[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000217

Length: 1,481

Sequence [FASTA format sequence]
GCTCTTTTCC CGAGATGCCC CGGGGAGGGA GGAGAACACC TTCAAAGACA GGCCCTCAGG
GTGAGACGAG CGGCAGACCA TCCAAGAAGA CAGTGCAGCT GCTCCCGAGG GCCTGGATGT
GATGGCGTCA CAGAAGAGAC CCTCCCAGAG GCACGGATCA AAGTACCTGG CCTCCGCGAG
CACCATGGAC CACGCCAGGC ACGGCTTCCT TCCCAGGCAC AGAGACACTG GCATCCTCGA
CTCCCTCGGC CGCTTCTTTG GCGCTGACAG GGGTGCGCCC AAGCGGGGCT CGGGCAAGGA
TGGACACCAC GCGGCCAGGA CCACCCACTA CGGCTCCCTG CCCCAGAAGG CACAGCACGG
CCGGCCCCAG GATGAAAACC CTGTAGTGCA TTTCTTCAAG AACATCGTGA CGCCTCGCAC
ACCTCCCCCA TCTCAAGGGA AGGGGCGAGG ACTGTCCCTC AGCAGATTTA GCTGGGGCGC
CGAGGGCCAG AAGCCGGGAT TCGGCTACGG AGGCAGAGCT CCTGACTACA AACCGGCTCA
CAAGGGACTC AAGGGGGCCC AGGACGCCCA GGGCACACTT TCCAAAATCT TCAAGCTGGG
AGGACGGGAC AGCCGCTCCG GGTCCCCCAT GGCCAGACGT TGACGCTCCT TCCTCTCAGG
ATCCTTCCCG GCTTCTAACA CGTTAACCGC GTAGATTCCC TAGTATAGCA CGTGCCCCTA
ACGCCTGGTG ACGACGCCCA GCGGGCTCCA CTCGGAGGAA ACGCTCCACC GTCGCCCTAC
CTCGGAGACA GTGACATCCC CTCCCCGCTC GCCCTCATCC TGAGATGGCT TCGGTGGGGA
CACTGCTGTG GGAACATTGC CGGGGGACAC TGCTGTGGGT TGGCCCGTGC AGGGCATAAA
GATGGTGTGG CTCCAAGCTT CCTTTGGTTT CTTTCGTGCC TCCTCCCTCT CACCCGCTAA
AGTATTTAAT CTTCCTAACA GGGTCGGGCC GTCGGAAAGG CTTGGCGGCG GGAGCTTTGG
TATGTGACAT GTGGGCGGGC AACGGGAAAG GCCCCGGTGG CCGTGGCTCA CCACCCCCAG
CTCAGCCGAA AGGGGATGCG GGGGCAGACT CGGGCCCAGT GGGGCTGCGG ACAGGAAACA
GGGTCTTCTT GGAAATCGGG CTGGCAGAGC GGGCCCCAGG GCAGCCTCCT CGACGCCCTG
TGTCCTGAGG GCCCGGCCGG GAGTGTGGGG AGATGGCTCA ACTCAGAACG GATGGCAGGG
GTTTGGCTCA GCCTCGCGGT GGCATGGTGG TCACCGCGAG CGCAAAGGTA ACAGGTGGCG
TGCTCAGCGG CGGTGCTCAC GGCAAATACT AACCTTCGGT GGGAAGATAA CTGTCCTTTC
CGCTTGCCTC CCTAGAATCC CCTGACCATA CACTCACCTT ACTGGGCCGC TGCCGGCTCG
GTGGGCGGCC GGCCACGTGA GGACAGGAGA GTCCCTCTGA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPGolli-MBP isoform 1 [Homo sapiens]. 389e-108
Contig/Assembly ProteinMBPmyelin basic protein isoform 3 [Homo sapiens]. 3272e-89O
Contig/Assembly ProteinMBPmyelin basic protein isoform 1 [Homo sapiens]. 3133e-85O
Contig/Assembly ProteinMBPmyelin basic protein isoform 4 [Homo sapiens]. 2964e-80O
Contig/Assembly ProteinMBPmyelin basic protein isoform 2 [Homo sapiens]. 2818e-76O
Contig/Assembly ProteinMBPGolli-MBP isoform 2 [Homo sapiens]. 1834e-46


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMbpmyelin basic protein isoform 3 [Mus musculus]. 3201e-87O
Contig/Assembly ProteinMbpmyelin basic protein isoform 1 [Mus musculus]. 3063e-83O
Contig/Assembly ProteinMbpmyelin basic protein isoform 5 [Mus musculus]. 2893e-78O
Contig/Assembly ProteinMbpmyelin basic protein isoform 2 [Mus musculus]. 2757e-74O
Contig/Assembly ProteinMbpGolli-Mbp isoform 1 [Mus musculus]. 2588e-69
Contig/Assembly ProteinMbpmyelin basic protein isoform 6 [Mus musculus]. 2256e-59O
Contig/Assembly ProteinMbpmyelin basic protein isoform 4 [Mus musculus]. 2111e-54O
Contig/Assembly ProteinMbpGolli-Mbp isoform 2 [Mus musculus]. 1681e-41


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPPREDICTED: similar to Myelin basic protein (MBP) (Myelin A1 protein) (Myelin membrane encephalitogenic protein) isoform 1 [Canis familiaris]. 3333e-91O
Contig/Assembly ProteinMBPPREDICTED: similar to Golli-mbp isoform 2 isoform 2 [Canis familiaris]. 1873e-47


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPmyelin basic protein [Bos taurus]. 399e-111


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMBPmyelin basic protein [Sus scrofa]. 364e-101O
Contig/Assembly ProteinLOC100625007PREDICTED: myelin basic protein S-like [Sus scrofa]. 3024e-82O


Assembly Members: 346      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10007D04BFLT1_0007_D04.bFS640532 
CBLT10004D05CBLT1_0004_D05.bHX212015 
CBLT10004G05CBLT1_0004_G05.bHX212049 
CBLT10004H12CBLT1_0004_H12.bHX212064 
CBLT10005E10CBLT1_0005_E10.bHX212116 
CBLT10006A07CBLT1_0006_A07.bHX212156 
CBLT10006H07CBLT1_0006_H07.bHX212229 
CBLT10007C02CBLT1_0007_C02.bHX212258 
CBLT10009G11CBLT1_0009_G11.bHX212458 
CBLT10011E06CBLT1_0011_E06.bHX212586 
CBLT10013B03CBLT1_0013_B03.bHX212704 
CBLT10014C12CBLT1_0014_C12.bHX212787 
CBLT10015E12CBLT1_0015_E12.bHX212871 
CBLT10021D08CBLT1_0021_D08.bHX213308 
CBLT10023A08CBLT1_0023_A08.bHX213419 
CBLT10023G10CBLT1_0023_G10.bHX213471 
CBLT10024B03CBLT1_0024_B03.bHX213490 
CBLT10024B08CBLT1_0024_B08.bHX213495 
CBLT10024D10CBLT1_0024_D10.bHX213516 
CBLT10024F01CBLT1_0024_F01.bHX213529 
CBLT10025B07CBLT1_0025_B07.bHX213575 
CBLT10025E08CBLT1_0025_E08.bHX213608 
CBLT10028F01CBLT1_0028_F01.b  
CBLT10028G06CBLT1_0028_G06.b  
CBLT10034A11CBLT1_0034_A11.bHX214162 
CBLT10034C01CBLT1_0034_C01.bHX214173 
CBLT10034F10CBLT1_0034_F10.bHX214207 
CBLT10034F12CBLT1_0034_F12.bHX214209 
CBLT10034H05CBLT1_0034_H05.bHX214224 
CBLT10035B11CBLT1_0035_B11.b  
CBLT10036C05CBLT1_0036_C05.bHX214313 
CBLT10037B04CBLT1_0037_B04.b  
CBLT10037B12CBLT1_0037_B12.b  
CBLT10037H08CBLT1_0037_H08.bHX214413 
CBLT10038C06CBLT1_0038_C06.bHX214440 
CBLT10038D11CBLT1_0038_D11.bHX214451 
CBLT10038E04CBLT1_0038_E04.bHX214455 
CBLT10039B10CBLT1_0039_B10.bHX214498 
CBLT10039D07CBLT1_0039_D07.bHX214511 
CBLT10039D10CBLT1_0039_D10.bHX214513 
CBLT10040B05CBLT1_0040_B05.b  
CBLT10040F03CBLT1_0040_F03.bHX214566 
CBLT10041C10CBLT1_0041_C10.bHX214596 
CBLT10041D07CBLT1_0041_D07.bHX214603 
CBLT10042B03CBLT1_0042_B03.bHX214644 
CBLT10042C01CBLT1_0042_C01.bHX214648 
CBLT10042E07CBLT1_0042_E07.bHX214672 
CBLT10044C08CBLT1_0044_C08.b  
CBLT10044D03CBLT1_0044_D03.bHX214781 
CBLT10046C06CBLT1_0046_C06.bHX214899 
CBLT10046H09CBLT1_0046_H09.bHX214945 
CBLT10050C05CBLT1_0050_C05.bHX215153 
CBLT10051A01CBLT1_0051_A01.bHX215201 
CBLT10052A10CBLT1_0052_A10.bHX215278 
CBLT10052G05CBLT1_0052_G05.bHX215325 
CBLT10052H02CBLT1_0052_H02.bHX215331 
CBLT10052H03CBLT1_0052_H03.bHX215332 
CBLT10053F07CBLT1_0053_F07.bHX215395 
CBLT10053G06CBLT1_0053_G06.bHX215405 
CBLT10054F08CBLT1_0054_F08.bHX215477 
CBLT10054G01CBLT1_0054_G01.bHX215482 
CBLT10055C05CBLT1_0055_C05.b  
CBLT10055D08CBLT1_0055_D08.bHX215535 
CBLT10055F02CBLT1_0055_F02.bHX215551 
CBLT10056D12CBLT1_0056_D12.bHX215622 
CBLT10059H04CBLT1_0059_H04.bHX215870 
CBLT10060G03CBLT1_0060_G03.bHX215936 
CBLT10060G12CBLT1_0060_G12.b  
CBLT10061C12CBLT1_0061_C12.bHX215977 
CBLT10061E10CBLT1_0061_E10.bHX215995 
CBLT10061H05CBLT1_0061_H05.bHX216021 
CBLT10062A01CBLT1_0062_A01.bHX216027 
CBLT10062D02CBLT1_0062_D02.bHX216060 
CBLT10062H04CBLT1_0062_H04.bHX216099 
CBLT10064A08CBLT1_0064_A08.bHX216200 
CBLT10067B02CBLT1_0067_B02.bHX216447 
CBLT10067B11CBLT1_0067_B11.bHX216456 
CBLT10067E11CBLT1_0067_E11.bHX216489 
CBLT10068C08CBLT1_0068_C08.bHX216553 
CBLT10068D11CBLT1_0068_D11.bHX216567 
CBLT10068G08CBLT1_0068_G08.bHX216596 
CBLT10069G11CBLT1_0069_G11.bHX216678 
CBLT10072C10CBLT1_0072_C10.bHX216889 
CBLT10072H09CBLT1_0072_H09.bHX216940 
CBLT10073B11CBLT1_0073_B11.bHX216964 
CBLT10073C05CBLT1_0073_C05.bHX216970 
CBLT10073F08CBLT1_0073_F08.bHX217001 
CBLT10074F01CBLT1_0074_F01.bHX217083 
CBLT10074H03CBLT1_0074_H03.bHX217107 
CBLT10075B12CBLT1_0075_B12.bHX217136 
CBLT10075C10CBLT1_0075_C10.bHX217144 
CBLT10075E09CBLT1_0075_E09.bHX217167 
CBLT10075G03CBLT1_0075_G03.bHX217183 
CBLT10076G10CBLT1_0076_G10.bHX217277 
CBLT10077C07CBLT1_0077_C07.bHX217313 
CBLT10077E12CBLT1_0077_E12.b  
CBLT10078C11CBLT1_0078_C11.bHX217389 
CBLT10078G12CBLT1_0078_G12.bHX217427 
CBLT10080E02CBLT1_0080_E02.bHX217540 
CBLT10080H12CBLT1_0080_H12.b  
CBLT10081G11CBLT1_0081_G11.bHX217633 
CBLT10082A09CBLT1_0082_A09.bHX217645 
CBLT10084G04CBLT1_0084_G04.bHX217844 
CBLT10085H01CBLT1_0085_H01.bHX217929 
CBLT10085H05CBLT1_0085_H05.bHX217932 
CBLT10086E03CBLT1_0086_E03.bHX217980 
CBLT10088A03CBLT1_0088_A03.bHX218105 
CBLT10088G06CBLT1_0088_G06.bHX218175 
CBLT10090F01CBLT1_0090_F01.bHX218326 
CBLT10093A09CBLT1_0093_A09.b  
CBLT10095H06CBLT1_0095_H06.bHX218767 
CBLT10096H03CBLT1_0096_H03.bHX218848 
HTMT10002C03HTMT1_0002_C03.bFS664449 
HTMT10002F07HTMT1_0002_F07.bFS664477 
HTMT10003B02HTMT1_0003_B02.bFS664500 
HTMT10005F06HTMT1_0005_F06.bFS664647 
HTMT10006A04HTMT1_0006_A04.bFS664664 
HTMT10006E11HTMT1_0006_E11.bFS664701 
HTMT10007C05HTMT1_0007_C05.bFS664735 
HTMT10010C06HTMT1_0010_C06.bFS664921 
HTMT10010E11HTMT1_0010_E11.bFS664944 
HTMT10010H05HTMT1_0010_H05.b  
HTMT10011A04HTMT1_0011_A04.bFS664974 
HTMT10011B07HTMT1_0011_B07.b  
HTMT10012E08HTMT1_0012_E08.bFS665075 
HTMT10012F03HTMT1_0012_F03.bFS665081 
HTMT10012H10HTMT1_0012_H10.bFS665100 
HTMT10013A02HTMT1_0013_A02.b  
HTMT10013B03HTMT1_0013_B03.bFS665112 
HTMT10013D07HTMT1_0013_D07.bFS665132 
HTMT10013F01HTMT1_0013_F01.bFS665149 
HTMT10014A01HTMT1_0014_A01.bFS665180 
HTMT10014G11HTMT1_0014_G11.bFS665241 
HTMT10014H01HTMT1_0014_H01.b  
HTMT10014H06HTMT1_0014_H06.bFS665245 
HTMT10015A09HTMT1_0015_A09.bFS665255 
HTMT10016A07HTMT1_0016_A07.bFS665331 
HTMT10016D05HTMT1_0016_D05.bFS665359 
HTMT10016G09HTMT1_0016_G09.bFS665393 
HTMT10016H08HTMT1_0016_H08.bFS665402 
HTMT10017E05HTMT1_0017_E05.bFS665449 
HTMT10019D11HTMT1_0019_D11.bFS665601 
HTMT10020H06HTMT1_0020_H06.bFS665709 
HTMT10021A06HTMT1_0021_A06.bFS665718 
HTMT10021A08HTMT1_0021_A08.bFS665719 
HTMT10021G07HTMT1_0021_G07.bFS665776 
HTMT10022F01HTMT1_0022_F01.bFS665843 
HTMT10024B03HTMT1_0024_B03.bFS665964 
HTMT10025A07HTMT1_0025_A07.bFS666028 
HTMT10025C06HTMT1_0025_C06.bFS666046 
HTMT10025D10HTMT1_0025_D10.bFS666053 
HTMT10025F09HTMT1_0025_F09.bFS666068 
HTMT10026D07HTMT1_0026_D07.bFS666123 
HTMT10026F11HTMT1_0026_F11.bHX223227 
HTMT10027A10HTMT1_0027_A10.bFS666174 
HTMT10027B01HTMT1_0027_B01.bFS666176 
HTMT10027C08HTMT1_0027_C08.bFS666191 
HTMT10028B11HTMT1_0028_B11.bFS666262 
HTMT10028C05HTMT1_0028_C05.bFS666265 
HTMT10028G05HTMT1_0028_G05.bFS666302 
HTMT10028H02HTMT1_0028_H02.bFS666311 
HTMT10034B04HTMT1_0034_B04.b  
HTMT10034E03HTMT1_0034_E03.bFS666675 
HTMT10034F11HTMT1_0034_F11.bFS666687 
HTMT10034H09HTMT1_0034_H09.bFS666698 
HTMT10035D11HTMT1_0035_D11.bFS666733 
HTMT10035E04HTMT1_0035_E04.bFS666737 
HTMT10035H01HTMT1_0035_H01.bFS666760 AK391945
HTMT10036D12HTMT1_0036_D12.bFS666791 
HTMT10036E07HTMT1_0036_E07.bFS666794 
HTMT10036E11HTMT1_0036_E11.bFS666798 
HTMT10037B01HTMT1_0037_B01.bFS666823 
HTMT10037B06HTMT1_0037_B06.bFS666826 
HTMT10037H11HTMT1_0037_H11.bFS666867 
HTMT10038C01HTMT1_0038_C01.bFS666879 
HTMT10038D01HTMT1_0038_D01.bFS666885 AK391966
HTMT10040B10HTMT1_0040_B10.bFS666981 
HTMT10041A02HTMT1_0041_A02.bFS667029 
HTMT10041B02HTMT1_0041_B02.bFS667039 
HTMT10041C07HTMT1_0041_C07.bFS667053 
HTMT10041H02HTMT1_0041_H02.bFS667093 
HTMT10042A07HTMT1_0042_A07.bFS667110 
HTMT10042B11HTMT1_0042_B11.bFS667124 
HTMT10042E11HTMT1_0042_E11.bFS667151 
HTMT10042F09HTMT1_0042_F09.bFS667160 
HTMT10042F11HTMT1_0042_F11.bFS667162 
HTMT10043E02HTMT1_0043_E02.bFS667213 
HTMT10043G10HTMT1_0043_G10.bFS667242 
HTMT10044G09HTMT1_0044_G09.bFS667305 
HTMT10044H10HTMT1_0044_H10.bFS667317 
HTMT10045D10HTMT1_0045_D10.bFS667347 
HTMT10045F04HTMT1_0045_F04.bFS667362 
HTMT10046G11HTMT1_0046_G11.bFS667455 
HTMT10047B04HTMT1_0047_B04.bFS667479 
HTMT10047D10HTMT1_0047_D10.bFS667504 AK392063
HTMT10047F01HTMT1_0047_F01.bFS667515 
HTMT10048A11HTMT1_0048_A11.bFS667556 
HTMT10048C02HTMT1_0048_C02.bFS667568 
HTMT10049A09HTMT1_0049_A09.bFS667628 
HTMT10050A03HTMT1_0050_A03.bFS667700 
HTMT10050B08HTMT1_0050_B08.bFS667715 
HTMT10051A10HTMT1_0051_A10.bFS667787 
HTMT10053A07HTMT1_0053_A07.bFS667930 
HTMT10053C11HTMT1_0053_C11.bFS667952 
HTMT10054B11HTMT1_0054_B11.bFS668023 
HTMT10056D12HTMT1_0056_D12.bFS668181 
HTMT10056H09HTMT1_0056_H09.bFS668217 
HTMT10057G09HTMT1_0057_G09.bFS668281 
HTMT10058C04HTMT1_0058_C04.bFS668311 
HTMT10059D04HTMT1_0059_D04.bFS668399 
HTMT10060B12HTMT1_0060_B12.bFS668457 
HTMT10060C11HTMT1_0060_C11.bFS668466 
HTMT10060E10HTMT1_0060_E10.bFS668486 
HTMT10061H06HTMT1_0061_H06.bFS668587 
HTMT10062E07HTMT1_0062_E07.bFS668630 
HTMT10063D12HTMT1_0063_D12.bFS668695 
HTMT10063E09HTMT1_0063_E09.bFS668702 
HTMT10064A02HTMT1_0064_A02.bFS668731 
HTMT10064B07HTMT1_0064_B07.bFS668745 
HTMT10064C09HTMT1_0064_C09.bFS668756 
HTMT10064G04HTMT1_0064_G04.bFS668789 
HTMT10065B01HTMT1_0065_B01.bFS668817 
HTMT10066C01HTMT1_0066_C01.bFS668900 
HTMT10066D08HTMT1_0066_D08.bFS668916 
HTMT10067A10HTMT1_0067_A10.bFS668968 
HTMT10067H07HTMT1_0067_H07.bFS669030 
HTMT10068B12HTMT1_0068_B12.b  
HTMT10068D07HTMT1_0068_D07.bFS669069 
HTMT10070G03HTMT1_0070_G03.bFS669227 
HTMT10071A04HTMT1_0071_A04.bFS669245 
HTMT10071D10HTMT1_0071_D10.bFS669275 
HTMT10073A06HTMT1_0073_A06.bFS669363 
HTMT10073B07HTMT1_0073_B07.bFS669373 
HTMT10073B12HTMT1_0073_B12.bFS669377 
HTMT10074H09HTMT1_0074_H09.bFS669513 
HTMT10075F07HTMT1_0075_F07.bFS669569 
HTMT10076B06HTMT1_0076_B06.b  
HTMT10076C01HTMT1_0076_C01.bFS669606 
HTMT10076H02HTMT1_0076_H02.b  
HTMT10077E08HTMT1_0077_E08.bFS669693 
HTMT10079B03HTMT1_0079_B03.b  
HTMT10083G02HTMT1_0083_G02.bFS670076 
HTMT10084E09HTMT1_0084_E09.bFS670127 
HTMT10085D02HTMT1_0085_D02.bFS670178 
HTMT10086E02HTMT1_0086_E02.bFS670265 
HTMT10086H08HTMT1_0086_H08.bFS670296 
HTMT10087A03HTMT1_0087_A03.bFS670303 
HTMT10087A04HTMT1_0087_A04.bFS670304 
HTMT10089D09HTMT1_0089_D09.bFS670481 
HTMT10089E09HTMT1_0089_E09.bFS670491 
HTMT10092C07HTMT1_0092_C07.bFS670692 
HTMT10093H12HTMT1_0093_H12.bFS670825 
HTMT10094C01HTMT1_0094_C01.bFS670843 
HTMT10094D10HTMT1_0094_D10.bFS670859 
HTMT10095A12HTMT1_0095_A12.bFS670907 
HTMT10095B10HTMT1_0095_B10.bFS670914 
HTMT10095F01HTMT1_0095_F01.bFS670950 
HTMT10096A11HTMT1_0096_A11.bFS670978 
HTMT10097G08HTMT1_0097_G08.bFS671094 
HTMT10098B07HTMT1_0098_B07.bFS671122 
HTMT10099A06HTMT1_0099_A06.bFS671198 
HTMT10099B11HTMT1_0099_B11.bHX223247 
HTMT10099C09HTMT1_0099_C09.bFS671219 
HTMT10100F01HTMT1_0100_F01.bFS671312 
HTMT10101E05HTMT1_0101_E05.bHX223278 
HTMT10103C12HTMT1_0103_C12.bHX223403 
HTMT10104B07HTMT1_0104_B07.bHX223469 
HTMT10104F09HTMT1_0104_F09.bHX223515 
HTMT10104G12HTMT1_0104_G12.bHX223524 
HTMT10105A01HTMT1_0105_A01.bHX223536 
HTMT10105B03HTMT1_0105_B03.bHX223545 
HTMT10105F06HTMT1_0105_F06.bHX223578 
HTMT10106A11HTMT1_0106_A11.bHX223611 
HTMT10106B11HTMT1_0106_B11.bHX223619 
HTMT10106C10HTMT1_0106_C10.bHX223626 
HTMT10106E05HTMT1_0106_E05.bHX223642 
HTMT10107A07HTMT1_0107_A07.bHX223680 
HTMT10109A05HTMT1_0109_A05.bHX223826 
HTMT10109F08HTMT1_0109_F08.bHX223873 
HTMT10111A02HTMT1_0111_A02.bHX223972 
HTMT10111D11HTMT1_0111_D11.bHX224006 
HTMT10111E01HTMT1_0111_E01.bHX224008 
HTMT10111F07HTMT1_0111_F07.bHX224023 
HTMT10111H01HTMT1_0111_H01.bHX224034 
HTMT10113A02HTMT1_0113_A02.bHX224117 
HTMT10113B09HTMT1_0113_B09.bHX224130 
HTMT10115B01HTMT1_0115_B01.bHX224265 
HTMT10117D03HTMT1_0117_D03.b  
HTMT10117E09HTMT1_0117_E09.bHX224397 
HTMT10117G02HTMT1_0117_G02.b  
HTMT10117H09HTMT1_0117_H09.bHX224414 
HTMT10118B12HTMT1_0118_B12.bHX224429 
HTMT10118F12HTMT1_0118_F12.bHX224459 
HTMT10118H02HTMT1_0118_H02.bHX224467 
HTMT10119B12HTMT1_0119_B12.bHX224486 
HTMT10119D08HTMT1_0119_D08.b  
HTMT10120A12HTMT1_0120_A12.bHX224536 
HTMT10120B01HTMT1_0120_B01.b  
HTMT10120B12HTMT1_0120_B12.bHX224545 
HTMT10120E04HTMT1_0120_E04.b  
HTMT10121B01HTMT1_0121_B01.bHX224604 
HTMT10121B03HTMT1_0121_B03.bHX224606 
HTMT10122B12HTMT1_0122_B12.bHX224680 
HTMT10122D09HTMT1_0122_D09.bHX224689 
HTMT10126A09HTMT1_0126_A09.bHX224888 
HTMT10126E03HTMT1_0126_E03.bHX224916 
HTMT10126F11HTMT1_0126_F11.bHX224931 
HTMT10126H07HTMT1_0126_H07.bHX224946 
HTMT10127H12HTMT1_0127_H12.bHX225010 
HTMT10128E02HTMT1_0128_E02.bHX225042 
HTMT10128G08HTMT1_0128_G08.bHX225062 
HTMT10128H06HTMT1_0128_H06.b  
HTMT10130C05HTMT1_0130_C05.bHX225143 
HTMT10131B02HTMT1_0131_B02.bHX225185 
HTMT10132A04HTMT1_0132_A04.b  
HTMT10132F03HTMT1_0132_F03.bHX225258 
HTMT10132F08HTMT1_0132_F08.bHX225261 
HTMT10133A10HTMT1_0133_A10.bHX225283 
HTMT10133A12HTMT1_0133_A12.bHX225285 
HTMT10133G04HTMT1_0133_G04.bHX225336 
HTMT10134C07HTMT1_0134_C07.bHX225378 
HTMT10134F06HTMT1_0134_F06.bHX225404 
HTMT10134G05HTMT1_0134_G05.bHX225413 
HTMT10135B04HTMT1_0135_B04.bHX225441 
HTMT10136G04HTMT1_0136_G04.b  
HTMT10136H12HTMT1_0136_H12.bHX225573 
HTMT10137G02HTMT1_0137_G02.bHX225634 
HTMT10138A04HTMT1_0138_A04.bHX225657 
HTMT10139A10HTMT1_0139_A10.bHX225736 
HTMT10139E01HTMT1_0139_E01.bHX225771 
HTMT10140C12HTMT1_0140_C12.bHX225842 
HTMT10140F06HTMT1_0140_F06.bHX225861 
HTMT10140H10HTMT1_0140_H10.bHX225881 
HTMT10141E10HTMT1_0141_E10.bHX225931 
HTMT10141H07HTMT1_0141_H07.bHX225957 
HTMT10144G09HTMT1_0144_G09.bHX226180 
HTMT10145A10HTMT1_0145_A10.bHX226200 
HTMT10146C12HTMT1_0146_C12.bHX226293 
HTMT10147C10HTMT1_0147_C10.bHX226359 
HTMT10148A09HTMT1_0148_A09.bHX226410 
HTMT10149F10HTMT1_0149_F10.bHX226517 
HTMT10149G10HTMT1_0149_G10.bHX226526 
HTMT10150D11HTMT1_0150_D11.bHX226567 
HTMT10151F05HTMT1_0151_F05.bHX226648 
ILNT10001B08ILNT1_0001_B08.bHX226752 
ILNT10002G10ILNT1_0002_G10.bHX226892 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
211C16200.479WSCTC/L
T17600.521CTT/L


Alignment:      TOP

20110601C-000217 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CBLT1_0023_A08.b : nnnaacgacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0050_B08.b : nttttgcgacggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_D11.b : nnaagttttttttttggacggttagaggccgtxxxx
CBLT1_0077_C07.b : ttttacgaggtagaggccgtxxxx
HTMT1_0126_A09.b : tttttggacggtacgacgxxxxxxxxxxxxxxxxxx
HTMT1_0038_C01.b : ttttggagagtacgaxxxxxxxxxx
HTMT1_0038_D01.b : ttttggcaggtacgaxxxxxxxxxx
CBLT1_0055_F02.b : tttttagcaggtagacgxxxxxxx
HTMT1_0079_B03.b : tttttccgacggtagacg
HTMT1_0145_A10.b : nttccttttttttttggacgag
CBLT1_0042_C01.b : nnncca
HTMT1_0012_E08.b :
HTMT1_0012_F03.b :
HTMT1_0006_A04.b :
HTMT1_0003_B02.b :
HTMT1_0005_F06.b :
HTMT1_0111_E01.b : t
HTMT1_0037_B01.b : tt
HTMT1_0035_E04.b :
CBLT1_0040_F03.b :
HTMT1_0027_C08.b :
HTMT1_0012_H10.b :
HTMT1_0011_B07.b :
CBLT1_0093_A09.b :
HTMT1_0144_G09.b : naaaaagaaattttattt
CBLT1_0068_C08.b :
HTMT1_0109_F08.b :
CBLT1_0038_E04.b :
HTMT1_0089_E09.b :
HTMT1_0014_H01.b :
HTMT1_0087_A04.b :
CBLT1_0078_G12.b :
HTMT1_0050_A03.b :
CBLT1_0086_E03.b :
HTMT1_0028_C05.b :
HTMT1_0042_F09.b :
HTMT1_0109_A05.b :
HTMT1_0006_E11.b :
HTMT1_0134_F06.b : ncccg
CBLT1_0042_E07.b :
HTMT1_0134_C07.b : nccgtctt
CBLT1_0072_C10.b :
ILNT1_0001_B08.b :
CBLT1_0078_C11.b :
CBLT1_0061_E10.b : ncccg
HTMT1_0002_C03.b :
HTMT1_0025_D10.b :
HTMT1_0002_F07.b :
HTMT1_0128_H06.b : tacatgaaaaggcgccacttttttttcaactcccacagggggttttaagagatgagtant
HTMT1_0064_A02.b : ttttttagacggtacga
CBLT1_0073_C05.b :
HTMT1_0138_A04.b : nnnccc
HTMT1_0025_F09.b :
HTMT1_0105_A01.b :
HTMT1_0120_E04.b :
HTMT1_0010_E11.b :
CBLT1_0039_B10.b :
HTMT1_0117_G02.b :
HTMT1_0107_A07.b :
HTMT1_0106_C10.b :
HTMT1_0104_B07.b :
HTMT1_0106_A11.b :
HTMT1_0137_G02.b :
HTMT1_0057_G09.b :
HTMT1_0047_D10.b :
CBLT1_0056_D12.b :
HTMT1_0047_F01.b :
HTMT1_0044_G09.b : nnnnnn
HTMT1_0141_E10.b :
HTMT1_0149_G10.b :
CBLT1_0055_C05.b :
CBLT1_0021_D08.b :
HTMT1_0099_B11.b :
HTMT1_0121_B03.b :
HTMT1_0151_F05.b :
HTMT1_0011_A04.b :
HTMT1_0010_H05.b :
HTMT1_0025_A07.b :
HTMT1_0021_A06.b :
HTMT1_0095_B10.b :
HTMT1_0021_G07.b :
HTMT1_0086_H08.b :
HTMT1_0037_B06.b :
HTMT1_0013_B03.b :
HTMT1_0065_B01.b : nnccc
HTMT1_0028_B11.b :
CBLT1_0037_B12.b :
HTMT1_0118_B12.b :
HTMT1_0117_E09.b :
CBLT1_0046_C06.b :
CBLT1_0028_G06.b :
HTMT1_0111_D11.b :
HTMT1_0092_C07.b :
HTMT1_0013_D07.b :
CBLT1_0076_G10.b :
HTMT1_0098_B07.b :
HTMT1_0064_B07.b :
HTMT1_0133_A12.b : nnnggc
HTMT1_0048_C02.b :
ILNT1_0002_G10.b :
HTMT1_0094_D10.b :
HTMT1_0046_G11.b :
CBLT1_0034_A11.b :
HTMT1_0083_G02.b :
HTMT1_0042_A07.b : nncc
HTMT1_0056_H09.b : nggata
HTMT1_0087_A03.b :
HTMT1_0060_E10.b :
CBLT1_0044_D03.b :
HTMT1_0016_A07.b :
HTMT1_0061_H06.b : nttt
HTMT1_0139_A10.b : nnncccg
CBLT1_0053_F07.b :
CBLT1_0034_F12.b :
HTMT1_0076_H02.b :
CBLT1_0067_B02.b :
HTMT1_0007_C05.b :
HTMT1_0041_C07.b :
HTMT1_0036_E07.b : ggatggtacgxxxxxxxxxxxxxxxxxxx
HTMT1_0010_C06.b :
HTMT1_0126_H07.b :
HTMT1_0113_A02.b :
HTMT1_0120_A12.b :
CBLT1_0024_B08.b :
HTMT1_0118_H02.b :
HTMT1_0045_F04.b :
HTMT1_0053_C11.b : nngg
HTMT1_0042_E11.b : nnn
CBLT1_0067_E11.b :
CBLT1_0074_F01.b :
HTMT1_0136_H12.b :
HTMT1_0126_E03.b :
HTMT1_0147_C10.b :
HTMT1_0041_H02.b :
HTMT1_0117_D03.b :
HTMT1_0034_B04.b :
CBLT1_0077_E12.b :
HTMT1_0118_F12.b :
HTMT1_0066_C01.b :
HTMT1_0073_B12.b :
CBLT1_0072_H09.b :
HTMT1_0041_A02.b :
CBLT1_0005_E10.b :
HTMT1_0111_A02.b :
HTMT1_0076_C01.b :
HTMT1_0122_D09.b :
CBLT1_0009_G11.b :
HTMT1_0093_H12.b :
HTMT1_0060_B12.b :
CBLT1_0034_H05.b :
HTMT1_0059_D04.b :
CBLT1_0068_G08.b :
HTMT1_0115_B01.b :
HTMT1_0058_C04.b :
CBLT1_0073_F08.b :
HTMT1_0013_A02.b :
CBLT1_0067_B11.b :
HTMT1_0119_B12.b :
CBLT1_0023_G10.b :
HTMT1_0127_H12.b :
HTMT1_0111_F07.b :
HTMT1_0105_F06.b :
HTMT1_0117_H09.b :
CBLT1_0073_B11.b :
HTMT1_0119_D08.b :
HTMT1_0126_F11.b : nttacaagt
HTMT1_0128_E02.b :
CBLT1_0050_C05.b :
HTMT1_0035_H01.b :
HTMT1_0035_D11.b :
CBLT1_0096_H03.b :
HTMT1_0140_H10.b :
CBLT1_0038_D11.b :
HTMT1_0132_F08.b :
HTMT1_0016_D05.b :
HTMT1_0097_G08.b :
CBLT1_0041_C10.b :
HTMT1_0121_B01.b :
HTMT1_0113_B09.b :
HTMT1_0077_E08.b :
CBLT1_0041_D07.b :
HTMT1_0148_A09.b :
HTMT1_0132_F03.b :
HTMT1_0140_C12.b :
HTMT1_0140_F06.b :
CBLT1_0024_F01.b :
HTMT1_0106_E05.b :
HTMT1_0099_C09.b :
HTMT1_0101_E05.b :
HTMT1_0021_A08.b :
HTMT1_0128_G08.b :
HTMT1_0120_B12.b :
HTMT1_0028_G05.b :
HTMT1_0060_C11.b :
HTMT1_0044_H10.b :
HTMT1_0026_D07.b :
CBLT1_0060_G12.b :
HTMT1_0105_B03.b :
CBLT1_0011_E06.b :
HTMT1_0135_B04.b :
CBLT1_0080_E02.b :
CBLT1_0064_A08.b :
HTMT1_0139_E01.b :
CBLT1_0090_F01.b :
HTMT1_0034_H09.b :
CBLT1_0014_C12.b :
CBLT1_0088_A03.b :
HTMT1_0106_B11.b :
HTMT1_0064_G04.b :
HTMT1_0062_E07.b :
HTMT1_0095_A12.b :
HTMT1_0150_D11.b :
HTMT1_0122_B12.b :
HTMT1_0141_H07.b :
CBLT1_0040_B05.b :
CBLT1_0052_A10.b :
HTMT1_0025_C06.b :
HTMT1_0067_H07.b :
CBLT1_0082_A09.b :
HTMT1_0013_F01.b :
HTMT1_0130_C05.b :
HTMT1_0099_A06.b :
CBLT1_0036_C05.b :
CBLT1_0037_B04.b :
HTMT1_0132_A04.b :
HTMT1_0070_G03.b :
HTMT1_0111_H01.b :
HTMT1_0100_F01.b :
CBLT1_0044_C08.b :
HTMT1_0133_A10.b :
CBLT1_0075_B12.b :
HTMT1_0027_B01.b :
CBLT1_0088_G06.b :
HTMT1_0048_A11.b :
CBLT1_0046_H09.b :
CBLT1_0004_D05.b :
HTMT1_0103_C12.b :
CBLT1_0035_B11.b :
HTMT1_0076_B06.b :
HTMT1_0095_F01.b :
CBLT1_0013_B03.b :
CBLT1_0095_H06.b :
HTMT1_0016_G09.b :
HTMT1_0019_D11.b :
CBLT1_0025_B07.b :
HTMT1_0028_H02.b :
CBLT1_0085_H01.b :
HTMT1_0054_B11.b :
CBLT1_0051_A01.b :
HTMT1_0014_G11.b :
HTMT1_0134_G05.b :
HTMT1_0034_E03.b :
HTMT1_0084_E09.b :
CBLT1_0061_C12.b :
HTMT1_0149_F10.b :
CBLT1_0039_D07.b :
CBLT1_0034_F10.b :
HTMT1_0051_A10.b :
CBLT1_0039_D10.b :
HTMT1_0022_F01.b :
CBLT1_0015_E12.b :
HTMT1_0041_B02.b :
HTMT1_0075_F07.b :
HTMT1_0020_H06.b :
HTMT1_0074_H09.b :
HTMT1_0014_A01.b :
HTMT1_0037_H11.b :
HTMT1_0066_D08.b :
CBLT1_0038_C06.b :
CBLT1_0034_C01.b :
CBLT1_0060_G03.b :
CBLT1_0062_H04.b :
HTMT1_0096_A11.b :
CBLT1_0075_C10.b :
CBLT1_0025_E08.b :
CBLT1_0004_G05.b :
CBLT1_0054_G01.b :
HTMT1_0053_A07.b :
HTMT1_0073_B07.b :
HTMT1_0094_C01.b :
HTMT1_0027_A10.b :
HTMT1_0017_E05.b :
HTMT1_0063_D12.b :
HTMT1_0045_D10.b :
HTMT1_0073_A06.b :
CBLT1_0061_H05.b :
HTMT1_0089_D09.b :
CBLT1_0062_D02.b :
HTMT1_0043_E02.b :
CBLT1_0059_H04.b :
HTMT1_0043_G10.b :
HTMT1_0067_A10.b :
CBLT1_0037_H08.b :
CBLT1_0084_G04.b :
HTMT1_0071_D10.b :
HTMT1_0014_H06.b :
CBLT1_0006_A07.b :
CBLT1_0055_D08.b :
CBLT1_0004_H12.b :
HTMT1_0042_F11.b :
HTMT1_0016_H08.b :
CBLT1_0081_G11.b :
HTMT1_0015_A09.b :
HTMT1_0040_B10.b :
BFLT1_0007_D04.b :
HTMT1_0024_B03.b :
CBLT1_0007_C02.b :
CBLT1_0028_F01.b :
HTMT1_0056_D12.b :
HTMT1_0131_B02.b :
HTMT1_0104_G12.b :
HTMT1_0042_B11.b :
HTMT1_0068_B12.b :
CBLT1_0054_F08.b :
CBLT1_0085_H05.b :
HTMT1_0064_C09.b :
HTMT1_0047_B04.b :
HTMT1_0068_D07.b :
CBLT1_0053_G06.b :
HTMT1_0026_F11.b :
HTMT1_0049_A09.b :
CBLT1_0080_H12.b :
HTMT1_0104_F09.b :
HTMT1_0071_A04.b :
HTMT1_0034_F11.b :
HTMT1_0146_C12.b :
HTMT1_0136_G04.b : nnggcctttntnn
HTMT1_0120_B01.b :
CBLT1_0006_H07.b :
HTMT1_0036_D12.b :
HTMT1_0133_G04.b :
HTMT1_0036_E11.b :
CBLT1_0062_A01.b :
HTMT1_0085_D02.b :
HTMT1_0063_E09.b :
CBLT1_0024_D10.b :
CBLT1_0024_B03.b :
CBLT1_0069_G11.b :
CBLT1_0075_E09.b :
CBLT1_0052_G05.b :
CBLT1_0074_H03.b :
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : ..GCTCTTTTCCCG*AGATGCCCCGGGGAGGGAGGAGAACACCTTCAAAGACAGGCCCTC
---------+---------+---------+---------+---------+---------+ 57
CBLT1_0023_A08.b : xxGCTCTTTTCCCGCAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTC
HTMT1_0050_B08.b : xxGCTCTTTTCCCG*AGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTC
CBLT1_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAACACCTTCAAAGACAGGCCCTC
CBLT1_0077_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAACACCTTCACAGACAGGCCCTC
HTMT1_0126_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0038_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0038_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
CBLT1_0055_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCTTCAAAGACAGGCCCTC
HTMT1_0079_B03.b : ccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaAAAGACACGTCTCT
HTMT1_0145_A10.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGGCCCTC
CBLT1_0042_C01.b : gtgagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGGCCCTC
HTMT1_0012_E08.b : nnncatacatggGATTTA
HTMT1_0012_F03.b : nnccatacaaagGATTTA
HTMT1_0006_A04.b : nnnggagatatctaagGATTTA
HTMT1_0003_B02.b : nnggcatactaagGATTTA
HTMT1_0005_F06.b : nnnnggactactataggaTTA
HTMT1_0111_E01.b : ttttggatggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_B01.b : ttaagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_E04.b : ggaaggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_F03.b : nnnncgcaggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_C08.b : ttttggacagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0012_H10.b : nncctatactt
HTMT1_0011_B07.b : nnnnccataac
CBLT1_0093_A09.b : ttttagacggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_G09.b : tnnggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_C08.b : ttttttcgacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_F08.b : nttgggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_E04.b : nnnccgcaggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0089_E09.b : tttttacgcaggaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_H01.b : ttttgccgcaagtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_A04.b : ttttggagacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0078_G12.b : ttttttagcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0050_A03.b : nnnggacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0086_E03.b : tttttagcaggtagaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_C05.b : ttttnggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_F09.b : ttttaggacgagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0109_A05.b : nnnngggatggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0006_E11.b : nnnnggcatactaaggattaa
HTMT1_0134_F06.b : catnttnnaagacggtacgacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0042_E07.b : nnnnccagtgagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_C07.b : nnnnnnnagacggttacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0072_C10.b : nnnnnggcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0001_B08.b : tttcgcgagaagaggccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0078_C11.b : tttttccgcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_E10.b : tatttnnnnccgacggtacacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_C03.b : ncctcatacta
HTMT1_0025_D10.b : ttttggacggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F07.b : nnnccatacta
HTMT1_0128_H06.b : atctactttatgattttttntnggacggttagacgcagtagtatttaacgactccnatan
HTMT1_0064_A02.b : ggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_C05.b : nnnccgacggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0138_A04.b : ttttttttttggacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0025_F09.b : ttttagacggtaagacgccntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_A01.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_E04.b : nngggatggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0010_E11.b : nccctaccta
CBLT1_0039_B10.b : ttttggagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_G02.b : tggcagagaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0107_A07.b : nnngggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_C10.b : ttttagacggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_B07.b : nnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_A11.b : ttttgcgagagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0137_G02.b : ttttttcgagagtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0057_G09.b : ttttagacaggagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_D10.b : nttttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0056_D12.b : nttttagcaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_F01.b : tttttcgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0141_E10.b : tttttacgaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0149_G10.b : ttttggcaggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0055_C05.b : tttngggcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0021_D08.b : nnnccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_B11.b : tttggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_B03.b : nnnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0151_F05.b : tttaggcagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_A04.b : nnnnccatact
HTMT1_0010_H05.b : ncccgatac
HTMT1_0025_A07.b : ttttccgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_A06.b : tttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_B10.b : ttttcgacagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_G07.b : tttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_H08.b : tttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_B06.b : tttttagacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_B03.b : tttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0065_B01.b : gtttttttnccgaggaacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_B11.b : tttttggatggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_B12.b : tttgggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_B12.b : ttggctggtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_E09.b : nttcgatagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0046_C06.b : ttccgacgttaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0028_G06.b : nntttggcaggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_D11.b : ntttaggacggtacgaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_C07.b : ttttggacggtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_D07.b : nnnnncgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0076_G10.b : nnttgagcagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0098_B07.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0064_B07.b : ttttggacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0133_A12.b : ttttttttagggacgagtacacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_C02.b : tttttggacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0002_G10.b : nnnccgcggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0094_D10.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_G11.b : tttttccgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_A11.b : tttttggcaagtagaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0083_G02.b : tttttggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_A07.b : ctttttttnnccgaggaacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0056_H09.b : ttnnttntgggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_A03.b : tttggacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_E10.b : tttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0044_D03.b : nnnnccaagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_A07.b : tttttagcaggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_H06.b : ttttttttttccgacggtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0139_A10.b : tttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0053_F07.b : ttttaacagagagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_F12.b : ttttttagacggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_H02.b : tcgcaggaagaggccgtacgtatttatacgactcctatagggaatttaa
CBLT1_0067_B02.b : nttaaacgaggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0007_C05.b : nnngggatatct
HTMT1_0041_C07.b : tttttggacaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0036_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgagggaggacaacaccttcaaagacaggccct
HTMT1_0010_C06.b : nnnncctacct
HTMT1_0126_H07.b : tttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_A02.b : tttttagacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_A12.b : nnnnnggatggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0024_B08.b : nnnaaagacgttagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_H02.b : nnncgatggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0045_F04.b : tttttggtaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_C11.b : cttttttttttnggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_E11.b : ttgcttttttttttggatggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0067_E11.b : nnccatatttttnttccgacggtacacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0074_F01.b : ttttacgacggaagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0136_H12.b : nnttcccttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0126_E03.b : tttttggacggtacgacgcagtagtattaaxxxxxxxxxxxxxxxxx
HTMT1_0147_C10.b : nntccgtttttttttccgagagtagacgcagtagtattaaxxxxxxxxxxxxxxxxx
HTMT1_0041_H02.b : tttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_D03.b : nggctggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_B04.b : ctcctatag
CBLT1_0077_E12.b : ttttttcgaggtacgacgccgtagtaxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_F12.b : nttggatggtaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0066_C01.b : tttttccgacggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_B12.b : nnccggtttnntnnnggacggtaagaggccgtagtatttatxxxxxxxxxxxxxxxxx
CBLT1_0072_H09.b : nnttttgcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0041_A02.b : tttttacgaggaacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0005_E10.b : tttttggcaggagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_A02.b : tttccgccggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_C01.b : nnnnggcgtttttttttccgacggtagacgccanxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0122_D09.b : tttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0009_G11.b : tttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0093_H12.b : ttttttcgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_B12.b : nnnnggggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_H05.b : ttttggcaggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_D04.b : ttttttggagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0068_G08.b : nnnttgacgacggtagcggccgtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0115_B01.b : nnntggctggtacgacgccgtagtaxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C04.b : tttttagagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_F08.b : nnnncgacggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_A02.b : tttttagccgagaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0067_B11.b : nnttcattttntnnnggcagagtacacgccgtxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_B12.b : ttttggatggtacgcggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0023_G10.b : ntttccgacggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_H12.b : tttttggatggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_F07.b : nngggacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_F06.b : ttccgagagtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_H09.b : nttttgacggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_B11.b : ttttggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_D08.b : tctagtacgaggccgtacxxxxxxxxxxxxxxxxxxxxx
HTMT1_0126_F11.b : acggnnnttttttttttttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0128_E02.b : ttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0050_C05.b : nnnnnggcaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_H01.b : gagagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0035_D11.b : txxxxxxxxxxxxxxxxx
CBLT1_0096_H03.b : ttttgggacgttagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_H10.b : nnnccgctttttttttggacggaacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_D11.b : ttttccgcggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0132_F08.b : ttttggatagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_D05.b : tttagacaagtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0097_G08.b : ttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_C10.b : nnnccgcaggacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_B01.b : nttttgcacagtcagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0113_B09.b : nnnnggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0077_E08.b : ttttccgagagtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_D07.b : nngggcaatgtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0148_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
HTMT1_0132_F03.b : ttttcgatagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_C12.b : nnnccacttttttttttggacggaacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0140_F06.b : nttcatctttttnnnnggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0024_F01.b : tttttcgacggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0106_E05.b : nnnggatggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_C09.b : tttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_E05.b : nttttggagagtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_A08.b : ttttcgcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0128_G08.b : ttttaggatggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_B12.b : ntttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0028_G05.b : ttttaacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0060_C11.b : nnttttttttttttttggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_H10.b : nnnccatttntnttnnggacggaacgacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0026_D07.b : ttttccgacggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0060_G12.b : tttttacgaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_B03.b : nngggatggtacgcggcagtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0011_E06.b : ttttgagcagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0135_B04.b : nnccgtttttttnnnggatggaacgaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0080_E02.b : ttttaagacagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0064_A08.b : nccgcttttnnnnnccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0139_E01.b : tttttggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0090_F01.b : ttccgaggtaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_H09.b : cgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_C12.b : tttttcgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0088_A03.b : tttttggacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_B11.b : ttttggacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0064_G04.b : tttttacgacggaagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E07.b : tttttccgaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_A12.b : ttatgggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0150_D11.b : ttttggacagtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0122_B12.b : ttttccgacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0141_H07.b : ttttttagcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_B05.b : tttcccaatgagaggccgtagtatttnxxxxxxxxxxxxxxx
CBLT1_0052_A10.b : ntttccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0025_C06.b : tttccgagagtagcggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0067_H07.b : ntttttagacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0082_A09.b : ntttaggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_F01.b : tttttggacggtagacgccataxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0130_C05.b : ttcgacggaagaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0099_A06.b : ttttggatggtaagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0036_C05.b : ttttccgcaggagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_B04.b : ntttgagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxx
HTMT1_0132_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
HTMT1_0070_G03.b : ttttccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_H01.b : tttgcgatggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0100_F01.b : tttttacgacggtacgaggcagtxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0044_C08.b : nncccagtgtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0133_A10.b : nnnccctatttttttnggatagaacgaggcantaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_B12.b : tttttccaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_B01.b : tttttggacggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0088_G06.b : ntttaagacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_A11.b : tttttaggagagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0046_H09.b : ttttagcaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_D05.b : tttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0103_C12.b : ttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0035_B11.b : ttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_B06.b : nccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_F01.b : tttttacgatggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0013_B03.b : ttttgcgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0095_H06.b : ntttggagtgaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_G09.b : ttttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D11.b : ttttggacgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_B07.b : tttttagcaggtagaggccgtagtatttnxxxxxxxxxxxxxxx
HTMT1_0028_H02.b : ttttaggatggtacgacgccgntaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_H01.b : ttttgcgaagtagaggccgtagtatttatxxxxxxxxxxxxxx
HTMT1_0054_B11.b : nccggtttttttttggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_A01.b : tttttggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_G11.b : tttttggcaggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_G05.b : nnccccttttttnnnggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_E03.b : agagtacgaggccataxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_E09.b : tttccgacggtagaggccataxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_C12.b : nnccacttttntnnnggacggtagacgcagtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0149_F10.b : ttttaggcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0039_D07.b : ttttacgacgttagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_F10.b : tttttagcaagtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0051_A10.b : ttttgtcgatggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0039_D10.b : tttttcgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0022_F01.b : tttttagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0015_E12.b : ttttggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0041_B02.b : tttttccgaggtacgaggccgtcgtattaaxxxxxxxxxxxxxxx
HTMT1_0075_F07.b : ttttccgacggtagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0020_H06.b : nnttacgaggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0074_H09.b : ttttttcgacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_A01.b : tttttacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0037_H11.b : tttttccgaggtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0066_D08.b : tttttccgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_C06.b : nnnnggcgagaagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_C01.b : ttttggcgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0060_G03.b : tttaaagacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_H04.b : tttnaacgcaggtagaggcagtxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0096_A11.b : ttttncgatggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_C10.b : ttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_E08.b : ttttggcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_G05.b : tttttggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0054_G01.b : nttttaagcaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_A07.b : tttttggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_B07.b : ttttaggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0094_C01.b : ttttgggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0027_A10.b : tttttggacggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0017_E05.b : tttttccgacggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0063_D12.b : ttttggctggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0045_D10.b : tttttcgatggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0073_A06.b : ttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_H05.b : ncccattnnnnnttcgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0089_D09.b : nnggcgtttttttttnnggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0062_D02.b : nggttattttnnnnccgacggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0043_E02.b : nntttccttnntnnnnggacggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0059_H04.b : nnttaggagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0043_G10.b : nnnccgtttttttttggacggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0067_A10.b : ttttttagacggtacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0037_H08.b : ntttgagcaggtagaggcagtagtattaaxxxxxxxxxxxxxxx
CBLT1_0084_G04.b : ttttacgagagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_D10.b : nttggacggtacgacgccgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0014_H06.b : nntttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_A07.b : nnnnccgcaggagaggccgtagtatttnxxxxxxxxxxxxxxx
CBLT1_0055_D08.b : ttttcccaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_H12.b : ttttttggacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_F11.b : tttttacgaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_H08.b : ntttatcgacggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0081_G11.b : tttttccgaggaacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0015_A09.b : tttttccgaggtacgacgcagtagtaxxxxxxxxxxxxxxxxxxxx
HTMT1_0040_B10.b : tttttggagagtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0007_D04.b : nnnccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0024_B03.b : tttttccgaggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0007_C02.b : ttttttgatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0028_F01.b : ttttccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxx
