
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000217

Length: 1,481

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPGolli-MBP isoform 1 [Homo sapiens]. 389e-108
Contig/Assembly ProteinMBPmyelin basic protein isoform 3 [Homo sapiens]. 3272e-89O
Contig/Assembly ProteinMBPmyelin basic protein isoform 1 [Homo sapiens]. 3133e-85O
Contig/Assembly ProteinMBPmyelin basic protein isoform 4 [Homo sapiens]. 2964e-80O
Contig/Assembly ProteinMBPmyelin basic protein isoform 2 [Homo sapiens]. 2818e-76O
Contig/Assembly ProteinMBPGolli-MBP isoform 2 [Homo sapiens]. 1834e-46

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMbpmyelin basic protein isoform 3 [Mus musculus]. 3201e-87O
Contig/Assembly ProteinMbpmyelin basic protein isoform 1 [Mus musculus]. 3063e-83O
Contig/Assembly ProteinMbpmyelin basic protein isoform 5 [Mus musculus]. 2893e-78O
Contig/Assembly ProteinMbpmyelin basic protein isoform 2 [Mus musculus]. 2757e-74O
Contig/Assembly ProteinMbpGolli-Mbp isoform 1 [Mus musculus]. 2588e-69
Contig/Assembly ProteinMbpmyelin basic protein isoform 6 [Mus musculus]. 2256e-59O
Contig/Assembly ProteinMbpmyelin basic protein isoform 4 [Mus musculus]. 2111e-54O
Contig/Assembly ProteinMbpGolli-Mbp isoform 2 [Mus musculus]. 1681e-41

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPPREDICTED: similar to Myelin basic protein (MBP) (Myelin A1 protein) (Myelin membrane encephalitogenic protein) isoform 1 [Canis familiaris]. 3333e-91O
Contig/Assembly ProteinMBPPREDICTED: similar to Golli-mbp isoform 2 isoform 2 [Canis familiaris]. 1873e-47

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPmyelin basic protein [Bos taurus]. 399e-111

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPmyelin basic protein [Sus scrofa]. 364e-101O
Contig/Assembly ProteinLOC100625007PREDICTED: myelin basic protein S-like [Sus scrofa]. 3024e-82O

Assembly Members: 346      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
HTMT10035H01HTMT1_0035_H01.bFS666760 AK391945
HTMT10038D01HTMT1_0038_D01.bFS666885 AK391966
HTMT10047D10HTMT1_0047_D10.bFS667504 AK392063


SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000217 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CBLT1_0023_A08.b : nnnaacgacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0050_B08.b : nttttgcgacggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_D11.b : nnaagttttttttttggacggttagaggccgtxxxx
CBLT1_0077_C07.b : ttttacgaggtagaggccgtxxxx
HTMT1_0126_A09.b : tttttggacggtacgacgxxxxxxxxxxxxxxxxxx
HTMT1_0038_C01.b : ttttggagagtacgaxxxxxxxxxx
HTMT1_0038_D01.b : ttttggcaggtacgaxxxxxxxxxx
CBLT1_0055_F02.b : tttttagcaggtagacgxxxxxxx
HTMT1_0079_B03.b : tttttccgacggtagacg
HTMT1_0145_A10.b : nttccttttttttttggacgag
CBLT1_0042_C01.b : nnncca
HTMT1_0012_E08.b :
HTMT1_0012_F03.b :
HTMT1_0006_A04.b :
HTMT1_0003_B02.b :
HTMT1_0005_F06.b :
HTMT1_0111_E01.b : t
HTMT1_0037_B01.b : tt
HTMT1_0035_E04.b :
CBLT1_0040_F03.b :
HTMT1_0027_C08.b :
HTMT1_0012_H10.b :
HTMT1_0011_B07.b :
CBLT1_0093_A09.b :
HTMT1_0144_G09.b : naaaaagaaattttattt
CBLT1_0068_C08.b :
HTMT1_0109_F08.b :
CBLT1_0038_E04.b :
HTMT1_0089_E09.b :
HTMT1_0014_H01.b :
HTMT1_0087_A04.b :
CBLT1_0078_G12.b :
HTMT1_0050_A03.b :
CBLT1_0086_E03.b :
HTMT1_0028_C05.b :
HTMT1_0042_F09.b :
HTMT1_0109_A05.b :
HTMT1_0006_E11.b :
HTMT1_0134_F06.b : ncccg
CBLT1_0042_E07.b :
HTMT1_0134_C07.b : nccgtctt
CBLT1_0072_C10.b :
ILNT1_0001_B08.b :
CBLT1_0078_C11.b :
CBLT1_0061_E10.b : ncccg
HTMT1_0002_C03.b :
HTMT1_0025_D10.b :
HTMT1_0002_F07.b :
HTMT1_0128_H06.b : tacatgaaaaggcgccacttttttttcaactcccacagggggttttaagagatgagtant
HTMT1_0064_A02.b : ttttttagacggtacga
CBLT1_0073_C05.b :
HTMT1_0138_A04.b : nnnccc
HTMT1_0025_F09.b :
HTMT1_0105_A01.b :
HTMT1_0120_E04.b :
HTMT1_0010_E11.b :
CBLT1_0039_B10.b :
HTMT1_0117_G02.b :
HTMT1_0107_A07.b :
HTMT1_0106_C10.b :
HTMT1_0104_B07.b :
HTMT1_0106_A11.b :
HTMT1_0137_G02.b :
HTMT1_0057_G09.b :
HTMT1_0047_D10.b :
CBLT1_0056_D12.b :
HTMT1_0047_F01.b :
HTMT1_0044_G09.b : nnnnnn
HTMT1_0141_E10.b :
HTMT1_0149_G10.b :
CBLT1_0055_C05.b :
CBLT1_0021_D08.b :
HTMT1_0099_B11.b :
HTMT1_0121_B03.b :
HTMT1_0151_F05.b :
HTMT1_0011_A04.b :
HTMT1_0010_H05.b :
HTMT1_0025_A07.b :
HTMT1_0021_A06.b :
HTMT1_0095_B10.b :
HTMT1_0021_G07.b :
HTMT1_0086_H08.b :
HTMT1_0037_B06.b :
HTMT1_0013_B03.b :
HTMT1_0065_B01.b : nnccc
HTMT1_0028_B11.b :
CBLT1_0037_B12.b :
HTMT1_0118_B12.b :
HTMT1_0117_E09.b :
CBLT1_0046_C06.b :
CBLT1_0028_G06.b :
HTMT1_0111_D11.b :
HTMT1_0092_C07.b :
HTMT1_0013_D07.b :
CBLT1_0076_G10.b :
HTMT1_0098_B07.b :
HTMT1_0064_B07.b :
HTMT1_0133_A12.b : nnnggc
HTMT1_0048_C02.b :
ILNT1_0002_G10.b :
HTMT1_0094_D10.b :
HTMT1_0046_G11.b :
CBLT1_0034_A11.b :
HTMT1_0083_G02.b :
HTMT1_0042_A07.b : nncc
HTMT1_0056_H09.b : nggata
HTMT1_0087_A03.b :
HTMT1_0060_E10.b :
CBLT1_0044_D03.b :
HTMT1_0016_A07.b :
HTMT1_0061_H06.b : nttt
HTMT1_0139_A10.b : nnncccg
CBLT1_0053_F07.b :
CBLT1_0034_F12.b :
HTMT1_0076_H02.b :
CBLT1_0067_B02.b :
HTMT1_0007_C05.b :
HTMT1_0041_C07.b :
HTMT1_0036_E07.b : ggatggtacgxxxxxxxxxxxxxxxxxxx
HTMT1_0010_C06.b :
HTMT1_0126_H07.b :
HTMT1_0113_A02.b :
HTMT1_0120_A12.b :
CBLT1_0024_B08.b :
HTMT1_0118_H02.b :
HTMT1_0045_F04.b :
HTMT1_0053_C11.b : nngg
HTMT1_0042_E11.b : nnn
CBLT1_0067_E11.b :
CBLT1_0074_F01.b :
HTMT1_0136_H12.b :
HTMT1_0126_E03.b :
HTMT1_0147_C10.b :
HTMT1_0041_H02.b :
HTMT1_0117_D03.b :
HTMT1_0034_B04.b :
CBLT1_0077_E12.b :
HTMT1_0118_F12.b :
HTMT1_0066_C01.b :
HTMT1_0073_B12.b :
CBLT1_0072_H09.b :
HTMT1_0041_A02.b :
CBLT1_0005_E10.b :
HTMT1_0111_A02.b :
HTMT1_0076_C01.b :
HTMT1_0122_D09.b :
CBLT1_0009_G11.b :
HTMT1_0093_H12.b :
HTMT1_0060_B12.b :
CBLT1_0034_H05.b :
HTMT1_0059_D04.b :
CBLT1_0068_G08.b :
HTMT1_0115_B01.b :
HTMT1_0058_C04.b :
CBLT1_0073_F08.b :
HTMT1_0013_A02.b :
CBLT1_0067_B11.b :
HTMT1_0119_B12.b :
CBLT1_0023_G10.b :
HTMT1_0127_H12.b :
HTMT1_0111_F07.b :
HTMT1_0105_F06.b :
HTMT1_0117_H09.b :
CBLT1_0073_B11.b :
HTMT1_0119_D08.b :
HTMT1_0126_F11.b : nttacaagt
HTMT1_0128_E02.b :
CBLT1_0050_C05.b :
HTMT1_0035_H01.b :
HTMT1_0035_D11.b :
CBLT1_0096_H03.b :
HTMT1_0140_H10.b :
CBLT1_0038_D11.b :
HTMT1_0132_F08.b :
HTMT1_0016_D05.b :
HTMT1_0097_G08.b :
CBLT1_0041_C10.b :
HTMT1_0121_B01.b :
HTMT1_0113_B09.b :
HTMT1_0077_E08.b :
CBLT1_0041_D07.b :
HTMT1_0148_A09.b :
HTMT1_0132_F03.b :
HTMT1_0140_C12.b :
HTMT1_0140_F06.b :
CBLT1_0024_F01.b :
HTMT1_0106_E05.b :
HTMT1_0099_C09.b :
HTMT1_0101_E05.b :
HTMT1_0021_A08.b :
HTMT1_0128_G08.b :
HTMT1_0120_B12.b :
HTMT1_0028_G05.b :
HTMT1_0060_C11.b :
HTMT1_0044_H10.b :
HTMT1_0026_D07.b :
CBLT1_0060_G12.b :
HTMT1_0105_B03.b :
CBLT1_0011_E06.b :
HTMT1_0135_B04.b :
CBLT1_0080_E02.b :
CBLT1_0064_A08.b :
HTMT1_0139_E01.b :
CBLT1_0090_F01.b :
HTMT1_0034_H09.b :
CBLT1_0014_C12.b :
CBLT1_0088_A03.b :
HTMT1_0106_B11.b :
HTMT1_0064_G04.b :
HTMT1_0062_E07.b :
HTMT1_0095_A12.b :
HTMT1_0150_D11.b :
HTMT1_0122_B12.b :
HTMT1_0141_H07.b :
CBLT1_0040_B05.b :
CBLT1_0052_A10.b :
HTMT1_0025_C06.b :
HTMT1_0067_H07.b :
CBLT1_0082_A09.b :
HTMT1_0013_F01.b :
HTMT1_0130_C05.b :
HTMT1_0099_A06.b :
CBLT1_0036_C05.b :
CBLT1_0037_B04.b :
HTMT1_0132_A04.b :
HTMT1_0070_G03.b :
HTMT1_0111_H01.b :
HTMT1_0100_F01.b :
CBLT1_0044_C08.b :
HTMT1_0133_A10.b :
CBLT1_0075_B12.b :
HTMT1_0027_B01.b :
CBLT1_0088_G06.b :
HTMT1_0048_A11.b :
CBLT1_0046_H09.b :
CBLT1_0004_D05.b :
HTMT1_0103_C12.b :
CBLT1_0035_B11.b :
HTMT1_0076_B06.b :
HTMT1_0095_F01.b :
CBLT1_0013_B03.b :
CBLT1_0095_H06.b :
HTMT1_0016_G09.b :
HTMT1_0019_D11.b :
CBLT1_0025_B07.b :
HTMT1_0028_H02.b :
CBLT1_0085_H01.b :
HTMT1_0054_B11.b :
CBLT1_0051_A01.b :
HTMT1_0014_G11.b :
HTMT1_0134_G05.b :
HTMT1_0034_E03.b :
HTMT1_0084_E09.b :
CBLT1_0061_C12.b :
HTMT1_0149_F10.b :
CBLT1_0039_D07.b :
CBLT1_0034_F10.b :
HTMT1_0051_A10.b :
CBLT1_0039_D10.b :
HTMT1_0022_F01.b :
CBLT1_0015_E12.b :
HTMT1_0041_B02.b :
HTMT1_0075_F07.b :
HTMT1_0020_H06.b :
HTMT1_0074_H09.b :
HTMT1_0014_A01.b :
HTMT1_0037_H11.b :
HTMT1_0066_D08.b :
CBLT1_0038_C06.b :
CBLT1_0034_C01.b :
CBLT1_0060_G03.b :
CBLT1_0062_H04.b :
HTMT1_0096_A11.b :
CBLT1_0075_C10.b :
CBLT1_0025_E08.b :
CBLT1_0004_G05.b :
CBLT1_0054_G01.b :
HTMT1_0053_A07.b :
HTMT1_0073_B07.b :
HTMT1_0094_C01.b :
HTMT1_0027_A10.b :
HTMT1_0017_E05.b :
HTMT1_0063_D12.b :
HTMT1_0045_D10.b :
HTMT1_0073_A06.b :
CBLT1_0061_H05.b :
HTMT1_0089_D09.b :
CBLT1_0062_D02.b :
HTMT1_0043_E02.b :
CBLT1_0059_H04.b :
HTMT1_0043_G10.b :
HTMT1_0067_A10.b :
CBLT1_0037_H08.b :
CBLT1_0084_G04.b :
HTMT1_0071_D10.b :
HTMT1_0014_H06.b :
CBLT1_0006_A07.b :
CBLT1_0055_D08.b :
CBLT1_0004_H12.b :
HTMT1_0042_F11.b :
HTMT1_0016_H08.b :
CBLT1_0081_G11.b :
HTMT1_0015_A09.b :
HTMT1_0040_B10.b :
BFLT1_0007_D04.b :
HTMT1_0024_B03.b :
CBLT1_0007_C02.b :
CBLT1_0028_F01.b :
HTMT1_0056_D12.b :
HTMT1_0131_B02.b :
HTMT1_0104_G12.b :
HTMT1_0042_B11.b :
HTMT1_0068_B12.b :
CBLT1_0054_F08.b :
CBLT1_0085_H05.b :
HTMT1_0064_C09.b :
HTMT1_0047_B04.b :
HTMT1_0068_D07.b :
CBLT1_0053_G06.b :
HTMT1_0026_F11.b :
HTMT1_0049_A09.b :
CBLT1_0080_H12.b :
HTMT1_0104_F09.b :
HTMT1_0071_A04.b :
HTMT1_0034_F11.b :
HTMT1_0146_C12.b :
HTMT1_0136_G04.b : nnggcctttntnn
HTMT1_0120_B01.b :
CBLT1_0006_H07.b :
HTMT1_0036_D12.b :
HTMT1_0133_G04.b :
HTMT1_0036_E11.b :
CBLT1_0062_A01.b :
HTMT1_0085_D02.b :
HTMT1_0063_E09.b :
CBLT1_0024_D10.b :
CBLT1_0024_B03.b :
CBLT1_0069_G11.b :
CBLT1_0075_E09.b :
CBLT1_0052_G05.b :
CBLT1_0074_H03.b :
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 57
CBLT1_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAACACCTTCAAAGACAGGCCCTC
CBLT1_0077_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAACACCTTCACAGACAGGCCCTC
HTMT1_0126_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0038_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0038_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
CBLT1_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0079_B03.b : ccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaAAAGACACGTCTCT
HTMT1_0145_A10.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGGCCCTC
CBLT1_0042_C01.b : gtgagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGGCCCTC
HTMT1_0012_E08.b : nnncatacatggGATTTA
HTMT1_0012_F03.b : nnccatacaaagGATTTA
HTMT1_0006_A04.b : nnnggagatatctaagGATTTA
HTMT1_0003_B02.b : nnggcatactaagGATTTA
HTMT1_0005_F06.b : nnnnggactactataggaTTA
HTMT1_0111_E01.b : ttttggatggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_B01.b : ttaagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_E04.b : ggaaggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_F03.b : nnnncgcaggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_C08.b : ttttggacagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0012_H10.b : nncctatactt
HTMT1_0011_B07.b : nnnnccataac
CBLT1_0093_A09.b : ttttagacggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_G09.b : tnnggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_C08.b : ttttttcgacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_F08.b : nttgggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_E04.b : nnnccgcaggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0089_E09.b : tttttacgcaggaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_H01.b : ttttgccgcaagtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_A04.b : ttttggagacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0078_G12.b : ttttttagcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0050_A03.b : nnnggacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0086_E03.b : tttttagcaggtagaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_C05.b : ttttnggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_F09.b : ttttaggacgagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_A05.b : nnnngggatggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0006_E11.b : nnnnggcatactaaggattaa
HTMT1_0134_F06.b : catnttnnaagacggtacgacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0042_E07.b : nnnnccagtgagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_C07.b : nnnnnnnagacggttacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0072_C10.b : nnnnnggcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0001_B08.b : tttcgcgagaagaggccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0078_C11.b : tttttccgcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_E10.b : tatttnnnnccgacggtacacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_C03.b : ncctcatacta
HTMT1_0025_D10.b : ttttggacggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F07.b : nnnccatacta
HTMT1_0128_H06.b : atctactttatgattttttntnggacggttagacgcagtagtatttaacgactccnatan
HTMT1_0064_A02.b : ggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_C05.b : nnnccgacggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0138_A04.b : ttttttttttggacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0025_F09.b : ttttagacggtaagacgccntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_A01.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_E04.b : nngggatggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0010_E11.b : nccctaccta
CBLT1_0039_B10.b : ttttggagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_G02.b : tggcagagaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0107_A07.b : nnngggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_C10.b : ttttagacggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_B07.b : nnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_A11.b : ttttgcgagagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0137_G02.b : ttttttcgagagtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0057_G09.b : ttttagacaggagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_D10.b : nttttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0056_D12.b : nttttagcaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_F01.b : tttttcgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0141_E10.b : tttttacgaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0149_G10.b : ttttggcaggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0055_C05.b : tttngggcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0021_D08.b : nnnccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_B11.b : tttggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_B03.b : nnnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0151_F05.b : tttaggcagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_A04.b : nnnnccatact
HTMT1_0010_H05.b : ncccgatac
