgc
PCT01_0004_B05.b : ctgctgctcggcgaacccccgttgtgaagcctatctggtgacgtgtctactaccctcccg
PST01_0098_G04.b : TCTGCTGCTCCGCGAACCCCCGGT*Cgggaggcctatctggtgaagtgttcaacaaaact
PST01_0078_H02.b : TCTGCTGCTCCGCCGACCCCCCGG*TGGTGAGGCtatcctgtggaagggttctactaact
PST01_0095_E09.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCtatcctggggaatggtctaacttaac
TES01_0096_B06.b : gaggcttatccggggaaatggttctactaaaatcccgttcggctggaagaacgcccaaat
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : cccccaaaccccccgggtgggaggcccaacccgggggaatggttccaccacccccccgct
BFLT1_0144_B08.b : gcgggccccaccaacacccgggtgggggaggccatccgggggaagggtttctcaccaacc
MLTL1_0054_H05.b : caagggggaaataaacccggggaaccctggcccggaaaaattcccgggaaaggggaaaat
BKFL1_0007_F04.b : accgggaaagtttcccccaccccccctgcggaaaagcccaaaaaaaaagtttttgggggg
DCI01_0042_G08.b : ccaacccccggtgtgggggccaacctggggaaggtttcacacaccccccccgtgggaaaa
MLTL1_0004_B05.b : ggttggagggcacccgggagaggtttcccaaccccccccgggggaaaagccaaaaaaaaa
LVRM1_0107_D12.b :
DCI01_0012_F02.b : acgttctaccactccctccccggaaaacgccaaagaacaacttcgggggcccctaaagtt
OVRT1_0007_B09.b : ctccgcgaaccccggttgtgaagcctacctggggaaagttcaactaacctccgttcgctg
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b : gggcgggtgttgccttataccccctccaaaaggttccccgggctgggcctccccccca
HTMT1_0125_B06.b : cccggtcggaggctacctgtgagtgtctactacatccgtcgctgaaagacggcaaagacc
DCI01_0030_H12.b : aagaccacaaaaaaaacatctttggggggccttctttgttttttatcttcaaaaaccacg
HTMT1_0011_H06.b : ccaacccccggggtggaggcctatccgggggaaagggtttaccacaaccccccctggtgg
CBLT1_0092_F01.b : ggttcccccaaacccccgggtcttgaggccaacccggttgactgtttaactaaactccct
HTMT1_0097_B02.b : cccgggtgggagcctaaccggggagggttcaaccacaccccctcggcggaaaaagcgcca
SPL01_0053_F05.b : aacccccggtgttgaggctatccg
CBLT1_0022_C05.b : cccccaaacccccggtggggggctacccggggaaggtttacccacctccccttgcgggaa
HTMT1_0113_C02.b : ccaaaccccggtgggaagccatccggggacgggtcacctaccccccccccggaaaaacgc
LNG01_0103_E05.b : gcgacccccgggcgggaggcaatccggttactggtcaccctacccccgtcgctgaaaaac
OVR01_0041_F03.b : ccctcctggtcccccccaaccccccccggcccgggagggcctatttccgggggggaacgg
OVRT1_0006_E06.b : ctgttcggcgaacccccggtcggaaggctaacctgttgacggttccaccttacctcccgt
OVR01_0039_E04.b : tctgcttgcttccccccaacccccccggtccgggaggcccaatcccgggggggacatgtt
ILNT1_0025_F06.b : Ttttggggtccgccgaaaccccggttgggaaggcaatacgggggaacgtttttaccaaac
MLN01_0077_B04.b : TCTGCTGCTCCGCCGACCCCCCGtcgtgaggctatcctggtggactgttctactacactc
THY01_0105_A01.b :
AMP01_0003_B07.b : tcttccgattctccttcattcactaccaccatcagattgcgttgtaaattgttttattta
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : gtccccccaaccccccggggggggggaatcccggggggagttttaccacccccccccccg
AMP01_0037_D04.b : cgggggaatgttcccccccccccccgctcttggggaaaaggccaaaaaaaaaagtttggg
TCH01_0096_A02.b : ctgggggctactggggtagttttctaatatcctcccttcgtgtgtgagagggccaaaaaa
MLTL1_0027_H11.b : gggtctccccccccccccccggggaaacgcgccaaaaaaaagattttgggggggcctctg
DCI01_0018_F06.b : ggttacctaactcccctgcggagaaacggccaaagaaaagcttcgggggggccttgggct
BFLT1_0004_F10.b :
AMP01_0046_E10.b : gcaccgccccaaccccccgggtgtggaagcgccaatccggggggaacgtgtatcaccaca
OVR01_0008_G03.b : tcccccctgcccccccgcccccccccccgccccgaaggcccttttccccggggaaccccg
CLNT1_0132_C10.b : cccccgggtgggaggctatccggggaagggttccacaaccccccgtccgggaaaaagggc
BFLT1_0079_A09.b : gctccgccaaaccccgggtcggaaggccatccggtgaacggttttacccacctccccccg
HTMT1_0015_G05.b : gctggtccgcccaccccccggtcggaaggccaacctgggggagttgtcaaccaacccccc
THY01_0095_E09.b : ctgctgctccccccaaccccccgggtcgggagggcctattcgtggtggacgtg
BMWN1_0021_E04.b : tggctccccacccccgggtgggagctatctggggaaatgtccaccaacctccgtctgctg
LNG01_0027_C01.b : ctcctgctgctcggcccaacccccccggtcctgaagccttattcctggtgaacttgttcc
LNG01_0016_B01.b : tctgccggctccgcccaacccccccgggtcggtgaggccttatccctgggtggaacctgg
ADR01_0083_B04.b : TCTGCTGCTCCGCCGACCCCCCGT*TGGTGAGGCtatcttggtgacttgttctactaccc
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : cgggggggggtgttcccacacccccccccccggggagaaagcccccacaaaaaaaaactc
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : ggggacctccgggggggttctccaccacccccccccgcgcggaaaaaaacaaaaaaaaaa
SMG01_0068_B01.b : ggcgcaatccggtggggtgttcccccaccccccctccgggaaaaaaggccaaaaaaaaaa
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b : tcaaatttcctcttccctctcccaccccaca
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : tcccctaggaaaagagacctttatatcccaaaaaaccgggggccggggggtgtcctatta
SMG01_0071_A01.b : aaccccggggttggagggataacgggggaaaggttctcccccaacccccctccggggaga
OVRT1_0140_A09.b : gggggggaggctacggggggattttttcccaccaacccccccgcgagaaaagggcaaaaa
OVR01_0069_B01.b : ctccggccaaccccccgggtcgtgaggccctatccgggggaactggtttcatccaaacat
UTR01_0045_B08.b :
TCH01_0054_C12.b :
THY01_0051_D05.b :
BFLT1_0112_G01.b : tccgcccaaaccccgggtgtgaaggcctctccggggaatgtttcaccccaccccccttgg
LVR01_0105_H12.b : gttcaaaattgttttcttgcctggcccccccccccaaaccccccccgggtgcgggaaggg