HTMT1_0056_D12.b : ntctttttttttcgacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxx
HTMT1_0131_B02.b : ttttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_G12.b : nttttgatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0042_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
HTMT1_0068_B12.b : ttcaagctagtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0054_F08.b : tttttccaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_H05.b : ttttacgaggtagaggccgtagtattaaxxxxxxxxxxxx
HTMT1_0064_C09.b : ttttacgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0047_B04.b : ttttttcgacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0068_D07.b : tttttagacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0053_G06.b : tttttggcaagtacacgcagtxxxxxxxxxxxxxxxxxxxxx
HTMT1_0026_F11.b : tttttagacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0049_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
CBLT1_0080_H12.b : tttttggcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0104_F09.b : ntttggagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_A04.b : ttttaacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0034_F11.b : nggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0146_C12.b : tttttttagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0136_G04.b : nnnggactggttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0120_B01.b : tactgtgacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_H07.b : nntttccaggtagaxxxxxxxxxxxxxxx
HTMT1_0036_D12.b : ncgacggtacgaxxxxxxxxxx
HTMT1_0133_G04.b : nnnccctttnttnnnggatagtagaggxxxxx
HTMT1_0036_E11.b :
CBLT1_0062_A01.b : nntccatttttnnnncgac
HTMT1_0085_D02.b : tttttac
HTMT1_0063_E09.b : ttttccg
CBLT1_0024_D10.b : nnnggc
CBLT1_0024_B03.b : nnnnnc
CBLT1_0069_G11.b : nn
CBLT1_0075_E09.b : t
CBLT1_0052_G05.b : n
CBLT1_0074_H03.b :
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : A*GGGTGAGACGAGCGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
---------+---------+---------+---------+---------+---------+ 115
CBLT1_0023_A08.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0050_B08.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0068_D11.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0077_C07.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0126_A09.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0038_C01.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0038_D01.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0055_F02.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0079_B03.b : C*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0145_A10.b : A*GAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0042_C01.b : A*GAGTCAGATGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0012_E08.b : ATGATTGAGA*GAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGTGGGCCTG
HTMT1_0012_F03.b : ATGATTGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGTGGGCCTG
HTMT1_0006_A04.b : ATGATTGAGACGAGCTGCAGAC*ATCCA**GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0003_B02.b : ATGATTGAGACGAGCTGCAGACCATCCA**GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0005_F06.b : ATGATTGAGACGAGCTGCAGACCATCCA**GAAGACAGTGCAGCTGCTCCCTAGGGCCTG
HTMT1_0111_E01.b : GAGAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0037_B01.b : GAGAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0035_E04.b : GAGAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0040_F03.b : GAGAGTCAGACGCGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0027_C08.b : GAGAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0012_H10.b : ggGATTTAATGATTGTGCAGACCATCCA**GAAGA*AGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0011_B07.b : taGGATTTAATGATTGGCAGACCATCCA**GAAGAC*GTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0093_A09.b : xxxGGTCAGACGAGCTCCATATCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0144_G09.b : xagGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0068_C08.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0109_F08.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0038_E04.b : xxxGGTCAGACGAGCTGCATACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0089_E09.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0014_H01.b : xxtGGTCAGACGAGCTGCAGACCATCCAA*GAAAACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0087_A04.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0078_G12.b : xxxGGTCAGACGAGCTGCTTACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0050_A03.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0086_E03.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0028_C05.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0042_F09.b : xxxAGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0109_A05.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0006_E11.b : tgaATTGAGACGAGCTGCA*ACCATCCA**GAAGACAGTGCAGCTGCTCCTGAGGGCCTG
HTMT1_0134_F06.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0042_E07.b : xxxGGTCAGACGAGCTGCCGATCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0134_C07.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0072_C10.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
ILNT1_0001_B08.b : xxtGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0078_C11.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0061_E10.b : xxxGGTCAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0002_C03.b : taggATTTAATGATTGGCAGACCATCCA**GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0025_D10.b : xxxxxTGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0002_F07.b : aggatTTAATGAATTGGCAGACCATCCA**GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0128_H06.b : ggaatTTAATGAATTGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0064_A02.b : gtgtgTGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0073_C05.b : xxxttaGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0138_A04.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0025_F09.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0105_A01.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0120_E04.b : xxxxxxGAGACGAGCCTTTGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCCG
HTMT1_0010_E11.b : taggatTTAATGATTGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0039_B10.b : xxxxxxGAGACGAGCTGCCCATT*TCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0117_G02.b : xxxxxxGAGACGAGCCGTTTACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0107_A07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0106_C10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0104_B07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0106_A11.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0137_G02.b : xxxxxxGAGACGAGCTGTAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0057_G09.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0047_D10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0056_D12.b : xxxxxxGAGACGAGCTGCACACCTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0047_F01.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0044_G09.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0141_E10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0149_G10.b : xxxxxxGAGACGAGCTGCATACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0055_C05.b : xxxxxxGAGACGAGCTGCACCCCTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0021_D08.b : xxxxxxGAGACGAGCTGCCGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0099_B11.b : xxxxxxGAGACCATTTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0121_B03.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0151_F05.b : xxxxxxGAGACGAGCTGCATACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0011_A04.b : aaggatTTAATGATTGGCAGACCATCCA**GAAGACAGTGCAGCTGCTCCCGAGGGCCTC
HTMT1_0010_H05.b : taaggaTTAATGATTGGCAGACCATCCA**GAAGAC*GTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0025_A07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0021_A06.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0095_B10.b : xxxxxxGAGACCAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0021_G07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0086_H08.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0037_B06.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0013_B03.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0065_B01.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0028_B11.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0037_B12.b : xxxxxxGAGACGAGCTGCACACCTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0118_B12.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0117_E09.b : xxxxxxGAGACGAGCCGCTTACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0046_C06.b : xxxxxxGAGACGAGCTGCCGATCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0028_G06.b : xxxxxxGAGACGAGCTGCACCACTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0111_D11.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0092_C07.b : xxxxxaGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0013_D07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0076_G10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0098_B07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0064_B07.b : xxxxxxGAGACGACCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0133_A12.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0048_C02.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
ILNT1_0002_G10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0094_D10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0046_G11.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0034_A11.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0083_G02.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0042_A07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0056_H09.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0087_A03.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0060_E10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0044_D03.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0016_A07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0061_H06.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0139_A10.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0053_F07.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0034_F12.b : xxxxxxGAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0076_H02.b : tgaattgAGACGAGCCCCTAAAGATCCAA*GAAGACAGNGCAGCTGCTCCCGAGGGCCTT
CBLT1_0067_B02.b : xxxxxxxAGACGAGCTGCCGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0007_C05.b : aaggattAATGAATTGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0041_C07.b : xxxxaaaAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGTCTG
HTMT1_0036_E07.b : cagagtcAGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0010_C06.b : tgggattTAATGATTGGCAGAC*ATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0126_H07.b : xxxxxxxgGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0113_A02.b : xxxxxxxxGACGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0120_A12.b : xxxxxxxxxxGGAGCTGCACACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0024_B08.b : xxxxxxxxxxGGAGCTGCAGACCATCTCAAGAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0118_H02.b : xxxxxxxxxxGGAGCTGCACACTATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0045_F04.b : xxxxxxxxxxGGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0053_C11.b : xxxxxxxxxxGGAGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0042_E11.b : xxxxxxxxxxxGAGCTGCGGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0067_E11.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0074_F01.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0136_H12.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0126_E03.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0147_C10.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0041_H02.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0117_D03.b : xxxxxxxxxxxxGGCTGCAGACCATTAAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0034_B04.b : ggaattaaatgaATTGGCAGACC*TTTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0077_E12.b : xxxxxxxxxxxxGGCTGCAGACCCCCCTA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0118_F12.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0066_C01.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0073_B12.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0072_H09.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0041_A02.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0005_E10.b : xxxxxxxxxxxxGGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0111_A02.b : xxxxxxxxxxxxxGCTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0076_C01.b : xxxxxxxxxxxxxxGTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0122_D09.b : xxxxxxxxxxxxxxGTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0009_G11.b : xxxxxxxxxxxxxxGTGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0093_H12.b : xxxxxxxxxxxtaaTGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0060_B12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0034_H05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0059_D04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0068_G08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0115_B01.b : xxxxxxxxxxxxxxxGGCAGACCCTTTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0058_C04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0073_F08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0013_A02.b : xxxxxxxxxxxxxxxGGCAGACCACCCGA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0067_B11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0119_B12.b : xxxxxxxxxxxxxxxGGCAGACCATCCTA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0023_G10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0127_H12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0111_F07.b : xxxxxxxxxxxxxxxGGCAGACCATCTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0105_F06.b : xxxxxxxxxxxxxxxGGCAGACCCTCTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0117_H09.b : xxxxxxxxxxxxxxxGGCAGACCACCCTA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0073_B11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0119_D08.b : xxxxxxxxxxxxxxxGGCAGACCCCCTAA**AAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0126_F11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0128_E02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0050_C05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0035_H01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0035_D11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0096_H03.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0140_H10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0038_D11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0132_F08.b : xxxxxxxxxxxxxxxGGCAGACCACCCTA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0016_D05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0097_G08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0041_C10.b : xxxxxxxxxxxxxxxGGCAGACCATCCACATAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0121_B01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0113_B09.b : xxxxxxxxxxxxxxxGGCAGACCCTCTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0077_E08.b : xxxxxxxxxxxxxxxGGCAGACCACCCTA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0041_D07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*TAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0148_A09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0132_F03.b : xxxxxxxxxxxxxxxGGCAGACCACCCTT*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0140_C12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0140_F06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0024_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*TAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0106_E05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0099_C09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0101_E05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0021_A08.b : xxxxxxxxxxxxxxxGGCAGACCATCCTT*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0128_G08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0120_B12.b : xxxxxxxxxxxxxxxGGCAGACCACTCCTAGAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0028_G05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0060_C11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0044_H10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0026_D07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0060_G12.b : xxxxxxxxxxxxxxxGGCAGACCATCCCA*TTAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0105_B03.b : xxxxxxxxxxxxxxxGGCAGACCATTTAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0011_E06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0135_B04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0080_E02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0064_A08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0139_E01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0090_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0034_H09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0014_C12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0088_A03.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0106_B11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0064_G04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0062_E07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0095_A12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0150_D11.b : xxxxxxxxxxxxxxxGGCAGACCATCCTATGAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0122_B12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0141_H07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0040_B05.b : xxxxxxxxxxxxxxxGGCAGACCATCCCC*TTANA*AGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0052_A10.b : xxxxxxxxxxxxxxxGGCAGACCATCCC**GTAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0025_C06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0067_H07.b : xxxxxxxxxxxxxxxGGCAGACCCTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0082_A09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAAGTAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0013_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0130_C05.b : xxxxxxxxxxxxxxxGGCAGACCACCCTT*TAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0099_A06.b : xxxxxxxxxxxxxxxGGCAGCCCTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0036_C05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*CAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0037_B04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*CATTTCAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0132_A04.b : xxxxxxxxxxxxxxxGGCAGACCCCCTTT*AAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0070_G03.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0111_H01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0100_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0044_C08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAAGCAATACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0133_A10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0075_B12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0027_B01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0088_G06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0048_A11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0046_H09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0004_D05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0103_C12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0035_B11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAAGCAGTACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0076_B06.b : xxxxxxxxxxxxxxxGGCAGACCACCCTT*AAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0095_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0013_B03.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0095_H06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0016_G09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0019_D11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0025_B07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0028_H02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0085_H01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0054_B11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0051_A01.b : xxxxxxxxxxxxxxxGGCAGACCATCCCA*GTAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0014_G11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0134_G05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0034_E03.b : xxxxxxxxxxxxxxxGGCAGACCATTCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0084_E09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0061_C12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0149_F10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0039_D07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0034_F10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0051_A10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0039_D10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0022_F01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0015_E12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GTAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0041_B02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0075_F07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0020_H06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0074_H09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0014_A01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0037_H11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0066_D08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0038_C06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0034_C01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0060_G03.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0062_H04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0096_A11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0075_C10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0025_E08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0004_G05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0054_G01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0053_A07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0073_B07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0094_C01.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0027_A10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0017_E05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0063_D12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0045_D10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0073_A06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0061_H05.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0089_D09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0062_D02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0043_E02.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0059_H04.b : xxxxxxxxxxxxxxxGGCAGACCATCCCA*GATGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0043_G10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0067_A10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0037_H08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAC*CAATACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0084_G04.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0071_D10.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0014_H06.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0006_A07.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0055_D08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0004_H12.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAATACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0042_F11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0016_H08.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0081_G11.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0015_A09.b : xxxxxxxxxxxxxxxGGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0040_B10.b : xxxxxxxxxxxxxxxGGCAGACCTTCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
BFLT1_0007_D04.b : xxxxxxxxxxxxxxxxGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0024_B03.b : xxxxxxxxxxxxxxxxGCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0007_C02.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GACGACTGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0028_F01.b : xxxxxxxxxxxxxxxxxGAGACCATCCA**GCCGATTGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0056_D12.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0131_B02.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0104_G12.b : xxxxxxxxxxxxxxxxtGAGACCATCCTT*TAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0042_B11.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0068_B12.b : xxxxxxxxxxxxxxxxxGAGACCATCCAT*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0054_F08.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0085_H05.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0064_C09.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0047_B04.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0068_D07.b : xxxxxxxxxxxxxxxxxCAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0053_G06.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0026_F11.b : xxxxxxxxxxxxxxxxxGAGACCATCCAA*TAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0049_A09.b : xxxxxxxxxxxxxxxxxxAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0080_H12.b : xxxxxxxxxxxxxxxxxxAGACCATCCAT*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0104_F09.b : xxxxxxxxxxxxxxxxxxAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0071_A04.b : xxxxxxxxxxxxxxxxxxAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0034_F11.b : xxxxxxxxxxxxxxxxxxAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0146_C12.b : xxxxxxxxxxxxxxxxxxAGACCATCCAA*GAAGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0136_G04.b : xxggagtcgaacaagctgctgaccatcaggaAAAACAGTGCGCCTGCTCCCGAGGGCATG
HTMT1_0120_B01.b : xxxxxxxxxxxxggagctgcccattaagggcacGACAGTGCAGCTGCTCCCGAGGGCCTG
CBLT1_0006_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACAGTGCAGCTGCTCCCGAGGGCCTG
HTMT1_0036_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTGCACCTGCTCCCGAGGGCCTG
HTMT1_0133_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGCTGCTCCCTAGGGCCTG
HTMT1_0036_E11.b : gccCCCGAGGGCCTG
CBLT1_0062_A01.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGGGCCTG
HTMT1_0085_D02.b : gaggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTG
HTMT1_0063_E09.b : agagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTG
CBLT1_0024_D10.b : gacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaagCTG
CBLT1_0024_B03.b : gacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaagCTG
CBLT1_0069_G11.b : nnaagacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTG
CBLT1_0075_E09.b : ttttggaagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTG
CBLT1_0052_G05.b : nnnnggacggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgG
CBLT1_0074_H03.b : ttttccgacagtaga
CBLT1_0052_H03.b :
CBLT1_0052_H02.b :
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
---------+---------+---------+---------+---------+---------+ 175
CBLT1_0023_A08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0050_B08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0068_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0077_C07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0126_A09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0038_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0038_D01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0055_F02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0079_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0145_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0042_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0012_E08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCACAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0012_F03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0006_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0003_B02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0005_F06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0111_E01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0037_B01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0035_E04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0040_F03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0027_C08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0012_H10.b : TATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0011_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0093_A09.b : GACGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0144_G09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0068_C08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0109_F08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0038_E04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0089_E09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0014_H01.b : GATGTGATGGCGTCACATAATAGACCCTCCCAGAGGCACGGATCATAGTACCTGGCCTCC
HTMT1_0087_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0078_G12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0050_A03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0086_E03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0028_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0042_F09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0109_A05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0006_E11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0134_F06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0042_E07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0134_C07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0072_C10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
ILNT1_0001_B08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0078_C11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0061_E10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0002_C03.b : TATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0025_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0002_F07.b : TATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0128_H06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0064_A02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0073_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0138_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0025_F09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0105_A01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0120_E04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0010_E11.b : CATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0039_B10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0117_G02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0107_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0106_C10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0104_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0106_A11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0137_G02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0057_G09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0047_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0056_D12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0047_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0044_G09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0141_E10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0149_G10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0055_C05.b : GATGCGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0021_D08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0099_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0121_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0151_F05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0011_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0010_H05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0025_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0021_A06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0095_B10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0021_G07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0086_H08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0037_B06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0013_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0065_B01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0028_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0037_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0118_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0117_E09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0046_C06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0028_G06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0111_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0092_C07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0013_D07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0076_G10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0098_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0064_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0133_A12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0048_C02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
ILNT1_0002_G10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0094_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0046_G11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0034_A11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0083_G02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0042_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0056_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0087_A03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0060_E10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0044_D03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0016_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0061_H06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0139_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0053_F07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0034_F12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0076_H02.b : TTTGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0067_B02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0007_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0041_C07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0036_E07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0010_C06.b : CATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0126_H07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0113_A02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0120_A12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0024_B08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0118_H02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0045_F04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0053_C11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0042_E11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0067_E11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0074_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0136_H12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0126_E03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0147_C10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0041_H02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0117_D03.b : GATGTCATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0034_B04.b : GATGCGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0077_E12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0118_F12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0066_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0073_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0072_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0041_A02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0005_E10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0111_A02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0076_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0122_D09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0009_G11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0093_H12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0060_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0034_H05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0059_D04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0068_G08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0115_B01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0058_C04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0073_F08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0013_A02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0067_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0119_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0023_G10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0127_H12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0111_F07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0105_F06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0117_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0073_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0119_D08.b : GATGTGCTGTTTTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0126_F11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0128_E02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0050_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0035_H01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0035_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0096_H03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0140_H10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0038_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0132_F08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0016_D05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0097_G08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0041_C10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0121_B01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0113_B09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0077_E08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0041_D07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0148_A09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0132_F03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0140_C12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0140_F06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0024_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0106_E05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0099_C09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0101_E05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0021_A08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0128_G08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0120_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0028_G05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0060_C11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0044_H10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0026_D07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0060_G12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0105_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0011_E06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0135_B04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0080_E02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0064_A08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0139_E01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0090_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0034_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0014_C12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0088_A03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0106_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0064_G04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0062_E07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0095_A12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0150_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0122_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0141_H07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0040_B05.b : GATGTGATGGCGCCTCAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0052_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0025_C06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0067_H07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0082_A09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0013_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0130_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0099_A06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0036_C05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0037_B04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0132_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0070_G03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0111_H01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0100_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0044_C08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0133_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0075_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0027_B01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0088_G06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0048_A11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0046_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0004_D05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0103_C12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0035_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0076_B06.b : GATGTGACGTCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0095_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0013_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0095_H06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0016_G09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0019_D11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0025_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0028_H02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0085_H01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0054_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0051_A01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0014_G11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0134_G05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0034_E03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0084_E09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0061_C12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0149_F10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0039_D07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0034_F10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0051_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0039_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0022_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0015_E12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0041_B02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0075_F07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0020_H06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0074_H09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0014_A01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0037_H11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0066_D08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0038_C06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0034_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0060_G03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0062_H04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0096_A11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0075_C10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0025_E08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0004_G05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0054_G01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0053_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0073_B07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0094_C01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0027_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0017_E05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0063_D12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0045_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0073_A06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0061_H05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0089_D09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0062_D02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0043_E02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0059_H04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0043_G10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0067_A10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0037_H08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0084_G04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0071_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0014_H06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0006_A07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0055_D08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0004_H12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0042_F11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0016_H08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0081_G11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0015_A09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0040_B10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