HTMT1_0025_A07.b : ttttccgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_A06.b : tttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_B10.b : ttttcgacagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_G07.b : tttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_H08.b : tttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_B06.b : tttttagacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_B03.b : tttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0065_B01.b : gtttttttnccgaggaacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_B11.b : tttttggatggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_B12.b : tttgggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_B12.b : ttggctggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_E09.b : nttcgatagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0046_C06.b : ttccgacgttaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0028_G06.b : nntttggcaggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_D11.b : ntttaggacggtacgaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_C07.b : ttttggacggtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_D07.b : nnnnncgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0076_G10.b : nnttgagcagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0098_B07.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0064_B07.b : ttttggacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0133_A12.b : ttttttttagggacgagtacacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_C02.b : tttttggacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_G10.b : nnnccgcggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0094_D10.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_G11.b : tttttccgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_A11.b : tttttggcaagtagaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0083_G02.b : tttttggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_A07.b : ctttttttnnccgaggaacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0056_H09.b : ttnnttntgggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_A03.b : tttggacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_E10.b : tttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0044_D03.b : nnnnccaagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_A07.b : tttttagcaggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_H06.b : ttttttttttccgacggtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0139_A10.b : tttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0053_F07.b : ttttaacagagagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_F12.b : ttttttagacggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_H02.b : tcgcaggaagaggccgtacgtatttatacgactcctatagggaatttaa
CBLT1_0067_B02.b : nttaaacgaggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0007_C05.b : nnngggatatct
HTMT1_0041_C07.b : tttttggacaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0036_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgagggaggacaacaccttcaaagacaggccct
HTMT1_0010_C06.b : nnnncctacct
HTMT1_0126_H07.b : tttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_A02.b : tttttagacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_A12.b : nnnnnggatggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0024_B08.b : nnnaaagacgttagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_H02.b : nnncgatggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0045_F04.b : tttttggtaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_C11.b : cttttttttttnggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_E11.b : ttgcttttttttttggatggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0067_E11.b : nnccatatttttnttccgacggtacacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0074_F01.b : ttttacgacggaagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0136_H12.b : nnttcccttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0126_E03.b : tttttggacggtacgacgcagtagtattaaxxxxxxxxxxxxxxxxx
HTMT1_0147_C10.b : nntccgtttttttttccgagagtagacgcagtagtattaaxxxxxxxxxxxxxxxxx
HTMT1_0041_H02.b : tttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_D03.b : nggctggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_B04.b : ctcctatag
CBLT1_0077_E12.b : ttttttcgaggtacgacgccgtagtaxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_F12.b : nttggatggtaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0066_C01.b : tttttccgacggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_B12.b : nnccggtttnntnnnggacggtaagaggccgtagtatttatxxxxxxxxxxxxxxxxx
CBLT1_0072_H09.b : nnttttgcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0041_A02.b : tttttacgaggaacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0005_E10.b : tttttggcaggagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_A02.b : tttccgccggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_C01.b : nnnnggcgtttttttttccgacggtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0122_D09.b : tttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0009_G11.b : tttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0093_H12.b : ttttttcgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_B12.b : nnnnggggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_H05.b : ttttggcaggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_D04.b : ttttttggagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_G08.b : nnnttgacgacggtagcggccgtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_B01.b : nnntggctggtacgacgccgtagtaxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C04.b : tttttagagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_F08.b : nnnncgacggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_A02.b : tttttagccgagaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0067_B11.b : nnttcattttntnnnggcagagtacacgccgtxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_B12.b : ttttggatggtacgcggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0023_G10.b : ntttccgacggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_H12.b : tttttggatggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_F07.b : nngggacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_F06.b : ttccgagagtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_H09.b : nttttgacggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_B11.b : ttttggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_D08.b : tctagtacgaggccgtacxxxxxxxxxxxxxxxxxxxxx
HTMT1_0126_F11.b : acggnnnttttttttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0128_E02.b : ttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0050_C05.b : nnnnnggcaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_H01.b : gagagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_D11.b : txxxxxxxxxxxxxxxxx
CBLT1_0096_H03.b : ttttgggacgttagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_H10.b : nnnccgctttttttttggacggaacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_D11.b : ttttccgcggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0132_F08.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_D05.b : tttagacaagtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0097_G08.b : ttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_C10.b : nnnccgcaggacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_B01.b : nttttgcacagtcagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_B09.b : nnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0077_E08.b : ttttccgagagtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_D07.b : nngggcaatgtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0148_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
HTMT1_0132_F03.b : ttttcgatagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_C12.b : nnnccacttttttttttggacggaacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_F06.b : nttcatctttttnnnnggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0024_F01.b : tttttcgacggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0106_E05.b : nnnggatggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_C09.b : tttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_E05.b : nttttggagagtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_A08.b : ttttcgcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0128_G08.b : ttttaggatggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_B12.b : ntttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_G05.b : ttttaacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_C11.b : nnttttttttttttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_H10.b : nnnccatttntnttnnggacggaacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0026_D07.b : ttttccgacggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0060_G12.b : tttttacgaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_B03.b : nngggatggtacgcggcagtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0011_E06.b : ttttgagcagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0135_B04.b : nnccgtttttttnnnggatggaacgaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0080_E02.b : ttttaagacagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0064_A08.b : nccgcttttnnnnnccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0139_E01.b : tttttggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0090_F01.b : ttccgaggtaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_H09.b : cgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C12.b : tttttcgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0088_A03.b : tttttggacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_B11.b : ttttggacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0064_G04.b : tttttacgacggaagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E07.b : tttttccgaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_A12.b : ttatgggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0150_D11.b : ttttggacagtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0122_B12.b : ttttccgacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0141_H07.b : ttttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_B05.b : tttcccaatgagaggccgtagtatttnxxxxxxxxxxxxxxx
CBLT1_0052_A10.b : ntttccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0025_C06.b : tttccgagagtagcggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0067_H07.b : ntttttagacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0082_A09.b : ntttaggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_F01.b : tttttggacggtagacgccataxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0130_C05.b : ttcgacggaagaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_A06.b : ttttggatggtaagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0036_C05.b : ttttccgcaggagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_B04.b : ntttgagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxx
HTMT1_0132_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
HTMT1_0070_G03.b : ttttccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_H01.b : tttgcgatggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0100_F01.b : tttttacgacggtacgaggcagtxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0044_C08.b : nncccagtgtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0133_A10.b : nnnccctatttttttnggatagaacgaggcantaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_B12.b : tttttccaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_B01.b : tttttggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0088_G06.b : ntttaagacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_A11.b : tttttaggagagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0046_H09.b : ttttagcaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_D05.b : tttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0103_C12.b : ttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0035_B11.b : ttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_B06.b : nccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_F01.b : tttttacgatggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0013_B03.b : ttttgcgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0095_H06.b : ntttggagtgaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_G09.b : ttttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D11.b : ttttggacgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_B07.b : tttttagcaggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0028_H02.b : ttttaggatggtacgacgccgntaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_H01.b : ttttgcgaagtagaggccgtagtatttatxxxxxxxxxxxxxx
HTMT1_0054_B11.b : nccggtttttttttggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_A01.b : tttttggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_G11.b : tttttggcaggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_G05.b : nnccccttttttnnnggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_E03.b : agagtacgaggccataxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_E09.b : tttccgacggtagaggccataxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_C12.b : nnccacttttntnnnggacggtagacgcagtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0149_F10.b : ttttaggcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0039_D07.b : ttttacgacgttagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_F10.b : tttttagcaagtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0051_A10.b : ttttgtcgatggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0039_D10.b : tttttcgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0022_F01.b : tttttagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0015_E12.b : ttttggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0041_B02.b : tttttccgaggtacgaggccgtcgtattaaxxxxxxxxxxxxxxx