CLNT1_0140_G07.b : cccggtggagagcaatacggggacagttcaacaaccccccccgcggaaaaagcgcaaaaa
BFLT1_0010_H12.b : tccccaaacccccgggttgggaagggctatctggggaagtggtttaactaaaaccccgtt
OVR01_0042_H11.b : tttaaaacccctattttggttttgtttttggaacccccaggggggtccatttt
SPL01_0084_C06.b : ttctctgctgtttccgccgaaccccccggggcgggaaggccatatccgggggaaagggtt
ITT01_0070_E04.b : gctccccgaacccccgttctggaggctatcctggtgacctgtttacctacaccccctctg
SPL01_0041_G01.b : ttcttcttgcttccccccaacccccccggggccggaagggcctattccggggggaaacgg
SMG01_0028_E01.b : gggttcgccaaacccccggttgggaagcctaaccggggaacggtcctaccaacccccctc
OVR01_0088_E05.b : ggtccgcccaaccccgcggtgggaaggctatccgggggacatgtttaactaaaaccccgt
CLNT1_0034_F06.b : ctcggcgacccccggtcgggagcctacctggggacgggtcctaccaactcccgccgctgg
BFLT1_0098_E08.b : ccccgacccccggtcgggagcctacccggggaagggtttaaccaactcccgctggctgaa
OVR01_0025_A09.b : gttttcttggctgcttccccccaacccccccgggtcggggggggcctaatccctgggggg
BFLT1_0090_C04.b : ccgccaaccccggtcgtgaggcctacttgggaatgttcacctaacctccgcctgctgaaa
OVR01_0052_A03.b :
ITT01_0091_E05.b : gctgctccccgacccccggtcgtgaagctatcctgtgactgttccacaacctcccgtcgc
BFLT1_0108_E11.b : gtccccccaacccccgggcttgagcccatccggggaactgttctcccaacccccctctgg
ITT01_0041_G04.b : gctgctcgccgaccccccgtcgtgagccatcctggtgacgtgtctaccaaactccgtctg
ITT01_0020_B05.b : gctgctcgccgacccccggtcgtgaggccatctggtgacgtgtcacctacactcctctgc
LNG01_0105_H01.b : ctgctccgcgaccccccgtcggtaggcaatccggggaccgtgtctactacctcccttctg
OVR01_0006_F06.b : cccccccggtcccccccacccccccccggccgggaggcccctcccccgggggacacctgt
OVRT1_0096_C06.b : gctgttcgccgacccccggtgtgaagcctacctggtgagtgtcctactaccctccgtctg
UTR01_0104_D02.b : ttgctggttcgccgaacccccgggtggggaggcttatcccggggaacggttctaccaaac
THY01_0202_A07.b : ctttgccgctccccccaaaccccccggtccttgagggccattcctgggtgacgttgttct
ITT01_0076_H10.b : TCTGCTGCTCCGCCAACCCCCGGT*Cggaggcctacctggtgaactgtcctactacactc
ITT01_0022_C12.b : TCTGCTGGTCCGCCGACCCCCCGG*TCtgaagcccatcctggtgacttgttcaactaacc
ITT01_0092_G11.b : TCTGCTGGTCCCCCGACCCCCGGG*TCGgaagcctaacccggggaagtgtttcacccaca
ITT01_0041_G10.b : TCTGCTGCTCCGCCGAACCCCCGG*TCGTGAGcctatcctggtgaagtgtttctactaaa
ITT01_0103_B06.b : TCTGCTGCTCCGC*GAACCCCCGG*TCGTGAGGCtatcctggtgacgggtcaacctacct
ITT01_0050_G07.b : TCTGCTGCTCCGCCGACCCCC*GG*TCGTGAGGCCTATCtggtgacgtgttcaactaaac
ITT01_0024_A12.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCtgggtgacatgtctacctaca
OVR01_0018_B08.b : TCTGCTGCTCCGCCGACCCCCCcggtcgtgaggcctatcccgggtgaacgtggttctacc
BMWN1_0041_D06.b : gttcccccaaacccccgggggggaggccaatcccgggggaaggtttccctcacacccccc
PTG01_0062_G08.b : ccccggtggggagccaaccggggactgttccaccaccccccccccgcggaaaaacccgcc
OVR01_0025_C06.b : tttttcctggctccccccaacccccccggtcgcggaagggctatatccggggggggaatc
TES01_0001_C09.b : ttggctgtcccggccaaccccccggttcgggtaggccctaccctggggaaggtgttttac
TES01_0009_B09.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAAGCCTATCCTGGgtgactggttctactac
UTR01_0041_C04.b :
CBLT1_0075_F04.b : aaccccccggtgtgaagcccaacctggggacgtgtttaccacactcccgttgctggagaa
HTMT1_0008_G09.b : gcgtgtccccgacccccgggcgggaagccaaccgggtgactgttcaactaaccccctctg
PBL01_0051_G05.b : TCTGCTGCTCCGCCGACCCCCCGtcgtgaggcctaccctgtgacctgttctactaaaccc
LNG01_0076_C10.b : TCTGCTGCTCCGCCGACCCCCGGT*Cgtgagcctatcctggtgacgtgtctacctacact
AMP01_0057_E02.b : tgctggtccgcccgacccccggggtgtgagggctatcccggggaacggtttccaccaacc
THY01_0043_D08.b : ctcctctccctctccccccccacccccccccccccctccgaagagctctctcctcgggtg
OVRM1_0022_C09.b :
TES01_0088_H10.b : tgtcccccccaaacccccgggggtgggggggctctctccgggggaaaggttttattacaa
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : ccaaaccccggttgggaggccatccgggggtgtgtttaacaaaactcccgctgccggaaa
BFLT1_0033_C10.b : cgccaaaccccgggtgggaggcctatcggggaacttttaaacaaccccccgtcgccggaa
SPL01_0008_F12.b :
ITT01_0067_H03.b : ctgctggtccgccaaccccggttctggagctatcctggtgacgggtctacctcactccgt
OVRT1_0050_A03.b : tgtcgcgaacccccggtgggaaggcaatccggggaagggtttacccacctcccgcctctt
ITT01_0040_D04.b : TCTGCTGCTCCG*CGACCCCCCGG*TCGTGA*GCCCATTCTGGTGACGTGTTCTACCTAC
ITT01_0031_F08.b : TCTGCTGCTCCGCCGACCCCCCG**TCGTGAAGGCTATCCTGGTGACGTGNTCTACCTAC
TES01_0079_C05.b : ccccaacccccgggggggggggcttcccgggggaaagttttctaccaaaccccccgccgc
OVRT1_0139_G06.b : tgtgaagcctaccgggggaagttttaccaaccacccgttggcggaagaaccccaaaaaaa
TES01_0085_A11.b : ttctctggctggccccccaaaaccccccgggtccgaagggcctatcccgggggaaacggg
KDN01_0062_E06.b : TCTGCTGCTCCGCCGACCCCCGGT*Cgtgagcctatcctgtgacgtgtctacctaactcc
KDN01_0028_F05.b : TCTGCTGCTCCGCCGACCCCCGGT*Cgtgagcctatcctggtgactgttctactacactc
TES01_0052_E10.b : TCTGCTGCTTCGCCGACCCCCCGG*TCtggaggctttcctggggaactgttcttactaaa
PST01_0047_D03.b : TCTGCTGCTCCGCCGACCCCC*GG*TCGTGAAGGCTATCCtggtgacttgtctacttaca
KDN01_0032_H10.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGGGAGGGCTATCCTGTTGACGTGTTCTACCTAA
TES01_0017_F10.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAAGCCTATCCTGGTGACGTGTTCTACCTA*