BFLT1_0007_D04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0024_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0007_C02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0028_F01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0056_D12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0131_B02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0104_G12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0042_B11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0068_B12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0054_F08.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0085_H05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0064_C09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0047_B04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0068_D07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0053_G06.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0026_F11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0049_A09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0080_H12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0104_F09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0071_A04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0034_F11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0146_C12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0136_G04.b : AATATGATGGCGTCACAGAAGATACCCTCCCAGAGGCACAGATCGAAGTACCTGGCCTCC
HTMT1_0120_B01.b : GACGTTATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0006_H07.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0036_D12.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0133_G04.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0036_E11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0062_A01.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0085_D02.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
HTMT1_0063_E09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0024_D10.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0024_B03.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0069_G11.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0075_E09.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0052_G05.b : GATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCAAAGTACCTGGCCTCC
CBLT1_0074_H03.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGTACCTGGCCTCC
CBLT1_0052_H03.b : tttttggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0052_H02.b : nnnngggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
---------+---------+---------+---------+---------+---------+ 234
CBLT1_0023_A08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0050_B08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0068_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0077_C07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0126_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0038_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0038_D01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0055_F02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0079_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0145_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0042_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0012_E08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0012_F03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0006_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0003_B02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0005_F06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0111_E01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0037_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0035_E04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0040_F03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0027_C08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0012_H10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0011_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0093_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0144_G09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0068_C08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0109_F08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0038_E04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0089_E09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0014_H01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAAAGACACTGGCAT
HTMT1_0087_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0078_G12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0050_A03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0086_E03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0028_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0042_F09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0109_A05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0006_E11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0134_F06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0042_E07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0134_C07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0072_C10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
ILNT1_0001_B08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0078_C11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0061_E10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0002_C03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0025_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0002_F07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0128_H06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0064_A02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0073_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0138_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0025_F09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0105_A01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0120_E04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0010_E11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0039_B10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0117_G02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0107_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0106_C10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0104_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0106_A11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0137_G02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0057_G09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0047_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0056_D12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0047_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0044_G09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0141_E10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0149_G10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0055_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0021_D08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0099_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0121_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0151_F05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0011_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0010_H05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0025_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0021_A06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0095_B10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0021_G07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0086_H08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0037_B06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0013_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0065_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0028_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0037_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0118_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0117_E09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0046_C06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0028_G06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0111_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0092_C07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0013_D07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0076_G10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0098_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0064_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0133_A12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0048_C02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
ILNT1_0002_G10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0094_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0046_G11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0034_A11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0083_G02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0042_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0056_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0087_A03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0060_E10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0044_D03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0016_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0061_H06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0139_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0053_F07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0034_F12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0076_H02.b : GCGAGCACCATGGACTCACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0067_B02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0007_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0041_C07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0036_E07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0010_C06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0126_H07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0113_A02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0120_A12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0024_B08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0118_H02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0045_F04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0053_C11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0042_E11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0067_E11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0074_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0136_H12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0126_E03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0147_C10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0041_H02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0117_D03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0034_B04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0077_E12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0118_F12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0066_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0073_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0072_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0041_A02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0005_E10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0111_A02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0076_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0122_D09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0009_G11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0093_H12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0060_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0034_H05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0059_D04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0068_G08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0115_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0058_C04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0073_F08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0013_A02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0067_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0119_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0023_G10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0127_H12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0111_F07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0105_F06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0117_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0073_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0119_D08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCCCAGAGACACTGGCAT
HTMT1_0126_F11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0128_E02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0050_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0035_H01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0035_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0096_H03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0140_H10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0038_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0132_F08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0016_D05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0097_G08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0041_C10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0121_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0113_B09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0077_E08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0041_D07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0148_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0132_F03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0140_C12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0140_F06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0024_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0106_E05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0099_C09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0101_E05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0021_A08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0128_G08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0120_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0028_G05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0060_C11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0044_H10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0026_D07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0060_G12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0105_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0011_E06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0135_B04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0080_E02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0064_A08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0139_E01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0090_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0034_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0014_C12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0088_A03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0106_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0064_G04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0062_E07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0095_A12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0150_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0122_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0141_H07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0040_B05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0052_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0025_C06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0067_H07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0082_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0013_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0130_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0099_A06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0036_C05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0037_B04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0132_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0070_G03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0111_H01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0100_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0044_C08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0133_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0075_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0027_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0088_G06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0048_A11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0046_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0004_D05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0103_C12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0035_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0076_B06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0095_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0013_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0095_H06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0016_G09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0019_D11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0025_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0028_H02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0085_H01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0054_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0051_A01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0014_G11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0134_G05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0034_E03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0084_E09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0061_C12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0149_F10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0039_D07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0034_F10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0051_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0039_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0022_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0015_E12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0041_B02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0075_F07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0020_H06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0074_H09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0014_A01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0037_H11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0066_D08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0038_C06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0034_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0060_G03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0062_H04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0096_A11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0075_C10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0025_E08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0004_G05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0054_G01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0053_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0073_B07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0094_C01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0027_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0017_E05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0063_D12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0045_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0073_A06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0061_H05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0089_D09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0062_D02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0043_E02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0059_H04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0043_G10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0067_A10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0037_H08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0084_G04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0071_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0014_H06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0006_A07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0055_D08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0004_H12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0042_F11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0016_H08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0081_G11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0015_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0040_B10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
BFLT1_0007_D04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0024_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0007_C02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0028_F01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0056_D12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0131_B02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0104_G12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0042_B11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0068_B12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0054_F08.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0085_H05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0064_C09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0047_B04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0068_D07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0053_G06.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0026_F11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0049_A09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0080_H12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0104_F09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0071_A04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0034_F11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0146_C12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0136_G04.b : TCAAGCACCCTGGAC*CACACCAGGCTCGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0120_B01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0006_H07.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0036_D12.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0133_G04.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0036_E11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0062_A01.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
HTMT1_0085_D02.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
HTMT1_0063_E09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0024_D10.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0024_B03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0069_G11.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0075_E09.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTCCCCAGGCACAGAGACACTGGCAT
CBLT1_0052_G05.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0074_H03.b : GCGAGCACCATGGAC*CACGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0052_H03.b : xxxxxxxxxxxxxxxxxxgGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0052_H02.b : xxxxxxxxxxxxxxxxxxgGCCAGGCACGGCTTCCTTCCCAGGCACAGAGACACTGGCAT
CBLT1_0042_B03.b :
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
---------+---------+---------+---------+---------+---------+ 294
CBLT1_0023_A08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0050_B08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0068_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0077_C07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0126_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0038_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0038_D01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0055_F02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0079_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0145_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0042_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0012_E08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0012_F03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0006_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0003_B02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0005_F06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0111_E01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0037_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0035_E04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0040_F03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0027_C08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0012_H10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0011_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0093_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0144_G09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0068_C08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0109_F08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0038_E04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0089_E09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0014_H01.b : CCTCCACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAATCGGAGCTCGGG
HTMT1_0087_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0078_G12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0050_A03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0086_E03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0028_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0042_F09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0109_A05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0006_E11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0134_F06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0042_E07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0134_C07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0072_C10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
ILNT1_0001_B08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0078_C11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0061_E10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0002_C03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0025_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0002_F07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0128_H06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0064_A02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0073_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0138_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0025_F09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0105_A01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0120_E04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0010_E11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0039_B10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0117_G02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0107_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0106_C10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0104_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0106_A11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0137_G02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0057_G09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0047_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0056_D12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0047_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0044_G09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0141_E10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0149_G10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0055_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0021_D08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0099_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0121_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0151_F05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0011_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0010_H05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0025_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0021_A06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0095_B10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0021_G07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0086_H08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0037_B06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0013_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0065_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0028_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0037_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0118_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0117_E09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0046_C06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0028_G06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0111_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0092_C07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0013_D07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0076_G10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0098_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0064_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0133_A12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0048_C02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
ILNT1_0002_G10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0094_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0046_G11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0034_A11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0083_G02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0042_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0056_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0087_A03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0060_E10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0044_D03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0016_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0061_H06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0139_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0053_F07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0034_F12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0076_H02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0067_B02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0007_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0041_C07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0036_E07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0010_C06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0126_H07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0113_A02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0120_A12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0024_B08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0118_H02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0045_F04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0053_C11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0042_E11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0067_E11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0074_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0136_H12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0126_E03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0147_C10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0041_H02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0117_D03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0034_B04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0077_E12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0118_F12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0066_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0073_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0072_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0041_A02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0005_E10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0111_A02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0076_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0122_D09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0009_G11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0093_H12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0060_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0034_H05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0059_D04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0068_G08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0115_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0058_C04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0073_F08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0013_A02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0067_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0119_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0023_G10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0127_H12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0111_F07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0105_F06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0117_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0073_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0119_D08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0126_F11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0128_E02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0050_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0035_H01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0035_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0096_H03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0140_H10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0038_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0132_F08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0016_D05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0097_G08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0041_C10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0121_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0113_B09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0077_E08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0041_D07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0148_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0132_F03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0140_C12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0140_F06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0024_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0106_E05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0099_C09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0101_E05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0021_A08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0128_G08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0120_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0028_G05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0060_C11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0044_H10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0026_D07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0060_G12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0105_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0011_E06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0135_B04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0080_E02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0064_A08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0139_E01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0090_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0034_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0014_C12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0088_A03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0106_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0064_G04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0062_E07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0095_A12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0150_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0122_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0141_H07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0040_B05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0052_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0025_C06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0067_H07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0082_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0013_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0130_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0099_A06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0036_C05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0037_B04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0132_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0070_G03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0111_H01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0100_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0044_C08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0133_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0075_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0027_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0088_G06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0048_A11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0046_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0004_D05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0103_C12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0035_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0076_B06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0095_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0013_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0095_H06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0016_G09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0019_D11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0025_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0028_H02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0085_H01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0054_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0051_A01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0014_G11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0134_G05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0034_E03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0084_E09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0061_C12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0149_F10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0039_D07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0034_F10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0051_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0039_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0022_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0015_E12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0041_B02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0075_F07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0020_H06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0074_H09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0014_A01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0037_H11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0066_D08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0038_C06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0034_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0060_G03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0062_H04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0096_A11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0075_C10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0025_E08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0004_G05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0054_G01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0053_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0073_B07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0094_C01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0027_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0017_E05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0063_D12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0045_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0073_A06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0061_H05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0089_D09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0062_D02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0043_E02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0059_H04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0043_G10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0067_A10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0037_H08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0084_G04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0071_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0014_H06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0006_A07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0055_D08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0004_H12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0042_F11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0016_H08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0081_G11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0015_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0040_B10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
BFLT1_0007_D04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0024_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0007_C02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0028_F01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0056_D12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0131_B02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0104_G12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0042_B11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0068_B12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0054_F08.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0085_H05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0064_C09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0047_B04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0068_D07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0053_G06.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0026_F11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0049_A09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0080_H12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0104_F09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0071_A04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0034_F11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0146_C12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0136_G04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACGGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0120_B01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0006_H07.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0036_D12.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0133_G04.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0036_E11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0062_A01.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0085_D02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
HTMT1_0063_E09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0024_D10.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0024_B03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0069_G11.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0075_E09.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0052_G05.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0074_H03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0052_H03.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0052_H02.b : CCTCGACTCCCTCGGCCGCTTCTTTGGCGCTGACAGGGGTGCGCCCAAGCGGGGCTCGGG
CBLT1_0042_B03.b : nnnnccagtgagaggxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
---------+---------+---------+---------+---------+---------+ 354
CBLT1_0023_A08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0050_B08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0068_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0077_C07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0126_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0038_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0038_D01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0055_F02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0079_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0145_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0042_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0012_E08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0012_F03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0006_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0003_B02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0005_F06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0111_E01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0037_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0035_E04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0040_F03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0027_C08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0012_H10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0011_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0093_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0144_G09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0068_C08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0109_F08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0038_E04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0089_E09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0014_H01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0087_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0078_G12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0050_A03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0086_E03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0028_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0042_F09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0109_A05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0006_E11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0134_F06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0042_E07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0134_C07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0072_C10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