HTMT1_0075_F07.b : ttttccgacggtagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0020_H06.b : nnttacgaggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0074_H09.b : ttttttcgacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_A01.b : tttttacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_H11.b : tttttccgaggtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0066_D08.b : tttttccgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_C06.b : nnnnggcgagaagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_C01.b : ttttggcgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0060_G03.b : tttaaagacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_H04.b : tttnaacgcaggtagaggcagtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0096_A11.b : ttttncgatggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_C10.b : ttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_E08.b : ttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_G05.b : tttttggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0054_G01.b : nttttaagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_A07.b : tttttggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_B07.b : ttttaggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0094_C01.b : ttttgggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_A10.b : tttttggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0017_E05.b : tttttccgacggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0063_D12.b : ttttggctggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0045_D10.b : tttttcgatggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_A06.b : ttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_H05.b : ncccattnnnnnttcgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0089_D09.b : nnggcgtttttttttnnggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_D02.b : nggttattttnnnnccgacggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0043_E02.b : nntttccttnntnnnnggacggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0059_H04.b : nnttaggagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0043_G10.b : nnnccgtttttttttggacggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0067_A10.b : ttttttagacggtacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_H08.b : ntttgagcaggtagaggcagtagtattaaxxxxxxxxxxxxxxx
CBLT1_0084_G04.b : ttttacgagagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_D10.b : nttggacggtacgacgccgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_H06.b : nntttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_A07.b : nnnnccgcaggagaggccgtagtatttnxxxxxxxxxxxxxxx
CBLT1_0055_D08.b : ttttcccaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_H12.b : ttttttggacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_F11.b : tttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_H08.b : ntttatcgacggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0081_G11.b : tttttccgaggaacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0015_A09.b : tttttccgaggtacgacgcagtagtaxxxxxxxxxxxxxxxxxxxx
HTMT1_0040_B10.b : tttttggagagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0007_D04.b : nnnccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0024_B03.b : tttttccgaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0007_C02.b : ttttttgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0028_F01.b : ttttccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxx
HTMT1_0056_D12.b : ntctttttttttcgacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxx
HTMT1_0131_B02.b : ttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_G12.b : nttttgatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
HTMT1_0068_B12.b : ttcaagctagtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0054_F08.b : tttttccaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_H05.b : ttttacgaggtagaggccgtagtattaaxxxxxxxxxxxx
HTMT1_0064_C09.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_B04.b : ttttttcgacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0068_D07.b : tttttagacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0053_G06.b : tttttggcaagtacacgcagtxxxxxxxxxxxxxxxxxxxxx
HTMT1_0026_F11.b : tttttagacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0049_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
CBLT1_0080_H12.b : tttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_F09.b : ntttggagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_A04.b : ttttaacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_F11.b : nggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0146_C12.b : tttttttagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0136_G04.b : nnnggactggttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_B01.b : tactgtgacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_H07.b : nntttccaggtagaxxxxxxxxxxxxxxx
HTMT1_0036_D12.b : ncgacggtacgaxxxxxxxxxx
HTMT1_0133_G04.b : nnnccctttnttnnnggatagtagaggxxxxx
HTMT1_0036_E11.b :
CBLT1_0062_A01.b : nntccatttttnnnncgac
HTMT1_0085_D02.b : tttttac
HTMT1_0063_E09.b : ttttccg
CBLT1_0024_D10.b : nnnggc
CBLT1_0024_B03.b : nnnnnc
CBLT1_0069_G11.b : nn
CBLT1_0075_E09.b : t
CBLT1_0052_G05.b : n
CBLT1_0074_H03.b :
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 115
HTMT1_0136_G04.b : xxggagtcgaacaagctgctgaccatcaggaAAAACAGTGCGCCTGCTCCCGAGGGCATG
HTMT1_0120_B01.b : xxxxxxxxxxxxggagctgcccattaagggcacGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0006_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0036_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTGCACCTGCTCCCGAGGGCCTG
HTMT1_0133_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGCTGCTCCCTAGGGCCTG
HTMT1_0036_E11.b : gccCCCGAGGGCCTG
CBLT1_0062_A01.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGGGCCTG
HTMT1_0085_D02.b : gaggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTG
HTMT1_0063_E09.b : agagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTG
CBLT1_0024_D10.b : gacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaagCTG
CBLT1_0024_B03.b : gacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaagCTG
CBLT1_0069_G11.b : nnaagacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTG
CBLT1_0075_E09.b : ttttggaagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTG
CBLT1_0052_G05.b : nnnnggacggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgG
CBLT1_0074_H03.b : ttttccgacagtaga
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 175
CBLT1_0074_H03.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGTACCTGGCCTCC
CBLT1_0052_H03.b : tttttggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0052_H02.b : nnnngggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 234
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 294
CBLT1_0042_B03.b : nnnnccagtgagaggxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 354
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 414
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 474
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
---------+---------+---------+---------+---------+---------+ 534
CBLT1_0075_G03.b : tttttggcaggtagaxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_E02.b : ttttaggatggt
---------+---------+---------+---------+---------+---------+ 593
CBLT1_0075_G03.b : xxxxxxxxxxxxxxxxxxxxxxaaacaAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0086_E02.b : acgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtccAAATCTTCA
---------+---------+---------+---------+---------+---------+ 652
---------+---------+---------+---------+---------+---------+ 712
---------+---------+---------+---------+---------+---------+ 771
CBLT1_0007_C02.b : TGCCCCTAACGCCTGGTGACGAacccagggggctccattcggaaggaaacgctccgctgt
HTMT1_0120_B01.b : TGTCCCTAACGCCTGGTGACGACctccagtgggttccctccgaagaaaccctccaccgcc
---------+---------+---------+---------+---------+---------+ 828
HTMT1_0060_B12.b : TCGCCCTACTTCGAAGACAGT*GACTTCCCtccccgcgcgctntatctgtgaagagnctc
CBLT1_0007_C02.b : cttccctacctggaagacagtgacagcgcaccccggtggcactcatcctgatatggcttc
HTMT1_0120_B01.b : gcctacctccgagacagggactcccctcccgcttctcctaatatgaaactggcttggggg
HTMT1_0085_D02.b : TCGCCttcctcggaaagagtgaaatcccctcccggttggcctattctggaaaaggttccg
---------+---------+---------+---------+---------+---------+ 882
CBLT1_0068_D11.b : *CTTCGGTGGGGAAAactgctgtgggaactttcccggggaccttgctgttggtttggccc
HTMT1_0076_C01.b : *CTTCGGTGGGGACctgctgtgggacatttgccgggggacctgctgttggttggcccctg
HTMT1_0060_B12.b : gcgtgggacacgtggactcttcgggggggaaaaaacgctggtgccgccccccccccagaa
CBLT1_0034_H05.b : cttcggggggaacctggcgggggaactttgccggggggaccctgctgttggtttgccccg
CBLT1_0007_C02.b : cgaggggacactaccggggggaaaatggttggggaaactgcagtgcgatcgaccgagggg
HTMT1_0120_B01.b : gaaaatgctgggggaaatattgccggggaaactggctggggttgcccctggcgagcaata
HTMT1_0085_D02.b : gggggaacctggtgggggaaaattggcgggggaaaactgccttgggttggcccgggaagg
---------+---------+---------+---------+---------+---------+ 938
CBLT1_0068_D11.b : ctgcaggccataaaaataggggggggccccactttcctttggtttcctttcgggcccccc
CBLT1_0093_A09.b : GGCCcgtggcaggcaaaaaaaatgtgtggcccccagccttccttggtttcctttggggcc
HTMT1_0076_H02.b : gcccgcggccgggcaaaaaaaatggggtggctcccaggcttcctttgggtttctttcggg
CBLT1_0067_E11.b : GCCC**TGCAGGGCATAaaagggggggctccaaacttctttggttctttcgggccccccc
HTMT1_0076_C01.b : caggcataaaaatgggtggggctcaagctccctttgtttctttcggcccccccctctccc
HTMT1_0060_B12.b : aaatgtgcccccnnntcactcnctctnnctgtgttctctcgcgctccncctnnaccgann
CBLT1_0034_H05.b : tccagggaaaaaaataggggggggccaagccttccttgggttccttcgggcccccccccc
HTMT1_0059_D04.b : ccngtgcangcataaaaatggtgtggctccagcttcctttggttctttcggcctcctcct
CBLT1_0068_G08.b : GCCC*GTGgcaggcaataaaaatgggggtgcctccagcttcccttgggtttctttcgggc
HTMT1_0115_B01.b : GCC**GTGCAGGccaanagaatgtgtggctccaacttctttgggttcttcgtgcccctcc
HTMT1_0058_C04.b : *CCC*GTGCAGGnatanaaatggtgtgcctcaagcttccttgggttcttcgggcctctcc
CBLT1_0073_F08.b : *CCC*GTGCAGGCCATAAAatggtgtggctccaagctccttgggttctttcgtgcctctc
HTMT1_0013_A02.b : GCCC*GTGCAAGGCAAAAAattggggggcaccaacttcctttggtttctttcgaggctcc
CBLT1_0067_B11.b : GCCC**TGCAGGGCAaaaaaagggggtgcctccaaccttcctttggtttcttcggggccc
HTMT1_0119_B12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCAAaannaaannnnnnnnnnnnannnna
CBLT1_0007_C02.b : gggcatacaacagtgtgtgttccggctccaagggtcaatgaagtcagtcacggaccctgc
HTMT1_0120_B01.b : aaatgggggggttccaagcttcttggggttcttccagccccccccctcccaccccctaag
HTMT1_0085_D02.b : gaaaaaaaagggggggcccccaacctccctgggtttctttggggcccccccccctccccg
---------+---------+---------+---------+---------+---------+ 994
CBLT1_0023_A08.b : G**CCTCCCCCcccccaccgccaaagttttttaacttcctaaaaggttcgggccctcgaa
HTMT1_0050_B08.b : C**TCCTCCCTCTacccgctaagtaattaatcttctaaaagggtcgggccgtcgaaaagc
CBLT1_0068_D11.b : ccccctccaccccctaaatatttttatctcccaaaaaggtcgggccctccgaaagggctt
CBLT1_0077_C07.b : C**TCCTCCCTCTCACCG*CTAAGTAT*TTA*TCTtcctacaggttcgggccttcngaaa
HTMT1_0111_E01.b : C**TCTTCCTCTCACCCG*CTAAA*TA*TTTTATCTTCtaacagggtcgggccctcgaaa
CBLT1_0093_A09.b : cccccctccccacccgcaaagtatttaacctccctaacggggtcgggccctcggaaaagc
HTMT1_0144_G09.b : cctcccccccaccgccaaagtatttatcttccaacaggttcggccctcgaaaagcttgcg
CBLT1_0068_C08.b : CCTCCTCCTCTtcccccgctaagatattaatctccctaaaagttcgggcctccgaaaagg
HTMT1_0109_F08.b : CTCCTCCCCTCACCCGCAAAGTATTTA*Ttctcctaacagggtgggccctcgaaaagctt
CBLT1_0038_E04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTAATCctcctacaaggtcgggccntcngaaa
HTMT1_0089_E09.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTAATCTccctacaggttcggccgttcgaaag
CBLT1_0073_C05.b : tcctctccccgctaagtattaatcttcaaacgggtcgggcttcggaaagcttgcggcgga
HTMT1_0138_A04.b : cctctcaccgctaaagtattatcttctaacaggtcggncnntcgannagctgcngcggga
HTMT1_0025_F09.b : CCCCCcccccccacccctaaagtattttatcttcctaacaggtcgggccctcgaaaaggt
HTMT1_0105_A01.b : CCCTCCCCCcccccccgctaagtaattaatcctcctaacaggtccggccttcgaaaaggc
HTMT1_0120_E04.b : CCCCCTCCCTCccccggctaaagtattaatcttcctaaaggttcggccntccgaaaaggc
CBLT1_0039_B10.b : C*TTCTCCCTCTCACCgctaagtatttaatcttctaacagggtcgggcccgtcgaaaggc
HTMT1_0117_G02.b : CCCTCTCCCTCCCACCCGtaaatttttatccttcctaaaaggttcggcccttggaaaggc
HTMT1_0107_A07.b : CCTC*TCCCTCTCCCCGCctaagtattaatctcctaacaggtcgggcctcggaaagcttg
HTMT1_0106_C10.b : CCTCCTCCTCTCCCCGCTAAataattattcttcctacagggtccggccgtcagaaagctt
HTMT1_0104_B07.b : CCTCCCTCCTCCCACCCG*Cctaaagtattttaatctcccaacagggtccggccctcggg
HTMT1_0106_A11.b : CCTCCTCCCTCTCAACCG*CTtaaagtattaaatcttccttaacggggtccggcccttcc
HTMT1_0137_G02.b : CCTC*TCCCTCTCACCCG*CTAAGTAT*Taatcctccaaacaggtcggccctcggaaagc
HTMT1_0057_G09.b : CC*CCCCCCTCCCACCCC*GTAAAGTA*TTT*Accttcctaacagggtccggccctccga
HTMT1_0047_D10.b : CTCTCCCTCTCACCGCTA*AGGTATTA*ATCTTcctacaggttcgggcctccgaaaggct
HTMT1_0044_G09.b : GNNCTCTCCTCTCACCCG*CTAGTATT*TATCTTCctacagggtcggccgtcggaaagct
HTMT1_0076_H02.b : actcctcccctcttcaccgttaaaattttttatcttcctaacagggtcgggccctccgaa
CBLT1_0067_B02.b : cccccccccccccccccgctaaaattatttaaccctccctaacaggggccgggccctccg
HTMT1_0036_E07.b : C*TCCTCCCTCTCACCCG*CT*AAGTA*ATTAATCTTCtaaaaaggtcggggcctcggag
HTMT1_0120_A12.b : ctccctccacccgctaagtatttaacctcctacaggtcgggcttcgaaaagcttgcggcg
CBLT1_0024_B08.b : CCTCCTCCCTCTAACCCG*CTAAgtatttatccttctaaaagggccggcccttcgaaaag
HTMT1_0042_E11.b : CCTCCTACCTCTCACCCG*CTAAAGTA*TTAATCTTtcatacagggttcggacgtcggaa
CBLT1_0067_E11.b : ctcccaccccaaagttttaatcttccaaaaggtcgggcccctcgaaggctggggggggga
CBLT1_0074_F01.b : ccccccctctaacccgctaagtatttaatctccctacagggtcgggccctcgaaaaggct
HTMT1_0136_H12.b : CCTCCTCCCTCcacccgctaaattatttatctcccaacagggtcggccctttcgaaagct
HTMT1_0126_E03.b : CTCTCCCTCTCACCGCTA*AGTATTTAtctcctaacaggtcggccgtcnganagcttggc
HTMT1_0147_C10.b : CCT*CTCCCTCTCA*CCG*CTAAAGTA*TTAATCTTcctaacaggtcgggccttcgaaag
HTMT1_0076_C01.b : cgctaagtatttatcttcctaaaagggtcgggcctcgaaaagctttggcggggaaccttg
HTMT1_0122_D09.b : CTCCCCCTCTtcacccgcaaagtaattaaccttcttaacgggtccggcctcggaaaagct
HTMT1_0060_B12.b : nnnagttatatttcatctacaggcgcgcgnnctcagtgcgggnnnnncgatnnnctgtgt
CBLT1_0034_H05.b : ctcacccgcaaaagtttttatcttcccaaaagggccgggcctcgaaaaggctttgcggcg
HTMT1_0059_D04.b : tcaccgctaagtatttatcttctaacagttcgggccccgaaaggctggcggcgaactttg
CBLT1_0068_G08.b : cccccccttcccaccggctaagtttttaatccttccaacagggttcggccttccgaaaag
HTMT1_0115_B01.b : ctccccccgctaagtattttcctccctacagggtcgggcctcgaaaagcttgcggcggga
HTMT1_0058_C04.b : ctctcaccgctaagtatttaaactcctacagggccggnccgtcgaaaagcttgccggcgg
CBLT1_0073_F08.b : cctctcaccgctaaagtattatcttcctacagggtcggccttcgaaaagcttggcggcgg
HTMT1_0013_A02.b : tgtctctcccccactaaaatatttatcctccacaaagggtccgacctacaaaaaggctgg
CBLT1_0067_B11.b : cccccctccccccccaaagttttaactttctaaaagggtcgggccctcgaaaagcttggc
HTMT1_0119_B12.b : nannannnnaanaaannngnccccnnattcccctttnntnanggttaattggtcccccaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : ctctcctctcaccgctaagtattaatctnncctacaggtcggccgtcngananngctgcg
HTMT1_0111_F07.b : tctccctctccccgctaaataataaatcttccaacacggtcgggcctccgaaaggttggc
HTMT1_0105_F06.b : tctccccttcaccgctaaagtattttatctcctaacagggtcggccctcggaaagctttg
HTMT1_0117_H09.b : tcctcctcccaccgctaaatatttaatctccaacagggtcggccgtccgaaagcctggcg
CBLT1_0073_B11.b : cccccccccttccacccgcctaaattatttaatctttcctaacagggtccggcccctccg
HTMT1_0119_D08.b : CCTCCTCCCctccccccgtaaaatttttaacttctccaaacggtccgggcccccgaaatg
HTMT1_0126_F11.b : tccctctcaccgctaagtatttatcttcctacaggtcgggcctcngaaagcttggcgcng
HTMT1_0128_E02.b : C*TCCTCCCTCTCACCGC*TAAagtattaatcttctacagggtcgggcgtccgaaagctt
CBLT1_0050_C05.b : C**TCCTCCTCTCACCCG*CTAAgtatttatcctcctaacagggtcgggcgtcggaaagc
HTMT1_0035_H01.b : CCCCCCCCC*CTCCCCCG*GTAAAGAA*TTTAatcctcctaaacggggtcggggccttcg
CBLT1_0096_H03.b : *CTCCTCCCTCTCACCCG*CTAAGTAT*TTATCttctaacaaggtcggggcctcgaaagc