PST01_0091_B11.b : TCTGCTGCTCCGCCGAACCCCCGG*TCGGGAGGCCTATCCGGGGGAATTGGTCCACCTAA
KDN01_0051_G01.b : ctgccccgcccaaacccccgggtcgtgaggcccaatccgggggaaattgttttaactaaa
KDN01_0027_C06.b : acaaagaactaacctacaaaatttctatcttctgaattataaccctcacaaaaaaaataa
TES01_0098_A12.b : gtctccccaaacccccggtcgggaaggcattttccgggggaaggggttttaccctacctc
SKNB1_0071_B08.b : cccaaacccccggtcttgaagctatcccggtgagttttccactacccccccccctgctga
KDN01_0039_B03.b : TCTGCTGCTCCGCCAACCCCCCGT*Cgtgaggcctaatctggtgaactggtccacttacc
KDN01_0036_D02.b : TCTGCTGCTTCCCCGACCCCCGGT*Cgtgagggctaacctgttgactgttctaactaaac
KDN01_0079_H01.b : TCTGCTGCTCCGGCGACCCCCGGG*TCGTGAGGCCTATCCTGGggacctggttctactaa
KDN01_0075_E12.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGGCTATCCTGGTGACGTGTTCTACCTAa
PST01_0026_B10.b : TCTGCTGCTCCGNCGACCCCC*GG*TCGTGAAGCCTATCCTGGTGACGTGTTCTACtacc
PST01_0067_A12.b : TCTGCTGCTCCCGCGACCCCCCGGGTCGTGAAGCCTATCCTGGTGACGTGTTCTACCTAA
TES01_0077_G07.b : tttttttgaggatatagtgtgatcaactttctttttaccctttgtaaaatgatttcacca
SKNB1_0016_A07.b : TCTGCTGCTCCGCCGACCCCCCGGgtcgtgaagcctatcctg
MLTL1_0085_C04.b : ccaccccccccccggaaagggccaaaaaaaaactttggggggccctttcctttcccccca
BFLT1_0147_B07.b : ccccggggggtgaggccaatccgggaagtgttttcacccacccccccgtcgcgggaaaaa
ADR01_0028_E09.b : TCTGCTGCTCCGCGACCCCCCGGT*Cgtgaagccatcctggggacgtgttctactaactc
DCI01_0118_F04.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGcctatcctggtgactgttctacctacac
KDN01_0022_A07.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0092_C02.b : TCTGCTGCTCCGCCGACCCCCNGT*Cgtgagcctatcctgttgacgtgtctacctacact
TES01_0088_E02.b : TCTGCTGCTTCGCCAACCCCCCGG*TCGTGAAGGCTATCCTGGTGACCTGTTCTAACTAC
LNG01_0042_B08.b : TCTGCTGCTCCtggtgacgtgttctacctacactcccgtctgctggagagagcggccaaa
SMG01_0103_D12.b : TCTGCTGCTCCGCCGAACCCCCGG*TCGTGAAGCCTATCCTGGTGACGTGTTCTAC*TAC
TES01_0085_H04.b : tttctgctggtcccgccagaccccccgggtcgggaggccctatcctggtgaaagggtttt
TCH01_0001_D09.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
SMG01_0052_B10.b : TCTGCTGGCTCGCCGACCCCCCGT*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
THY01_0041_H01.b : TCTGCTGCTCCCCCCACCCCCCGG*GCCTGAGGCCTATCCTGGTGACtggtctacctaac
AMP01_0061_G02.b : TCTGCTGCTCCGCCGACCCCCCG**TCGTGAGGCCTATCCctgatgacgtgtctactaca
MLN01_0070_D09.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
KDN01_0063_D06.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0080_H12.b : TCTGCTGCTCCGCCGACCCCC*GG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
DCI01_0060_F02.b :
PCT01_0004_F11.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGNTGACGTGTTCTACCTAC
MLTL1_0075_F01.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0090_B07.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
PCT01_0022_H01.b : TCTGCTGCTCCGCCGAACCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0044_D03.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
CLNT1_0038_B10.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
OVRT1_0146_E09.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0085_F05.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
THY01_0109_F12.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGGCTATCCTGtgaagtgttttaccataa
UTR01_0083_H03.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLTL1_0036_B10.b : TCTGCTGCTCCGCCGGCCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
PBL01_0096_C03.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
TES01_0031_B10.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
TES01_0063_A05.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLN01_0062_D06.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
TES01_0015_B10.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
TES01_0059_B06.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
KDN01_0092_G03.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTGAGGCCTATCCTGGTGACGTGTTCTACCTAC
MLN01_0055_B02.b : TCTGCTGCTCCGCCGACCCCCCGG*TCGTAAGGCCTATCCTGGTGACGTGTTCTACCTAC
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
---------+---------+---------+---------+---------+---------+ 1200
CBLT1_0007_E04.b : aaagaacaagcttcgggggggcccttgcggtttaatatcaaacaaatgggggtgttgttt
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : aggggcaaaaaaaaagaatcttgggggggggcctttaaccctttaaaattctaaaaaaaa
PST01_0095_C03.b : ctgaaaaaacggcaaaataacaatccttcggggggggcccttgacgtttaacagcataaa
MLN01_0048_E07.b : tcccttcgccggaaaaacggccaaataaaaaggctttcggggggcccctgagggtttcca
MLTL1_0053_G06.b : tgttcttccccccttctccgggaaattttgaaaattcaaaccccccacattttgtttggg
TES01_0030_G06.b : accccgtccggcgggaaaaaaccgcccaaaaaaacaaagactttcgggggggggctcctg
TES01_0032_B05.b : aaagggccaaaataaaaaaactttcggggggggccccttaatggtttcccaccctctaaa
CBLT1_0051_H09.b : aaaaaaaaagcttggggggggcccttagcgttataaaaaaaaaaaaaagtgggttttttt
SMG01_0072_A06.b : cccacccccccccccccccgcggggaaggggggggggaaaaaaaaaattttttttttttg