ILNT1_0001_B08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0078_C11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0061_E10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0002_C03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0025_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0002_F07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0128_H06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0064_A02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0073_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0138_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0025_F09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0105_A01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0120_E04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0010_E11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0039_B10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0117_G02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0107_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0106_C10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0104_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0106_A11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0137_G02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0057_G09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0047_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0056_D12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0047_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0044_G09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0141_E10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0149_G10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0055_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0021_D08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0099_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0121_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0151_F05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0011_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0010_H05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0025_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0021_A06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0095_B10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0021_G07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0086_H08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0037_B06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0013_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0065_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0028_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0037_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0118_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0117_E09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0046_C06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0028_G06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0111_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0092_C07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0013_D07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0076_G10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0098_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0064_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0133_A12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0048_C02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
ILNT1_0002_G10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0094_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0046_G11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0034_A11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0083_G02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0042_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0056_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0087_A03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0060_E10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0044_D03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0016_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0061_H06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0139_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0053_F07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0034_F12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0076_H02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0067_B02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0007_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0041_C07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0036_E07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0010_C06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0126_H07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0113_A02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0120_A12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0024_B08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0118_H02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0045_F04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0053_C11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0042_E11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0067_E11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0074_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0136_H12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0126_E03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0147_C10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0041_H02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0117_D03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0034_B04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0077_E12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0118_F12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0066_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0073_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0072_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0041_A02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0005_E10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0111_A02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0076_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0122_D09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0009_G11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0093_H12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0060_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0034_H05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0059_D04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0068_G08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0115_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0058_C04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0073_F08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0013_A02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0067_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0119_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0023_G10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0127_H12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0111_F07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0105_F06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0117_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0073_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0119_D08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0126_F11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0128_E02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0050_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0035_H01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0035_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0096_H03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0140_H10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0038_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0132_F08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0016_D05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0097_G08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0041_C10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0121_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0113_B09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0077_E08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0041_D07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0148_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0132_F03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0140_C12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0140_F06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0024_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0106_E05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0099_C09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0101_E05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0021_A08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0128_G08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0120_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0028_G05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0060_C11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0044_H10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0026_D07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0060_G12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0105_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0011_E06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0135_B04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0080_E02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0064_A08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0139_E01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0090_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0034_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0014_C12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0088_A03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0106_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0064_G04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0062_E07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0095_A12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0150_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0122_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0141_H07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0040_B05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0052_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0025_C06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0067_H07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0082_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0013_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0130_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0099_A06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0036_C05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0037_B04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0132_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0070_G03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0111_H01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0100_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0044_C08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0133_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0075_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0027_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0088_G06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0048_A11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0046_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0004_D05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0103_C12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0035_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0076_B06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0095_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0013_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0095_H06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0016_G09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0019_D11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0025_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0028_H02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0085_H01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0054_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0051_A01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0014_G11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0134_G05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0034_E03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0084_E09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0061_C12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0149_F10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0039_D07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0034_F10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0051_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0039_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0022_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0015_E12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0041_B02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0075_F07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0020_H06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0074_H09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0014_A01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0037_H11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0066_D08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0038_C06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0034_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0060_G03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0062_H04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0096_A11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0075_C10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0025_E08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0004_G05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0054_G01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0053_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0073_B07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0094_C01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0027_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0017_E05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0063_D12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0045_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0073_A06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0061_H05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0089_D09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0062_D02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0043_E02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0059_H04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0043_G10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0067_A10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0037_H08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0084_G04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0071_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0014_H06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0006_A07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0055_D08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0004_H12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0042_F11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0016_H08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0081_G11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0015_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0040_B10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
BFLT1_0007_D04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0024_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0007_C02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0028_F01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0056_D12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0131_B02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0104_G12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0042_B11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0068_B12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0054_F08.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0085_H05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0064_C09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0047_B04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0068_D07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0053_G06.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0026_F11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0049_A09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0080_H12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0104_F09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0071_A04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0034_F11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0146_C12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0136_G04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0120_B01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0006_H07.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0036_D12.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0133_G04.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0036_E11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0062_A01.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0085_D02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
HTMT1_0063_E09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0024_D10.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0024_B03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0069_G11.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0075_E09.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0052_G05.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0074_H03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0052_H03.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0052_H02.b : CAAGGATGGACACCACGCGGCCAGGACCACCCACTACGGCTCCCTGCCCCAGAAGGCACA
CBLT1_0042_B03.b : xxxxxxxxxxxxxxxxxxxxxxAGGACCACCCACTACCGCTCCCTGCCCCAGAAGGCACA
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
---------+---------+---------+---------+---------+---------+ 414
CBLT1_0023_A08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0050_B08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0068_D11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0077_C07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0126_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0038_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0038_D01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0055_F02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0079_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0145_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0042_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0012_E08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0012_F03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0006_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0003_B02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0005_F06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0111_E01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0037_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0035_E04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0040_F03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0027_C08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0012_H10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0011_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0093_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0144_G09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0068_C08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0109_F08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0038_E04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0089_E09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0014_H01.b : GCACGGCCGGCCCCATGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0087_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0078_G12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0050_A03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0086_E03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0028_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0042_F09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0109_A05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0006_E11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0134_F06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0042_E07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0134_C07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0072_C10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
ILNT1_0001_B08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0078_C11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0061_E10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0002_C03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0025_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0002_F07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0128_H06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0064_A02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0073_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0138_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0025_F09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0105_A01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0120_E04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0010_E11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0039_B10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0117_G02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0107_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0106_C10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0104_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0106_A11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0137_G02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0057_G09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0047_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0056_D12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0047_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0044_G09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0141_E10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0149_G10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0055_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0021_D08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0099_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0121_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0151_F05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0011_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0010_H05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0025_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0021_A06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0095_B10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0021_G07.b : GCACGGCCGGCCCCATGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGGGACGCC
HTMT1_0086_H08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0037_B06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0013_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0065_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0028_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0037_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0118_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0117_E09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0046_C06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0028_G06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0111_D11.b : GTACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0092_C07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0013_D07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0076_G10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0098_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0064_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0133_A12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0048_C02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
ILNT1_0002_G10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0094_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0046_G11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0034_A11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0083_G02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0042_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0056_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0087_A03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0060_E10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0044_D03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0016_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0061_H06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0139_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0053_F07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0034_F12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0076_H02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0067_B02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0007_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0041_C07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0036_E07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0010_C06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0126_H07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0113_A02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0120_A12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0024_B08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0118_H02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0045_F04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0053_C11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0042_E11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0067_E11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0074_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0136_H12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0126_E03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0147_C10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0041_H02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0117_D03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0034_B04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0077_E12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0118_F12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0066_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0073_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0072_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0041_A02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0005_E10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0111_A02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0076_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0122_D09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0009_G11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0093_H12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0060_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTNCAGAACATCGTGACGCC
CBLT1_0034_H05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0059_D04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTNCAGAACATCGTGACGCC
CBLT1_0068_G08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0115_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0058_C04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0073_F08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0013_A02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0067_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0119_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0023_G10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0127_H12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0111_F07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0105_F06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0117_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0073_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0119_D08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0126_F11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0128_E02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0050_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0035_H01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0035_D11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0096_H03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0140_H10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0038_D11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0132_F08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0016_D05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0097_G08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0041_C10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0121_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0113_B09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0077_E08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0041_D07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0148_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0132_F03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0140_C12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0140_F06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0024_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0106_E05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0099_C09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0101_E05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0021_A08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0128_G08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0120_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0028_G05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0060_C11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0044_H10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0026_D07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0060_G12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0105_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0011_E06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0135_B04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0080_E02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0064_A08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0139_E01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0090_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0034_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0014_C12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0088_A03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0106_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0064_G04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0062_E07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0095_A12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0150_D11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0122_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0141_H07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0040_B05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0052_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0025_C06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0067_H07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0082_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0013_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0130_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0099_A06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0036_C05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0037_B04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0132_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0070_G03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0111_H01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0100_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0044_C08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0133_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0075_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0027_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0088_G06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0048_A11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0046_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0004_D05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0103_C12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0035_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0076_B06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0095_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0013_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0095_H06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0016_G09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0019_D11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0025_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0028_H02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0085_H01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0054_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0051_A01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0014_G11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0134_G05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0034_E03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0084_E09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0061_C12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0149_F10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0039_D07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0034_F10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0051_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0039_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0022_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0015_E12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0041_B02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0075_F07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0020_H06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0074_H09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0014_A01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0037_H11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0066_D08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0038_C06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0034_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0060_G03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0062_H04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0096_A11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0075_C10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0025_E08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0004_G05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0054_G01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0053_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0073_B07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0094_C01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0027_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0017_E05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0063_D12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0045_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0073_A06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0061_H05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0089_D09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0062_D02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0043_E02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0059_H04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0043_G10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0067_A10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0037_H08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0084_G04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0071_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0014_H06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0006_A07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0055_D08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0004_H12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0042_F11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0016_H08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0081_G11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0015_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0040_B10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
BFLT1_0007_D04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0024_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0007_C02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0028_F01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0056_D12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0131_B02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0104_G12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0042_B11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0068_B12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0054_F08.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0085_H05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0064_C09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0047_B04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0068_D07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0053_G06.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0026_F11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0049_A09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0080_H12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0104_F09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0071_A04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0034_F11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0146_C12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0136_G04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0120_B01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0006_H07.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0036_D12.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0133_G04.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0036_E11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0062_A01.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0085_D02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
HTMT1_0063_E09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0024_D10.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0024_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0069_G11.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0075_E09.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0052_G05.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0074_H03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0052_H03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0052_H02.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0042_B03.b : GCACGGCCGGCCCCAGGATGAAAACCCTGTAGTGCATTTCTTCAAGAACATCGTGACGCC
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
---------+---------+---------+---------+---------+---------+ 474
CBLT1_0023_A08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0050_B08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0068_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0077_C07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0126_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0038_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0038_D01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0055_F02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0079_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0145_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0042_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0012_E08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0012_F03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0006_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0003_B02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0005_F06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0111_E01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0037_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0035_E04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0040_F03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0027_C08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0012_H10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0011_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0093_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0144_G09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0068_C08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0109_F08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0038_E04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0089_E09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0014_H01.b : TCTCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0087_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0078_G12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0050_A03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0086_E03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0028_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0042_F09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0109_A05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0006_E11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0134_F06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0042_E07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0134_C07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0072_C10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
ILNT1_0001_B08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0078_C11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0061_E10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0002_C03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0025_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0002_F07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0128_H06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0064_A02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0073_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0138_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0025_F09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0105_A01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0120_E04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0010_E11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0039_B10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0117_G02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0107_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0106_C10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0104_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0106_A11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0137_G02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0057_G09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0047_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0056_D12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0047_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0044_G09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0141_E10.b : TCGCACACCTCCCCCGTCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0149_G10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0055_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0021_D08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0099_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0121_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0151_F05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0011_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0010_H05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0025_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0021_A06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0095_B10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0021_G07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCACCAGATTTAGCTG
HTMT1_0086_H08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0037_B06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0013_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0065_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0028_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0037_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0118_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0117_E09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0046_C06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0028_G06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0111_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0092_C07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0013_D07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0076_G10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0098_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0064_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0133_A12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0048_C02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