HTMT1_0140_H10.b : C*TCCCTCCTCTCACCGC*TAAgtattaatcttctaacagggtcgggccgtcgaaaggct
HTMT1_0148_A09.b : CCCCCTCCCTCTCACCC**CTAAAGTA*TTTAtctccctacagggtcgggccctcgaaag
HTMT1_0140_C12.b : CCT*CTCCCTCTCA*CCG*CTAAGTAT*TTATCTCCctacagggtcgggcgtcggaaagc
HTMT1_0140_F06.b : CCTCCTCCCTCTC*CCCG*CTAAAGTA*TTTAATCTccaacaggttccgggcgtcngaaa
CBLT1_0007_C02.b : catatctgtacacccgaaagcaggcgaagatatttgaggttgccgagcgcatcacctgta
CBLT1_0028_F01.b : ccccctccctcctccccgctaaagtatttaacctcccaaaaggggccggccctccgaaaa
HTMT1_0056_D12.b : CCTCCTCCCTCTCA*CCG*CTTAAGTA*TTaatctccctacagggtcgggccctcggaaa
HTMT1_0136_G04.b : CCTCCTCCTCTCCCCGCT*AAAtatttatcttcctaccgggtcgggccntcgaaaggctt
HTMT1_0120_B01.b : gttttaacctctccaacgggcccggccttcgaaatgcttgccgccggacttctgatatat
HTMT1_0036_E11.b : CCT*CTCCCTCTCACCgctaaagattaaacctcccaacaagtctggccctcgaaaaggct
HTMT1_0085_D02.b : cggaaaaatttaaccttccaaaagggggccggcccccaaaaaagttttgggggggaacct
---------+---------+---------+---------+---------+---------+ 1050
CBLT1_0023_A08.b : aagcttggcgggcggaaccttggtatttgactttgggcgggcacgggaaaagccccgggg
HTMT1_0050_B08.b : ttggcggcggaactttggtatgtactgggggccggcaccgaaaagccccgtggccgtgct
CBLT1_0068_D11.b : tgggcggggacctttttgtatttaacattgtggcgcgccaccgggaaaaagccccgggtg
CBLT1_0077_C07.b : ggcttggcgcggaagcttggtatgtgacatgtggcgggcaaccggaaagccccggtggcc
HTMT1_0126_A09.b : aaggctggncngcggggactttngttgtgacatgtggcgggcaccggagaagccccgttg
HTMT1_0038_C01.b : CGAAAGGCTTGGCGGCGGGgagctttggtaggtgaactgtgggccgggcaccggggaaag
HTMT1_0079_B03.b : GGAAAGcttggccgcgggagctttggtagtgacatggggcccgcacacggaaaagccccg
HTMT1_0145_A10.b : agcttgccgccgaagctttggttgtgacatgtgggcggcaacgggaaagccccgtggccc
HTMT1_0111_E01.b : aggctggcggcggaactttggtattgacagtgggcgggcaccggaaagcccccgtggcct
HTMT1_0037_B01.b : gataggcttgggcgccgggagctttggtatgggacaaggtgggccggccaacgggaaaag
HTMT1_0035_E04.b : *GAAAGGCTTGGCG*CCGGGACCTTTGG*AATGgacttgggggcggccaccggaaaagcc
CBLT1_0093_A09.b : tggcgcggggaacttggtatttgacattggggcggcacgggaaagcccccggggccctgc
HTMT1_0144_G09.b : gcggaactttttattaaattgggcgcaccggaaagcccccttgccttgtccccccccacc
CBLT1_0068_C08.b : ctgggggcggaacttttgttttaacattgggcgggcaccggaaaagcccgggggccctgg
HTMT1_0109_F08.b : gccggcggacctttggtttttaaatgggggcggccaacggaaaagccccgtggccttggc
CBLT1_0038_E04.b : gggctggcggcggaaccttggtatgtgactgtgggccggcancgggaaagccccggtggc
HTMT1_0089_E09.b : ccttggcgcgggacctttggtatgtgacatgtggcgggcaacgggaaagccgcggtggcc
HTMT1_0014_H01.b : aaaggctgacagccggagctttggtaatgtgaacagtgggcaggccccgatagagccccc
HTMT1_0087_A04.b : gcttgggcgcggacttgggtatgtactgtgggcggcaacggagaggcccgtgccgtgctc
CBLT1_0078_G12.b : ggaaaagcctgggggcgggaacttttggtatgtgaactgtgggccggcacccggaaaggc
HTMT1_0050_A03.b : gaaagctttgcgcngnagctttgtatgtgactgtggcggnnncacggaaagccgcggtgg
CBLT1_0086_E03.b : GGAAAGCTTGGCGG**CGGGAGCTTTGG*TAgtaacatgtgggccggcaacggggaaagc
HTMT1_0028_C05.b : GAGAGGCTTGGCGG**CCGGAACTTTGG*TAAGTGAatgtggggcggcaacgggaaaggc
HTMT1_0042_F09.b : GAAGAGGCTGGNCG**CGGGAGCTTTGG*TATGTGACtgtgggcgggcaacgggaaaagc
HTMT1_0025_D10.b : GAGAGGCTTGCCGG**CGGGAGCTTTGtatgtgaaatggggccgggcacggaaaagcccc
HTMT1_0128_H06.b : GAAAGcttgccggcgggactttggtattgacatgttggcgggcacgggaaaagccccgtt
CBLT1_0073_C05.b : ctttgttatttacattggccggcacggaaaaggcccgtggcctgctcccccccccaccaa
HTMT1_0138_A04.b : ctttgtagtgactgtgggcggcacggaaagccccgtggccctgctcaccccccgctaccc
HTMT1_0025_F09.b : tggccgcggaactttgggatgtgaaatgtgggcgggcaacggaaaaagccccgtggcctt
HTMT1_0105_A01.b : tttggcggcggacctttgtatgtaaatttgggcgggcacggaaaaggccccgtgggcctg
HTMT1_0120_E04.b : tgccggcgggactttggtagtaacttggggcggccaacggaaaggcccggtggctggccc
HTMT1_0010_E11.b : ggaaaagctttggcggcgggaactttgggtatgtgacattgtggccgggcaaccggaaaa
CBLT1_0039_B10.b : ttggcggcgggaactttggttgtgactgtgggcgggcaacgggaaaggccccgtggccgt
HTMT1_0117_G02.b : tggggagcgggaacttgattaataattgtggccggtccaggtaaagctcctatgccttat
HTMT1_0107_A07.b : gcggcgggactttggtatttaaatgtgggcggcaaccggaaagccccggggccctggctc
HTMT1_0106_C10.b : ggcggccggagctttggtagtaactttggccggcaacaggaaaggcccgtggcctggccc
HTMT1_0104_B07.b : aaaggcttggcggccggaaccttggtttgttacaagtggggcgggccaccggaaaggccc
HTMT1_0106_A11.b : gaaaaagctgggcgggggggaacttttggtaagtaaaattggggccgggccaacgggaaa
HTMT1_0137_G02.b : ttggcgcggaactttgtaatggacatgtggcgggcaccgggaaaggcccggtggcttggc
HTMT1_0057_G09.b : aaagcttggccggcggaactttgttatgtaaatgggggcggcaacgggaaaaggcccggt
HTMT1_0047_D10.b : tgcggcgggactttggtagtaactgtgggcggccacggaaaagccccggggcttggctac
CBLT1_0056_D12.b : aaaaggcttggcggcgggaagcttttgtatgtgacatgtgggccgggcaccgggaaaggc
HTMT1_0047_F01.b : aagctttgccgcggacctttgtatgtgactgtgggccggcaccgggaaaggcgcggtggc
HTMT1_0044_G09.b : tggcgcgggagctttgtatgtgactgtgggcgggcacggaaaagcccggtgccctgctca
HTMT1_0141_E10.b : aaggctggcggccgggaccttggtatgtgacatgtgggcggcacacggaaaggccccgtg
HTMT1_0149_G10.b : aaggcttgccgcgggagctttgtttgtaactgtgggccggcaccggaaaagcccccgtgc
CBLT1_0055_C05.b : aagcttggcggccggaacttggtatgtgacatgtgggccggcaacggaaaagcccccgtg
CBLT1_0021_D08.b : aaaggcttggcggcggaactttggtagtgactttgggcgggcaccgggaaaggcccggtg
HTMT1_0099_B11.b : aaaggttgggcggcggaacttttggtatgtgactggggggcgggccacgggaaaagcccc
HTMT1_0121_B03.b : aggctggcggcggaaccttgtatgtactgttggccgcacggaaaagcccgtggcctgctc
HTMT1_0151_F05.b : aaaggctggcggcgggagctttgaatgtgacatgtggcgggccacggaaaaagcccggtg
HTMT1_0025_A07.b : GAAAGcttgccggcggagctttggtatgtacatttggcgggcaccggaaaagccccgggg
HTMT1_0021_A06.b : GAAAGcttggcggcggaactttggtagtaaactgtggcgggcaccggaaaagcccccggt
HTMT1_0095_B10.b : GAAAGGCctggnccgcgggacttttggtatgtaactgtgggcggncancggaaaagcccc
HTMT1_0021_G07.b : GAAAAGgctttggcggcgggaacttttgtatgtgaaatggtgggccgggcaaacggaaag
HTMT1_0086_H08.b : GANAAGCTggncgcggnnagctttgtatgtgnacatgtggcggnncacgggaaaagccgc
HTMT1_0037_B06.b : GAAAGGCTTGGCcggcggaaactttggtaggtgacatgggggccggcaacgggaaaagcc
HTMT1_0013_B03.b : GAAAGGCTTTGGCGgcgggaactttgtaagggacatgtgggccggcaccggaaaaggccc
HTMT1_0065_B01.b : GANAGcttggnncgcggagctttgtatgtgacatngtggcggncancgggaaagccgccg
HTMT1_0028_B11.b : GAAAGGCCTGGCGGCcgggacctttggtagtgaacttgtggccgggcaaccggaaaagcc
CBLT1_0037_B12.b : GAAAGGCTTGGCGG**CGGGAACTTttggtatggaacatgggggcgggcacccggaaagg
HTMT1_0118_B12.b : GATAGGCTTGGCGG**CGGGAACTTTGtttgtgaacatggggccgccaacgggaaaagcc
HTMT1_0117_E09.b : GAAAGGCTTGCCGG**CGGGACCTTTGttattgaacagggggcgggcaccggaaaggccc
CBLT1_0046_C06.b : GAAAAGCTTGGCGG**CGGGACCTTTGtatgtgactgtgggccggcacgggaaagccccg
CBLT1_0028_G06.b : AAAAGGCTTGGCGG**CCGGAGCTTTGG*Ttatgtaacatgtgggcgggcaaccgggaaa
HTMT1_0111_D11.b : AAAAGGCTTGGCGG**CGGGAGCTTTGG*Ttagtaaatttgggcgggccacgggaaagcc
HTMT1_0092_C07.b : GAAAAGCTGTGCGG**CGGGAACTTTGG*Ttgtgaacatgggggcggcaccgggaaaggc
HTMT1_0013_D07.b : GAAAGGCTTGGCGG**CGGAACCTTTGG*TATGgacatgggggcgggcaccgggaaaagc
CBLT1_0076_G10.b : G*AAGGCTTGGCGG**CGGGGACTTTGG*TATGTacatgtggccggccaccggaaaggcc
HTMT1_0098_B07.b : GAAAGGCTTGGCCG**CGGGAGCTTTGG*TATGgaactgtgggcgggcaccggagaagcc
HTMT1_0133_A12.b : GAAAGGCTTGGCGG***CGGGAGTTTTG*TATGTtaaatgtgggccggcaacgggaaagg
HTMT1_0076_H02.b : aaggttgggacgggggaagcttttgggtatgggaaattgggggccggccaccggaaaaag
CBLT1_0067_B02.b : aaaaggctttggcggggcggaactttggtatttgaaatgttgggcgggccccccggaaaa
HTMT1_0007_C05.b : aaaaggctggcggcgggactttggtatgtgacatgtgggcggccaacgggaaaggcccgg
HTMT1_0041_C07.b : aagcttggcgggcgggaactttggatgtaaaaggggggcgggcaacggaaaaagcccggg
HTMT1_0036_E07.b : aggctgggcggcgggacctttggtatgtaacatgttggcgggcaaccgggaaaggccccg
HTMT1_0120_A12.b : gacctttggtattaactttggccggcaaccgaaaacccccgtgtgctggcctaccccccc
CBLT1_0024_B08.b : cttgccggccggaacttggtatgtgacattgggccggcaccggaaaggccccggtggcct
HTMT1_0118_H02.b : gaaaagcttgcgggcgggatctttgtatgtaaatgggggccggcaatcggaaaggccccg
HTMT1_0045_F04.b : GAAAAGCTTGGCGGCGGgaactttggatgtgacatgtgggccggcaaccggaaaagccgc
HTMT1_0042_E11.b : aggctggcagcgggagcttggtatgtgaatgtgggcgggcacgagagaggcgcggtggcc
CBLT1_0067_E11.b : cctttgattttaaaatggggggggacccggaaagcccccggggccttgcccccccccccc
CBLT1_0074_F01.b : tgggggcggaactttggtattgacattgggggcgggacccggaaaagccccggtggcctg
HTMT1_0136_H12.b : tggcgggcgaacctttggtatgtaacaggggggcggcaacgggaaagccccggtgcccgt
HTMT1_0126_E03.b : gcgggacttnngttgtgacatgtggcgggcacggaaagcccggtggcgtgctcacaccca
HTMT1_0147_C10.b : gcttgccgccggagctttggtagtgactgtgggcggcaccggaaaggcccggtggcgtgg
HTMT1_0041_H02.b : ataagcttgccggccggaactttggtaggggaaatgggggcgggaaccggaagaagcccc
HTMT1_0117_D03.b : aaagctctggcggcggaacccttggaatttaactgtgggccggacaccaggaaacccgcg
HTMT1_0034_B04.b : GGAAGCCTTGGCGG**CGGGAACTTTGG*TAatgggacatgggggcgggcaaccggaaaa
CBLT1_0077_E12.b : ggaaaaagcttggcggcgggaccttgggttgttaaaatgtgggggggcaaacggaaaaag
HTMT1_0118_F12.b : GAAAGGCTTGccgcgggaactttggtatgtacatgtgggcgggcaaccggaaaagccccg
HTMT1_0066_C01.b : GAAAAGCTTGGCGG**CGGGAGCTTggtatgtgacattgtggcggncancggaaaagccc
HTMT1_0073_B12.b : GAAAAGCTTGCCGG**CGGGAGCTTTGtaagtgacatgtggcgggcaacggaaaaagccc
HTMT1_0111_A02.b : GAAAGGCTTGGCCG**CGGGACCTTTGG*TATGTacatgtggccggcaaccgaaaaggcc
HTMT1_0076_C01.b : gtattgaaaaatgggggggccacggaaaagcccgggggcctgggttccccccccccttct
HTMT1_0122_D09.b : ttggcggcggaactttggtatttaacattggcgggcaacggaaaagccccgtggccttgg
HTMT1_0060_B12.b : gatatgcgcnnnngagaannagagcgggctggnnnnnnnnncnnccaccatccanntaca
CBLT1_0034_H05.b : ggactctttgattgtaaatttgtgggggcacccggaaaacccccgggggcctggcttcac
HTMT1_0059_D04.b : tatttacatgtggcggcaccggaaggccggtggccgtgctccaccccactcacgagaggg
CBLT1_0068_G08.b : ctttggcggcgggaacttttggtatttaacctgtgggccgggccccgggaaaggccccgg
HTMT1_0115_B01.b : cttttggattgaactggggcggccaccggaaagcccgttggcctggccccccccccgctc
HTMT1_0058_C04.b : actttgtaatgtacatggggcgggcacgggaaagccccggtggcctgtttcaccccccaa
CBLT1_0073_F08.b : aactttggttttaaatgtggccgggcaccgggaaagccccggtgccgtggcccccccccc
HTMT1_0013_A02.b : gcggcgaaaccttggtatagacatgaggacggattattataaaccctagttgctttgttc
CBLT1_0067_B11.b : ggggggaacctttgttatttaaaattggggcgggccacgggaaaggccccggggtgccgt
HTMT1_0119_B12.b : ttaaaaaaatctttttgagtttggccaccccacctcaaagtgggggaaaaaagggctcat
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : cngnagcttngtatgtgacatgtggcggggcacggaaagccccgtggccntgctcacacc
HTMT1_0111_F07.b : ggcgggagctttgtatgtaaatgtggccgggcacgggaaaggccccgtggcccttgctac
HTMT1_0105_F06.b : cggcggaacttggtatttgaaatgggggcgggcacggaaaagccccggggccttggccac
HTMT1_0117_H09.b : ccggaccttggttaggacttgtgggcgggcacgggaaagccccggggccttgcccccccc
CBLT1_0073_B11.b : aaaagccttggcgggggggaccctttggtttgtaacattgtggccggccaaccgggaaag
HTMT1_0119_D08.b : cttggcgacgggatctttggcatgtgactagtggccggcccccagaaagcctcgggggct
HTMT1_0126_F11.b : gactttgtattttaatttggccggccacggaaaagcccggtgccctgctcaccaccccat
HTMT1_0128_E02.b : gcggcgggactttgtagtgacttggggcgcaccggaaagcccggtgccttgctacccccc
CBLT1_0050_C05.b : ttggcggcgggagctttggtagtgacatgtggcgggcaacgggaaggcgcgttgcccntg
HTMT1_0035_H01.b : aaaaaggcttggcgggcgggaacctttggttaggggaaatgtgggccgggcaaccggaaa
HTMT1_0035_D11.b : aaaaggcttggcgggcggaaacttttggtatgtgacatgggggccggacaacaggaaaag
CBLT1_0096_H03.b : ttggcgcggaacttggtagtgacatgtggcgggcacggaaagccccggtgcctgctcaca
HTMT1_0140_H10.b : ggcgccgagctttgtagtgactgtggcgggcancggaaaggccccgtgccntgctcccac
CBLT1_0038_D11.b : aaaaggcttggcggcgggaactttggtatgttaacatgtgggccggcaaccggaaaaggc
HTMT1_0132_F08.b : gcttgccggccggagctttgttagtgacttgtggccggcaacgggaaagcccctgtggcc
HTMT1_0016_D05.b : agcttgccggccggaccttggtatgtgaatgtgggcgggcacggagaagccccggggccg
HTMT1_0097_G08.b : aaaaggcttgggggggggacctttggttgtgacatgtgggcgggcaaccggaaaaggccc
CBLT1_0041_C10.b : aaagcctggccgccggagctttggtaggtaaatgtgggcgggcaccgggagaggccccgg
HTMT1_0121_B01.b : aggctggcggcggaactttggtagtgaaatgtgggcggcaaccggaaagtcccggtgtcc
HTMT1_0113_B09.b : aaagctggcggcgggaactttgttattaaattttggcgggccacggaaaagcccccgtgg
HTMT1_0077_E08.b : aagcttgccggccggagcttggtatggaaatgtgggccggccacggaaaggcccggtggc
CBLT1_0041_D07.b : gaagcttggcgcgggaccttgttattgacatgtgggcgggcaccgggaaaggccccgtgg
HTMT1_0148_A09.b : gcttgcggcggaactttgtatttacatttggcggcaccgggaaagcccccttgccctggc
HTMT1_0132_F03.b : aagcttggcggcgaaactttggatgtgactgtgggccgcaaccggaaaggcccggtgccg
HTMT1_0140_C12.b : ttggcgcggaactttggagtgactgtgggcgggcacggaaaagccccgttggctgctccc
HTMT1_0140_F06.b : ggctggcngcggnagccttggtagtgacatgtggccggcacgggaaaagccccgtggccg
CBLT1_0024_F01.b : aaaaggctggcggcgggaactttgttatggaattgtggccggcaccgggaaaaggccccg
HTMT1_0106_E05.b : aagcttggcggcgggactttgttagtaaatgtgggcggcaacgggaaagccccggtgcct
HTMT1_0099_C09.b : aaggctggcggcggaaccttggtatgtgacatgtgggcggcaacggaaaggccgcgtggc
HTMT1_0101_E05.b : agaagctggccggcgggaacttttgtatgtaacatggggcgggcaccgggaaaagcccgg
HTMT1_0021_A08.b : aagcttggcgccggaacctttggttttgacattgtggcgggcaacggaaaggcccggtgg
HTMT1_0128_G08.b : annagctggncgcgggagctttgtatgtgactgtgggcgggcacngaaaaagcccgtggc
HTMT1_0120_B12.b : aaagcttgccggcgggacctttgtaagtgacatgtgggcgggcaaccggaaaaggcccgt
HTMT1_0028_G05.b : agcttggccggcggaccttggtatgtgacatgtgggcggcaccggaaaagccccggtgcc
HTMT1_0060_C11.b : aggctggncgcggaacttttgtatgtgacatgtgggcggcanccggaaaagccccggtgg
HTMT1_0044_H10.b : nagcttgnncgcnggagctttgtatgtgacaatgtgggcgggcacggaaaagcccccgtg
HTMT1_0026_D07.b : aaaagcttggcgncgggagctttggatgtgactgtggccggcaccgggaaaggccccggg
CBLT1_0060_G12.b : cgaaaaggcttgccggcgggaactttggttatgtgaaatgtggggcgggcaaccggaaaa
HTMT1_0105_B03.b : GAAAagcctggccggcggaacctttggtattgaactgtgggccgggcacgggaaaaggcc
CBLT1_0011_E06.b : GAAAagcttggccggcggaagctttggtatgtgacatgtgggcgggcaacgggaaaaggc
HTMT1_0135_B04.b : aaaggctggcggcggactttgttatgtacatgtggcgggcacggaaagcccccgtggcgt
CBLT1_0080_E02.b : GAAAGGCTggcggcgggaacttggtatgtgaatgtgggcggcaaccggaaaggcccggtg
CBLT1_0064_A08.b : aaaggctggcggcgggagcttggtatgtgacatgtgggcgggcaacgggaaaggccccgt
HTMT1_0139_E01.b : GAAAGCTTGccggcgggactttggtatgtgacagtgggcgggcacgggaaaggccccgtt
CBLT1_0090_F01.b : GAAAGGCTTGGtcggcgggacctttggtagtgacattgtggccggccaccgggaaaaccc
HTMT1_0034_H09.b : GAAAAGCTTGGCCGgcggaagctttggtaagtgacattgtgggcgggcaacgggaaaagc
CBLT1_0014_C12.b : GAAAGGCCTGGCcggcgggaacttttggtagttgacatgtgggccgggccaccggaaaag
CBLT1_0088_A03.b : GAAAGGCTGGGCGcgggagctttggtagtgaaatgtgggccgccacccggaaaaggcccg
HTMT1_0106_B11.b : GAAAAGGCTGGCGGgcgggacctttgggtattgaattgtggccgggcaacgggaaaaagc
HTMT1_0064_G04.b : GAAAGGCTGGGCGcgggagctttgtatgtgactgtgggccggcacgggaaagccgccgtg
HTMT1_0062_E07.b : GAAAAGCTTGGCGcnggagctttgtatgtgacatgtgggcggcaacgggagaggccgcgt
HTMT1_0095_A12.b : GAAAAGCTTGGCCGgcggaacctttggtatgggaaatgtggggcgggcaaccggaaaagc
HTMT1_0150_D11.b : GAAAAGCTTGGCGGCcgggaactttggtatggaaatgggggccgggcaccgggaaaaggc
HTMT1_0122_B12.b : GAAAAGCTTGCCCGCGGagccttgggtagtgacatgtggcgggcaccgggaaagccccgg
HTMT1_0141_H07.b : GAAAGGCTTTGCGGCcgaaaccttgtatgtaacctgtgcgcgggcaccaggaaaaccacg
CBLT1_0040_B05.b : GAAAAGCTTGGCCGGCGGAACTTtggtaagtgaacatgtggcgggcaacgggaaaggccc
CBLT1_0052_A10.b : GAAAAGCTTGGCCG**CGGGAGCTTTGtatgtgacatgtggcccggcaccgggaaaggcc
HTMT1_0025_C06.b : AAAAGGCTTGGGGG**CGGAAGCTTTGGaagtgacatgtgggcggcaaccgggaaagccc
HTMT1_0067_H07.b : GAAAGGCTTGGCGG**CGGGACCTTggtatggaactgtgggcgggcaccggaaaagcccc
CBLT1_0082_A09.b : GAAAAGCTTGGCCG**CCGGAGCTTTGG*TAgtgaactgtgggcgggccacgggaaaagc