THY01_0026_F10.b : cttaatgctccaccattatcatccctgaatgcactctgcccctcctcccaccctatgttg
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : tccgtggggaacagggttattccctcctcaacaccccccccccctcctgttgtttgggaa
THY01_0003_D01.b :
OVR01_0022_H03.b :
THY01_0002_E02.b :
SMG01_0023_D11.b : gcccaaaagaacaagctttggggggggccccttggggtttctccccctcaaaaacaaagg
THY01_0044_C10.b :
SMG01_0093_G08.b : tttctggggggccccttaggtttaacaattaaaaaaagcggggggtgtttgtttttccca
SMG01_0007_C10.b : tcggggggggccttttaggttttacgccttcaaacaaagggggtagttttttatatttcc
TES01_0057_E03.b : gccaaataaacaaactttcgggggggcctctaacggtttacaaccctcaaaccaagtggg
LNG01_0045_G11.b : gacgttttttccttcccctttcca
UTR01_0035_D07.b :
SMG01_0103_C12.b : aactttcgggggggccttagggtttcccctcccgaaaaaatggggagggttgtttaattt
SMG01_0095_A07.b : aaaaacggccaaaaaacaaagctttggggggggcccctgacggttaacaacccccaaaca
OVRT1_0118_F10.b : cccctcgcgggaaaaagggcgccaaaaaaaaaagacttctggggggggccccttgagggt
OVRT1_0086_G09.b : ggaaaagcgccaaaatgaacaggctttcgggggggcccttgaaggtttaaccgcacggaa
OVR01_0062_F06.b : taaccttcccgtttgcgtgaaaaaaacgggcaaatgtgaacaaatctttttggg
LNG01_0026_E04.b : ttctaccccaacccctcccccgctcttggctgggaaaaaaaaagcgggccccaaaaaata
SMG01_0039_C05.b : gaaaaagggccaaaagaaaaacctttggggggggccctgtaaggtttaaaaccctcaaaa
OVRT1_0115_G03.b : gaaaacggcaaaaaaaaaagttttgggggggcccctaagggtttccaatacaaaaaaaag
PST01_0038_C12.b : ccgtctgctgaaaaaacggccaaaaggaacgaagctttcgggggggctccttgaatgcta
BFLT1_0107_H09.b : ccgaaaagcgccaaaaaaacaagactttggggggggcccttaggttttaaacttcaaaaa
OVRT1_0039_B11.b : ctcgcctggaaaaacggcccaaagaacaaaggtctcgcgggggggtcctgtgagggttta
BFLT1_0012_H08.b : gctgggaaacggccaaaagaacaagctttcggggggggtcctagaggctttcaatacaca
THY01_0034_D05.b : tctaacctaccctttcccccctcttgcttgggaaaaaaaaccggggccaaaaaatggaaa
THY01_0088_C05.b : tacctacccttcccccttctgcctggaaaaaaagcgggccaaaaaattaaaacaaaatcc
PBL01_0101_G07.b : ccgtctgctgaaaaagcggccaaatgaacgatgcttcggggggggtcctgacggctaaca
OVR01_0020_D04.b : ctacccttcccgttttggttggaaaaaaaacgggcccaaaaatgaaaccaagggcttttt
CLNT1_0032_G11.b : tcccgtttgctggaaaaacggcaaaatgaacaagctttcgggggggggcctttaagggtt
ITT01_0048_F06.b : ACTCCttcggctggaaaaaacgccaaatgaacaagctttcgggggggcccttggatgcct
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : atctctcccattctgatcgcttgaattctccagactcccctccccccatactcccccccc
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : aaaaaaaaaaactctctcgggggggccccttttggtttacaaccctccaaaacaatgtgg
TES01_0087_A12.b : ggggtgggtgggggcctctaccctgggggaaaggggtttttctacaaaaaacaccccccc
PTG01_0072_D03.b : ggggccaaaaaaacagctttggggggggccccttagggttttcagtacaaaaacaagggg
SMG01_0080_E11.b : ccaaaaaaaaaagttttggggggggccctggaggtttcaagccacaaaaaaaagggggag
OVR01_0047_D04.b : ctacacttccccgttgtggtgggaaaaaagggggccaaaaattgaaacaaatgggttttt
KDN01_0053_G01.b : ACTCCgtctgctggagaaaccggcaaaatgaacgagctttcgggggtggctcctgactgc
PST01_0062_D01.b : ACTCCgtctgctggaaaagcgccaaaatgaacaatgcttcgggggggcttcttgaatgtt
ITT01_0077_A05.b : ccctcggctggaaaagccgccaaatgacgatgcttcgggggtgctcctgactgcttacaa
BFLT1_0082_E10.b : cctccgtctgctggaaaaaggggccaaaatgaacaaagccttcggggggggcccctggaa
KDN01_0052_D07.b : CCCCCCCTCTGGTGAAAAAAACGGCCAAAATGAACGATGCTTTCcgggggggctccctta
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : tcaaaacccccctaaattttgttttcggggccccccccacaaggggacaaaagaacataa
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : aaaagcgcaaaaaaaaaaagtttcgggggggcctcttaatgttttcaatacaaaaaaaaa
CLNT1_0121_H11.b : ggccaaaaaaaaaacttttggggggggccttgacggtttaacaattaaaaccaagtggta
OVRT1_0026_G10.b : tcccctcgggtggaaaaaacggccaaagaacaaatgctttcgggggggcccctgaatgtt
PST01_0073_F06.b : ctcccgtctggctggaaaaccgcccaaaagaaacaatgctttcggggggggccctttaat
ITT01_0026_F03.b : ctcccgtcgctggaaaaagcgccaaatggacaatgcttcgggggggctcctgattgctta
MLN01_0076_G03.b : cgttcggtggaaaagcggcaaatgacaatgctttcgggggggccctgaggctttccactt
THY01_0045_E04.b : cccccccttaccccctcctctctcctctttcaacctcccacctccatcactcctctcctc
THY01_0119_C06.b :
SKNB1_0004_F11.b :
PCT01_0035_H05.b : acaaactttcgggggggccttacggtttacatctccaaacaaactgggatttttgtttaa
PCT01_0009_E01.b : cggcggagaaaaggccaaaaaaaaaaagctttccgggggggccttgaaggttttacaacc
KDN01_0090_E07.b : tggaaaacggccaatgaacaaactttcggggggctcctgatgcttacaatcatcaaacaa
PCT01_0004_B05.b : tcgctggaaaaaccgccaaatgaacaagccttcgggggggctcttgacgcttaacaacct
PST01_0098_G04.b : cccgtcggctgaaaaaagcgccaaaagaaaaaagcttcgggggtggcccttgaacgcttt
PST01_0078_H02.b : tccgtttgctggaaaaacggccaaattgacaagctttcgggggggcccttgactgcttac
PST01_0095_E09.b : tcccgtctgctgaaagaaacggccaaatgaccaagctttcgggggtggctccttaatgtt
TES01_0096_B06.b : gaacaagctttcgggggggtccttgaagggnttacagtcactgaaacaagccggggaagg
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : cccgggaaaagaggcctaaaagaaacaacttttgggggggccccctttcgtgtttcccaa
BFLT1_0144_B08.b : tcccgtctccggggaaaaaccgcccaaaaaaaacaaagtttctgggggggccctctgagg