ILNT1_0002_G10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0094_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0046_G11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0034_A11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0083_G02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0042_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0056_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0087_A03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0060_E10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0044_D03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0016_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0061_H06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0139_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0053_F07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0034_F12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0076_H02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0067_B02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0007_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0041_C07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0036_E07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0010_C06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0126_H07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0113_A02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0120_A12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0024_B08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0118_H02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0045_F04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0053_C11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0042_E11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0067_E11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0074_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0136_H12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0126_E03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0147_C10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0041_H02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0117_D03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0034_B04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0077_E12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0118_F12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0066_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0073_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0072_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0041_A02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0005_E10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0111_A02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0076_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0122_D09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0009_G11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0093_H12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0060_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0034_H05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0059_D04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0068_G08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0115_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0058_C04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0073_F08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0013_A02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0067_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0119_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0023_G10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0127_H12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0111_F07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0105_F06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0117_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0073_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0119_D08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0126_F11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0128_E02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0050_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0035_H01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0035_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0096_H03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0140_H10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0038_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0132_F08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0016_D05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0097_G08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0041_C10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0121_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0113_B09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0077_E08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0041_D07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0148_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0132_F03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0140_C12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0140_F06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0024_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0106_E05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0099_C09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0101_E05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0021_A08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0128_G08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0120_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0028_G05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0060_C11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0044_H10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0026_D07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0060_G12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0105_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0011_E06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0135_B04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0080_E02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0064_A08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0139_E01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0090_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0034_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0014_C12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0088_A03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0106_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0064_G04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0062_E07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0095_A12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0150_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0122_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0141_H07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0040_B05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0052_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0025_C06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0067_H07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0082_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0013_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0130_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0099_A06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0036_C05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0037_B04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0132_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0070_G03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0111_H01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0100_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0044_C08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0133_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0075_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0027_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0088_G06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0048_A11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0046_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0004_D05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0103_C12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0035_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0076_B06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0095_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0013_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0095_H06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0016_G09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0019_D11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0025_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0028_H02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0085_H01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0054_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0051_A01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0014_G11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0134_G05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0034_E03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0084_E09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0061_C12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0149_F10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0039_D07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0034_F10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0051_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0039_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0022_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0015_E12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0041_B02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0075_F07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0020_H06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0074_H09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0014_A01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0037_H11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0066_D08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0038_C06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0034_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0060_G03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0062_H04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0096_A11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0075_C10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0025_E08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0004_G05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0054_G01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0053_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0073_B07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0094_C01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0027_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0017_E05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0063_D12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0045_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0073_A06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0061_H05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0089_D09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0062_D02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0043_E02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0059_H04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0043_G10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0067_A10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0037_H08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0084_G04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0071_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0014_H06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0006_A07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0055_D08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0004_H12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0042_F11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0016_H08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0081_G11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0015_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0040_B10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
BFLT1_0007_D04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0024_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0007_C02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0028_F01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0056_D12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0131_B02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0104_G12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0042_B11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0068_B12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCACCACATTTAGCTG
CBLT1_0054_F08.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0085_H05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0064_C09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0047_B04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0068_D07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0053_G06.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0026_F11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0049_A09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0080_H12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0104_F09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0071_A04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0034_F11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0146_C12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0136_G04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0120_B01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCATCAGATTTAGCTG
CBLT1_0006_H07.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0036_D12.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0133_G04.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0036_E11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0062_A01.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0085_D02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
HTMT1_0063_E09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0024_D10.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0024_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0069_G11.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0075_E09.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0052_G05.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0074_H03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0052_H03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0052_H02.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0042_B03.b : TCGCACACCTCCCCCATCTCAAGGGAAGGGGCGAGGACTGTCCCTCAGCAGATTTAGCTG
CBLT1_0075_G03.b :
HTMT1_0086_E02.b :
20110601C-000217 : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
---------+---------+---------+---------+---------+---------+ 534
CBLT1_0023_A08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0050_B08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0068_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0077_C07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0126_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0038_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0038_D01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0055_F02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0079_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0145_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0042_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0012_E08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0012_F03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0006_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0003_B02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0005_F06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0111_E01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0037_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0035_E04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0040_F03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0027_C08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0012_H10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0011_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0093_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0144_G09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0068_C08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0109_F08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0038_E04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0089_E09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0014_H01.b : GGGCGCCTAGGGCCATAATCCGGGATTCTGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0087_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0078_G12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0050_A03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0086_E03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0028_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0042_F09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0109_A05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0006_E11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0134_F06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0042_E07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0134_C07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0072_C10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
ILNT1_0001_B08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0078_C11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0061_E10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0002_C03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0025_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0002_F07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0128_H06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0064_A02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0073_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0138_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0025_F09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0105_A01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0120_E04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0010_E11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0039_B10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0117_G02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0107_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0106_C10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0104_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0106_A11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0137_G02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0057_G09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0047_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0056_D12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0047_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0044_G09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0141_E10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0149_G10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0055_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0021_D08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0099_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0121_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0151_F05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0011_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0010_H05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0025_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0021_A06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0095_B10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0021_G07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0086_H08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0037_B06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0013_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0065_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0028_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0037_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0118_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0117_E09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0046_C06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0028_G06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0111_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0092_C07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0013_D07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0076_G10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0098_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0064_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0133_A12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0048_C02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
ILNT1_0002_G10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0094_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0046_G11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0034_A11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0083_G02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0042_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0056_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0087_A03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0060_E10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0044_D03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0016_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0061_H06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0139_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0053_F07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0034_F12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0076_H02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0067_B02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0007_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0041_C07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0036_E07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0010_C06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0126_H07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0113_A02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0120_A12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0024_B08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0118_H02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0045_F04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0053_C11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0042_E11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0067_E11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0074_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0136_H12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0126_E03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0147_C10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0041_H02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0117_D03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0034_B04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0077_E12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0118_F12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0066_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0073_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0072_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0041_A02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0005_E10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0111_A02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0076_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0122_D09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0009_G11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0093_H12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0060_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0034_H05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0059_D04.b : GGGCGCCGAGGGGCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0068_G08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0115_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0058_C04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0073_F08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0013_A02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0067_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0119_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0023_G10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0127_H12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0111_F07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0105_F06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0117_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0073_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0119_D08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0126_F11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0128_E02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0050_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0035_H01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0035_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0096_H03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0140_H10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0038_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0132_F08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0016_D05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0097_G08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0041_C10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0121_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0113_B09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0077_E08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0041_D07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0148_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0132_F03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0140_C12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0140_F06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0024_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0106_E05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0099_C09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0101_E05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0021_A08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0128_G08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0120_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0028_G05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0060_C11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0044_H10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0026_D07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0060_G12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0105_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0011_E06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0135_B04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0080_E02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0064_A08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0139_E01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0090_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0034_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0014_C12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0088_A03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0106_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0064_G04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0062_E07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0095_A12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0150_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0122_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0141_H07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0040_B05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0052_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0025_C06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0067_H07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0082_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0013_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0130_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0099_A06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0036_C05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0037_B04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0132_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0070_G03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0111_H01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0100_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0044_C08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0133_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0075_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0027_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0088_G06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0048_A11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0046_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0004_D05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0103_C12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0035_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0076_B06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0095_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0013_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0095_H06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0016_G09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0019_D11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0025_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0028_H02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0085_H01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0054_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0051_A01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0014_G11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0134_G05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0034_E03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0084_E09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0061_C12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0149_F10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0039_D07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0034_F10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0051_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0039_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0022_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0015_E12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0041_B02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0075_F07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0020_H06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0074_H09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0014_A01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0037_H11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0066_D08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0038_C06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0034_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0060_G03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0062_H04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0096_A11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0075_C10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0025_E08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0004_G05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0054_G01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0053_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0073_B07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0094_C01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0027_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0017_E05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0063_D12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0045_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0073_A06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0061_H05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0089_D09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0062_D02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0043_E02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0059_H04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0043_G10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0067_A10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0037_H08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0084_G04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0071_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0014_H06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0006_A07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0055_D08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0004_H12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0042_F11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0016_H08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0081_G11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0015_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0040_B10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
BFLT1_0007_D04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0024_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0007_C02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0028_F01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0056_D12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0131_B02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0104_G12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0042_B11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0068_B12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0054_F08.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0085_H05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0064_C09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0047_B04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0068_D07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0053_G06.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0026_F11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0049_A09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0080_H12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0104_F09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0071_A04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0034_F11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0146_C12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0136_G04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0120_B01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0006_H07.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0036_D12.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0133_G04.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0036_E11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0062_A01.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0085_D02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
HTMT1_0063_E09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0024_D10.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0024_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0069_G11.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0075_E09.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0052_G05.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0074_H03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0052_H03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0052_H02.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0042_B03.b : GGGCGCCGAGGGCCAGAAGCCGGGATTCGGCTACGGAGGCAGAGCTCCTGACTACAAACC
CBLT1_0075_G03.b : tttttggcaggtagaxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_E02.b : ttttaggatggt
20110601C-000217 : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
---------+---------+---------+---------+---------+---------+ 593
CBLT1_0023_A08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0050_B08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0068_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTNC
CBLT1_0077_C07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0126_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0038_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0038_D01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0055_F02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0079_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0145_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0042_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0012_E08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0012_F03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0006_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0003_B02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0005_F06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0111_E01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0037_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0035_E04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0040_F03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0027_C08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0012_H10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0011_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0093_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0144_G09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0068_C08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0109_F08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0038_E04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0089_E09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0014_H01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGAGCACACTTTCCAAAATCTTCA
HTMT1_0087_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0078_G12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0050_A03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0086_E03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0028_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0042_F09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0109_A05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0006_E11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0134_F06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0042_E07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0134_C07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0072_C10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
ILNT1_0001_B08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0078_C11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0061_E10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0002_C03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0025_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0002_F07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0128_H06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0064_A02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0073_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0138_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0025_F09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0105_A01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0120_E04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0010_E11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0039_B10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0117_G02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0107_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0106_C10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0104_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0106_A11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0137_G02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0057_G09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0047_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0056_D12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0047_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0044_G09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0141_E10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0149_G10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0055_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0021_D08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0099_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0121_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0151_F05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0011_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0010_H05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0025_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0021_A06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0095_B10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0021_G07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0086_H08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0037_B06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0013_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0065_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0028_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0037_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0118_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0117_E09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0046_C06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0028_G06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0111_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0092_C07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0013_D07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0076_G10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0098_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0064_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0133_A12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0048_C02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
ILNT1_0002_G10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0094_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0046_G11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0034_A11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0083_G02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0042_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0056_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0087_A03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0060_E10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0044_D03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0016_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0061_H06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0139_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0053_F07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0034_F12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0076_H02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0067_B02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0007_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0041_C07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0036_E07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0010_C06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0126_H07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0113_A02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0120_A12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0024_B08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0118_H02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0045_F04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0053_C11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0042_E11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0067_E11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0074_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0136_H12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0126_E03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0147_C10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0041_H02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0117_D03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0034_B04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0077_E12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0118_F12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0066_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0073_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0072_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0041_A02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0005_E10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0111_A02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0076_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTNC
HTMT1_0122_D09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0009_G11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0093_H12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0060_B12.b : GGCTCANCAGGGAACTCAGGGGGNCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTTC
CBLT1_0034_H05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTTCAAAATCTTCA
HTMT1_0059_D04.b : GGCTCACAAGGGA*CTNCAGGGGGCCCCAGACGCCCAGGGCACACTTTCCAAAATCTTTC
CBLT1_0068_G08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0115_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0058_C04.b : GGCTCACAGGGGA*CTCAAGGGGGCCCNAGACGCCCAGGGCACACTTTCCAAAATCTTTC