HTMT1_0013_F01.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TAgtgaaatgggggcgggcaaccggaaaagc
HTMT1_0130_C05.b : GAAAAGCTTGGCGG**CGGGAGCTTTTG*TATGTtcatgtgggcgggcaccggaaaagcc
HTMT1_0099_A06.b : AAAAGGTTTGGCGG**CGGAACCTTTGG*TAgtgactgttggcgggcaccggaaaagacc
CBLT1_0036_C05.b : GANAAGCTTGGCGG**CGGGAACTTTGG*TATGTtaacatggggcggccaaccggaaagg
CBLT1_0037_B04.b : GAAAGGCTTGCCGG**CGGNAGCTTTGG*TATGTacatgtgggcgggcaccgggaaagcc
HTMT1_0132_A04.b : GAAAAGCTTGGCGG**CGGGAACTTTGG*AATGTaattgtgggcggccaacggaaaaggc
HTMT1_0070_G03.b : GAAAAGCTTTGGCG**CGGNAGCTTTGN*TATGTtgacatgtggcggncancggagaagc
HTMT1_0111_H01.b : AAAAGGCTTGGCGG**CGGGACCTTTGT*TATGTaaaagtgggccgggcaccggaaaagc
HTMT1_0100_F01.b : GAAAAGGCTGGGCG**CGGGAGCTTTGG*TATGTGAatgttggccggcaccgggaaaagc
HTMT1_0133_A10.b : GAAAAGCTTGGCGG**CGGGAGCTTTGtatttgacatgtgggcgggcacgggaaagcccc
BFLT1_0007_D04.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTaaatgtggccggccaccggaaaggcc
CBLT1_0007_C02.b : cgtgatcatgcccggcctgtccacaagagaggagcctagtctaatcaactgtgaccatcg
CBLT1_0028_F01.b : gcttggccgccggaacttttggatgtgaattgggggcgggcacccggaaaggcccccggg
HTMT1_0056_D12.b : ggcttggccgcggaaactttggaatggaaattggggcgggcaacggaaaagccccggtgg
HTMT1_0131_B02.b : GAAAGGCTTGGCGG**CGGGAGCTTggtattgacatgtgggccgccacgggaaaggcgcg
HTMT1_0104_G12.b : GAAAAGGCTTGGCGG*CGGGACCTTTTG*TATGTaaaattgggcgggccacgggaaaagc
HTMT1_0042_B11.b : GAAAAGCTTGGGCG**GCGGAGCTTTGtatgtgacatgtgggcgggcnacggagaaggcc
HTMT1_0049_A09.b : agctttggcgcnggagctttgtatgtgacatgtgggcggcaacggaaaagccccggtggc
CBLT1_0080_H12.b : GAAAAGCTTGGCGG**CCGGAACTTTGG*Ttattaaattgtgggccgggcaaccggaaaa
HTMT1_0104_F09.b : GAAAGGCTTGGCGG**CCGGAGCTTTGG*TATGTaactttgggcggccaccgggaaagcc
HTMT1_0071_A04.b : GAAAGGCTTGGCNG**CNGGAGCTTTNG*TATGTGACnatgtggcggccancgggaaagc
HTMT1_0136_G04.b : ggcgcggaagcttggttttaacatttggccggcccggaaaagcccggtggcttgctccca
HTMT1_0120_B01.b : taaacgttgccgggaacggaaaaatcctcggggcctttctcccccccctattcttacaaa
HTMT1_0036_D12.b : GAAAAagcttggcgggcggaaccttgggtatgggaaatgtggggccggcaacgggaaaag
HTMT1_0036_E11.b : ggccggcggaacttgggaagtgaaatgtggccgaaaacgaaaagcccccggggccctgtt
HTMT1_0085_D02.b : tttattttgaatttggggcggacacaggaaaaagcccggggggggtgggttacccccccc
CBLT1_0024_D10.b : GGAAAGgcttggcggccgggaactttggtaagttacatgtgggcggggcacgggaaaggc
---------+---------+---------+---------+---------+---------+ 1108
CBLT1_0023_A08.b : gcctggtcctccccccccctctaccaaaggggggggggggggcaaaccggccccgggggg
HTMT1_0050_B08.b : ccccaccccactcancaaaagggaaggggggcaatccggccctggggttgcgaagaaacg
CBLT1_0068_D11.b : gccttggctctcccccccccccttccccaaaaaggggaggcggggggcaaactcggcccc
CBLT1_0077_C07.b : tggctcacaccccccctcacccaaaagggagcggggcgaatcgggccatggggcgcggag
HTMT1_0126_A09.b : ccntgctcccacccccacttacccgaaaggatgcggggcaactcggcccgtggggtgccg
HTMT1_0038_C01.b : gccccggtggccttggtttccccccccccatcttaacccaaaaggggattggcggggcca
HTMT1_0038_D01.b : ggcccgggtggcctgtggttctccacccccactttcccccaaagagggatgcggggccaa
CBLT1_0055_F02.b : GCCCCGGTGG*CCGTGCTTCACCACCCCCgctcacccaaaagggattgcggggcaaactc
HTMT1_0079_B03.b : gggccctggctcaccaccccgctaaccaaaagggatgcggggcaaacccggcccgggggg
HTMT1_0145_A10.b : tgctcacaccccacctcaacaaaagtggaggggggcaaccgggcccatggggcgcgaaag
CBLT1_0042_C01.b : gccgcgcgtggccgtggctccccacccccacctcaactaaaaggggatccgggggcaaac
HTMT1_0012_E08.b : agccgcggtggcccggggctcacccacccccaacttcacccaaagaggaatccgggggca
HTMT1_0012_F03.b : GCCCCGGTGG*CCTTGGTTCACCACCCCagctcacccaaaggggatgcgggggcaaactc
HTMT1_0006_A04.b : GCCGCGGTGG*CCGTGGCTCACAACCCCagctcaccgaaaagggatgcggggcaaactgg
HTMT1_0005_F06.b : ccgccgtggccgtgctcaacaccccagctcacccaaaaggaagcgggggcaatcgggccc
HTMT1_0111_E01.b : tgccccccccccccgctcccccaaggggaggggggcaaacccggcccgtggggtccgaaa
HTMT1_0037_B01.b : gccccggtgggcctggtttacccccccccatttcaacccaaagggggatggcgggggaaa
HTMT1_0035_E04.b : ccgttggccctggcccccccccccgactcacccaaagggatgcgggggcacacccggccc
CBLT1_0040_F03.b : cccgcgtggccctggctcacaaccccagctccncccaaagggatccgggggcaactcggc
HTMT1_0027_C08.b : CCCCCGGTGG*CCGTGctcacccccccacctcacccaaaggggatgcggggccaactctg
HTMT1_0012_H10.b : CCCGCGGTGG*CCGTGGCTCACAACCCCagctcacccaaaaggggagcgggggcagactc
CBLT1_0093_A09.b : tcccccccccgcctccccagaggggggcggggccaaacgggccctggggggtgcgaaaag
HTMT1_0144_G09.b : tccccaaaaggaaccggggcaactggcccagggggccgcaaaaaaagtttctttgaatcg
CBLT1_0068_C08.b : ctcacccccccccctcacccaaaagggagggggggaaaactcggcccgtggggcgcggaa
HTMT1_0109_F08.b : tccccccccctctcaccaaaggggaagggggggcaaaccgggcccggggggtgcgaaagg
CBLT1_0038_E04.b : ctggctcacacccccgctcacccaaaggggatgcggggcaaactcggcccaggggctgcg
HTMT1_0089_E09.b : ctgcttcacaccccagtctaccaaagggatgcggggcaaatccggcccagggggctgcga
HTMT1_0014_H01.b : ggggaccttgccccaccaccccattttatccaaaagtggagttggggacaaaatcggttc
HTMT1_0087_A04.b : acaccccgctcnccaaagggatgcgggcaatcggcccatggctgcgacagacagtcttct
CBLT1_0078_G12.b : cccggtggccttggctcaaccccccccacttcaacccaaaggggaagccggggccaaaat
HTMT1_0050_A03.b : ccgtggctcacaccccagctcanccgaaaggggagcgggggcaaactcggcccatgggcc
CBLT1_0086_E03.b : cccgttggccctggctcacacccccgctcacccaaaagggatgcgggggcaaatccggcc
HTMT1_0028_C05.b : ccgggggcctggcctcacacccccattcaaccaaaagggatgcggggcagaccgggccca
HTMT1_0042_F09.b : cgcgtggccgttgctcccacccccgctcaaccgaaaaggtatgccgggcagactcgggcc
HTMT1_0109_A05.b : ccccccgtggcnttgctcaccaccccaactaaccgaaggggatgcggggcaaatcgggcc
HTMT1_0006_E11.b : CCCCCGTGGG*CCCTGGCTCACCACCCCCActtaacccaaaggggaatcgggggccaaat
HTMT1_0134_F06.b : GCCcggtggncgtggctccccacccccacctcacccaaaggggatgcggggcaaactcgg
CBLT1_0042_E07.b : GCCCCCGGTGGCCGTGGCTCACCCCCCCagctcaaccaaaagggatgcgggggcaaactc
HTMT1_0134_C07.b : GCCCCGTTGG*CCGTGctccccaccccaactcaccaaaaagggagcggggcaaatcgggc
CBLT1_0072_C10.b : GGCCGCGGTGCCCGTGGCTCACCACCCCCgctcaacccaaaggggatccggggcaaactg
HTMT1_0025_D10.b : gggggccgtggctcacccccccgctcacccaaagggaagggggggcaactcgggcccatg
HTMT1_0002_F07.b : GCCCCGGTGG*CCGGGGCTCCCCCCCCCCActtaaccaaaggggagccggggcaaactcg
HTMT1_0128_H06.b : ggcctggctcacaccccactccacgaaagggatgcgggcaactcgggccgtgggcgcgaa
HTMT1_0064_A02.b : GCCGCGtgggcgtgcctcacaacccccactcaaccaaaagggatgcgggggcaactcggg
CBLT1_0073_C05.b : ccaaagggaacggggcaaatcggcccatgggtccgaaagaaacggcctcttgaaacgggg
HTMT1_0138_A04.b : aaaggatgcggggcaacccggccaggggggtcgaggaaaaggcttctgaatgggggggaa
HTMT1_0025_F09.b : gcctcccacccccacttcaccaaaagggaagcggggcaaaactgggcccggggggcgcgg
HTMT1_0105_A01.b : gctcccccccccgcccacccgaaggggatggcggggcaaacccggccagtgggctgcgaa
HTMT1_0120_E04.b : ccccccccactccccaaaaggaatgcggggcaactcggccaagggggtcggaaggaaaag
HTMT1_0010_E11.b : ggccccggtggcctttgctcacccccccccgctctacccaaaaggggatgcgggggcaaa
CBLT1_0039_B10.b : ggctcacacccccaccccacccaaaagggaagcgggggcaaactcggccccatggggctg
HTMT1_0117_G02.b : tctaccccccaatctaccaaaaggaatggagggacaactccgcccgggggctttgaatgg
HTMT1_0107_A07.b : cccccccactctaccaaagggatgggggggcaactcggcccgggggccccgaaagaaaag
HTMT1_0106_C10.b : ccacccccgcctaccaaaaggggaggcggggcaactcggcccttggggcgcgaaagaaaa
HTMT1_0104_B07.b : gcgtgccttgctccaccccccccacccaccccaagggggatgggggggcaaaatcgggcc
HTMT1_0106_A11.b : aagcccccggtgggccttggtttccccccccccatctcacccaaaagggaatgcgggggc
HTMT1_0137_G02.b : tcccacccccactcacccaaaagggaggcgggggaaacccggcccggggggctccaacgg
HTMT1_0057_G09.b : gggctgggtttcccccccccgttacaccaaagggaagggggggcaaacccgggccccggg
HTMT1_0047_D10.b : cccccccgttaaccaaaagggaagcggggcaatccggcccagggggtggggaaagaaaag
CBLT1_0056_D12.b : cccggttggccttggcttcacccccccagctctaccaaaaagggaaagcgggggcaaaat
HTMT1_0047_F01.b : ctggctcacacccccactcaacgaaaggggatgcggggcaactcggcccatggggctgcg
HTMT1_0044_G09.b : cacccccgctaccgaaagggatgcggggcaatcgggccatggggctcggaagaaaaggtc
HTMT1_0141_E10.b : cccttgctccccccccccctcaacctaaggggatgggggcaaactcgcccgtggggccgc
HTMT1_0149_G10.b : cttgctcaccaccccactcaccccaaagggatgccgggcaaaccgggccatggggcgcgg
CBLT1_0055_C05.b : gccttggtaacaccccagctcacccaaagggaagcgggggccaaccggcccaatgggctg
CBLT1_0021_D08.b : gccttgcccacaccccacctcaccaaaaggggagcgggggcaaacccggccccgtgggcg
HTMT1_0099_B11.b : ggtggcccgggctccccacccccatctcaccaaaagggggatgcgggccaaaacccggcc
HTMT1_0121_B03.b : cccccccgctaacccaagggatgcgggccaccggcccgttggggcggaagaaaaggtttc
HTMT1_0151_F05.b : gcgtggctcacccccccaactaacgaaaggggatgcggggcaaactccgcccgaggggct
HTMT1_0011_A04.b : ggccccggtggcccggggctcaccacccccaccttcaccaaaaagggaaagcggggggca
HTMT1_0010_H05.b : gccccggtgggcctgggttcaaccaccccagctcaaccaaaaaggggatgcgggggcaaa
HTMT1_0025_A07.b : cctggctcccaccccaacttaaccaaaagggaggggggggcaactcggcccatggggtgc
HTMT1_0021_A06.b : gccttggttcacacccccattttacccaaaggggaagcgggggcaaaactccggcccggg
HTMT1_0095_B10.b : ggtgggcttggctcacccccccatttaacaaaaagggatgcgggggcaactcggcccgtg
HTMT1_0021_G07.b : gccccgggtggccgtgggtccaccacccccggctttaccaaaaggagtaagggggggcaa
HTMT1_0086_H08.b : gtggccgtggctcaccaccccaactcanccgaaagggatgcgggggcaaactcggcccat
HTMT1_0037_B06.b : ccgggggccctgggtcaccccccccagcctccccaaaagggtatgcgggggcaaatcggg
HTMT1_0013_B03.b : cgtgggccgtggctcacaaccccagctcaccgaaagggggatgcgggggcaaaatccggc
HTMT1_0065_B01.b : tggcgtggctcaccaccccagctcacccgaaagggatgcgggggcagactcgggccagtg
HTMT1_0028_B11.b : ccggtggccttggctcccacccccccttcacccaaaggggatccggggcaaattgggccc
CBLT1_0037_B12.b : ccccgggggccgtgggctcccacccccaatttaaccaaaaggggatgcgggggccaaatc
HTMT1_0118_B12.b : ccgttgcccgtggctcccaccccccgctcaaccaagagggaagggggggcaaatcgggcc
HTMT1_0117_E09.b : cgtggccgggctccccaccccacccaaccgaaggggatgcggggcaactccgccccgggg
CBLT1_0046_C06.b : gtgccctggccacccccccacttcaccaaggggagcggggccaatcggcccaggggctgc
CBLT1_0028_G06.b : ggccccgtggccctgggctcacaccccccacttaacccaaaagggaatccgggggcaaac
HTMT1_0111_D11.b : ccggtggccctggctccccaccccacctcccccagagggaatgcgggggcaaacccggcc
HTMT1_0092_C07.b : cccggtggcggtgctcccccccccacttaccaaaaggggagccggggcaaatcgggccag
HTMT1_0013_D07.b : cccggtggcctgggctcacacccccagcctccccaaaaggggagcgggggcaaatccggg
CBLT1_0076_G10.b : ccgtggcccttgctcaccaccccccactcaacccaaagggatgccggggccaaaccgggc
HTMT1_0098_B07.b : gcggtgccgtggctcccaccccagctcacccaaagggatgcggggcaaaccgggcccatg
HTMT1_0064_B07.b : ccgcgggtggccgtggctcacacccccagcttcaccaaaagggatgcggggcagaactcg
HTMT1_0133_A12.b : ccccggtgccctttttccccaccccagctcaccccaaaggggaggcggggcaaactcggg
HTMT1_0048_C02.b : cgcggggccgtggttcacaaccccactcanccaaaagggaagtcggggcaactccgccca
ILNT1_0002_G10.b : gcgccgttggcctggctcaccaccccacctcacccaagaggggagcgggggcaaatcggg
HTMT1_0094_D10.b : ccccggtgggnttggcttaccacccccactcaaccaaaagggaatgcggggccaactcgg
HTMT1_0046_G11.b : GCgcggntggcgtggctcaccacccccactcaccngagagggatgcgggggcaaactcgg
CBLT1_0034_A11.b : GCCCCCGTggcccgtggctcaccacccccaacttaacccaaaaggggaatgcgggggcaa
HTMT1_0083_G02.b : GCCCCCGtgggccgtggttccacaccccccacttacaccgaaaggggatgccggggcaaa
HTMT1_0042_A07.b : ccccggtggccgtggctcaccaccccagctcacccggaagggatgcgggggccgactcgg
HTMT1_0056_H09.b : Gccgcgtggccntgcctcaccaccccagctcaccnaaaagggatggcggggcaaactcgg
HTMT1_0087_A03.b : GCCCCGGTGG*Cgtggctcaccaccccagctcacccgaaaggaatgcgggggcaaatcgg
HTMT1_0060_E10.b : GCCGCGGTGC*CCGTGctcacacccccagctcanccgaaagggatgcgggggcagactcc
CBLT1_0044_D03.b : GCCGCGGTGG*CCTTGGCTCACCACCCCagctcaacccagagggatgcgggggcaactcg
HTMT1_0016_A07.b : CCCCCGTTGG*CCTTGGCTCACCACCCCCAccttaccaaaagggatgccggggcaacccc
HTMT1_0061_H06.b : CCCCCGGTGG*CCTTGGCTCACAACCCCaattcaaccaaaagggatgcgggggcaactcg
HTMT1_0139_A10.b : GCCCCGGTGG*CCNTGCCTCACACCCCCactcaaccaaaagggatgcggggcaaactcgg
HTMT1_0076_H02.b : cccccggtggcccgtggtttctccccccccctatttttatccaaaatggaattgtggtgg
CBLT1_0067_B02.b : ccccccgtgggccttggtccccccccccccttttaaacaaaagagggatccgggggcaaa
HTMT1_0007_C05.b : tggccgtggctcaccacccccactcaccaaaagggatgcggggcaaaaccggcccattgg
HTMT1_0041_C07.b : ggccttggttcaccccccccacttcacccaagggggaagcgggggcaaaatccggcccag
HTMT1_0036_E07.b : tgggcctggctcaccacccccagtttacacaaaagggaatgcgggggcaaatccggcccc
HTMT1_0126_H07.b : cgncgtggccgtgctcancacccccactcaccgaaagggatgcggggcaaatcggccnag
HTMT1_0113_A02.b : GCCCCGGTGG*CCttgcccccaccccagctcacccaaaagggatgcggggcaacccgggc
HTMT1_0120_A12.b : cctacccaaaagggatgcgggccaatccgccccctggggtcggaaaagaaaaagtttttt
CBLT1_0024_B08.b : ggccccccccccccccttaccaaaaggggaggcgggggcaactccggcccatgggggcgc
HTMT1_0118_H02.b : ggggcctggttcccccccctanttcaccaaaagggatggggggcaaacccggccccgggg
HTMT1_0045_F04.b : ggtggcccgggttcaccaccccagctcacccaaagggaatgcgggggcaaactcggccca
HTMT1_0053_C11.b : ccccgttggcctggcctcaccacccaatctcaacaaaaggggatgcggggcaaactccgg
HTMT1_0042_E11.b : gggctcacaccccactcacccaaagggatggggggcaaatcgggccatggggtgcgaagg
CBLT1_0067_E11.b : cctacccaaaagggggcggggggaaaccgggcccaggggggcgcgaaaaaaaaaggggcc
CBLT1_0074_F01.b : ggtcaccccccccccttccccaaaggggatcgggggcaaaacggggcccgtgggggtggg
HTMT1_0136_H12.b : gcttcacccccccgcttcaccaaaagggatgcgggggcaaaccggcccaggggggcgcgg
HTMT1_0126_E03.b : gctcnccaagagggatgcgggcgactcggccatgggctgcgacagaacaagtctctggat
HTMT1_0147_C10.b : ctccccccccactcacccaaagggatgccgggccacccggcccgggggcgccaaaggaaa
HTMT1_0041_H02.b : gtgggcctgggtttaccacccccatctaacccaaaagggatgcgggggaaaacccggccc
HTMT1_0117_D03.b : ggggctagttctaacacctcccccctccccgaagggtatggggggccaaaccggccctag
HTMT1_0034_B04.b : ggccccggaggccgtggctcccccccccacgtccacccaaaaggggaagcgggggaaaac
CBLT1_0077_E12.b : cccccggtggccctgggtttcaccccccccacttaatcaaaaaggggaagcgggggccaa
HTMT1_0118_F12.b : gtggccttggctcacacccccccccaccgaaaagggaagcgggggcaactcggcccatgg
HTMT1_0066_C01.b : gcgtggcgtggctcacaccccagctcancgagagggatgcggggcaaactcggcccatgg
HTMT1_0073_B12.b : cggtgggcgtggttcacccccccagctaaccaaaaggggtgcggggcaaaatcgggccct
CBLT1_0072_H09.b : GCCCCCGtgggcgtggctcacaaccccagctcacccgaaagggatgcgggggcaactcgg
HTMT1_0111_A02.b : ccggtgccttggctcccccccccactcaacaaaagggatgcggggcaaatcgggcccgtg
HTMT1_0076_C01.b : tccaaaaaggggtggggggggaaactcggccccgggggggggggaaaaaaaaagggtttt
HTMT1_0122_D09.b : tccccccccccccccaaccaaaagggatgcgggggcaaaatgggcccatgggggtccgaa
CBLT1_0009_G11.b : ggccccgtgccgtggctcacacccccagctcaaccaaaaggggagcgggggcaaactcgg
HTMT1_0093_H12.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCgctcancccaaaagggatggcggggcaaact
HTMT1_0060_B12.b : gatgggannnnnnngatcgcaggctggcgagaaaanaagaggttganctgatcgtgangt
CBLT1_0034_H05.b : cccccatttccccaagaggggatgcggggcaaacttggccccaggggggtcggaaaggaa
HTMT1_0059_D04.b : agggggaccacccgcgcagtggggtggacgaaaaggtctttgaattgnntggnaagggcc
CBLT1_0068_G08.b : tgcccttggctccccccccccctctaccccaaaaggggaccggggggaaaactgggcccc
HTMT1_0115_B01.b : cccaaaggggatggggggacaccccggccctggggccgcgaaaaaaaaggttttctggaa
HTMT1_0058_C04.b : ctcaacaaagggaatgcggggcaacccgggcaagggggctgggaaagaaaaggccctctg
CBLT1_0073_F08.b : accccacccaaaggggaccggggccaaacgggcccatggggtgcgaaagaaaaggtcctt
HTMT1_0013_A02.b : cacatcccttcctccccatacgggaatcgggccttacacaaccctttgaggtgcggaaat
CBLT1_0067_B11.b : gggttccccaccccaactttaacaaaagggggaatgggggggcaaaacccggccccaggg
HTMT1_0119_B12.b : tgggaaaattgggaaggtttggttttttttaacccttttagcggcaaaaaaaatttacaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : ccagctaccnaaagggatgcgggccaaatcggcccatggggctgcgaagaaacagtcttc
HTMT1_0111_F07.b : ccccccacttaaccaaaggggatggggggcaaaccgggcccgggggcgccaaaaaaaaag
HTMT1_0105_F06.b : cccccaactcaccaaaagggaagcggggcaaactcgccccgggggcgcgaaaaggaaagg
HTMT1_0117_H09.b : ccccccaccaaaggatggggggcaaactcggccagggggcgggaaagaacaggtctttgg