MLTL1_0054_H05.b : tttttgccctataaagggaaccccggggggaaaaaatttaccttaaagggttccccccct
BKFL1_0007_F04.b : cctttatggttttaccaacaaaaaaagggtggggttctcattccccctctttttcctgga
DCI01_0042_G08.b : aggccaaaaaaaaaagctttggggggggccctagggtttttaaccttaaaaaaaccggga
MLTL1_0004_B05.b : agctttgggggggcctttagcttaacaacacaaaaaaggggttggtttcttttcccaact
LVRM1_0107_D12.b :
DCI01_0012_F02.b : taaccttaaaaaagtggggtgtctttattccaacacttctccctggaaatttgaaaaaag
OVRT1_0007_B09.b : aaaaaccgcaaaaagaaaagccttcggggggggctcttaaggcttacaaacaaaaaaaaa
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b :
HTMT1_0125_B06.b : atcttcgtggggctctgaagctacaccaaaaaaaactggattgtggctatccacaagctt
DCI01_0030_H12.b : ggggggtgtg
HTMT1_0011_H06.b : aagaagagggcaaaaaaaaaaagcttttggggggggggcccctgtggggctttacagtcc
CBLT1_0092_F01.b : tctgccgaaaaaacgccccaaataaaatagttttcgggggggttccttacggcttaacct
HTMT1_0097_B02.b : aagaaaaaaagcttcgggggggcccttaaggtttacaataaaaaaaaaaaggggggggtt
SPL01_0053_F05.b :
CBLT1_0022_C05.b : aaacgccaaaaaaaaacgctccgggggggcccctgagggtttacaaccacaaaaaaaagg
HTMT1_0113_C02.b : caaaagaaaaacttcggggggcccctgaggctttaccacaaaaaaagggggtgggttttt
LNG01_0103_E05.b : gccaaatgaacagctttcggggggccctgaaggtttcagtatccaaaaaagtgggatgtt
OVR01_0041_F03.b : gttttctacctaaaaccttcc
OVRT1_0006_E06.b : cgccggaaaaacgccaaatgaacaagctttcgggggggtccttgatggttaccaatatta
OVR01_0039_E04.b : ctcaaccaaacacctccccgtccggctgggaaaaaaaaacggacccaaaaaataaaaaaa
ILNT1_0025_F06.b : tccccgtggctggaaaaggggccaaataaaccaaagctttcgggggggctcctgtatggt
MLN01_0077_B04.b : cctctgctggaaaaacggcaaaatgacaatgtttcggggggggccctgacggtttaccgt
THY01_0105_A01.b :
AMP01_0003_B07.b : ag
LVRM1_0187_H06.b :
OVRM1_0056_H10.b :
LVRM1_0002_F06.b :
PTG01_0034_C07.b : ctgagaaaaggcgcaaaataaaaaactttcggggggggcccttttgcgtttaccccttca
AMP01_0037_D04.b : ggggggctccttaacttttaaaaaaaa
TCH01_0096_A02.b : caagactttcgggggggcccttaacggtttacagtttagaaacgagggttgattggtgct
MLTL1_0027_H11.b : gtttttaaatcaaaaaaaaggggggggggtgcttttatccccagttttttctcgggaggg
DCI01_0018_F06.b : ttaaacccaaaaaccgggaggttgcgttattccaccgctttccccgggagaattttgaaa
BFLT1_0004_F10.b :
AMP01_0046_E10.b : cacccccccgcgtgggggaagaagaagggccccaataa
OVR01_0008_G03.b : tttcc
CLNT1_0132_C10.b : aaagaaaaagctttggggggggcctgagttttaaaaaccaaacaaagtggtatgtttgtt
BFLT1_0079_A09.b : ccggaaaaaagcggcaaaaaaaaaagactttcgggggggtcctttgagggtttaccgccc
HTMT1_0015_G05.b : ctctgctggaaaaaacggccaaataaaaaaaggcttcgggggggggccctgtaaggtttt
THY01_0095_E09.b :
BMWN1_0021_E04.b : aaaaaccgccaaagaacaaccttcgggggggcccctgacggttaacattaccaaaaaaat
LNG01_0027_C01.b : acccttacacccccctccctcgcttggaaaaaaaccggcccaaaaagaaaacaaaatctt
LNG01_0016_B01.b : ttcctaccttaaaccttccccctcctggcctgggaaaaaaaaaaccgggccccaaaaaaa
ADR01_0083_B04.b : tccgtctgctgaaagaacgccaaaatggaccaagctttcggggtggctcctgactgtttt
OVRM1_0039_G11.b :
OVRM1_0028_B01.b :
LVRM1_0184_G04.b :
OVRM1_0171_F10.b :
TES01_0035_F06.b : ttcggggggggccctttttgtgtttttccacaaaaaaaaaaaagggggggggggtgtttt
LVRM1_0096_A09.b :
OVRM1_0037_A04.b :
PTG01_0052_D06.b : aaaatttgggggggggcctttttttttttttctattaaaaaaaaagggtggtggggtgtt
SMG01_0068_B01.b : attctttgggggggccctttatgtttcaacaccagaaacaaagattggggtgttggtttt
OVRM1_0136_B08.b :
OVR01_0076_A03.b :
OVRM1_0167_B01.b :
OVRM1_0190_E10.b :
OVRM1_0218_H01.b :
OVRM1_0056_A07.b :
THY01_0059_C01.b :
OVRM1_0087_H02.b :
OVRM1_0206_E07.b :
OVRM1_0067_F12.b :
OVRM1_0037_G07.b :
OVRM1_0124_F07.b :
OVR01_0099_G02.b : taccgcc
SMG01_0071_A01.b : aaagacgcaaaaaaaaaaaaattcttgggggggccccttggggtttttacccccaaaaaa
OVRT1_0140_A09.b : aaaaaatctttggggggggccctagggttcacaaatacaaaaaaagggggtgggtttgtc
OVR01_0069_B01.b : ccccgtcggtggg
UTR01_0045_B08.b :
TCH01_0054_C12.b :
THY01_0051_D05.b :
BFLT1_0112_G01.b : cgaggaaaaggccaaaaagaaaaaccttcggggggggccctgaagtttttcaatacaaaa
LVR01_0105_H12.b : ccctttccctggggtgaacgggggttttct
CLNT1_0140_G07.b : aaaaaacttcggtgggccccttagggttaaaaacaaaaaaaagggggtttttgtgttatt
BFLT1_0010_H12.b : ttggggaaaaagcgcccaaaagaaaaaagctttccggggggggcccttgagtggttatcc
OVR01_0042_H11.b :
SPL01_0084_C06.b : tttcactaaacatccccgtctggtg
ITT01_0070_E04.b : ctgaaaaacgggcaaaagaacaagccttcgggggggccccttgactgcttaccaccatca
SPL01_0041_G01.b : gttttctacccttaacacctc
SMG01_0028_E01.b : cgcggaaaagaccgccaaaaaaacaaacttttgggggggcccttaaagttttacacaccc
OVR01_0088_E05.b : tggggggaaagagggccaaaataaaaaaacttttcgcgggggcctcttaaaggctttcca
CLNT1_0034_F06.b : aaaaacggccaaatgaacaaggcttcgggggggctcttgaaggtttaccacttctgaaaa
BFLT1_0098_E08.b : aaacggccaaaataaaaaggcttccgggggggtcccttgaggctttccagtctcaaaaac
OVR01_0025_A09.b : agaggggtttcttaaccttaaccccttccccgccttgggctcggggaaaaaaaag
BFLT1_0090_C04.b : agaggccaaataaaaaagcttgggggggcccctgaagtctaccaccccaaaacaagtgga
OVR01_0052_A03.b :
ITT01_0091_E05.b : ggaaaaacgccaaatgacgagctttcgggtggcccctaatgcttacagtatcaaaaaagc
BFLT1_0108_E11.b : cggaaaaaacggccaaaaaaaaaacctttggggggggcccctgaagggtttacaccccaa