CBLT1_0073_F08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0013_A02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0067_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0119_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0023_G10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0127_H12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0111_F07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0105_F06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0117_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0073_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0119_D08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0126_F11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0128_E02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0050_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0035_H01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0035_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0096_H03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0140_H10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0038_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0132_F08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0016_D05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0097_G08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0041_C10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0121_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0113_B09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0077_E08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0041_D07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0148_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0132_F03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0140_C12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0140_F06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0024_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0106_E05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0099_C09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0101_E05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0021_A08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0128_G08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0120_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0028_G05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0060_C11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0044_H10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0026_D07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0060_G12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0105_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0011_E06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0135_B04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0080_E02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0064_A08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0139_E01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0090_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0034_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0014_C12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0088_A03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0106_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0064_G04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0062_E07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0095_A12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0150_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0122_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0141_H07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0040_B05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0052_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0025_C06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0067_H07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0082_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0013_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0130_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0099_A06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0036_C05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0037_B04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0132_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0070_G03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0111_H01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0100_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0044_C08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0133_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0075_B12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0027_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0088_G06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0048_A11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0046_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0004_D05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0103_C12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0035_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0076_B06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0095_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0013_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0095_H06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0016_G09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0019_D11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0025_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0028_H02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0085_H01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0054_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0051_A01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0014_G11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0134_G05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0034_E03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0084_E09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0061_C12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0149_F10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0039_D07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0034_F10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0051_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0039_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0022_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0015_E12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0041_B02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0075_F07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0020_H06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0074_H09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0014_A01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0037_H11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0066_D08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0038_C06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0034_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0060_G03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0062_H04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0096_A11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0075_C10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0025_E08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0004_G05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0054_G01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0053_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0073_B07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0094_C01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0027_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0017_E05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0063_D12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0045_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0073_A06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0061_H05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0089_D09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0062_D02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0043_E02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0059_H04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0043_G10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0067_A10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0037_H08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0084_G04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0071_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0014_H06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0006_A07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0055_D08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0004_H12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0042_F11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0016_H08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0081_G11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0015_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0040_B10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
BFLT1_0007_D04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0024_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0007_C02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0028_F01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0056_D12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0131_B02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0104_G12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0042_B11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0068_B12.b : GGCTCACAAGGGA*CTCCAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0054_F08.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0085_H05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0064_C09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0047_B04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0068_D07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0053_G06.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0026_F11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0049_A09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0080_H12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0104_F09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0071_A04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0034_F11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0146_C12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0136_G04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0120_B01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0006_H07.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0036_D12.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0133_G04.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0036_E11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0062_A01.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0085_D02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0063_E09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0024_D10.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0024_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0069_G11.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0075_E09.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0052_G05.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0074_H03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0052_H03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0052_H02.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0042_B03.b : GGCTCACAAGGGA*CTCAAGGGGGCCCAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
CBLT1_0075_G03.b : xxxxxxxxxxxxxxxxxxxxxxaaacaAGGACGCCCAGGGCACACTTTCCAAAATCTTCA
HTMT1_0086_E02.b : acgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtccAAATCTTCA
20110601C-000217 : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
---------+---------+---------+---------+---------+---------+ 652
CBLT1_0023_A08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0050_B08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0068_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0077_C07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0126_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0038_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0038_D01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0055_F02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0079_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0145_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0042_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0012_E08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0012_F03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0006_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0003_B02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0005_F06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0111_E01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0037_B01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0035_E04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0040_F03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0027_C08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0012_H10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0011_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0093_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0144_G09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0068_C08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0109_F08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0038_E04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0089_E09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0014_H01.b : AGCTGGGAGGACAGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0087_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0078_G12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0050_A03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0086_E03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0028_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0042_F09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0109_A05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0006_E11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0134_F06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0042_E07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0134_C07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0072_C10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
ILNT1_0001_B08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0078_C11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0061_E10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0002_C03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0025_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0002_F07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0128_H06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0064_A02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0073_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0138_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0025_F09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0105_A01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0120_E04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0010_E11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0039_B10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0117_G02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0107_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0106_C10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0104_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0106_A11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0137_G02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0057_G09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0047_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0056_D12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0047_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0044_G09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0141_E10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0149_G10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0055_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0021_D08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0099_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0121_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0151_F05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0011_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0010_H05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0025_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0021_A06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0095_B10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0021_G07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0086_H08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0037_B06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0013_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0065_B01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0028_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0037_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0118_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0117_E09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0046_C06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0028_G06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0111_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0092_C07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0013_D07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0076_G10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0098_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0064_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0133_A12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0048_C02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
ILNT1_0002_G10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0094_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0046_G11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0034_A11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0083_G02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0042_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0056_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0087_A03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0060_E10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0044_D03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0016_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0061_H06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0139_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0053_F07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0034_F12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0076_H02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0067_B02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0007_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0041_C07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0036_E07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0010_C06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0126_H07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0113_A02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0120_A12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0024_B08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0118_H02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0045_F04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0053_C11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0042_E11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0067_E11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0074_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0136_H12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0126_E03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0147_C10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0041_H02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0117_D03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0034_B04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0077_E12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0118_F12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0066_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0073_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0072_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0041_A02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0005_E10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0111_A02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0076_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0122_D09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0009_G11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0093_H12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0060_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGNTCCCCATGGNCAGACGTTGACGCTCCTTC
CBLT1_0034_H05.b : GGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0059_D04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0068_G08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0115_B01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0058_C04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGGTCCCCATGGNCAGACNGTGACGCTCCTTC
CBLT1_0073_F08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0013_A02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0067_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0119_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0023_G10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0127_H12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0111_F07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0105_F06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0117_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0073_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0119_D08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0126_F11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0128_E02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0050_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0035_H01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0035_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0096_H03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0140_H10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0038_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0132_F08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0016_D05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0097_G08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0041_C10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0121_B01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0113_B09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0077_E08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0041_D07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0148_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0132_F03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0140_C12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0140_F06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0024_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0106_E05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0099_C09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0101_E05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0021_A08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0128_G08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0120_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0028_G05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0060_C11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0044_H10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0026_D07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0060_G12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0105_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0011_E06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0135_B04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0080_E02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0064_A08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0139_E01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0090_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0034_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0014_C12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0088_A03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0106_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0064_G04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0062_E07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0095_A12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0150_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0122_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0141_H07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0040_B05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0052_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0025_C06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0067_H07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0082_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0013_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0130_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0099_A06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0036_C05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0037_B04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0132_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0070_G03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0111_H01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0100_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0044_C08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0133_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0075_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0027_B01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0088_G06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0048_A11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0046_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0004_D05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0103_C12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0035_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0076_B06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0095_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0013_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0095_H06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0016_G09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0019_D11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0025_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0028_H02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0085_H01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0054_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0051_A01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0014_G11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0134_G05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0034_E03.b : AGCTGGGAGGACGGGACAG*CCGTTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0084_E09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0061_C12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0149_F10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0039_D07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0034_F10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0051_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0039_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0022_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0015_E12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0041_B02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0075_F07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0020_H06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0074_H09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0014_A01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0037_H11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0066_D08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0038_C06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0034_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0060_G03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0062_H04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0096_A11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0075_C10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0025_E08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0004_G05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0054_G01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0053_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0073_B07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0094_C01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0027_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0017_E05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0063_D12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0045_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0073_A06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0061_H05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0089_D09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0062_D02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0043_E02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0059_H04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0043_G10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0067_A10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0037_H08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0084_G04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0071_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0014_H06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0006_A07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0055_D08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0004_H12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0042_F11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0016_H08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0081_G11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0015_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0040_B10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
BFLT1_0007_D04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0024_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0007_C02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0028_F01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0056_D12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0131_B02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0104_G12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0042_B11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0068_B12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0054_F08.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0085_H05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0064_C09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0047_B04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0068_D07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0053_G06.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0026_F11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0049_A09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0080_H12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0104_F09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0071_A04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0034_F11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0146_C12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0136_G04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0120_B01.b : AGCTGGGAGGACGGGACAGCCCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0006_H07.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0036_D12.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0133_G04.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0036_E11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0062_A01.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0085_D02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0063_E09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0024_D10.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0024_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0069_G11.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0075_E09.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0052_G05.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0074_H03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0052_H03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0052_H02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0042_B03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
CBLT1_0075_G03.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
HTMT1_0086_E02.b : AGCTGGGAGGACGGGACAG*CCGCTCCGGGTCCCCCATGGCCAGACGTTGACGCTCCTTC
20110601C-000217 : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
---------+---------+---------+---------+---------+---------+ 712
CBLT1_0023_A08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0050_B08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0068_D11.b : CTCTCAGGATCCTTCCCGGCTTTCTACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0077_C07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0126_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0038_C01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0038_D01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0055_F02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0079_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0145_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0042_C01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0012_E08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0012_F03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0006_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0003_B02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0005_F06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0111_E01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0037_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0035_E04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0040_F03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0027_C08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0012_H10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0011_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0093_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0144_G09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0068_C08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0109_F08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0038_E04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0089_E09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0014_H01.b : CTCTCACGATCCTTCCCGGCTTCTAACACGTTGACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0087_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0078_G12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0050_A03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0086_E03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0028_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0042_F09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0109_A05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0006_E11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0134_F06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0042_E07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0134_C07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0072_C10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
ILNT1_0001_B08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0078_C11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0061_E10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0002_C03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0025_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0002_F07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0128_H06.b : CTCTCAGGATCCTTCCCGGCTTTCTACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0064_A02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0073_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0138_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0025_F09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0105_A01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0120_E04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0010_E11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0039_B10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0117_G02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0107_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0106_C10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0104_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0106_A11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0137_G02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0057_G09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0047_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0056_D12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0047_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0044_G09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0141_E10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0149_G10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0055_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0021_D08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0099_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0121_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0151_F05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0011_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0010_H05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0025_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0021_A06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0095_B10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0021_G07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0086_H08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0037_B06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0013_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0065_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0028_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0037_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0118_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0117_E09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0046_C06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0028_G06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0111_D11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0092_C07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0013_D07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0076_G10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0098_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0064_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0133_A12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0048_C02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
ILNT1_0002_G10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0094_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0046_G11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0034_A11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0083_G02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0042_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0056_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0087_A03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0060_E10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0044_D03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0016_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0061_H06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0139_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0053_F07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0034_F12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0076_H02.b : CTCTCAAGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0067_B02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0007_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0041_C07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0036_E07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0010_C06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0126_H07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0113_A02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0120_A12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0024_B08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0118_H02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0045_F04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0053_C11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0042_E11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0067_E11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0074_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0136_H12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0126_E03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0147_C10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0041_H02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0117_D03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0034_B04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0077_E12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0118_F12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0066_C01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0073_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0072_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0041_A02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0005_E10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0111_A02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0076_C01.b : CTCTCANGGATCTTCCCGGCTTTCTACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0122_D09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0009_G11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0093_H12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0060_B12.b : CTCTCAGGATCTTNCCCGGGGCTCTACACGTTTACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0034_H05.b : CTCTCAGGATCCTTCCCGGCTTTCAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0059_D04.b : CTCTCANGGATCTTTCCGGGGCTCTACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0068_G08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0115_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0058_C04.b : CTCTCAGGGATCTTNCCGGCNTTCTACACGNTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0073_F08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0013_A02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0067_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0119_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0023_G10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0127_H12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0111_F07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0105_F06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0117_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0073_B11.b : CTCTCAGGATCCTTCCCGGCTTTCTACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0119_D08.b : CTCTCATGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0126_F11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0128_E02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0050_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0035_H01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0035_D11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0096_H03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0140_H10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0038_D11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0132_F08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0016_D05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0097_G08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0041_C10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0121_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0113_B09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0077_E08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0041_D07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0148_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0132_F03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0140_C12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0140_F06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0024_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0106_E05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0099_C09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0101_E05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0021_A08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0128_G08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0120_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0028_G05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0060_C11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0044_H10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0026_D07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0060_G12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0105_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0011_E06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0135_B04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0080_E02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0064_A08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0139_E01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0090_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0034_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0014_C12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0088_A03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0106_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0064_G04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0062_E07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0095_A12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0150_D11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0122_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0141_H07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0040_B05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0052_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0025_C06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0067_H07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0082_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0013_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0130_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0099_A06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0036_C05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0037_B04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0132_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0070_G03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0111_H01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0100_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0044_C08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0133_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0075_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0027_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0088_G06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0048_A11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0046_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0004_D05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0103_C12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0035_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0076_B06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0095_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0013_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0095_H06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0016_G09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0019_D11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0025_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0028_H02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0085_H01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0054_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0051_A01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0014_G11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0134_G05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0034_E03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0084_E09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0061_C12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0149_F10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0039_D07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0034_F10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0051_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0039_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0022_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0015_E12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0041_B02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0075_F07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0020_H06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0074_H09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0014_A01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0037_H11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0066_D08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0038_C06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0034_C01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0060_G03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0062_H04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0096_A11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0075_C10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0025_E08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0004_G05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0054_G01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0053_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0073_B07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0094_C01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0027_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0017_E05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0063_D12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0045_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0073_A06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0061_H05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0089_D09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0062_D02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0043_E02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0059_H04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0043_G10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0067_A10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0037_H08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0084_G04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0071_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0014_H06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0006_A07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0055_D08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0004_H12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0042_F11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0016_H08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0081_G11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0015_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0040_B10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