CBLT1_0073_B11.b : cccccggggggccctgggcccaccccccccacctcaccaaaaaaggggagccggggcaaa
HTMT1_0119_D08.b : atgtttcccacctcaattcacccaagaggagtggggggcaaaattcggccattggggtac
HTMT1_0126_F11.b : ctacccaagggggagcgggggaaaccggcccttggggtgcgaaagaaaggggcctttgga
HTMT1_0128_E02.b : caccaccaaaggaatgcgggcaacccgcccctggggcgcgaagaaacagtctctgaatcg
CBLT1_0050_C05.b : ctcacccccccactcacccaaaggggatcggggcaaatcggcccattgggctgcggcagg
HTMT1_0035_H01.b : aggcccccgggggcccgggcttcaccaccccccaacttaaacaaaaaggggattcggggg
HTMT1_0035_D11.b : cccccgttggccgtggttcacccccccccacttaaaccaaaaggggaatgcggggcaaaa
CBLT1_0096_H03.b : ccccactcacgaaagggatcggggcaatcggcccatggggctcgacgaaaggtctctgga
HTMT1_0140_H10.b : cccactcaccaaaggaagccgggcaaaccggcccgtggggtgcgaagaaaaagtttcttg
CBLT1_0038_D11.b : cccggtggccttgggtcaacaccccaaacttaaccaaaaagggaatccggggccaaaccc
HTMT1_0132_F08.b : gtgcctacccccccaactcaaccaaagggaagcgggggcaaatcgggcccgggggctgcg
HTMT1_0016_D05.b : ggcccaccccccccgctcaaccaaaggggatgcggggcaaaccgggcccggggggctgga
HTMT1_0097_G08.b : cgggggccttggttccaccaccccaatttaaccgaaaggggaagccgggggcaaatcggg
CBLT1_0041_C10.b : tgcccggggctcacacccccacctcaacccaaaggggatgcgggggcaaaccggggccca
HTMT1_0121_B01.b : ttgcttaccccccccacttcacccaaaggggatgcgggggcaaatcgggccccatggggc
HTMT1_0113_B09.b : ccctgcctcccacccccactaacccaaaagggatgccggggcaacccggcccatggggct
HTMT1_0077_E08.b : cttgctcccccccccactcacccaaagggagcggggcaaaccggccccttggggggcaaa
CBLT1_0041_D07.b : ccttgctcccccccccgctcacccaaagggatgcgggggcaaatcggcccattgggctgc
HTMT1_0148_A09.b : tccaccccccccctcaccaaaggggaggggggccaaaccggcccttgggggggccaacga
HTMT1_0132_F03.b : ttgctcaccccccctctcaaccaaaggggaagcggggcaacccggcccattgggctgcga
HTMT1_0140_C12.b : accccacttaccaaaagggagcgggggcaatcggcccatgggcgcgaaaagaaaagggcc
HTMT1_0140_F06.b : tgcccacacccccactcaccaaaggggatgcggggcaaactcggcccttgggctgcgaaa
CBLT1_0024_F01.b : gggccgtggtttcaccccccaattaaaccaaaaggggaaggcggggcaaaaccgggcccc
HTMT1_0106_E05.b : tgctaaccccccactcacccaaaggggagcggggcaaatcggcccgtggggcgggaaaga
HTMT1_0099_C09.b : cttgctcaccccccaactcacccaaaggggaagcgggggcaaactcggcccagggggctg
HTMT1_0101_E05.b : tggcctggccccaccccccacctcacccaaaagggatgccggggcaaactcggcccgtgg
HTMT1_0021_A08.b : cctgggtcaccacccccagttcaccaaaaagggatgcgggggcaaacccgggcccagtgg
HTMT1_0128_G08.b : gtgctcacacccccactccccagagggatgcgggcaatcgggcaatgggctgcgaagaac
HTMT1_0120_B12.b : ggccttgctcccccccccacctaacccaaagggatgcggggcaactcggccccgggggct
HTMT1_0028_G05.b : gtgctcaccaccccactcaaccaaaggggaacgggggaaaatcggcccatgggctgcgaa
HTMT1_0060_C11.b : ccttggctcacaccccccactcacccaaaagggattgcggggcaaactcggcccagtggg
HTMT1_0044_H10.b : gccntggctcacaccccccactcacccaaaagggatgcggggcgaaatcgggcccctggg
HTMT1_0026_D07.b : gcttggctcacaccccanctcaccaaaagggatcggggcaaactcgggccagggggctgc
CBLT1_0060_G12.b : agcccccggtgggcccttggctcaccaccccccaacctcaaccaaaagggggatgcgggg
HTMT1_0105_B03.b : cggttggcctggctcccccccccccacctcccccaaagggaagcgggggcaaatccggcc
CBLT1_0011_E06.b : cgcgtgtggccgtggctcaccacccccacctcaaccaaaaggggaatccggggccaaact
HTMT1_0135_B04.b : gctcacaccccactcaccgaaagggatcngggcaactcggccccatgggctcgacagaaa
CBLT1_0080_E02.b : gcctggctcaccaccccactcaaccaaaagggaaccgggggcaaccgggcccatggggcg
CBLT1_0064_A08.b : ggccgtggctcaccaccccagctcaccccaaggggagccggggccaactcggcccagtgg
HTMT1_0139_E01.b : gccttggctcacaccccactcaccgaaaggggatcggggccaatcgggccattgggctgc
CBLT1_0090_F01.b : ccgggggccttgttccacccccccctctcaacccaaaagggatgccgggggcaaacccgg
HTMT1_0034_H09.b : ccccgttggccggggttcaccaccccagctcaaccaaaaagggatggcgggggcaaaacc
CBLT1_0014_C12.b : gccccggtggccctggcctcaccccccccagcttaacccaaaaggggagccgggggcaaa
CBLT1_0088_A03.b : gtggcttggctcaccccccccgctcacccaaaagggaagcgggggcaaatcgggcccagt
HTMT1_0106_B11.b : cccgtggccctgggctccccccccccacctcaacaaaaggggaggcgggggcaaacccgg
HTMT1_0064_G04.b : gcgtggctccacaccccactctaccgaaagggaggcggggccaactcggcccaggggggt
HTMT1_0062_E07.b : ggcgtggctcacacccccactcaccaaaaggggagcggggcagatccgggccagtggggc
HTMT1_0095_A12.b : ccccggtgggccttggttcaaccccccccatttaaacaaaaagggggatgcggggggcaa
HTMT1_0150_D11.b : ccgggtgccctgggttccccccccccgcttaaccctaaaggggatgtcgggcgcaaatcc
HTMT1_0122_B12.b : tgccttggctcccacccccgctcaacaaaaaaggaatgcggggccaaaccggcccatggg
HTMT1_0141_H07.b : ttggccctggtcccccccccccacctcaccaagagggaagcgggggcaacccgggcccag
CBLT1_0040_B05.b : ggtggccctggctcaccaccccacccaaccgaaagggatgcgggggcaaaccgggccagg
CBLT1_0052_A10.b : cggtggcctggctcacacccccagctaacccaaaggggaagcggggcaaactcgggccca
HTMT1_0025_C06.b : cggtggcctgggctacccccccccaatcaaccaaaaggggatgcgggggcaaactcgggc
HTMT1_0067_H07.b : cgtggccgtgcttcaccccccgcttaaccaaaaggatgcggggcaaatcgggccaagggg
CBLT1_0082_A09.b : cccgtgggcctggctccccaccccagcccacccaaaggggatgcgggggcaactcggccc
HTMT1_0013_F01.b : ccccggtggccttggttcaccacccccactcaaccaaaaggggatccgggggcaactccg
HTMT1_0130_C05.b : ccggtggccttgatccccaccccactctaccaaagggaagccggggcaaaaccggccagg
HTMT1_0099_A06.b : ctggggccgtggctccacccccccctccacccaaagggaatgcggtggtaaacccggccc
CBLT1_0036_C05.b : ccccggtggcctggctcccaccccccgctcacccaaaagggaatcggggggcaaatcggc
CBLT1_0037_B04.b : ccgttggccgtggtcaccccccccacctcacccaaagggaagcgggggcaaatcgggccc
HTMT1_0132_A04.b : cacgtggccgtgggtccccccccccactctaccaaaaggggaaccgggggaaaatcggcc
HTMT1_0070_G03.b : cgcgntggccgtggctcacacccccagctcacccgagagggatgcgggggcgaactcggc
HTMT1_0111_H01.b : cccggtgggccttgttccccccccccctcctacccaaagggggatgggggggcaaaatcg
HTMT1_0100_F01.b : cccgtgggcttgcttcacacccccagctcaccgaaaagggatgcggggcaaatccgggcc
CBLT1_0044_C08.b : ggccccgttggcctggcttcacacccccaactcacccaagaggggagccggggcaaactc
HTMT1_0133_A10.b : ggtggccttggctcaccacccccacttaccgaaaggggaggcggggcaaactcggcccat
CBLT1_0075_B12.b : gccccgtgggccttgggttaccacccccttttaaacaaaagggggattcgggggcaaaac
HTMT1_0027_B01.b : gcgccgttgccgtggctcacacccccgctcacccaaaggggatgcggggcaaactccggc
CBLT1_0088_G06.b : ccccgggggccttggctccccccccccgctaaaccaaagggggagcgggggcaaatccgg
HTMT1_0048_A11.b : cccggtgcccctggttcccacccccagttcaaccaaaagggaatgcggggcaaactccgg
CBLT1_0046_H09.b : ccggggggcccgtgctcaccccccccgcttcaccaaaagggaatccgggggcaaatcggg
CBLT1_0004_D05.b : gccgcgtggcccttgcctcaccacccccactcaccccaaaggggatgcggggcaaaatcg
HTMT1_0103_C12.b : cccccggtgcccttggcctaccacccccacttaaccaaaagggatgcgggggcaaactcg
CBLT1_0035_B11.b : ggccgcgttggcctggcctccccaccccaactcaaccaaaggggaatcgggggcaaatcc
HTMT1_0076_B06.b : gccccggtggccgtggttcaacccccccagctcaaccaaaaagggaaggcggggcaaaac
HTMT1_0095_F01.b : gcggtggcgtggctcacaccccagctcacccagagggatgcggggccaaatccggcccag
CBLT1_0013_B03.b : gccccgggtgcccgtggctcacacccccagctcaaccaanaagggattcgggggcaactc
CBLT1_0095_H06.b : gcccggtgccctggctcacacccccactcaccaaaagggatgcggggcaaactcggccag
HTMT1_0016_G09.b : ggccgcggtggcccgtggctcccacccccagctcaaccaaaaggggaatgcgggggcaaa
HTMT1_0019_D11.b : gcccgggggccgttgctcaccacccccagctcacccaaaagggaatgcggggcaaactcc
CBLT1_0025_B07.b : gccgcgttggccttgcctcacaaccccagctcaacccaaaggggagcgggggacaacccg
HTMT1_0028_H02.b : ggcccccggggccctgggctcacacccccaactcacccaaaggggatgccggggcaactc
CBLT1_0085_H01.b : cccccgtggccttggttcccacccccaccttacccaaaaggggatgcggggccaactcgg
HTMT1_0054_B11.b : ccccgtggccgtggctcaccaccccagtttcaccaaaaggggatgcgggggccaacccgg
CBLT1_0051_A01.b : gcgcggtggccttgcttaccaccccacctaaccaaaaggggatcggggccaaccgggccc
HTMT1_0014_G11.b : gcccggtgggccggggttccacacccccacttaaccaagagggaagccgggggaaacctc
HTMT1_0134_G05.b : ccccggttgcccgtgctcaccccccagctcaccgaaagggatgcggggcagactcggcca
HTMT1_0034_E03.b : GCCgcgtgggccctggttccccacccccacttcacccaaaagggaagcgggggcaaactc
HTMT1_0084_E09.b : cccgcggggccgttgctcaccaccccagctcaccgaaaagggatgcggggccaactcggg
CBLT1_0061_C12.b : gccccggtgggcctggctcaccaccccaacctcacccaaaggggaggcgggggcaaaatc
HTMT1_0149_F10.b : ggccccgttgggcgtgcctaccccccccactcacccaaaggggatgccggggccaactcg
CBLT1_0039_D07.b : ccccggtggccgtggctcacccccccaactcacccaaaggggatgcggggccaaacccgg
CBLT1_0034_F10.b : cccccggtgccgtggctcaccaccccacctcaacccaaagggaatccggggccaaatcgg
HTMT1_0051_A10.b : cccccggtggcngtgctcaaccacccanctcaaccaaaaggggatcgggggcaacccggg
CBLT1_0039_D10.b : GCCgccggtgccctggcctccccacccccactcacccaaaagggatgcgggggcaaatcg
HTMT1_0022_F01.b : GCCccgtggccctggctcacccccccagtttacccaaaggggaagcgggggcaaacccgg
CBLT1_0015_E12.b : GCCCcgggtggcctggcttaccaaccccaacttaacccaaaaggggaagccgggggcaaa
HTMT1_0041_B02.b : GCCCCgtggccgtggctcaccaccccagcttaacccaaaggggatgcggggcaaactcgg
HTMT1_0075_F07.b : GCCGCGttgccgtggctcacacccccagctcanccgaaaggggatgcnggggcaaatccg
HTMT1_0020_H06.b : GCCCCCGtggcctggctcacaacccccgctccaccgaaaggggagcgggggccaactcgg
HTMT1_0074_H09.b : GCCCCggtgccgtggctcaccaccccagctcaaccgaaaggggagccggggcaaaatcgg
HTMT1_0014_A01.b : GCCGCGGTGG*Cgtggctcaccacccccgctcanccaaaagggatgcgggggcaaatcgg
HTMT1_0037_H11.b : GCCCCGGTGG*CCcttggcttcaccaccccagttcaaccaaaagggaatgcggggacaaa
HTMT1_0066_D08.b : GCCNGCGTGG*CCGTGGgctcacaccccagctcanccgagagggatgcgggggcagctcc
CBLT1_0038_C06.b : GCCGCCGTGG*CCGTGGCcaccaccccagctcanccgagaggggagcgggggcaaatcgg
CBLT1_0034_C01.b : GCCCCGGTGG*CCGTGGCTtcacaccccagcttcaccagaggggatgccggggccaactc
CBLT1_0060_G03.b : GCCCCGGTGG*CCTTGGCTCACaccccagctcaccaagagggatgcgggggcaactcggg
CBLT1_0062_H04.b : GCCGCGNTGG*GCCTGGCTCACacccccgctcaccgagaggggatgcgggggcaaactcg
HTMT1_0096_A11.b : GCCCCGGTGG*CCGTGCCTCccacccccagctcacccaaaagggatgcggggggcaactc
CBLT1_0075_C10.b : GGCCCGGTGG*CCGTGGCTCACCCCCCCaactcacccaaaggggatgcgggggccaactc
CBLT1_0025_E08.b : GCCCCCGTGG*CCGTGGCTCACCACCCCacctcacccaagaggggagcgggggcagacct
CBLT1_0004_G05.b : GGCCCGGTGG*CCNTGGCTCACCACCCCagctcaaccaagagggatgcggggcaaactcg
CBLT1_0054_G01.b : GCCGCGGTGG*CCGTGGCTCACCACCCCagctcacccaaaagggatgcgggggcaactcg
HTMT1_0053_A07.b : GCCNGCGTGG*CCGTGGCTCACCACCCCagctcnccgaaagggatgcgggggcgactcgg
HTMT1_0073_B07.b : GCCCCGTGGG*CCGTGCCTCACCACCCCagcttanccaaaagggaatgcggggcaaatcc
HTMT1_0094_C01.b : GCCCCGTTGG*CCTTGGCTCACCACCCCagctcacccaagaagggagcnggggcagatcc
HTMT1_0027_A10.b : GCCCCGGTGG*CCCTGGCTTCACACCCCCActcacccaaaagggatgccgggcaaactcc
HTMT1_0017_E05.b : GCCCCGGTGG*CCGTGCCTCACCACCCCCActcaaccaaagagggatgcggggcaaaatc
HTMT1_0063_D12.b : GCCCCGGTGC*CCGTGGCTCACCACCCCCAG*Cctaaccaaaagggatgcgggggccaaa
HTMT1_0045_D10.b : GCCCCGGTGG*CCCTGTCTCCCCACCCCCAG*CTCAacaaaaagggatggcgggggcaaa
HTMT1_0073_A06.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCAG*CTCAccgaaaggggatgcgggggcaact
CBLT1_0061_H05.b : GCCGCGGTGG*CCGTGGCTCACCACCCCacctcacccaaaaggggagcgggggcaaaccc
HTMT1_0089_D09.b : GCCCCGGTGG*GCGTGGCTCACCACCCCagctaaccaaaagggatgcggggccaactcgg
CBLT1_0062_D02.b : GCCCCGGTGG*CCGTGGCTCACCACCCCCActtaacccaaaggggatgcggggcaaaatc
HTMT1_0043_E02.b : GCCGCGTTGG*CCGTGGCTCACCACCCCagctcaccgaaaagggatgccggggcagactc
HTMT1_0043_G10.b : GCCCCCGTGG*GCGTGGCTCACCACCCCCActcanccaaaagggatgcgggggccaactc
BFLT1_0007_D04.b : cggtggcctggctcaccaccccgctcaaccaaaagggagcggggccaaatccggcccagg
HTMT1_0024_B03.b : cccggtgggcgtggctcaccaccccactcaaccaaaggggatgcggggcaaacccggccc
CBLT1_0007_C02.b : agggcgcattgtccgataccctgcactgagaccacgtagttaagaaacatcttggggaat
CBLT1_0028_F01.b : gccttggtctcccccccccctcttaacccaaaagggataccggggcaaacatcggccccg
HTMT1_0056_D12.b : cttggttcccccccccatttcacccaaaaggggggccgggcaaaacccggccccgggggg
HTMT1_0131_B02.b : gtgccgtgctcaccccccactcaccgaaagggagcggggcatactcggcccgggggtgcg
HTMT1_0104_G12.b : cccggggggccgtgtctcccccccccaacttaaccaaaggggatgcggggccaactcggg
HTMT1_0042_B11.b : cgttggcgtggctcaccacccccactcaacccaaagggatgcggggcaaactcggcccca
HTMT1_0068_B12.b : ccccggtggccgtggttcccccaccccaactcaaccaaaagggaagcgggggcacaaccc
CBLT1_0054_F08.b : ggccgcggtgccgtggctcaccaccccanctcaacccaaaagggagcgggggcaaactcg
CBLT1_0085_H05.b : GCCCCGGGGG*CCtggcccaccccccccgcctcaccaaaaagggatgccgggggaaactt
HTMT1_0064_C09.b : GCCGCGGTGG*GCGTGGCTCACCACCCCagctcaccgaagagggatgcgggggcagactc
HTMT1_0047_B04.b : GCCGCGGTGG*CCGTGGCTCACCACCCCaactcacccaagaggggagcgggggcaaactc
HTMT1_0068_D07.b : GCCGCGTTGG*CCGTGGCTCACACCCCCagctcacccaaaagggaggccgggcaaaatcg
CBLT1_0053_G06.b : GCCGCGGTGG*CCGTGCCTCACCACCCCCACCTCAccccaaagggatgccggggcaaaat
HTMT1_0049_A09.b : ctggctccccaccccactcaaccaaaagggatccggggggcaaccggcccattggggcgc
CBLT1_0080_H12.b : gcccccgtgggccgtggttccacacccccacttaacccaaaggggatgcgggggcaaaac
HTMT1_0104_F09.b : ccggtggccttgccccccccccccaccacccaaaaggggatgcgggggcaactcggccca
HTMT1_0071_A04.b : cgncgtggncgtggctcacaccccagctcaccgaaaagggatgcggggcaaactcggccc
HTMT1_0034_F11.b : ggccccgttggccggggctccaccccccccacttaaaccaaaagggaaggccggggccaa
HTMT1_0146_C12.b : GCCCCCGTGG*CCCTTGCTCACCCCCCCaactcacccaaagggaagccggggcaaacccg
HTMT1_0136_G04.b : ccccgctcacggagaggatcggggcaacccggcccatgggctgcaaagaacaggtctctt
HTMT1_0120_B01.b : gggtagcgggtgcaaaccggttccgggggtggcaaaaaacaggtttttttgtaaacctcg
CBLT1_0006_H07.b : GCCCCGGTGG*CCTTGGCTCACCACCCCCActcaaccaaaggggatgcggggcaaacccg
HTMT1_0036_D12.b : gccccggtggcccttggctcaaccacccccatttcacccaaaaaggggatcgggggggca
HTMT1_0133_G04.b : GCCCCCGtggccttgctcaccacccccactcaccgaaaaggggagccggggcaaaccggg
HTMT1_0036_E11.b : tcccctccccatatcaccaaaagggaaagcggggaaaaattgacccatggggttggtaaa
CBLT1_0062_A01.b : GCCGCGGTGC*CCGTGctcaacaccccaacttacccaaaagggaagcgggggcaaactcg
HTMT1_0085_D02.b : ggtcctacccaaaggggatggggggggaaatctggcccaatggggctcccaaaaaaaaaa
HTMT1_0063_E09.b : ccgcggtggcgtggnctcacaccccagctcaccgaagaggggagcgggggcagactcggg
CBLT1_0024_D10.b : ccccggtggccgtggctcacacccccccctcacccaagagggaatcgggggcaaatccgg
CBLT1_0024_B03.b : cccccgttggccttggcttacacccccaacctaacccaaaagggatgcgggggcaaaacc
CBLT1_0069_G11.b : ccgcggtggccgtggctcacaaccccaactcaccaagaagggatgcgggggcaaactcgg
CBLT1_0052_G05.b : GCCGCGGTGG*CCGTGGCTCACCACCCCANCTCAccaanaaggggagcgggggcaaactc
CBLT1_0074_H03.b : cccgtgggcttggttcacacccccacctccccaaaagggataggggggcaaatcgggccc
---------+---------+---------+---------+---------+---------+ 1168
CBLT1_0023_A08.b : gtgcgaaaagaaaaaggtttttttgaaatagggtggggaaaggggccccggggccccctc
HTMT1_0050_B08.b : gttctttggaaatcggggggaaagggcccagggacccccccaaccctttctcttaggccc
CBLT1_0068_D11.b : atgggggttccgcaagagaaaaaggggttttttggaaaaagggggggagaaaaaggggcc
CBLT1_0077_C07.b : gaaaaggtcttctggaatggctgggaagggcccaggcacccccaacccttgtctaggccg
HTMT1_0126_A09.b : aaggaacaggctttcttgaatcgggtgggaacgggcccaggacccccccaccctttgcta
HTMT1_0038_C01.b : aacccgggccccgtggggcctggcggacagaaacacagggtctctctggaaatatgggct
HTMT1_0038_D01.b : accccggcccagggggggtggggaaaggaaaaaaggtctttcttggaaatcggctgggaa
CBLT1_0055_F02.b : cggcccatgggggtgcgaacggaaaaagggtcttttggaattgggctggcaaaacgggcc
HTMT1_0079_B03.b : ctgcggacaggaaagggtctcttgaaatcggctggcaaaagggcccagggaccccctctc
HTMT1_0145_A10.b : aaaaggcctctggaaatgggcggggaaaggcccagggaaccctaacccctttctgggccc
CBLT1_0042_C01.b : tcgggccaagtggggctgccgacaggaaaaagggtcttcttgaaaacgggcgtgggaaac
HTMT1_0012_E08.b : aactccggccccagtgggggtgcgaaacggaaacagggtctttttggaaaatgggctggc
HTMT1_0012_F03.b : ggccccaagggggctgcgaaaaggaaaaaggtctttctggaatatcggctgggcaaacgg
HTMT1_0006_A04.b : gcccatggggctgcgacagaaacgggtcttctggaatcggccgtgcgagcgggccaaggc
HTMT1_0003_B02.b : TCGGGCCCAtggggctggcgaaaggaaacggtcctcctggaaatcggctgcagaaggggc
HTMT1_0005_F06.b : atgggctgcgaacagaacgggtcttctgaaaccggtgggaaaacggcccaggcacccctc