ITT01_0041_G04.b : ctggaaaagcgccaaaagaacaagctttcgtggggcccctgacgcttatcattatcaaaa
ITT01_0020_B05.b : tgaaaaacggcaaatgacgatgcttcgtgtggctctgatgcttacaatctcaaacaagcg
LNG01_0105_H01.b : ctgaaaaagcgccaaaagaacagctttcggggggcccctgacgctttacgtatcaaacaa
OVR01_0006_F06.b : tccccccccccccccccccctccttgccgggaaaaaaagggcggcccccaaaaatgaaaa
OVRT1_0096_C06.b : cgggaaagcgcccaatgaacaagctttcgggggggtcctgaaggtttacagcatcaacca
UTR01_0104_D02.b : cctccccttgcgggaaaaagcgcccaaaagaa
THY01_0202_A07.b : tcccttcccctcccccttcttccttgaaaaaaaacgggccaaaaaataaaaaaaatgctt
ITT01_0076_H10.b : cctctgcggaaaaaacggccaaataacaagcctccgggggggcccctgactgctttccag
ITT01_0022_C12.b : tcccgttggctggaaaaagcggccaaaaagacgaagccttcggggggggctccttaacgg
ITT01_0092_G11.b : ctcccgtcggctggaaaaaagcggccaaatgaaaaagtcttctggggggggcctcttgac
ITT01_0041_G10.b : ctccccgtctgctgaaaaaaacgccaaaatgaagaagctttcgggggggctccttgatgc
ITT01_0103_B06.b : ccgtccgctggaaaagcgccaaaatgacaagctttcgtgggggctctgacggcttacaat
ITT01_0050_G07.b : tcccgtctgctgggaaaagcgcccaaatgaccaagccttcgggggggctccttgactgct
ITT01_0024_A12.b : ctcccgtcggctggaaaaaccggccaattgtaccaagccttccggggggggtccttgaag
OVR01_0018_B08.b : ttacacttccccgtctggctgggaaaaaaacgggccaaaaatgaaaagaaatggtctttt
BMWN1_0041_D06.b : gtcgcgggaaagagggccacaaataaaaaaactcttggggggggcctcttggcggtttaa
PTG01_0062_G08.b : aaagaaaaaaatttcgggggggcccttaatgtttacaatccaaaaacaagggggtgtgtt
OVR01_0025_C06.b : tgtttctcacccacaaccctcccccctttgggcggggaaaaaaaaacagggcaaaaaaat
TES01_0001_C09.b : ctaaacctcccgtttggtttggaaagagcgggcccaatagaaaagaagccttccggtggg
TES01_0009_B09.b : ctcccctctgcggaaaaagcggccaaatgaacaagcctttcgggggggggtccttgacgc
UTR01_0041_C04.b :
CBLT1_0075_F04.b : acggccaaataacaagcctttggggggggcccttaaggcttacaattaccaaacaaagcg
HTMT1_0008_G09.b : ctggaaaaaccgccaaaaaacaagcttcgggggggctcttgatgcttaacgccacgaaac
PBL01_0051_G05.b : cgtctgctgaaaaagcggccaaatgacgagccttcgggggggctcctgacgctttacant
LNG01_0076_C10.b : ccgtctgctgaaaaaccggccaaatgacgaggctttggtggtggtccctgaatgcttacc
AMP01_0057_E02.b : cccccctcgcgggaaaaacgggccaaaaaaacaaaaggcttgggtggggt
THY01_0043_D08.b : gacccttccttccaccacacaccctctcccccatccccctgcgctacaaaacaaaaagcc
OVRM1_0022_C09.b :
TES01_0088_H10.b : aaaaccccccctttttctggaaaaaaaaaccccccaaaaagaaaaaagaactttttcgcg
OVR01_0073_E01.b :
LVRM1_0038_D02.b :
OVRM1_0191_E03.b :
OVRM1_0007_H01.b :
OVRT1_0112_C01.b : aacggccaaaagaacaaccttttgggggggcccctgtagggtttcaattccgaaaaagaa
BFLT1_0033_C10.b : aagcggccaaaataaaatcttttgggtgggcccccttaaggtttcagcccccaaaaacaa
SPL01_0008_F12.b :
ITT01_0067_H03.b : ctgcggaaaaagcggcaaatggaccagccttcggtggggcccttaacgctttacaatctc
OVRT1_0050_A03.b : gaaagaaaggcaaaaaaacaaaccttcggggggggcccttgaggtttccaatacttaaaa
ITT01_0040_D04.b : ACTCCgtctgcctgaaagagcggccaaatgaacgatgcttcggtggggcctcttgactgc
ITT01_0031_F08.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTgaa
TES01_0079_C05.b : ggggaaagaggggccaaaaaaacaatatcttttggggggggccctttgagggtttttccg
OVRT1_0139_G06.b : agatgccttcggggggcccctcagtgcttcacactttaaaaaagcgtggggagtgcgttt
TES01_0085_A11.b : ttcttcctaaacactccccctctgtggggaaaaaacacggccaaaaaaggaacaaaagcc
KDN01_0062_E06.b : gtctgctggaaaaacggcaaaatgacgagctttcggggggcctcctgactgcttacagtc
KDN01_0028_F05.b : cgtctgctggaaaaacggccaaatgacgatgcttttcggggtgcctcttgactgcttaca
TES01_0052_E10.b : ctcccgtctgctggaaaaaccgcccaaaggaacaaagctttccgtgggggcctctgaacg
PST01_0047_D03.b : ctccgtctgctgaaaaaagcggcaaattgacgatgctttcggggggggctcctgactgct
KDN01_0032_H10.b : CCTCCCGTCTGCTGGAAAAAACGGCCAAAAgaaccaaggctttcgggggggctcctgtat
TES01_0017_F10.b : ACTCCCGTCTGCTGGAAAGAGCGCCCAAAATGAccaggctttcgtgggtggccccttgac
PST01_0091_B11.b : ACTCCCGTCTGCTGAAAAAAGCGCCCAAAATGACCGAGGCTTCCGGGGGGGGCTCCTTaa
KDN01_0051_G01.b : ctcccgtttgctggaaaaaagccccaaaatgaaaaaagctttccgggggtgggcccttga
KDN01_0027_C06.b : aaacaattctcgcatcctgaaaatcataacagcttatctcaaaatcatcaacaatattat
TES01_0098_A12.b : ccccccttcttgaaaaaaacggcccaaaaaaaaaaaaaccttttggggggggggcccctt
SKNB1_0071_B08.b : aaaaagcgccccaataacaaaccttttcggggtggctcctgaatcttaacaaacctccaa
KDN01_0039_B03.b : tccccgtcgcttgaaaaagcggacaaaagaaccaagctttggtgggggctcctgacggtt
KDN01_0036_D02.b : ttccgtctgctggaaaaagcggcccaatgaacgaagctttccgtgggggttcttgaatgc
KDN01_0079_H01.b : actccggtctgctgggaaaaaccacccaaatggaacaagcctttcgggggtggctccttg
KDN01_0075_E12.b : ctcccgtctgctggaaaaacggcccaaagaacgatgctttcgggggggctctttgacgct
PST01_0026_B10.b : tccgtctgctgaaaaaacggcaaaatgacgagctttcgcgggggttcctgactgcttaca
PST01_0067_A12.b : ACTTCCGTCTGCTGaaaaaacgggcaaaatgaacaatgcttcgggggttggtccttgact
TES01_0077_G07.b : atggtggtggttttattatcaacaaaaaatttattgtatgtccccataacacccctcggt
SKNB1_0016_A07.b :
MLTL1_0085_C04.b : accacgggaggttgccatccacccccttccccgggaaatttgaaaaaattcaaagccccc
BFLT1_0147_B07.b : acccacaaaagaaaaaagctttggggggggggcccttggcgctttaaccacctcaaaaaa
ADR01_0028_E09.b : ccgtctgctggaaaaccggcaaatgaacgagcttttgggtggcccctgaaggctttcctt