HTMT1_0111_E01.b : ggaaaagggctctttaaaattgggcgggaaaggggccccaggacaccccccacccccttt
HTMT1_0037_B01.b : acccgggcccagtgtggttgcggaaaggaaaaagggttttcttggaaatcggggtgggaa
HTMT1_0035_E04.b : aggggggctgggaaagaaaaagggcctttggaaacgggtgggaaaggggcccagggaatc
CBLT1_0040_F03.b : cccagtgggctgcggacggaaacagggcttcttgaaaacgggtgggaaaagggccccaag
HTMT1_0027_C08.b : gccatggggctgccaacaggaacaggttctcttggaatgggctgaaaaaggccccaggga
HTMT1_0012_H10.b : ggggccagggggctgccgacagaaaacaggtctctggaaatcgggctgccaaaagggccc
HTMT1_0011_B07.b : ccggcccagggggctgcgaacgggaaaagggtcttcttggaatcgggctggcaaagcggg
CBLT1_0093_A09.b : aaaggggtctctgggaaaggggggggaaaggggccnggggaccctctacaccccttttct
HTMT1_0144_G09.b : gcggcaacgggccccgggaccccctgctctatttatgggcccggcgtttgggtgccanaa
CBLT1_0068_C08.b : aggaaaggggtctctttggaatggggtggggaaaagggccccaggggccccctccaaccc
HTMT1_0109_F08.b : aaagggtctttttgaaattggtgggaaagggggcccgggaaccctcccaacccttttcct
CBLT1_0038_E04.b : gaaggaacaggtcttctgaaatgggcggcaaaacggcccaggaacctcttcaacctttgt
HTMT1_0089_E09.b : aaggaaaagggcctctggaaatggggtgggaaagggcccagggaaccccccaaccccttt
HTMT1_0014_H01.b : cacgggggttcagaaagaaaaagggtcttcttgaaaacgggctttacgaaagggcccaag
HTMT1_0087_A04.b : gaaatcggtgggaacggccccggcactctcaccctgttctgggccggcggatggggaaag
CBLT1_0078_G12.b : ccgggcccagggggggcgcggaaaggaaaaaagggctttcctgggattccggggtgggaa
HTMT1_0050_A03.b : tgcggacagaaacaggtctcttgaaatcggcggggaaagggccaaggaacccctctancc
CBLT1_0086_E03.b : caggggggcgcggaaggaaaagggccttctggaatcgggctggaaaggggccccgggacc
HTMT1_0028_C05.b : ggggcttgcgaacggaaagggtcttctgaaatcgggggggaaagcggcccgggaactctc
HTMT1_0042_F09.b : atggggctgcggacagaaacagttcttctgaaatcgggttgaaaaagggcccaagggacc
HTMT1_0109_A05.b : agtggggctgcgaaggaaaaggtcttctgaaacggggtggaaaacggccccggcccctcc
HTMT1_0006_E11.b : ccggcccattggggcgtcgaaaggaaaagggtcttctggaaatcggggtggaaaacgggc
HTMT1_0134_F06.b : cccatggggctgcgaaagaaccagttcttctggaatcgggtggcaaacggcccagggcac
CBLT1_0042_E07.b : ggccccttggggcggcggaagggaaacgggtcctcttggaaaccgggttggaaaacgggc
HTMT1_0134_C07.b : cagtgggctgcgacagaacaagtcttcctgaatcgggctgcaaagggcccaggcnacctc
CBLT1_0072_C10.b : ggcccatggggctgcgaacggaaacaggtcttcttggaaccggctgggaaaacgggcccc
ILNT1_0001_B08.b : cggcccctggggctgccgacagaaacgggtctcctgggaaccgggtggcaaaaggggccc
HTMT1_0002_C03.b : ccggccccagggggctgccgaacagaaaacaggtcctctttaaaaccggctggaaaaaag
HTMT1_0025_D10.b : gggtgcgaaaggaaaagggctcttggaaatgggtgggaaagggccccgggaactcccacc
HTMT1_0002_F07.b : ggcccatggggctgcggaaagaaaaaggttttctggaaaatggctggaaaacggggccca
HTMT1_0128_H06.b : agaaaaggtctctgaatcgcttggcnaagggccaggacctctaacccttttctaggccgc
HTMT1_0064_A02.b : cccatggggctgcgaacagaaacgggtcttcttggaatcgggctggaaaaaagggcccag
CBLT1_0073_C05.b : ggaaagggcccgggaccctctaacccctttcctaggcccccggaattgggaatttccatt
HTMT1_0138_A04.b : aggggccaggacctcctcacccttttttaggcccccggattgggaaactccccaaaaggg
HTMT1_0025_F09.b : aaagagaacgggctttcttggaactggttgggaaaggggcccaggggacccctaaaccct
HTMT1_0105_A01.b : agaaaagggccttctggaatcggggggaaaaggggccagggcccccctcacccctgttct
HTMT1_0120_E04.b : gttttttggaatggtgggaaagggccaggaacctccaaccctttcctgggcccgccggat
HTMT1_0010_E11.b : aatccgggccaagtggggcttccgaacagaaaacaaggtctttcttggaaaatcggctgg
CBLT1_0039_B10.b : cggaaggaaacaggttttcttgaaatcggctggaaacgggccccaggcacctcctcaccc
HTMT1_0117_G02.b : aaaaggcccttttgataccgattgtaaacgggcccgtgctacacatccaaccttgcttta
HTMT1_0107_A07.b : gggcttcttgaaatggggggaaaggggcccagggccccctccaccctttttcttaggccc
HTMT1_0106_C10.b : ggggttttctgaattgggtgggaaacgggcccaggacccccctaccccctgttctagggc
HTMT1_0104_B07.b : cattgggctcgggaagaaacagggtcttctgtaaatgggcggggaaaggggccaagggcc
HTMT1_0106_A11.b : gaaaatccgggcccaggggggcctccgaaaagaaaaagggttttctgggaaatcgggggg
HTMT1_0137_G02.b : aaaaagggcttttggaaaggggggggaaagggccccggggaccccctaaccctgttctga
HTMT1_0057_G09.b : gggtgcgaaagaaaaagggttcttctgaaatacgggtgggaaaaagggcccaggggactc
HTMT1_0047_D10.b : ggctttttgaaatcgggtggaaaagggccccagaaaccccttcaacctttgtctaggccc
CBLT1_0056_D12.b : cgggcccatgggggcgtggcgacggaaaaagggtcttcttggaaatcgggctgggcaaaa
HTMT1_0047_F01.b : acaggaaaaagttcttctgaattcgggctggaaaggggcccagggcaccttctcaccccc
HTMT1_0044_G09.b : ttctgaatcgggggggaaagggccccgggacccctcaacctttttctaaggcccccggat
HTMT1_0141_E10.b : gaacgaaaagagtttttttgaattggggggaaaagggcctggctcccctcaacccctttc
HTMT1_0149_G10.b : aaaggaaacggtcttctggaatcgggtggaaaagggcccgggaaccccctcaaccctgtt
CBLT1_0055_C05.b : cgaaaggaaaagtccttctggaaatcgctgggaaagcggccccgggaccccctcaaccct
CBLT1_0021_D08.b : gccaacggaaacaggttttttggaaatggggtggaaaaggggcccggggacctccttaac
HTMT1_0099_B11.b : cctgggggttgcgaaaaggaaaaaggtctttttggaaaccggggtggaaagagggccccg
HTMT1_0121_B03.b : tggaattggggggaaaaggcccaggaccctccaaccctttcttaggcccccggatttgga
HTMT1_0151_F05.b : tcgacaggaaaaggccttctggaatcggcgggcaaaggggccaaggccccccccaaccct
HTMT1_0011_A04.b : gaatccgggccccagtggggctggcggaaaggaaacaaggtcttcttggaaaaccgggtt
HTMT1_0010_H05.b : ctcgggccccattggggctgcggacaggaaacagggtcctcttgggaaattcggctggga
HTMT1_0025_A07.b : gaacggaaagggtcttctgaaatcgggggaaaaggggccagggacctccccaacccttgt
HTMT1_0021_A06.b : gggttcggaaaggaaaaagggcttcctgggaacgggggtggaaaaaggggccccggggac
HTMT1_0095_B10.b : gggttgcgaaggaaacaggtcttctggaaatcggctggaaaagggcccagggaaccccct
HTMT1_0021_G07.b : aactcggccccctgtgggctgggacaagggaaacaggtcctcttgggaaatacggggtgg
HTMT1_0086_H08.b : ggggctgcgaaaggaacagggtctcttgggaatcggctgggaaaaggggcccaggcaacc
HTMT1_0037_B06.b : ccatggggggcggcgaaaggaaaaagggcctcttggaaaacggggtggaaaagggggccc
HTMT1_0013_B03.b : ccttggggctgcggaacggaacagggccttcttggaatccggctgtggaaaagggcccca
HTMT1_0065_B01.b : ggctgcggacaggaacggttcttctgaaaatcgctggnaaaagggcccaggcacctccca
HTMT1_0028_B11.b : aatgggctgcgaaagaaaaaagtcttcttggaatcggggtggaaagggcgcccgggaact
CBLT1_0037_B12.b : gggccccgtgggggcgcggaagggaaacaggtcttcctggaaacggggctgggaaaaggg
HTMT1_0118_B12.b : caggggggctgcggacagaaaacgggtctttttggaaaatgggctgggaaaaggggccca
HTMT1_0117_E09.b : gcgcggaacagaacaggtcttcttgaatcggctggaaaagggccccaggacctccccaac
CBLT1_0046_C06.b : gaagaaaagggcttctggaatcggctggaaagggcccgggcacccccctaccctgggtcc
CBLT1_0028_G06.b : tcgggcccagtgggggttcggaaaggaaaaaggggcttccttggaatacgggtgggaaaa
HTMT1_0111_D11.b : ccgtgggctgccgacagaaacagggttctctggaaacgggcgggaaaaagggccccaggg
HTMT1_0092_C07.b : tggggctccgaaagaaaaagggcctcttgaaatcgggtggaaaagggccccgggaacctc
HTMT1_0013_D07.b : cccgtggggctgcggaaagaaacaggtcttctggaaatcgggtgggaaaggggccccggg
CBLT1_0076_G10.b : ccatggggctgcgacaagaaaaggggtcttctggaaatcgggctgggaaacggggcccaa
HTMT1_0098_B07.b : gggcgcggaaggaaacaggcctcttggaatcggtgggaaaaggccccaggaaccctctaa
HTMT1_0064_B07.b : gccagtggggctgcngacagaaacagggtcctcttgaaatccggctgaagaacgggcccc
HTMT1_0133_A12.b : cccatggggccgcgaaaagaaaaaggttctttcgggaaaacgggctggaaaacgggccca
HTMT1_0048_C02.b : aggggctgcggaaggaacgggtctcttggaaatcggctggaaaagggcccaggcacctcc
ILNT1_0002_G10.b : cccatggggctgggaaaggaaacaggtcctctggaaatcggcctgcaaaagggcccaagg
HTMT1_0094_D10.b : gcccatgggtctgcgaacaggaaagggctctcttgaaatcggttgggaaaggggcccagg
HTMT1_0046_G11.b : gccagtggggctgcggacagaaacaggtcctcttggaatcgggctggcaaaggggcccca
CBLT1_0034_A11.b : actccggccccgtgggggcttccgaacaggaaaacagggtcttccttgaaatccggcgtg
HTMT1_0083_G02.b : atccgggcccatgggggctgcggacaagaaacaggtccttcttggaaatcgggcttgaca
HTMT1_0042_A07.b : ccccattgggcctgcgacgnaaacggggtcttctggaaatcggctggaaaacgggcccag
HTMT1_0056_H09.b : ccccgtggggctgccgaagaaaccgggtcttctggaaatcggctggaaaaagggccccag
HTMT1_0087_A03.b : gcccagggggctgcgaaagaaacagggtcttctggaatcggcttggaaagcngcccagga
HTMT1_0060_E10.b : ggccagtggggctgcggacggaaacgggtcttcctggaactcggctgccaacggggccca
CBLT1_0044_D03.b : ggcccaatgggctgcggacggaaacgggtcctctggaatcggtgggagacgggcccaggc
HTMT1_0016_A07.b : ggcccattggggctgcggaaagaacacagtcctcttggaaatcggctggaaaaaggggcc
HTMT1_0061_H06.b : ggcccagtggggctgcggacagaaaaaggtcttcttgaatacgtgggggaaaagggcccc
HTMT1_0139_A10.b : gccattgggctgcgacaggacagggtctcttgaaacggggtgggaaaggggcccagggac
CBLT1_0053_F07.b : cggggcccgggggcctgcgacagaaaaagggtcttcttgaaatcgggctgggagagcggg
CBLT1_0034_F12.b : CTCGGGCCCAATGGGGgctgccgaacaggaaacagggtcttcctggaaatcgggcgggca
HTMT1_0076_H02.b : actaaattctggacccagtgtgggtcgcgaaaaaatatactggtgtttctcttgaaaata
CBLT1_0067_B02.b : ccccgcccctatgggggtctccgaaagaaaaagggttctttttggaaataggggggggaa
HTMT1_0007_C05.b : ggttgcgaaagaaaagggtcttctggaaacgggtgggaaaggggcccaggcaacccccca
HTMT1_0041_C07.b : gggggtggcgaaaaggaaaagggtcttcttgggaaacgggtgggaaagggggcccaggga
HTMT1_0036_E07.b : gggggggttgcggaaagaaacagggtctccttgaaaacgcggcgggaaaaggggcccagg
HTMT1_0126_H07.b : tgggctgcggacagaacaggtcttctggatcgggttggaaacggccccaggcactcctaa
HTMT1_0113_A02.b : cagtgggctggcgaaggaaccaggtcttctggaatcgggcgggaaacggcccagggaccc
HTMT1_0120_A12.b : gaataggggggaaaaagggcccgggaccccctcaccccttttttagcccccccggttttt
CBLT1_0024_B08.b : gaaaaggaaaaaggtcctttttgaaatggggtgggagaaagggcccaagggaccctccca
HTMT1_0118_H02.b : gctgggaaaaataaagggttttttggatagggcgggaaaggggcccgggaactcccccac
HTMT1_0045_F04.b : gggggctcgaacaggaacagggtcttctgaaaacgggtgggaaaaggggcccagggaacc
HTMT1_0053_C11.b : cccattggggctgcgaacgaaacggggcttcttgaaatgggctggaaaagggcgccagga
HTMT1_0042_E11.b : aaacaggtctcttggatcggttggaaaggggcccaggcacctcctcaaccctgttctgga
CBLT1_0067_E11.b : cttggaaataggggggaaaaaaggcccccgggacccccttaaccccctttttttaggccc
CBLT1_0074_F01.b : gaagggaacaggtccttctgaaaacgggggggaaaaaggccccagggaccccccaaaccc
HTMT1_0136_H12.b : aagggaacgggtcttctgggaatcggccgggaaagggggcccagggcccccctcaaccct
HTMT1_0126_E03.b : cgggcggngacggcccagcactcctcaccttgttctagcccgccggatgtggaaggccac
HTMT1_0147_C10.b : gggccttctgaaatcggtgggaaaggggccagggacccctccacccctggtctaaggccg
HTMT1_0041_H02.b : caggggggttcgaaaagaaaaaggttcttcttgaaatggggggggaaaagggcccaggga
HTMT1_0117_D03.b : tgggcctgagaagagaaagggctctctagaatagtgtggaagggggccagggctcctctc
HTMT1_0034_B04.b : tcgggcccagtggggttgcggaagagaaaagggtcttcttggaaatcgggtgggaaaagg
CBLT1_0077_E12.b : atccgggccccgtggggggtgcgaaccagaaaaaggggctttccggaaaatggggctggg
HTMT1_0118_F12.b : gggctgcgaaggaaaaggttcttctggaaaatggttggaaaaggggccccagggaccccc
HTMT1_0066_C01.b : ggctgcggacagaaacaggtcttctggaatcggnttgggnaagggccccaggcacctctc
HTMT1_0073_B12.b : ggggggtcgaaagaaaacagggtttttgggaacgggggggaaaaggggcccagggacccc
CBLT1_0072_H09.b : ccccatggggcttgcgaaggaaacagggtcttcctgaaatcggctgggaaaacgggcccc
HTMT1_0041_A02.b : CTCCGGCCCAGGGGGctgcggacaggaaaagggtcttcttgaaaatgggttgcgaaacgg
HTMT1_0111_A02.b : gggctgcgaaagaaaagggtcttttggaaatgggcgggaaaggggccccggcaccccctt
HTMT1_0076_C01.b : ttgaaaacgggtggggaaaagggcccccgggaaccccccccacccttttttttggccccc
HTMT1_0122_D09.b : acgaaaaaaggtcctcttggaaaatggggggggaaaaggccccacgggccccctctaacc
CBLT1_0009_G11.b : cccattgggctgcggacaggaacaggttcttctggaaaatcgccttggaaaagggcccca
HTMT1_0093_H12.b : ccgggccattggggctgcgaaaaggaaacaggtcttcttgaaatcnggctgggaaagagg
HTMT1_0060_B12.b : gaggcnnnnnagcagcctnnnnnncccacctgctccggtcagccggnnnnnnnnnnnnna
CBLT1_0034_H05.b : aaggtctcttgtgaaaaggggtgggaagagggcccagggcccccccccccctttttttct
HTMT1_0059_D04.b : cggggactcccacacttgannaggncgcggaggtggggaagtcacaaaagagagggggtg
CBLT1_0068_G08.b : ttggggcctggaaaagaaaaaagggtttctggaaaatcgggggggaaaagggcgcccagg
HTMT1_0115_B01.b : aggggtgggaagggggcccggggcccccctacccttgttcaagggccgccggtttgggaa
HTMT1_0058_C04.b : gaaatcggctgggaaaaaggccccagaacccccccaacccttgttcctagggccgcccgg
CBLT1_0073_F08.b : ctgaaatgggtggggaaagggcccgggaacttcccaaccctttttttagggccccccgga
HTMT1_0013_A02.b : gaaaaagtcactccctaacaccgtaaagacagaaagtcctaacctcctttcgagatcttc
CBLT1_0067_B11.b : gggcgcgccaaaaaaaaaaagggtctttttgggaaacgggggggggaaaaaggggccccc
HTMT1_0119_B12.b : acaatttgctttctttttttttcaggtccggggagggtggggggttttttgcgtaaagaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : tgaatcgntggggaaaggcccaaggacctcttaacccttttctagcccgccgggattggg
HTMT1_0111_F07.b : gtttttttgaattgggggggaaagggccccagggacccccccaaccctgttcctgggccc
HTMT1_0105_F06.b : tcttttaaaatcggcggcaaaggggcccaggcaccccccaacctttttctaggccggcgg
HTMT1_0117_H09.b : aaatggggggaaagggcccaggcacctcccccccctgttttagggcccccggattgggaa
CBLT1_0073_B11.b : acccgggccccgtggggggtcgcgaaagaaaaaagggttttttggaaaaacgggggtgga
HTMT1_0119_D08.b : caaacgaacaggtttttttgaaatagggtggaaaagggccccggagatcttccacacccc
HTMT1_0126_F11.b : acgggggggaaagggcccaggaacccctcacccttttcttgggcccccggaggtggggaa
HTMT1_0128_E02.b : gcggggaagggccccaggaccccccccccttgctagggccgccggaaggggaaagccccc
CBLT1_0050_C05.b : aacaggtctctgaatcggttgcaaggggcccaggcacctctcaacccttgtcctagggcg
HTMT1_0035_H01.b : gtaaaacccgggcccaggggggttgccggaaaaggaaacaagggcttctctgggaaaaac
HTMT1_0035_D11.b : ctcgggcccagtgggggttggcaaaaggaacaaggtcttctttgaaaatcggggtgaaaa
CBLT1_0096_H03.b : atcgggtggaaaagggcccggaccccctaaccctttctaggcccccggatttggaaaagc
HTMT1_0140_H10.b : aatggttgggaaagggcccgggacccctcaaccttgtccaagcccgcggggttgggaaag
CBLT1_0038_D11.b : cggcccttgggggctcgaaaagaaaaaggggcttcttggaaatcgggttgggaaaagggg
HTMT1_0132_F08.b : aaagaaaagggtcttctgggattcggctggaaaagggcccagggacctccccaccccgtg
HTMT1_0016_D05.b : aaggaaaaggtccttttggaatcggctggaaaaggggcccggggaccccctcacccctgt
HTMT1_0097_G08.b : cccagggggggtggggaaaggaaaaagggcccccttggaaatcggggtgggaaaaggggc
CBLT1_0041_C10.b : tgggggctgcgaaaggaaaaggggcttcttggaaatcgggtgggggaaaggggcccaggg
HTMT1_0121_B01.b : tgcggaaaggaaaaggggtctcttggaaattgggtgggaaaaggggcccagggaaccccc
HTMT1_0113_B09.b : gcggaagaaaaagggttttttgaaatgggctggaaaggggcccagggaccctcccacccc
HTMT1_0077_E08.b : agaaaagggtttctggaaaggggtggaaaagggccccggggacccccccaccctgtctaa
CBLT1_0041_D07.b : ggaaggaaaaaggtcttctggaaatcgggttggaaaaggggccaggggaacctcctnaac
HTMT1_0148_A09.b : aaaaggtttctttgaaatgggggtgaaaagggccccnngncccccctacccctttttctt
HTMT1_0132_F03.b : acggaaaagggtctcttgaaatcggctgggaaaggggcccaagcgaaccccctaaccttg
HTMT1_0140_C12.b : tttgaaagggggggaaagggccccgggacctcccaccccttttttaggcccccggtttgg
HTMT1_0140_F06.b : ggaaaaggtctcttgaaatcgcggtggaaaaggggcccaggcaacccttaacccttgttc
CBLT1_0024_F01.b : ggggggtggcgaaaaggaaaagggtcttcttggaaatcgggggggaaaaggggcccccgg
HTMT1_0106_E05.b : aaagggtttttggaatgggtgggaaagggcccaggcccctttaacccttttctgaggccg
HTMT1_0099_C09.b : cggaaggaaaagggtcttctgaaaattggctggaaaagggccccagggaacctcttaaac
HTMT1_0101_E05.b : gctgcgaacagaaaggggtttctggaaatcggttgggaaacggccccagggaaccctcca
HTMT1_0021_A08.b : ggctgcggaaggaaaaagggcctttcttggaaatcggcgggaaaaagggccccagggcaa
HTMT1_0128_G08.b : agtcctctgaatcgntggggaaaggcccagggaccccaaccctttccaaggccgccggat
HTMT1_0120_B12.b : gcgaaagaaaaaggtcttctggaatcggggggaaaagggcccggggaccccccacccctt
HTMT1_0028_G05.b : aggaaaaggtctttctgaaacggcgggaaaaggggcccgggaacccctcaaccctggttc
HTMT1_0060_C11.b : gctgcgaaaggaaacagggtcttctggaaaactgttgggaaaagggggccccaggaacct
HTMT1_0044_H10.b : ggctggaaaggaaaaagggcttcttggaatctggggggaaaagggggcccaggaacccct
HTMT1_0026_D07.b : gaaggaaacggttctcttggaatcggcggcaaacgggcccgggaaactcctcaaccttgg
CBLT1_0060_G12.b : ggcaaacctcgggccccatgggggcctgccggaaaggaaaaagaggtcctccttggaaaa
HTMT1_0105_B03.b : agtggggtcgcgaaagaaaaaggttttttggaaatggggggggaaggggcccggggacct
CBLT1_0011_E06.b : cggcgccatgggggtttcggacaggaaccagggtcttctgtgaaatcggtttggagaaga
HTMT1_0135_B04.b : cagtctctggaatcggtgtgaaggggccagggaactcctcaccctgttctaggcccggcg