DCI01_0118_F04.b : tccgtcttgctgaaagaacggcaaaatgacgaagctttcggggtggctcttgactgctaa
KDN01_0022_A07.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCNGTGGTGGCTCCTTGA
MLTL1_0092_C02.b : ccgtctgctgaaaagaccggccaaatgaccgagctttcggggggggctcttgacggctta
TES01_0088_E02.b : CTTCCCGTCTGCctggaaaaaacgggccaaatgaaccaagcttttcggggggggctcctt
LNG01_0042_B08.b : atgaacgatgcttttcggtggtgggctccttgactgctttaccagtcatcgaaacacaag
SMG01_0103_D12.b : ACTCCCGTCTGCTGGAAAGAACGGCCAAAAAGAACGATGCTTTCGGGGGTGGCTCCTgac
TES01_0085_H04.b : aacctaacttccccgtttggtggaaaaaaccggcccaaaatgaaacaatgtcttccgggg
TCH01_0001_D09.b : ACTCCCGTCTGCTGGAGAAGAGCGCCCAAATGAACGATGCTTCCGGTGGTGGCTCCTTGA
SMG01_0052_B10.b : ACTCCCGTCTGCTGGAGAGAGCCGGCCAAATGAACGATGCTTTCCGGGGTGGGCTCCTGA
THY01_0041_H01.b : ctccccgtctgctggaaaaagcggccaaaataaaccatgcttttccggggggggcttctt
AMP01_0061_G02.b : ctcccgtcntgtgnagaagcgccaaaatgacgatgctttcggtgtggctcttgactgctt
MLN01_0070_D09.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
KDN01_0063_D06.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
MLTL1_0080_H12.b : ACTCCGGTCGGCTGAAGAGAGCGGGCAAAATGAACGATGCTTTTCGTGGTGGCTCttgac
DCI01_0060_F02.b :
PCT01_0004_F11.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
MLTL1_0075_F01.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCCTGA
MLTL1_0090_B07.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
PCT01_0022_H01.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAA*TGAACGAATGCTTCGGTGGTGGCTCCTTGA
MLTL1_0044_D03.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
CLNT1_0038_B10.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
OVRT1_0146_E09.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTCGA
MLTL1_0085_F05.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
THY01_0109_F12.b : cccgccttttgaaaaa
UTR01_0083_H03.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
MLTL1_0036_B10.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
PBL01_0096_C03.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
TES01_0031_B10.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
TES01_0063_A05.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
MLN01_0062_D06.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
TES01_0015_B10.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
TES01_0059_B06.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
KDN01_0092_G03.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
MLN01_0055_B02.b : ACTCCCGTCTGCTGGAGAGAGCGGCCAAAATGAACGATGCTTTCGGTGGTGGCTCCTTGA
BKFL1_0106_H03.b :
BKFL1_0095_C01.b :
ILNT1_0008_B04.b :
20110601C-000204 : CTGCTTTACCAGTCATCGAAACACAAGCTGGTGATGTGTCTGCTTACATTCCAACCAACG
---------+---------+---------+---------+---------+---------+ 1260
CBLT1_0007_E04.b : attcaacagatttttcctcatagggagaattttgggaaaatttcaaagatccccccccaa
OVRM1_0022_D02.b :
BFLT1_0129_G11.b : gggggggaggtggtgttctatctccaaaaattttttttttagagggaagattattttgtg
PST01_0095_C03.b : acaaagtggtatgtttggttaattcaacaaatttttcaatctgaggaaaatttttggaac
MLN01_0048_E07.b : gtccaaaacaagctggtatgtctgctaattcacacacgttttcctttgagggaaattttt
MLTL1_0053_G06.b : gtccccaccaagggggaaaaaaatcaattttttcttctcccacccctttttttnnnnncc
TES01_0030_G06.b : taagggttttccaatcttccaaaaacaacctggggaaggtgccggcttaatctcacccaa
TES01_0032_B05.b : acaaaggggggaaggtgtgtgttatttccaccacaattattttcttcagagaggaaaatt
CBLT1_0051_H09.b : ttattccaacaatatttccccgggggagaatttgttaaaaattttcaagggacacccgcc
SMG01_0072_A06.b : tgtgttgtgttttttct
THY01_0026_F10.b : tcaaacctctctgtctcccccctccacaaatttctcgacacatctttcacaaccctttat
OVRM1_0132_G08.b :
OVRM1_0219_G05.b :
THY01_0043_A01.b : aaaaaaaaaagggcggcccaaaacaaaaaaagaaaaaagcaaatggcttttttttttttt
THY01_0003_D01.b :
OVR01_0022_H03.b :
THY01_0002_E02.b :
SMG01_0023_D11.b : gggagttgggtgttattttcccaacatttttttcttcgtgtggaaaaattttttgaacaa
THY01_0044_C10.b :
SMG01_0093_G08.b : acaatttttcctcaggagaaattttttaaaaaaattttcaaaaagccccccccccaaaat
SMG01_0007_C10.b : acacattttttttcttagaagaatttttttaaaaaaagtttccaaagacccccccccata
TES01_0057_E03.b : tattgttgtttaattcaccaagtttttcctccgtaggaaaatttttgaaaaaatttcaca
LNG01_0045_G11.b :
UTR01_0035_D07.b :
SMG01_0103_C12.b : caacacatttttcccatggggaaaaatttttgaaaaatttttcaaaaaaccccccccaaa
SMG01_0095_A07.b : agggggggatgttgcgttattcaacaaagtttttctctttggaggaaattttttgaaaaa
OVRT1_0118_F10.b : ttcacagtcaagaaacaaaggggtggtgttgtgtttttttaccaacagtttttttctccg
OVRT1_0086_G09.b : aacaggggggagagtgtggtttatttcaccaaagttttttttaagtgagggaaatttttt
OVR01_0062_F06.b :
LNG01_0026_E04.b : aaaaacaaaaagtccctttttttcggggtgggggggggggccctttctccctttttaaaa
SMG01_0039_C05.b : caaattggtatgggttgtttattctaaaaaagtttttcctttgagggaaatattttgaaa
OVRT1_0115_G03.b : ggggatgtggggttttttccacacgttttttcctgtgagaaaaattttggaaaatatttt
PST01_0038_C12.b : accatcctcgaaacaaaacgtgggaagggtcggcttaattccaaccaagtcatttcctcc