CBLT1_0080_E02.b : cggacggaaacggttctcctggaatcgggctggaaaacggccccaggcaccctcccaacc
CBLT1_0064_A08.b : ggttgcgaaaggaaaagggccttttggaaatcgggtgggaaagggggcccagggaacctc
HTMT1_0139_E01.b : ggaaggaacaggtctcctggaacggctgggaaaggggcccagggaacccccaacccctgt
CBLT1_0090_F01.b : ccccgtggggccgccgaaaggaaaaagggctttctggaaatgggttggtaaaaagggccc
HTMT1_0034_H09.b : cggcccaggggggctggggaaaaggaaaaagggtctcttggaaaaccgggtgggcaaaag
CBLT1_0014_C12.b : acccgggcccattggggcctgcggaacggaaaaaggggccttcttggaaatcggggttgg
CBLT1_0088_A03.b : gggttccgaagggaaaagggtctcttgaaaacgggggggaaaaggggccaggggaccccc
HTMT1_0106_B11.b : gccgttgggcctgcggaaggaaaaagggtctttttgaaaatcggggggaaaaggggcccc
HTMT1_0064_G04.b : ccgaacgaaacagggtctctggaaacggcttggnaaagggcccaagggaacccctcaaac
HTMT1_0062_E07.b : tgcgaaagaaacgggtcttctgaaaatcggtgggaaaacgggcccaggaaccccctaaac
HTMT1_0095_A12.b : aatccggcccagtgggggttgccaaaggaaacagggtctttctgggaatccggcggggaa
HTMT1_0150_D11.b : ggccccgtggggctccggccaggaaccaggtcctcctggaaaccgggcgggagaaagggc
HTMT1_0122_B12.b : ggcgcggaacgggaaagggtctcttgaaatgggctgggaaaggggcccgggggaccccct
HTMT1_0141_H07.b : ggggcttcgaaaaaaaacaggtctccttgaaatcggtaggcaaaccggcctagtgagctc
CBLT1_0040_B05.b : ggggtgcggacagaaacgggtctcttggaaacgggtgggagaggggcccaggaacctctc
CBLT1_0052_A10.b : tgggggtgccgaaggaaacagggccttcttgaaatccgggtggagaagcgcccccaggca
HTMT1_0025_C06.b : cctgtgggctgccgaaaagaaaacaggtcttcttggaaatcggtgttgaaaagagggccc
HTMT1_0067_H07.b : ctgcgaaagaaaagggtctcttgaatcgggttggagaagggccccaggaacccctccacc
CBLT1_0082_A09.b : agggggctgcggaaaggaacggggtcttctggaatcgggtggaaaacggggcccggggaa
HTMT1_0013_F01.b : ggcccatgggggctgcggacaggaaaacgggccttcttgggaatcgggctgggaaaaggg
HTMT1_0130_C05.b : gggctggcgaaggaaaagggcttctggaatgggcgggagaaggccccagggaccccccct
HTMT1_0099_A06.b : aatgggctcgcgaagagaaaaaggcttcttggaaaaggggtggaaaacggcccccggggc
CBLT1_0036_C05.b : ccaatggggctgcggacagaaaagggccttctggaatcgggtgtggaagggggcccaagg
CBLT1_0037_B04.b : caggggctgccgaaaggaaacaggtcttctggaaatcgggtggaaaacgggccccggcac
HTMT1_0132_A04.b : ccgtgggatggcggcaggaacagggcctcttggagactggggggcaaaggcgccaagaga
HTMT1_0070_G03.b : ccagtgggctgcggaagggaacggttcttctggaatcggnctggaaaacgggcccaggnc
HTMT1_0111_H01.b : ggcccaggggggccccaaaagaaaaagggtctttctagaaaatggggggggaaaaggggc
HTMT1_0100_F01.b : cgtgggctgcggaaagaacaaggtcttctggaatcgggcgggaaaagggcccaaggaacc
CBLT1_0044_C08.b : gggccccatggggctgcggaaagaaaacaggtcttttggaaatcgggttggaaaacggcc
HTMT1_0133_A10.b : ggggctgcggaaggaaaagggtctcttggaaacgggctggaaaacggcccccaggaacct
CBLT1_0075_B12.b : tcgggccccaggggggctcccgaaaaggaaaaagggtcttcttgggaaatggggggggaa
HTMT1_0027_B01.b : catggggctgcgaacagaacgggccttctggaatcngctggaaaacggcccaaggaacct
CBLT1_0088_G06.b : cccaatggggctgcggaaggaaacgggtctttcttgaaacgggctggaaaggggccccag
HTMT1_0048_A11.b : cccgtggggctgtcgaaaggaacaggtcttcttgaaaatcgggtggcnaaaggggcccag
CBLT1_0046_H09.b : cccatgggggctgcgaaaggaaaaggggcttttggaaatcggctggcaaaaggggcccag
CBLT1_0004_D05.b : ggccattggggctcggaaagaaaaaggttttcttggaaatcggctggaaaacgggcccag
HTMT1_0103_C12.b : ggcccgtggggctgcgaaaagaaaaaagggtcctttgtggatcggggtgggaaagcgggc
CBLT1_0035_B11.b : gggcccagggggggctgcgaaaaggaacagggtcttcttggaaatcggctgggaaaacgg
HTMT1_0076_B06.b : ccggccccagggggcctgcgaaaagaaaaagggttttcttggaaaccgggtggaagaaag
HTMT1_0095_F01.b : ggggctgcggacagaacagggtcttctggaaatcggctggaaacgggcccaggcagcctc
CBLT1_0013_B03.b : cggcccagtggggctgcggacggaaaaagggtctcttgaaatcgggctggcaaacgggcc
CBLT1_0095_H06.b : tgggctgcgacagaaacaggtctctggaatcggcctggaaacgggccaggcacttctcac
HTMT1_0016_G09.b : ttcgggcccatgggggctgcgaaaagaaaaaaggccctcttgaaatcggggcgggaaaac
HTMT1_0019_D11.b : gccccaggggggctgcgaaaggaaaaggggtcttcttgaaatcggggtggaaaaaggggc
CBLT1_0025_B07.b : ggcccttggggctcggaaagaaaaaaggtccttcttgaaatcgggcggggaaaaaggccc
HTMT1_0028_H02.b : gggccctgggggctgcgaacaggaacaggtcctcctggaaatcggctggaaaacgggccc
CBLT1_0085_H01.b : gcccaagggggctccggaaaggaaaaagggtcttctggaaaacggggtggaaaaaagggc
HTMT1_0054_B11.b : ccccagggggctgccgaaaggaaaggggcttcttgaaattcggctgggaaaaagggcccc
CBLT1_0051_A01.b : atggggctgcgaaggaaacaggtcttctgaaatcggctgggaaaacgggcccagggaccc
HTMT1_0014_G11.b : gggccaggggggctgcggaaagaaaacagggccttcttgaaaatcggctgggaaaacggg
HTMT1_0134_G05.b : tggggctgcgaaagaaacaggtctcttgaatcgggctggcaaagggccccaggaacctct
HTMT1_0034_E03.b : cggcccggggggctgcggacaggaaacagggcctcctgaaaaccgggttgggaaaggggg
HTMT1_0084_E09.b : ccaggggggctgcgaaagaaaaaggctctctgggaaatcggtgggcaaagcggccccggg
CBLT1_0061_C12.b : ggggcccatggggctgcggaaaggaaacagggccttttggaaaacgggcttgcaaaaagg
HTMT1_0149_F10.b : gcccaggggggctgcgaaaggaaaaaggtcttcctggaaatcggcggggaaacgggcccc
CBLT1_0039_D07.b : cccagtgggctgcgaacagaaacaggtcttcttgaaaatcgggtggcaaagggccccggg
CBLT1_0034_F10.b : gccaagggggctgcgaaaaggaaacggtccttcttgaaatcgggtgggaaaacgggcccc
HTMT1_0051_A10.b : ccaagggggctcggacggaaacagggcttctgtgaatggngtgggaaaggggcccaggaa
CBLT1_0039_D10.b : ggcccagtgggctgcggaaggaaacagttcttctggaaatggccgggaaaagggcccagg
HTMT1_0022_F01.b : gcccaggggggtgcggaaaggaaacggggtcttcttgaaaatcggcggggaaaacggggc
CBLT1_0015_E12.b : attcggggcccgtggggggctgcgaacaggaaaaagggttcttctggaaatcgggctgga
HTMT1_0041_B02.b : gccattggggctgccgaaaagaaaaagggtcttcttggaatcggcctgcgaaaggggccc
HTMT1_0075_F07.b : ggcccgtggggctgcggaaaggaaaaggtcttcttggaattcngnttggnaaaagggccc
HTMT1_0020_H06.b : cccaggggggcttcggaaggaaacaggtctttttgaaatcgggcttggaaagggggccca
HTMT1_0074_H09.b : gcccatggggctgcggaaggaaacagggccttcttgaaatcgggcgggcaaaaggggccc
HTMT1_0014_A01.b : gcccatggggctgccgacggaaacaggtcctcttggaatcgggttggcaaaagggccccg
HTMT1_0037_H11.b : atcgggcccagtggggctgcggaacggaaaaaggggcctcttggaaaacggcgtggcaaa
HTMT1_0066_D08.b : ggcccantggggctgcgaaagaaacagggtcttctggaantcngnctgnnaacgggcccc
CBLT1_0038_C06.b : gcccgtggggctgcgaaaggaacaggtcttcttggaactggggggcgaacgggccccggg
CBLT1_0034_C01.b : ggcccagtggggctgcgaacggaacaagggtctcctggaaatcggctggcaaacgggccc
CBLT1_0060_G03.b : cccgttgggctggcgacaggaaaagggtcttcttggaatcggcttggaaaaggggcccag
CBLT1_0062_H04.b : gcccagtgggctgcgacaggaaccgggtctcctggaatcgggcgggcaaaggggcccagg
HTMT1_0096_A11.b : cgggccagtgggctgcggaaggaaaaagggtcctctggaaatgggttggaaaaagggccc
CBLT1_0075_C10.b : ggcccactggggctggcgaaaggaaaagggtcttcttggaaatcggggggggaaaagggg
CBLT1_0025_E08.b : cgggccaatggggctgcggacaggaaacgggtcttcttggaatcgggtgggaaaacgggc
CBLT1_0004_G05.b : ggccattgggctgcgaacagaaacaggtctcttgaaatcggctggcaagggggcccagga
CBLT1_0054_G01.b : gggccatggggctgcggacagaaaagggtcttctggaatcggctggacaaacgggcccag
HTMT1_0053_A07.b : cccagggggctgcggaaagaaaagggtctccttgaatcgggtgggaaaaggggccaggga
HTMT1_0073_B07.b : gggcccgtggggctgcgaacagaaaagggcctcctggaatcgggctggaaaaggggccca
HTMT1_0094_C01.b : ggccagtggggctgcgacaggaacaggtcttcttggaatcggcctgcaaacgggccccgg
HTMT1_0027_A10.b : gcccaatgggctgcggaaagaaacaggtcttctggaaaacggcttggaaagcgggcccag
HTMT1_0017_E05.b : gggcccatggggctgcggacaggaaaagggtcttctgggaaccgccgtggcnaacgggcc
HTMT1_0063_D12.b : tcggccccagggggcctgcggacagaaacaggccttcctgaaaatcggctggaaaagggg
HTMT1_0045_D10.b : ctgggcccaggggggtgcaaaaggaacagggtcttcttaaaatcggctgtgaaaaggggc
HTMT1_0073_A06.b : cgggcccagggggctgcggacaggaaacgggtcttcttggaaatcggtggggaaaaggcc
CBLT1_0061_H05.b : ggcccagtggggctgcggacagaaaacaggtctttctggaaatcggcttggcaaaagggg
HTMT1_0089_D09.b : cccaggggggctgcggaaggaaacagggcttcttggaaacgggcggggaaaacgccccca
CBLT1_0062_D02.b : ggcccagtggggctgccgacaggaacagggttttcttggaacgggccgggcaaacggggc
HTMT1_0043_E02.b : gggcccgtgggggtgcggaaagaaaaagggcttcctggaatcgggctgcaaaacgggccc
CBLT1_0059_H04.b : gggcccattggggctgccgaaagaaaaggggtcttcttggaatccgctgggaaaacgggc
HTMT1_0043_G10.b : cggcccatggggctgcggacagaaacaggggcttctggaaatcgggtggggaaaagggcc
HTMT1_0067_A10.b : cgggcccatggggctgcggacagaaaacaggttctcttggaaacggncntgaaaaagggc
CBLT1_0037_H08.b : tcggcccagggggcctgcgaaagaaacagggccttctgaaatcgggtgggaaaaggggcc
CBLT1_0084_G04.b : cgggccagtggggctgcgaaaggaaacaaggcctcttggaaacgggttgggaaaagggcc
HTMT1_0071_D10.b : CTCGGcccagtgggcctggcgacagaaaaaggttcttcttggaatcgggctggaaacggg
HTMT1_0014_H06.b : CTCGGGCCaggggggctgcgaaaggaaacagggccttcttggaatcgggcttggaagcgg
CBLT1_0006_A07.b : CTCGGGCCCAtggggctgcggaaggaaacgggtcttcctgaaatcgggctggcaaacggg
CBLT1_0055_D08.b : CTCCGGGCCAGTGGGGCTtgcgaaggaaacgggttcttctggaaatcggccgggcaaagg
CBLT1_0004_H12.b : CTCGGGCCCATTGGGGCTGCGaaaagaaaaagggtcttctggaaatccggctggcaaaac
HTMT1_0042_F11.b : CTCGGCCCCATGGGGGCTGCGaaaggaaacagggtcttcttggaatcgggttgcaaaaag
HTMT1_0016_H08.b : CTCGGGCCCAGTGGGGCTGCGGACAGGAAAagggtctccttggaatcnggctggaaaaag
CBLT1_0081_G11.b : ATCGGGCCCCATGGGGCTGCGAACGGAAAACAGGtcctcttggaaatcgggggggggaaa
BFLT1_0007_D04.b : ggctgcggaagaaaaagtccttctgaaacgggctggaaacgggcccagggacctcctcaa
HTMT1_0024_B03.b : atggggctgcggaaggaaacaggcctcctggaaatgggtgggaaaacggcccaggcagct
CBLT1_0007_C02.b : ctccaattaattttagatgcacatccagtgcttcaaccgtgaggggtcatcaggacagta
CBLT1_0028_F01.b : ggggggccccaaaagaaaaagggtcttcttgaaaatgggggggaaaaggggccccaggga
HTMT1_0056_D12.b : tgcaaaaaaaaaggggcttcctgaaaaagggggggaaaaagggccccagaaacccccctc
HTMT1_0131_B02.b : aaagaaaagttctcttgaatcggcgggaaagggccaagcacctcctaacctggtctaagc
HTMT1_0104_G12.b : cccggggggcgtcagaaagaaaaggggttctttggaattgggggtgaagaggggccccgg
HTMT1_0042_B11.b : tggggctgcggacaggaacagggtctttctgaaaatgggtgtggaaaggggcccaggaac
HTMT1_0068_B12.b : ggcccagggggcctgcgcacagaaaacagggcctcctggaaatcgggtgtgaaaaagggg
CBLT1_0054_F08.b : ggcccttggggctgcggacaggaacagggtctcttgaaatcgggttgggaagcgggccca
CBLT1_0085_H05.b : cggcccattggggctgcggaaggaaaacgggtcctcttggaaatcggggtggcaaagggg
HTMT1_0064_C09.b : gggcccgtgggctgcgaacagaacagggtctcctgaattcgggctggagaacgggccaag
HTMT1_0047_B04.b : gggccaatggggctgcggacagaaccagggtcttcttgaaatcgggctgcaagaacgggc
HTMT1_0068_D07.b : ggcccatggggctgcggacagaaccaggtcttcttgaaatccggctggagaaggggcccc
CBLT1_0053_G06.b : ccggccccatggggctgcgaacaggaacagggtcttcttggaaatgggtgggcaaaaggg
HTMT1_0026_F11.b : ATCCGGCCCAGGGGGGCTGCGGAaggaaaaaagggccttcttggaatcgggtgtggaaaa
HTMT1_0049_A09.b : ggaaggaaaaggtcttcttgaaacgggtggaaaagggccccagggacccccctaaccctt
CBLT1_0080_H12.b : ccgggcccatgggggcttcgagaaagaacaaggggccttctgtgaaacggggggggcaaa
HTMT1_0104_F09.b : tgggggctcagaaagaaaaagggctttttgaaatcgggcggaaaaggggcccagggaacc
HTMT1_0071_A04.b : agggggctgcngacagaaccaggtctcctgnaaatcggctgcaaacgggccccagcacct
HTMT1_0034_F11.b : cccgggcccaggggggctgcggaaaggaaaaaaggcctttctggaaatacgggtgggaaa
HTMT1_0146_C12.b : gcccatggggctgcgaaaggaaacaggtctcttggaatcggctggaaaacgggcccaggg
HTMT1_0136_G04.b : gaatgggctggaaagggcccaggacccttccaccctttcttagcccgccggattgggaaa
HTMT1_0120_B01.b : gaaagaggtgccatgacccccccccccccttttttgaaggccccccagaatttggaacaa
CBLT1_0006_H07.b : gcccatggggctgcggaaagaaacaggtctcttggaaatcgggtgggaaaggggcccaag
HTMT1_0036_D12.b : aaactcgggcccagtgggggcctgccgaaaaagaaaaaagggtcctccttggaaaatcgg
HTMT1_0133_G04.b : cccatggggctgcggagggaacaggtcctctggaatcggggggaaaaggggcccaggcaa
HTMT1_0036_E11.b : aggaaaagggcctcttggaactggctgggaaaaaggacccaagaacccccctaaacccat
CBLT1_0062_A01.b : gcccattgggctgcgaaaggaaccaggtcttcttgaatcgggtgggaaaaggggcccagg
HTMT1_0085_D02.b : aggagtcttctagaaaacgggggggagaaagggccacgggagcccccccacacccctttt
HTMT1_0063_E09.b : cccagtgggctgcggacgggaccagggcctcttggaatcgggctggcaaaggggcccagg
CBLT1_0024_D10.b : cccatggggctgcgaaaggaacaagggttttttgaaatcgggggggagaaggggccccgg
CBLT1_0024_B03.b : cgggccccatggggcttccgaacagaaaaaggggtttccttgaaaaccggctggggaaaa
CBLT1_0069_G11.b : gcccattggggctgccggaaggaaaccgggtcttcctgggaatcgggctggccaaaccgg
CBLT1_0075_E09.b : CTC*GGCCCAGTGGGGCTGCGGACAGGAAACAGGtcttcttggaatcgggctggcaaaac
CBLT1_0052_G05.b : ggcccagtgggctgcggacggaaacagggtctctgaaatggcctggcaaacgggccccag
CBLT1_0074_H03.b : atggggctgcggaaagaaaaagggtcttttggaaaatgggctggaaaaggggcccaggga
CBLT1_0052_H03.b : CTCGGGCCCAGTGGGctggcgaacagaaaagggtcttctggaaatccggctggcaaaacg
---------+---------+---------+---------+---------+---------+ 1228
CBLT1_0023_A08.b : ccccccctttttcttagggccgcgcgggagttggggaaggtgctcctcccagaggggggg
HTMT1_0050_B08.b : ccggaatggggaaaggctcctcaaaaggggggggtgtggtccccccgggggtggtgcccc
CBLT1_0068_D11.b : ccagggaacccccccctaaaccccctttttttaaaaggccccccgcggaggttgggggaa
CBLT1_0077_C07.b : gcggatttgggaaaggccatcaaagaggagggttggcccccccggggtggggcccgagca
HTMT1_0126_A09.b : ggcccgcggattggggaatgctaccaaaggagcgggttgtccccccggtgctgggccacc
HTMT1_0038_C01.b : ggaaaaaaggggccccagggaaccctccctcaacccctgttgtcctgagagcccgtcccg
HTMT1_0038_D01.b : aaaggggcccacggagaacccccctcaaaccctttgtttctagagcccccccggaaatgt
CBLT1_0055_F02.b : cagggcacctcctcaccccttgttctgaaggcccgccggaatttggggaatcgctaactc
HTMT1_0079_B03.b : accctggcctggggccccccggaattggggaaagcccacctccaagttggcgggtttggc
HTMT1_0145_A10.b : gcggaattggggaaagcccaccaaggaggggggttggccaccccggggggggggccccac
CBLT1_0042_C01.b : ggggccccagggcaccccctcacccccgggctccgagggccggcgggaattgggggaaag
HTMT1_0012_E08.b : aaaacgggccccaggcaccctccctcaaccccgtggttcctagggcccggccggggattg
HTMT1_0012_F03.b : gccccaaggtagcctcctcaagccctgtgtcctgaaggcccggcccggaggtgggggaaa
HTMT1_0006_A04.b : accttctcaaaccctggttctgaggcccgccggaattgggaatgctcaatccaaggatgc
HTMT1_0003_B02.b : ccaggggaacctcccaacccctgtttcctaagccccgccggatgtggggaatgcccaacc
HTMT1_0005_F06.b : aaccctgtttttaggcccccgggatggggaatggaaaccaaaaagagggggttgtccccc
HTMT1_0111_E01.b : ttctaggcccccccggaattggggaaaagcccctccaaggggggggggggtgggcccccc
HTMT1_0037_B01.b : gaggggccccagggaaccctcccttaacccctttttcttaaggccccccccggaattgtg
HTMT1_0035_E04.b : ccccaaaccccgttcctaaggcccgccgggaagggggaaagggcccccccaaaagggggg
CBLT1_0040_F03.b : acacctcctcaaccctttgtcctagggccggccggatgttgggaatagccacccaaaaga
HTMT1_0027_C08.b : acctctcaaacctgtttctgaggcccggcgggaatgtgggaattgccacccaaaggatgc
HTMT1_0012_H10.b : cgggaagcttcctaaacccctggttcttgaggcccgccgggaatgtgggaaaagcccaac
HTMT1_0011_B07.b : cccagggaagctccctcaccccctggtccttagggcccggccgggaagtggggaaaatgg
CBLT1_0093_A09.b : tgagccccgcggatgtggggaaaattcccctcaaaaggaggggggggtgtggcccctccg
HTMT1_0144_G09.b : gcgtgccgggttgtcccactagagctatgcggagataaggntgcgcgcgcacgcacagtc
CBLT1_0068_C08.b : cttttttctaggccccgccgggattgggggaatattcctccccaaaagggggggggggtt
HTMT1_0109_F08.b : tgggccggccgggattggggaatatccactcaaaggggggggggtttggccaccccgggg
CBLT1_0038_E04.b : ctaggcccgccggaattggggaaaggtcaaccaaggagggggggttgtcccccccgggcg
HTMT1_0089_E09.b : ccgagggccgccggattgggggaaggccatccaaagggggggggtgtggcacccccgggg
HTMT1_0014_H01.b : ggaaccccccacacccctttgtctaaggccccccccggaaatggggaaaagcttccccca
HTMT1_0087_A04.b : gccaccaaggtgagggttgctcccccgggttggggcccaagcaagaaaggggggtccggg
CBLT1_0078_G12.b : aaagggcccccgggaacacccccctcaccccctttttctagggccccgcccggagattgt
HTMT1_0050_A03.b : ttgttcttgaggccgccggagtgggggaatgctaaccaaacgagggggggttggctcccc
CBLT1_0086_E03.b : tcctcaacccgttcctggggcccgccggattggggaaagcccccttaaagggggcagggt
HTMT1_0028_C05.b : ttaaccctgttcctagggcccgccgaatgggggaatggccaactcaaagtaggggggttg
HTMT1_0042_F09.b : tctcaaccctgttcctgagggcgggcgcggatggggaaatgctcactcaaagagaggggg
HTMT1_0109_A05.b : ccaacccttttccgaggccgggcgggattggggaaagcccacccaaggagggggggttgg
HTMT1_0006_E11.b : ccaggggcaccccctcaacccttgtttctagggccgcgccgaatgtggggaatagcctat