BFLT1_0107_H09.b : aaggggtatgtgtggtttatataaacaattttttctctagggagaattttttgaaaaaat
OVRT1_0039_B11.b : cagacatctaaaacagggggggaggggtggttttatttcaacaaggtttttctccggggg
BFLT1_0012_H08.b : aaacaatggggagtgcttggttaattcaccaagttttttctttggtggaaaatttctggg
THY01_0034_D05.b : aaaaaattggcctttttttttcggggggggggggggggggcctttccccc
THY01_0088_C05.b : cttttttcgggggggggggggcttcccctttttgaccag
PBL01_0101_G07.b : gtcatcaaaccaaactgggagtgttgcttatttcaaccacgtttttcctctggaggaaaa
OVR01_0020_D04.b : ccgggggggggggggctcccccttttgaactggggtttttttaccccaaacctccttctt
CLNT1_0032_G11.b : tcagccatgaaaccaagcgggggagggggtggttaattcaaccaagttt
ITT01_0048_F06.b : tacaaccatcaaacaaactgggatgggttgcttatttcaccaagttttttctctgaggga
OVRM1_0066_G06.b :
THY01_0123_A06.b :
THY01_0040_E09.b : cacccggcttcctacacaggacgcccttataactcttctacgtccagagacctcttcact
OVRM1_0189_F08.b :
OVRM1_0010_F04.b :
OVRM1_0125_B07.b :
PTG01_0103_B12.b : gttgttgtggtttaatttaaccaagatatttttacagaaaaaaatatttttgggaaaaaa
TES01_0087_A12.b : tttgtgcgagagaaaaaaccgccccaaaataaaaaacaaagactttctcgcggggggggg
PTG01_0072_D03.b : ggtgttttgtttattcacccagtttttttcctgaggggaatttttggaaaaaattctcaa
SMG01_0080_E11.b : tgttgtttaattttaacaaattttttctctgtgggaaatttttggaaaaaaatttccaaa
OVR01_0047_D04.b : ttcgggggggggggcgctctcccttttaacacggtcttttttttcacca
KDN01_0053_G01.b : taacagncatcgaaccaaggctgggaatggttggttaaatcaaccaagtcatttcatcct
PST01_0062_D01.b : taccatcatccaaacaagctggggaaggtctggtaatttcaaccaagtcatttcctcccg
ITT01_0077_A05.b : ccatcaaacaaccggggaggggtggttaattcacccaagtttccttccggaggacaattc
BFLT1_0082_E10.b : gggtttccagtcaccgaaaaaaagtgtgggagggttgttttaattcacacaatgtttttc
KDN01_0052_D07.b : aggctttcccaacatcaaacacaagggggggagggtcggcttaattccaccaaagttatt
THY01_0113_H05.b :
LVRM1_0183_E06.b :
PBL01_0027_B08.b : aagtttttctgttaaacccaaacaagtttttttaaaaaaccaaaaaatatggggtggcaa
OVRM1_0055_A09.b :
OVRM1_0208_B01.b :
OVRM1_0031_E06.b :
THY01_0048_H08.b :
PTG01_0050_A08.b : ggggggagggtggttatttcccacacaattttttcttatggagaaatatttttgaaaaaa
CLNT1_0121_H11.b : agtttgtctttttcccaaagttttttctataggagaaatttttgaaaaaatttcacaagg
OVRT1_0026_G10.b : ttacaattacgaaaaaaaatgggggaatgttttgtttttttcaaccaagtttttttctca
PST01_0073_F06.b : gctttaccgtcatcaaaacaaccggggaatgtttggtttaattccaccaagttatttcct
ITT01_0026_F03.b : cagtcacaaacacaacggggatgtgtcgcttaatccaccaattatttcctctggagaaaa
MLN01_0076_G03.b : cgaaaaaagtggggtaggtggctaattccccaaggttttctctgtaggagattcttggaa
THY01_0045_E04.b : cctatctctcctcttcctcaccatatctcttctcctcctctcctccca
THY01_0119_C06.b :
SKNB1_0004_F11.b :
PCT01_0035_H05.b : tcaacactgttttcctttgaggaaatttttgaaaaatttccaaagaacccccccctaatg
PCT01_0009_E01.b : tcaaaacaaagggggtattttgtgtttattccaacaaattttttcttttggaggaaattt
KDN01_0090_E07.b : actggggagggtctgttaaattcaacaaagtattcatcatatggacaatttcttgaaaca
PCT01_0004_B05.b : cgaaacaaactgggatgtgtcgttaattcaacaagtttttcctctgtaggaaaatttttg
PST01_0098_G04.b : ccagtcaccaaaacaactgtgtgatgtctgcttaattcaaacaagctattccatccgagg
PST01_0078_H02.b : atcatcaaaacaacctgggaggggtggctaaattcaacaagttttttcttcctgaggaaa
PST01_0095_E09.b : tacaatctcaaacaaagctggggatggttggcttaattccaccaagtcatttcctcatga
TES01_0096_B06.b : tgtggtttatttcaaccaagtttttcttcctgaaggacaaatttctggaacacaattgtc
LVRM1_0027_D03.b :
HTMT1_0118_E12.b : cttcaaaaacaggggggaggtgtttttttatttacaacaagtttttttctcaggaagaaa
BFLT1_0144_B08.b : tgttcacaaaccatctaaaaacaagggtgagtgtgtttgctttttttcacccaattgttt
MLTL1_0054_H05.b : ccttataaagcaagggttccaaattttggggaggaaacccccttcccctnnaannnnnnt
BKFL1_0007_F04.b : gaattttgaaaattttcaaggccccccccattggtttctctggggggtcccacccgcaaa
DCI01_0042_G08.b : ggtggtttatttcccacagctttctccctggagaa
MLTL1_0004_B05.b : ttttcccggggagaatttttaaaaattttaaaaacccccccaagtgggtgtcccgggggc
LVRM1_0107_D12.b :
DCI01_0012_F02.b : ttccagaccccccccaactgttgttcctggggggcccccaccccacggggggcaaaaaag
OVRT1_0007_B09.b : aggtgggagttttgcctaatttcaccagttttttctaatgagaggaattttgggaaaaaa
THY01_0110_E01.b :
OVRM1_0223_F12.b :
OVRM1_0149_F02.b :
OVR01_0072_H10.b :
HTMT1_0125_B06.b : cctccgagaaattctggaaaaatttcaagtccccgccatagtgttgtatcgggaatgccc
DCI01_0030_H12.b :
HTMT1_0011_H06.b : tcaaaaacaaaccgtggggtgtgttgttttaatttcaacacaaggtttttttcccacgga
CBLT1_0092_F01.b : ccaccaaaacaagcgggtgatgtgtagcctatactaaacagtatattctcttctgataga
HTMT1_0097_B02.b : tttttatttcaacaaggtttttcccttgagggaaaattttggaaagaaatttctaaagga
SPL01_0053_F05.b :
CBLT1_0022_C05.b : tggtttgtgttttatttacaccaattttttcctagggggaattttttgggaaaaaatttc
HTMT1_0113_C02.b : tttcaaaaattttttatcgaggaaattcttaaaaaagtgtaaaagaaccccgcacaaggt
LNG01_0103_E05.b : ggttattcaccagtttttttattatgaaaatttttgaaaaatttcaaagtccccccccac
OVR01_0041_F03.b :
OVRT1_0006_E06.b : aaacaagttggtaggtttgctatatttcaacagtattttactctggagaaaattttggaa
OVR01_0039_E04.b : aaatgtttttttttggggggggtgggtgccctcccttttttaaacctgttttttttaatc
ILNT1_0025_F06.b : tataaaacataaaaaaaagtgggaaatgtcgggttaattcacacgagtgtttctgatgtg
MLN01_0077_B04