BFLT1_0007_D04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0024_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0007_C02.b : CTCTCAAGATCCTTCCGGGCTTCTAACACGTTAACCGCGTAGAATCCCTAGTATAGCTCG
CBLT1_0028_F01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0056_D12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0131_B02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0104_G12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0042_B11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0068_B12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0054_F08.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0085_H05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0064_C09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0047_B04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0068_D07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0053_G06.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0026_F11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0049_A09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0080_H12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0104_F09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0071_A04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0034_F11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0146_C12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0136_G04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0120_B01.b : CTCTCAGGATCCTTCCCGGCTTCTAACCCGTTTACCGCGTAAATTCCCTAGTATATGACG
CBLT1_0006_H07.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0036_D12.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0133_G04.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0036_E11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0062_A01.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0085_D02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAAATTCCCTAGTATAGCAAG
HTMT1_0063_E09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0024_D10.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0024_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0069_G11.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0075_E09.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0052_G05.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0074_H03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0052_H03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0052_H02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0042_B03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
CBLT1_0075_G03.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
HTMT1_0086_E02.b : CTCTCAGGATCCTTCCCGGCTTCTAACACGTTAACCGCGTAGATTCCCTAGTATAGCACG
20110601C-000217 : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
---------+---------+---------+---------+---------+---------+ 771
CBLT1_0023_A08.b : TGCCCCCTACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0050_B08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0068_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0077_C07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0126_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0038_C01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0038_D01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0055_F02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0079_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0145_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0042_C01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0012_E08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0012_F03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0006_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0003_B02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0005_F06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0111_E01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0037_B01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0035_E04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0040_F03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0027_C08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0012_H10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0011_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0093_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAAGAAACGCTCCACCG
HTMT1_0144_G09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0068_C08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0109_F08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0038_E04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0089_E09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0014_H01.b : TGCCCCTAACGCCTGGTGACGACGCCCATCG*GGCTCCACTCGGAGGAGACGCTCCATCG
HTMT1_0087_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0078_G12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0050_A03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0086_E03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0028_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0042_F09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0109_A05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0006_E11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0134_F06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0042_E07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0134_C07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0072_C10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
ILNT1_0001_B08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0078_C11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0061_E10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0002_C03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0025_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0002_F07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0128_H06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCCACG
HTMT1_0064_A02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0073_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCCACTCGAGGAAACGCTCCACCG
HTMT1_0138_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0025_F09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0105_A01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0120_E04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0010_E11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0039_B10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0117_G02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCCCTCGGAGGAAACGCTCCACCG
HTMT1_0107_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0106_C10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0104_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0106_A11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAATGCTCCACCG
HTMT1_0137_G02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0057_G09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0047_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0056_D12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0047_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0044_G09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0141_E10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0149_G10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0055_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0021_D08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0099_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0121_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0151_F05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0011_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0010_H05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0025_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0021_A06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0095_B10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0021_G07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0086_H08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0037_B06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0013_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0065_B01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0028_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0037_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0118_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0117_E09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0046_C06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0028_G06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0111_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0092_C07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0013_D07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0076_G10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0098_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0064_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0133_A12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0048_C02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
ILNT1_0002_G10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0094_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0046_G11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0034_A11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0083_G02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0042_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0056_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0087_A03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0060_E10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0044_D03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0016_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0061_H06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0139_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0053_F07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0034_F12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0076_H02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCAAAGGAA*CGCTCCCCCG
CBLT1_0067_B02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0007_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0041_C07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAAGAAACGCTCCACCG
HTMT1_0036_E07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0010_C06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0126_H07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0113_A02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0120_A12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCNACG
CBLT1_0024_B08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0118_H02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0045_F04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0053_C11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0042_E11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0067_E11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAAACGCTCACCG
CBLT1_0074_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0136_H12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0126_E03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0147_C10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0041_H02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0117_D03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0034_B04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0077_E12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0118_F12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0066_C01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0073_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0072_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0041_A02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0005_E10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0111_A02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0076_C01.b : TGCCCCCTACGCCTGGTGACGACGCCNAGCG*GGCTCCACTCGGAAGAAACGCTCCCACG
HTMT1_0122_D09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCCACG
CBLT1_0009_G11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0093_H12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0060_B12.b : TGCCCCCTACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGAAGGAAACGCTCCCACG
CBLT1_0034_H05.b : TGCCCCTAACGCCTGGTGACAACGCCCAGCGGGGCTCCACTCGGAAGGAACCCTCCACCG
HTMT1_0059_D04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCNNTCACG
CBLT1_0068_G08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCCACG
HTMT1_0115_B01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0058_C04.b : TGCCCCTAAACGCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAAGAAACGCTCCCACG
CBLT1_0073_F08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0013_A02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0067_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCCACG
HTMT1_0119_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0023_G10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCNACG
HTMT1_0127_H12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0111_F07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0105_F06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0117_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0073_B11.b : TGCCCCCTACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0119_D08.b : TGCCCCTAACGCCTGGTGACGACACCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0126_F11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCCACG
HTMT1_0128_E02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0050_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0035_H01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0035_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0096_H03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0140_H10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0038_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0132_F08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0016_D05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0097_G08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0041_C10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0121_B01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0113_B09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0077_E08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0041_D07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0148_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0132_F03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0140_C12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0140_F06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0024_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0106_E05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0099_C09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0101_E05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0021_A08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0128_G08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0120_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0028_G05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0060_C11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACNTGCGAGGAACGCTCCACCG
HTMT1_0044_H10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0026_D07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0060_G12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0105_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0011_E06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0135_B04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0080_E02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0064_A08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0139_E01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0090_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0034_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0014_C12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0088_A03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0106_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0064_G04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0062_E07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0095_A12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0150_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0122_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0141_H07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0040_B05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0052_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0025_C06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0067_H07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0082_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0013_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0130_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0099_A06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0036_C05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0037_B04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0132_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCCCTCAGAGGAAACGCTCCACCG
HTMT1_0070_G03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0111_H01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0100_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0044_C08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0133_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0075_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0027_B01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0088_G06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0048_A11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0046_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0004_D05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0103_C12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0035_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0076_B06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0095_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0013_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0095_H06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0016_G09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0019_D11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0025_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0028_H02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0085_H01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0054_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0051_A01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0014_G11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0134_G05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0034_E03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0084_E09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0061_C12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0149_F10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0039_D07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0034_F10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0051_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0039_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0022_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0015_E12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0041_B02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0075_F07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0020_H06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0074_H09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0014_A01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0037_H11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0066_D08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0038_C06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0034_C01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0060_G03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0062_H04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0096_A11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0075_C10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0025_E08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0004_G05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0054_G01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0053_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0073_B07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0094_C01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0027_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0017_E05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0063_D12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0045_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0073_A06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0061_H05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0089_D09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0062_D02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0043_E02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0059_H04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0043_G10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0067_A10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0037_H08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0084_G04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0071_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0014_H06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0006_A07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0055_D08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0004_H12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0042_F11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0016_H08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0081_G11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0015_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0040_B10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
BFLT1_0007_D04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0024_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0007_C02.b : TGCCCCTAACGCCTGGTGACGAacccagggggctccattcggaaggaaacgctccgctgt
CBLT1_0028_F01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0056_D12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCCACTCGAGGAAACGCTCCACCG
HTMT1_0131_B02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0104_G12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0042_B11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0068_B12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0054_F08.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0085_H05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0064_C09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0047_B04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0068_D07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0053_G06.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0026_F11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0049_A09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0080_H12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0104_F09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0071_A04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0034_F11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0146_C12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0136_G04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0120_B01.b : TGTCCCTAACGCCTGGTGACGACctccagtgggttccctccgaagaaaccctccaccgcc
CBLT1_0006_H07.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0036_D12.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0133_G04.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0036_E11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0062_A01.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0085_D02.b : GGCCCCTAACGCCTGGTGACGACGCCAAGCG*GGCTCCACTCGGAGGAAACGCCCCACCG
HTMT1_0063_E09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0024_D10.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0024_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0069_G11.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0075_E09.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0052_G05.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0074_H03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0052_H03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0052_H02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0042_B03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
CBLT1_0075_G03.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
HTMT1_0086_E02.b : TGCCCCTAACGCCTGGTGACGACGCCCAGCG*GGCTCCACTCGGAGGAAACGCTCCACCG
20110601C-000217 : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
---------+---------+---------+---------+---------+---------+ 828
CBLT1_0023_A08.b : TCGCCCTACCTCGGAGACAGT*GACATCCCCCTTCCCGCTCGCCTTCATCCT*GAGATGG
HTMT1_0050_B08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCAATCT*GAGATGG
CBLT1_0068_D11.b : TCGCCCCTACTCGGAAGACGG*TGAAATCCCCTTCCCGCTCGCCCTTATCCT*GAGAAGG
CBLT1_0077_C07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0126_A09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0038_C01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0038_D01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0055_F02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0079_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCAT*GAGATGG
HTMT1_0145_A10.b : TCGCCCTACCTCGGAGACAGT*GNACATCCCCT*CCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0042_C01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0012_E08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0012_F03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0006_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0003_B02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0005_F06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0111_E01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0037_B01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0035_E04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0040_F03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0027_C08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0012_H10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0011_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0093_A09.b : TCGCCCTACCTCGGAGACAGT*GACATCCCCTTCCCCGCTGGCCCTCATCCT*GAGATGG
HTMT1_0144_G09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0068_C08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGGCCTCATCCT*GAGATGG
HTMT1_0109_F08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0038_E04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0089_E09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0014_H01.b : TCGACCTACCTCGGAGATAGT*GACA*TCACCTCCCCGCTCGCCCTCATCAT*GAGATGA
HTMT1_0087_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0078_G12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0050_A03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0086_E03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0028_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0042_F09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0109_A05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0006_E11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0134_F06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0042_E07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0134_C07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0072_C10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
ILNT1_0001_B08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0078_C11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0061_E10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0002_C03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0025_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0002_F07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0128_H06.b : TCGCCCCTACTCGGAGACAGT*GACA*TCCCCCTCCCGCTCNGCCTCATCCT*GAGATGG
HTMT1_0064_A02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0073_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0138_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0025_F09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0105_A01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0120_E04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATTCT*GAGATGG
HTMT1_0010_E11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAAATGG
CBLT1_0039_B10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0117_G02.b : TCGCCCTACCTCGGAAACAGT*GACG*TCTCCTCCCCGCTCGCCCTCATCCT*GAAAAGG
HTMT1_0107_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0106_C10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCANTCT*GAGATGG
HTMT1_0104_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0106_A11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0137_G02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0057_G09.b : TCGCCCTACCTCGGAGACAGG*GAAATCCCCTTCCCGGGTCGGCCTCATCCT*GAGATGG
HTMT1_0047_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCC*CGCTCGCCCTCATCCT*GAGATGG
CBLT1_0056_D12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0047_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0044_G09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0141_E10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0149_G10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0055_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0021_D08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0099_B11.b : TCGCCCTACCTCGGAGACAGG*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0121_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0151_F05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0011_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0010_H05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0025_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0021_A06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCNNTCATCT*GAGATGG
HTMT1_0095_B10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0021_G07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCTTCCT*GAGATGG
HTMT1_0086_H08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0037_B06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0013_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0065_B01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0028_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0037_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0118_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCCTCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0117_E09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0046_C06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0028_G06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0111_D11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0092_C07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0013_D07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0076_G10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0098_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0064_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0133_A12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0048_C02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
ILNT1_0002_G10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0094_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0046_G11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0034_A11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0083_G02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0042_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0056_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0087_A03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0060_E10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0044_D03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0016_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0061_H06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0139_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCCTCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0053_F07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0034_F12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0076_H02.b : TCCCCCTACCTCGGAGACAGT*GAAA*TCCCCTCCCCGCTCGGCCTCATCAT*GAGATGG
CBLT1_0067_B02.b : TCGCCCTACCTCGGAGACAGT*GACATCCCCTTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0007_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0041_C07.b : TCGCCCTACCTCGGAGACAGTGGACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0036_E07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0010_C06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0126_H07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0113_A02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0120_A12.b : TCGCCCTACCTCGGAGACAGT*GACA*NTCCCTCCCCGCTCGCCCNTCATCT*GAGATGG
CBLT1_0024_B08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0118_H02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0045_F04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0053_C11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0042_E11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0067_E11.b : TCGCCCTACTTCGGAGAC*GT*GACA*TCCCCTCCCCGCTGGC*CTTATCTT*GAGATGG
CBLT1_0074_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0136_H12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCNGCCTCATCCT*GAGATGG
HTMT1_0126_E03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0147_C10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0041_H02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0117_D03.b : TCGCCCTACCTCGGAAACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GGAATGG
HTMT1_0034_B04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0077_E12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0118_F12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0066_C01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0073_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0072_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0041_A02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0005_E10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0111_A02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0076_C01.b : TCGCCCTAACTCGGAGACGTG*GA***ATCCCCTCCCGGTCGCCCTCATCTT*GAGATGG
HTMT1_0122_D09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0009_G11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0093_H12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0060_B12.b : TCGCCCTACTTCGAAGACAGT*GACTTCCCtccccgcgcgctntatctgtgaagagnctc
CBLT1_0034_H05.b : TCGCCCTACCTCGGAAAAAGT*GAAA*TTCCCTTCCCGgttggccctattctgaaaaggg
HTMT1_0059_D04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCTTCCCCGNTCGGCCTCATCCT*GAGATGG
CBLT1_0068_G08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0115_B01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0058_C04.b : TCGCCCNTACTCGGAGNAAGT*GACA*TCCCCTCCCCGGTCGCCNNTCATCT*GAGATGG
CBLT1_0073_F08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0013_A02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGAAGG
CBLT1_0067_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTGGGCCTCATCCT*GAGATGG
HTMT1_0119_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0023_G10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0127_H12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0111_F07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0105_F06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0117_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0073_B11.b : TCGCCCCTACTCGGAGACAGT*GACNATCCCCTCCC*GCTCGCCCTCATTCT*GAGATGG
HTMT1_0119_D08.b : TCGCCCTACCTCGGAGACAGT*GACT*TCCCCTCCCCGCTCGCCCCTATCCT*GAAATGG
HTMT1_0126_F11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGNCCTCATCCT*GAGATGG
HTMT1_0128_E02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCANTCT*GAGATGG
CBLT1_0050_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0035_H01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAAATGG
HTMT1_0035_D11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0096_H03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0140_H10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0038_D11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0132_F08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0016_D05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0097_G08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCGGCTCGCCCTCATCCT*GAGATGG
CBLT1_0041_C10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0121_B01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0113_B09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0077_E08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0041_D07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0148_A09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0132_F03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0140_C12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0140_F06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0024_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0106_E05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0099_C09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0101_E05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0021_A08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0128_G08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0120_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCCTCCCGCTCNGCCTCATCCT*GAGATGG
HTMT1_0028_G05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0060_C11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCNNCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0044_H10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0026_D07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0060_G12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0105_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0011_E06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0135_B04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0080_E02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0064_A08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0139_E01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0090_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCCTCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0034_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0014_C12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0088_A03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0106_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0064_G04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCNTCATCCT*GAGATGG
HTMT1_0062_E07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0095_A12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0150_D11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0122_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0141_H07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0040_B05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0052_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0025_C06.b : TCGCCCTACCTCGAAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0067_H07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0082_A09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0013_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0130_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0099_A06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0036_C05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0037_B04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0132_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0070_G03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0111_H01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0100_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TNCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0044_C08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0133_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0075_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TNCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0027_B01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0088_G06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0048_A11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0046_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0004_D05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0103_C12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0035_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0076_B06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGAAGG
HTMT1_0095_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0013_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0095_H06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0016_G09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0019_D11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0025_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0028_H02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0085_H01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0054_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0051_A01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0014_G11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0134_G05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0034_E03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0084_E09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0061_C12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0149_F10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0039_D07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0034_F10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0051_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0039_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0022_F01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0015_E12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0041_B02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0075_F07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0020_H06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0074_H09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0014_A01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0037_H11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0066_D08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0038_C06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0034_C01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0060_G03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0062_H04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0096_A11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0075_C10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0025_E08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0004_G05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0054_G01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0053_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0073_B07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0094_C01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0027_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0017_E05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0063_D12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0045_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0073_A06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0061_H05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0089_D09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0062_D02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0043_E02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0059_H04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0043_G10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0067_A10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0037_H08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0084_G04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0071_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0014_H06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0006_A07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0055_D08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0004_H12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0042_F11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0016_H08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0081_G11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0015_A09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0040_B10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
BFLT1_0007_D04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0024_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0007_C02.b : cttccctacctggaagacagtgacagcgcaccccggtggcactcatcctgatatggcttc
CBLT1_0028_F01.b : TCGCCCTACCTCGGAGACAGT*GAAA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0056_D12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCCTCCCGCTCGCCNTCATCCT*GAGATGG
HTMT1_0131_B02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0104_G12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0042_B11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0068_B12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0054_F08.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0085_H05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0064_C09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0047_B04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0068_D07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0053_G06.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0026_F11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0049_A09.b : TCGCCCNTACTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCNTCATCCT*GAGATGG
CBLT1_0080_H12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0104_F09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0071_A04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0034_F11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0146_C12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0136_G04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0120_B01.b : gcctacctccgagacagggactcccctcccgcttctcctaatatgaaactggcttggggg
CBLT1_0006_H07.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0036_D12.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0133_G04.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0036_E11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGGCCTCATCCTTGAGATGG
CBLT1_0062_A01.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0085_D02.b : TCGCCttcctcggaaagagtgaaatcccctcccggttggcctattctggaaaaggttccg
HTMT1_0063_E09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0024_D10.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0024_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0069_G11.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0075_E09.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0052_G05.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0074_H03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0052_H03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0052_H02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0042_B03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
CBLT1_0075_G03.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
HTMT1_0086_E02.b : TCGCCCTACCTCGGAGACAGT*GACA*TCCCCTCCCCGCTCGCCCTCATCCT*GAGATGG
20110601C-000217 : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
---------+---------+---------+---------+---------+---------+ 882
CBLT1_0023_A08.b : *CTTCGGTGGGGGACACTGC*TGTGGGAAACATTGGCCGGGG*ACCCTGCTG*TGGGGTG
HTMT1_0050_B08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGG***ACTTGCCCGGG*GAACTGCTG*TG*GGTT
CBLT1_0068_D11.b : *CTTCGGTGGGGAAAactgctgtgggaactttcccggggaccttgctgttggtttggccc
CBLT1_0077_C07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0126_A09.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0038_C01.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0038_D01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CCTTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0055_F02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0079_B03.b : *CTTCGGTGGCGA*CACTGC*TGTGCGAA*CATTGCGGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0145_A10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGG*ACACTGCTG*TGGGTTG
CBLT1_0042_C01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0012_E08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0012_F03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0006_A04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0003_B02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0005_F06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAAACATTGC*GGGGG*ACACTGCTG*TGGGTTG
HTMT1_0111_E01.b : *CTTCGGGTGGGGACACTGC*TGTGGGAA*CATTGCGGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0037_B01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0035_E04.b : *GCTTCGGTGGGGACACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0040_F03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0027_C08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0012_H10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0011_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0093_A09.b : *CNTTCGGTGGGA*CCCTGC*TGTGGGAC*CATTGCCGGGGG*GACCTGCGG*TGGGGTT
HTMT1_0144_G09.b : *CTTCGGTGGGGA*CACTGC*TGGTGGAA*CATTGCCGGGGG*AACATGCTG*TGGGTTT
CBLT1_0068_C08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGACATTTGCGGGGGG*A*ACTGCTG*TGGGTTG
HTMT1_0109_F08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CTTGCCCGGGGG*A*ACTGCTG*TGGGTTG
CBLT1_0038_E04.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0089_E09.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCNGGGG*ACACTGCTG*TGGGTGG
HTMT1_0014_H01.b : *CTTCAGTGGGGA*CACTGC*TGTGGTAA*CATTGCCTGGGG*ACACTGCTG*TGTGTTG
HTMT1_0087_A04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0078_G12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0050_A03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
CBLT1_0086_E03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0028_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGGGACACTGCTG*TGGGTTG
HTMT1_0042_F09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0109_A05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0006_E11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0134_F06.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0042_E07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0134_C07.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0072_C10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
ILNT1_0001_B08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0078_C11.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0061_E10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0002_C03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0025_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0002_F07.b : *CTTCGGTGGGGA*AACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0128_H06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGC*GGGGG*ACACTGCTG*TGGGTTG
HTMT1_0064_A02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0073_C05.b : *CCTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGG*TG
HTMT1_0138_A04.b : *CTTCNGTGGGGA*CACTGC*TGTGGGA**CATTGCCGGGGG*AC*CTGCTG*TGGGTTG
HTMT1_0025_F09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0105_A01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0120_E04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGGGACACTGCTG*TGGGGTG
HTMT1_0010_E11.b : *CTTCGGTGGGGA*CACTGC*TGTGAGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTT
CBLT1_0039_B10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0117_G02.b : *CTTCAGGGGGGA*AACTGC*TGT*GGAA*ACTTGCCGGGGG*AAACTGTTG*TGGGTTG
HTMT1_0107_A07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGG*G*ACACTGCTG*TGGGTTG
HTMT1_0106_C10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGG*TG
HTMT1_0104_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA**CATGCCGGGAG*ACACTGCTG*TGGGTTG
HTMT1_0106_A11.b : *CTTCNNGTGGGGACACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0137_G02.b : *CTTCCGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0057_G09.b : *CTTCCGTGGGGA*CACTGC*TGGGGGAAAC*TTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0047_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGC*GGGGG*ACACTGCTG*TGGGTTG
CBLT1_0056_D12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0047_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0044_G09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0141_E10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGG*TG
HTMT1_0149_G10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0055_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0021_D08.b : *CTTCNGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0099_B11.b : *CTTCGGGGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGGGACACTGCTG*TGGGTTG
HTMT1_0121_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0151_F05.b : *CTTCGGTGGGGA*CACTGC*TGTGAGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0011_A04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0010_H05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0025_A07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCGGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0021_A06.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0095_B10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0021_G07.b : GCTTCGGTGGGGA*CACGGC*TGTGGGAA*AATTGCCGGGGGAACCCGGCTG*GGGGTTG
HTMT1_0086_H08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0037_B06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGGGACACTGCTG*TGGGTTG
HTMT1_0013_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0065_B01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0028_B11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0037_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCG*GGG*ACACTGCTG*TGGGTTG
HTMT1_0118_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0117_E09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0046_C06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
CBLT1_0028_G06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CCTTGCCCGGGGGACACTGCTG*TGGGTTG
HTMT1_0111_D11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0092_C07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0013_D07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0076_G10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0098_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACATTGCTG*TGGGTTG
HTMT1_0064_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0133_A12.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0048_C02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
ILNT1_0002_G10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0094_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0046_G11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0034_A11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0083_G02.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0042_A07.b : *GCTCGGTGGGGA*CACTGC*TGTGGGAA*CATTNGCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0056_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0087_A03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0060_E10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TNGGTTG
CBLT1_0044_D03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0016_A07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0061_H06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACGGCTG*TGGGTTG
HTMT1_0139_A10.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0053_F07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0034_F12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0076_H02.b : *ATTCGGTGGGGA*AACTGC*TGGGGGGAATTTGCCCGGGGG*ACACTGgttgtgggttg
CBLT1_0067_B02.b : *GTTCGGGGGGGGAAACTGCCTGTGGGAACATTTGCGGGGGG*AAACTGCTG*TGGGTTG
HTMT1_0007_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0041_C07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0036_E07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0010_C06.b : *CTTCNGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0126_H07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0113_A02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0120_A12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGG*GG*ACACTGCTG*TGGGTT*
CBLT1_0024_B08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0118_H02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CAT*GCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0045_F04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0053_C11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0042_E11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0067_E11.b : *CCTCGGTTGGGA*CACTGC*TGTTGAAA*CATTGCGGGGGG*AC*CTGCTG*TGGGTTG
CBLT1_0074_F01.b : GCTTCGGTGGGGA*CACTGC*TGTGGGGAACATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0136_H12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTNGCCGGGG*ACACTGCTG*TGGGTTG
HTMT1_0126_E03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0147_C10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0041_H02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0117_D03.b : *CTTCGGGGGGGA*AACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCGG*TGGGGTG
HTMT1_0034_B04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0077_E12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*AAACTGCTGGTGGGTTG
HTMT1_0118_F12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0066_C01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0073_B12.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0072_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0041_A02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0005_E10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0111_A02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGC*GGGGG*ACACTGCTG*TGGGTTG
HTMT1_0076_C01.b : *CTTCGGTGGGGACctgctgtgggacatttgccgggggacctgctgttggttggcccctg
HTMT1_0122_D09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*ACATGGCGGGGG*ACCCTGCTG*TGGGTTG
CBLT1_0009_G11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0093_H12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0060_B12.b : gcgtgggacacgtggactcttcgggggggaaaaaacgctggtgccgccccccccccagaa
CBLT1_0034_H05.b : cttcggggggaacctggcgggggaactttgccggggggaccctgctgttggtttgccccg
HTMT1_0059_D04.b : *CTTTCGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*A*ACTGCTG*TGGGTgg
CBLT1_0068_G08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTGTGGGGTTG
HTMT1_0115_B01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0058_C04.b : *NCTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGG**ACACTGCTG*TGGGTTG
CBLT1_0073_F08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CAT*GCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0013_A02.b : *CTTCGGTGGGGA*CACTGG*CGTGGGAA*CATTGCCCGGGG*AACCTGCTG*TGGGTTG
CBLT1_0067_B11.b : *GCTCGGTGGGGG*AACTGC*TGTGGGGA*CATTGCCGGGGGGAAACTGCTG*TGGGTTG
HTMT1_0119_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCGGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0023_G10.b : *GCTCGGTGGGGA*CACTGC*TGTGGGAA*CATTTGCCGGGG*ACACTGCTG*TGGGTTG
HTMT1_0127_H12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0111_F07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0105_F06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0117_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CTTTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0073_B11.b : *CTTCGGTGGGGA*CCCTGC*TGTGGGAA**CATTGCGGGGG*ACACTGCTT*GTGGTTG
HTMT1_0119_D08.b : *CTTCAGTGGGGA*CACTGC*TGGTGGGAACATTGCCGGGGGGACACTGCTG*TGGGTTG
HTMT1_0126_F11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CA*TGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0128_E02.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0050_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0035_H01.b : *CTCCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*GGGGTTG
HTMT1_0035_D11.b : *CTTCGGTGGGGA*CACTGC*TGGGGGAA*CATTGCCGGGGG*ACACTGCTG*GGGGTTG
CBLT1_0096_H03.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0140_H10.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0038_D11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTACCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0132_F08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0016_D05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0097_G08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*AAACTGCTG*TGGGTTG
CBLT1_0041_C10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTACCGGGGG*ACACGGCTG*TGGGTTG
HTMT1_0121_B01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0113_B09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGGGACACTGCTG*TGGGTGG
HTMT1_0077_E08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGG**ACACTGCTG*TGGGTTG
CBLT1_0041_D07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0148_A09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGGGACACTGCTGTGGGGTTG
HTMT1_0132_F03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0140_C12.b : *CTTCCGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0140_F06.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0024_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGGGACACTGCTG*TGGGTTT
HTMT1_0106_E05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGG*TG
HTMT1_0099_C09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0101_E05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0021_A08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0128_G08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0120_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0028_G05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0060_C11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0044_H10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0026_D07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0060_G12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGGGACACTGCTG*TGGGTTG
HTMT1_0105_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGAG*ACACTGCTG*TGGGTTG
CBLT1_0011_E06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0135_B04.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0080_E02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0064_A08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0139_E01.b : *GCTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0090_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0034_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTGGTGGGTTG
CBLT1_0014_C12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0088_A03.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0106_B11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0064_G04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0062_E07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0095_A12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACCCTGCTG*TGGGTTG
HTMT1_0150_D11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0122_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0141_H07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGGGACACTGCTG*TGGGGTT
CBLT1_0040_B05.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0052_A10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0025_C06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CA*TGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0067_H07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
CBLT1_0082_A09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0013_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0130_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGGTG*TGGGTTG
HTMT1_0099_A06.b : CATTCGGTGGGGA*ACCTGC*TGTGGGAACATTGGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0036_C05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTACCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0037_B04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0132_A04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CTTTCCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0070_G03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0111_H01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0100_F01.b : *CTTCNGTGGGGA*CACTGC*TGTGGGGA*CATTTGCGGGG**ACACTGCTG*TGGGTTG
CBLT1_0044_C08.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0133_A10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0075_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0027_B01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0088_G06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0048_A11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0046_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTACCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0004_D05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0103_C12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0035_B11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0076_B06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CTTTGACGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0095_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0013_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0095_H06.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTNGCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0016_G09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0019_D11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0025_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*C*TTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0028_H02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0085_H01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCGGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0054_B11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*C*TTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0051_A01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0014_G11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0134_G05.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0034_E03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0084_E09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0061_C12.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0149_F10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0039_D07.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
CBLT1_0034_F10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGG*ACACTGCTG*TGGGTTG
HTMT1_0051_A10.b : *CTTTCGGTGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
CBLT1_0039_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0022_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACGGCTG*TGGGTTG
CBLT1_0015_E12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0041_B02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0075_F07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0020_H06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0074_H09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0014_A01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0037_H11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGNTG
HTMT1_0066_D08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0038_C06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0034_C01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0060_G03.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0062_H04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0096_A11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
CBLT1_0075_C10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCCGGGG*ACACTGCTG*TGGGTTG
CBLT1_0025_E08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0004_G05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0054_G01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0053_A07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0073_B07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0094_C01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0027_A10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0017_E05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0063_D12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TNGGGTG
HTMT1_0045_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0073_A06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0061_H05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0089_D09.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCCGGGG*ACACTGCTG*TGGGGTG
CBLT1_0062_D02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0043_E02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0059_H04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0043_G10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0067_A10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0037_H08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0084_G04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0071_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0014_H06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0006_A07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0055_D08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0004_H12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0042_F11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0016_H08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0081_G11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0015_A09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0040_B10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
BFLT1_0007_D04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGTGG
HTMT1_0024_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
CBLT1_0007_C02.b : cgaggggacactaccggggggaaaatggttggggaaactgcagtgcgatcgaccgagggg
CBLT1_0028_F01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCCGGGGG*ACACTGCTG*TGGGGTT
HTMT1_0056_D12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0131_B02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGC*GGGGG*ACACTGCTG*TGGGTTG
HTMT1_0104_G12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0042_B11.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0068_B12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0054_F08.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0085_H05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0064_C09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0047_B04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0068_D07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0053_G06.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0026_F11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0049_A09.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTTGCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0080_H12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0104_F09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGGA*CATTGCGGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0071_A04.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0034_F11.b : *CTTCGGTGGAGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0146_C12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0136_G04.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CAT*GCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0120_B01.b : gaaaatgctgggggaaatattgccggggaaactggctggggttgcccctggcgagcaata
CBLT1_0006_H07.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGGTG
HTMT1_0036_D12.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0133_G04.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0036_E11.b : *CTTCGGTGGGGA*AACTGCTTGTGGGAA*CATTGCCGGGGG*ACACTGCTG*GTGGTTG
CBLT1_0062_A01.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0085_D02.b : gggggaacctggtgggggaaaattggcgggggaaaactgccttgggttggcccgggaagg
HTMT1_0063_E09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0024_D10.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTGTGGGGTTG
CBLT1_0024_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0069_G11.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0075_E09.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0052_G05.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0074_H03.b : *CTTCNGTGGGGA*CACTGC*TGTGGGAAACATTGCCG*GGG*ACACTGCTG*TGGGGTG
CBLT1_0052_H03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0052_H02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0042_B03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
CBLT1_0075_G03.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
HTMT1_0086_E02.b : *CTTCGGTGGGGA*CACTGC*TGTGGGAA*CATTGCCGGGGG*ACACTGCTG*TGGGTTG
20110601C-000217 : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
---------+---------+---------+---------+---------+---------+ 938
CBLT1_0023_A08.b : GCCC*CTGCAGGGCATAAAAAGGG*TGTGGCC*CCAAGCTTCCTTTGGGTTCTTTCGGG*
HTMT1_0050_B08.b : GCCC*CTGCAGGGCATANAGATGG*TGTGGCT*CCA*GCTTCCTTTGGGTTCTTCGGGC*
CBLT1_0068_D11.b : ctgcaggccataaaaataggggggggccccactttcctttggtttcctttcgggcccccc
CBLT1_0077_C07.b : GGCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCA*GCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0126_A09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0038_C01.b : GCCC*GTGCAGGGCATAAAAATGG*TGTGGCC*TCAAGCTTCCTTTGG*TTCTTTCGTG*
HTMT1_0038_D01.b : GCCC*GTGCAGGGCATANAGAAGG*TGTGGCT*CCA*GCTTCCTTTGTTTCTTTTCGGG*
CBLT1_0055_F02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTTCTTCGTG*
HTMT1_0079_B03.b : G*CC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCCTTCTTTTGGTTCTTTCGTG*
HTMT1_0145_A10.b : G*CC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTCGTGC*
CBLT1_0042_C01.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0012_E08.b : GCCC*GTGCAGGGCATAAA*ATGG*TGTGGCT*CCAAGCTTCCTTTGGTTCCTTTCGGG*
HTMT1_0012_F03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCCTTCGTG*
HTMT1_0006_A04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0003_B02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0005_F06.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCTTTTGGTTTCTTT*GTG*
HTMT1_0111_E01.b : GCCC*GTGCAGGGCATAAAGATGG*GGTGGCT**CCAGCTTCTTTGGTTTTCTTCGTGC*
HTMT1_0037_B01.b : GCCC*GTGGCAGGGATAGAGATGG*TGGGGCT*CCCAGCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0035_E04.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0040_F03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNA**GCTCCTTTGGTTTCTTTCGTG*
HTMT1_0027_C08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNA**GCTTCCTTGGTTTCTTTCGTG*
HTMT1_0012_H10.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0011_B07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0093_A09.b : GGCCcgtggcaggcaaaaaaaatgtgtggcccccagccttccttggtttcctttggggcc
HTMT1_0144_G09.b : GCCCCGTGCAGGGCATAAAGATGT*GGTGGCT**CAAACTTCCTTTGtttctttcgtgcc
CBLT1_0068_C08.b : GGCC*GTGCAGGGCATAAAGATG**TGGGGCCTCCAAGTTCCTTTTGGTTTCTTTCGGG*
HTMT1_0109_F08.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCC*CCCAGCTTCCTTTGGTTTCTTCGGGC*
CBLT1_0038_E04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCCAGCTTCCCTTTGGTTCTTCT***G*
HTMT1_0089_E09.b : NCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTCCTTTTGGTTTC*TTCGTG*
HTMT1_0014_H01.b : GCCC*GTGCAGGGCATACAGATGG*TGTGGCA*TCGAGCTTCCTTTGTTTACTTCGGGC*
HTMT1_0087_A04.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGT*TCTTNCGTG*
CBLT1_0078_G12.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGCCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0050_A03.b : NCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTNCTTTCGTG*
CBLT1_0086_E03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCAAGCCTCCCTTTGGTTTCT*TCGTG*
HTMT1_0028_C05.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0042_F09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0109_A05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGC*TCAAGCNTCCTTTGGNTTCTTTCGTG*
HTMT1_0006_E11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0134_F06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTNCGTG*
CBLT1_0042_E07.b : GCCC*GTGCAGGCCATANAGATGG*TGTGGCT*CCAAGCTTCCCTTGGGTTCTTTCGTG*
HTMT1_0134_C07.b : GGCC*GTGCAGGNCATANAGATGG*TGTGGCTCCNAGCTTTCCTTTGGGTTCTT*CGTG*
CBLT1_0072_C10.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCTCCNNAGC*TCCTTTGGTTTTCTTCGTG*
ILNT1_0001_B08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0078_C11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0061_E10.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGGTTCTTTCGGG*
HTMT1_0002_C03.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0025_D10.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCCAGCTTCCTTTGTTTTCTTTCGTG*
HTMT1_0002_F07.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTT*GGTTTCTTTCGTG*
HTMT1_0128_H06.b : GCCC*GTGCAGGGC*TANAAATGG*TGTGGCT**CCAAGCTCCTTTGGTTTCTTTCGTG*
HTMT1_0064_A02.b : GCC**GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTTGTTTCTTTCGTG*
CBLT1_0073_C05.b : GCCC*GTGCAGGGCATA*AGATGG*TGTGGCTCCAGCTccttgggtttctttgtggctcc
HTMT1_0138_A04.b : GCCC*GTGCA*GGCATANAGATGG*TGTGGCTCCAGCTnctttggttncttcgtgctcct
HTMT1_0025_F09.b : GCCC*CGGGCAGGCATANAGATGG*TGTGGCT*CCAACCTTCCTTTGGTTTCTTTCGGC*
HTMT1_0105_A01.b : GCCC*GTGCAGGGCATAGAAATGG*TGTGGCT*CCAAGCTTCCTTGGGTTTCTTTGGGG*
HTMT1_0120_E04.b : GCCC*GTGCAAGGCAAAAAGATGG*GGTGGCT*CCCAGCTTTCTTTGGTTTCTTTCG*G*
HTMT1_0010_E11.b : GGCCCGTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCTTG*
CBLT1_0039_B10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0117_G02.b : GCCC*CCGCAGGGCATAAAAAGGG*TGGGGT**CCCTGCTTCCCTTTGTTTCTTTCGTG*
HTMT1_0107_A07.b : GCCC*GTGCAGGGCATAAAAATGG*TGTGGCT***CAAGCTTCTTTGGTTTCTTTCGGG*
HTMT1_0106_C10.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGC*TCAAGCTTCCTTGGGTT*CTTTCGTG*
HTMT1_0104_B07.b : GCCC*GTGCCAGGCATAGAGATTG*TGTGGCTCCCAACCTCCCTTTGGTTTCTTTCGTG*
HTMT1_0106_A11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCAAGCTTTCCTTTGGTTTCTTTCGGG*
HTMT1_0137_G02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCC*TCAAGCTTCCCTTTGGTTCTTTCGTG*
HTMT1_0057_G09.b : GCCCCGGGCAGGGCATAAAGATGG*GGTGGCTTCCAAGCTTCCTTGGGTTTCTTTCGGG*
HTMT1_0047_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTCTTTCGTGC*
CBLT1_0056_D12.b : GCCC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTTCTTCGTG*
HTMT1_0047_F01.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTT*CTTTCGTG*
HTMT1_0044_G09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTGG**TTNCTTNCGT*
HTMT1_0141_E10.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCAAACTTCCTTGGGTTTCTTTCGTG*
HTMT1_0149_G10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTTCTTTGGTTTCTTTCGTG*
CBLT1_0055_C05.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTT*TTTCGTG*
CBLT1_0021_D08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCCTTT*GTTTCTTTCGTG*
HTMT1_0099_B11.b : GCCC*GTGCAAGCCATAAAGATGG*GGTGGGCTCCA*GCTTCCTTTGGTTTCCTTCGTG*
HTMT1_0121_B03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CAAAGCTTCCTT*GGTTTCTTTCGTG*
HTMT1_0151_F05.b : GCCC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0011_A04.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCTTTTGGTTTCTTTCGTG*
HTMT1_0010_H05.b : GCCC*GTGCAGGGCATANAGATGT*TGTGGCT*CCNAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0025_A07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0021_A06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGCCT**CAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0095_B10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0021_G07.b : GCCG*TGGCGGGGCATAAAGAAGG*TGTGGCT*CCAAGCTTCCTTGGGTTTCTTTCGTG*
HTMT1_0086_H08.b : GNCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTNNNCTTCGT*
HTMT1_0037_B06.b : GCCC*GTGCAGGGCATAAAGATGG*GGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0013_B03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0065_B01.b : NCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0028_B11.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCTCCAAGCTTCCTTTTGGTTTCTTTCGTG*
CBLT1_0037_B12.b : GGCCCGTGCAGGGCATAAAGATTG*GGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0118_B12.b : GCCC*GTGCAGGCCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCCGG*
HTMT1_0117_E09.b : GCCC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTTGGTTCTTTCGTG*
CBLT1_0046_C06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0028_G06.b : GCCC*GTGCAGGGCATAAAAATGGTGGTGCCT**CCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0111_D11.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGC*TCAAGCTTCCTT*GGTTTCTTTCGTG*
HTMT1_0092_C07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTT*CGTG*
HTMT1_0013_D07.b : GGCC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0076_G10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0098_B07.b : *CCC*GTGCAGGNCATAAAGATGG*TGTGGCT*CAAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0064_B07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0133_A12.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0048_C02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTCTTTTCGGC*
ILNT1_0002_G10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0094_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGG*TTCTTTCGTG*
HTMT1_0046_G11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTNCGTG*
CBLT1_0034_A11.b : GCCC*GTGCAAGGCATANAGATGG*TGTGGCTCCCAGCTTCCCTTTGGTTTCTTTCGTG*
HTMT1_0083_G02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTCCCTTTGGTTTCTTTCGTG*
HTMT1_0042_A07.b : NCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTCCNTTTGGTTTCTTNCGTG*
HTMT1_0056_H09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGNTTCTTTCGTG*
HTMT1_0087_A03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGNTTCTTTCGTG*
HTMT1_0060_E10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTTCTTCGTG*
CBLT1_0044_D03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0016_A07.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0061_H06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNAGCTTCCCTTGGTTTCNTTNNCGT*
HTMT1_0139_A10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNNAGCTCN*TTTNGTTTCTTTCGTG*
CBLT1_0053_F07.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0034_F12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCTTTTGGTTTCTTTCGTG*
HTMT1_0076_H02.b : gcccgcggccgggcaaaaaaaatggggtggctcccaggcttcctttgggtttctttcggg
CBLT1_0067_B02.b : GCCC*GTGCAGGGCATAAAAAAGG*GGTGGCCCCAAGCTTCCCTTTGGTTCCTTTcgggc
HTMT1_0007_C05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0041_C07.b : GCCC*GTGCAGGGCATAAAGATGG*TGGGGCT*CCCACCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0036_E07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNAAGCT*CCTTTGGTTTCTTTCGTG*
HTMT1_0010_C06.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCTTTTGGTTTCTTTCGTG*
HTMT1_0126_H07.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGNTTCTTNCGTG*
HTMT1_0113_A02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNNAGC*TCCTTTTGGTTCTTTCGTG*
HTMT1_0120_A12.b : GCCC*GTGCAGG*CATANAGATGG*TGTGGCT*CCAAGCTccttgggttcnntcgtgctc
CBLT1_0024_B08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCAAGGCTTCCTTGGGTTTCTTTCGGG*
HTMT1_0118_H02.b : GCCC*GTGCAGGGCATAAAGATGG*GGTGGCT*CCAAGCTTCCTTTGGTTTCTT*CGGG*
HTMT1_0045_F04.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT**CAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0053_C11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCCTTGGTTNCTTNNCGT*
HTMT1_0042_E11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0067_E11.b : GCCC**TGCAGGGCATAaaagggggggctccaaacttctttggttctttcgggccccccc
CBLT1_0074_F01.b : GCCC*GTGCAGGGCATAAAAATGG*TGTTGGCTCCA*GCCTCCTTGGGTTTCctccgggc
HTMT1_0136_H12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCTTTTGGTTTCT*TCGTG*
HTMT1_0126_E03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCA*GCTTCCTTTGGTTCTTNNCGTG*
HTMT1_0147_C10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTC*TTTGGTTTCTTTCGTG*
HTMT1_0041_H02.b : GCCC*CTGCAGGGCATAAAGATGG*GGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0117_D03.b : GCCC*GTGCAGGGCATAAAGAGGG*TGGGGCT**CCAGCCTCCTTTGGTTTCATTCGGG*
HTMT1_0034_B04.b : GCCC*GTGCAGGGCATAAAGATGG*GGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0077_E12.b : GCCC*GTGCAGGGCATAGAAAGGG*GGTGGGC*CCAAGCCTCCCTTGGTTTCTTTCGGG*
HTMT1_0118_F12.b : GCCC*GTGCAGGNCATANAGA*GG*TGTGGCT*CCAAGCTTCCTTGGGTTTCTT*CGTG*
HTMT1_0066_C01.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTCCNTTTGGTTNCTTTCGTG*
HTMT1_0073_B12.b : GGCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTCCNTTTNGGGTTCTTCGTG*
CBLT1_0072_H09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTTCCTTGGTTTCTTTCGTG*
HTMT1_0041_A02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTT*CTTTGTTTTCTTTCGTG*
CBLT1_0005_E10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0111_A02.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTCCCTTGGGTTTCTTTCGTG*
HTMT1_0076_C01.b : caggcataaaaatgggtggggctcaagctccctttgtttctttcggcccccccctctccc
HTMT1_0122_D09.b : GCCC*GTGCAAGGCATAAAGATGG*TGTGGCT*CCAAGCTTCTTTGGGTTCTTTCCGGC*
CBLT1_0009_G11.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0093_H12.b : NCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGGTTCTTNCGTG*
HTMT1_0060_B12.b : aaatgtgcccccnnntcactcnctctnnctgtgttctctcgcgctccncctnnaccgann
CBLT1_0034_H05.b : tccagggaaaaaaataggggggggccaagccttccttgggttccttcgggcccccccccc
HTMT1_0059_D04.b : ccngtgcangcataaaaatggtgtggctccagcttcctttggttctttcggcctcctcct
CBLT1_0068_G08.b : GCCC*GTGgcaggcaataaaaatgggggtgcctccagcttcccttgggtttctttcgggc
HTMT1_0115_B01.b : GCC**GTGCAGGccaanagaatgtgtggctccaacttctttgggttcttcgtgcccctcc
HTMT1_0058_C04.b : *CCC*GTGCAGGnatanaaatggtgtgcctcaagcttccttgggttcttcgggcctctcc
CBLT1_0073_F08.b : *CCC*GTGCAGGCCATAAAatggtgtggctccaagctccttgggttctttcgtgcctctc
HTMT1_0013_A02.b : GCCC*GTGCAAGGCAAAAAattggggggcaccaacttcctttggtttctttcgaggctcc
CBLT1_0067_B11.b : GCCC**TGCAGGGCAaaaaaagggggtgcctccaaccttcctttggtttcttcggggccc
HTMT1_0119_B12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCAAaannaaannnnnnnnnnnnannnna
CBLT1_0023_G10.b : GCCC*GTGCAGGGCATANAAATGG*TGTGGCTCCAAaa
HTMT1_0127_H12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNNAGCTtcttnggttncntnnncgtg
HTMT1_0111_F07.b : *CCC*GTGCAGGGACTAGAGATGG*TGTGGCT**CCAGCCTTCTTTGGTTctttcgggcc
HTMT1_0105_F06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCCTTCTTTGGTTTCTTcgtgcc
HTMT1_0117_H09.b : GCCC*GTGCCGGGCATAAAGAGGG*TGTGGCT**CCAGCCTCCTTTGGTTTCTTcgggcc
CBLT1_0073_B11.b : GCCC*GTGCAGGGCATAAAAATGG*TGTGGGCTCCAAGCTCCCTTGGGTTTCTTTCGggg
HTMT1_0119_D08.b : GCCC*GTGCAGGGGAATAAAAAAG*GGGTGGCCCCAACCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0126_F11.b : GCC**GTGCAGGNCATAAAAATGG*TGTGGCT*CCAAGCTCCTTggttncttcnntgctc
HTMT1_0128_E02.b : G*CC*GTGCAGGNCATANAGATGG*TGTGCT**CCAAGCTTCCTTTGG*TTCTTTCGTG*
CBLT1_0050_C05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTCTTTCGTGC*
HTMT1_0035_H01.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCTCCCAACTTCCCTTTGGTTTCTTTCGGG*
HTMT1_0035_D11.b : GCCC*GGGCAGGGCATAAAAATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0096_H03.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT**CAAGCTNCNTTGGGTTCNTTCGTG**
HTMT1_0140_H10.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCTCCNA**GCTCCTTTGGTTNCTTTCGTG*
CBLT1_0038_D11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0132_F08.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0016_D05.b : GCCC*GTGCAGGCCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGG*TTCTTTCGGG*
HTMT1_0097_G08.b : GC*C*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAACTTCTTTTGGTTTCCTTCGTG*
CBLT1_0041_C10.b : GCCC*GTGCAGGGCAAAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0121_B01.b : GCCC*GTGCAGGGCATAAAAATGG*TGTGCCT*CCAAGCTTCCTTTGGTTTC*TTCGTG*
HTMT1_0113_B09.b : GCCC*GTGCAAGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCCTTGGTTTCTTTCGTG*
HTMT1_0077_E08.b : G*CC*GTGCAGGGCATANAGATGG*TGGGGCT**CCAGCTTCCTTTGGTTCCTTTCGGG*
CBLT1_0041_D07.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAACTTCCTTGGGTTTCT*TCGTG*
HTMT1_0148_A09.b : GCCC*GTGCAAGGCATAAAGATGG*TGTGGCT*CCAACCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0132_F03.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCNAGCTTCTTTTGGTTCCTT*CGTG*
HTMT1_0140_C12.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTTC*TTCGTG*
HTMT1_0140_F06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNAAGCTCCTTT**GTTTCTTNCGTG*
CBLT1_0024_F01.b : GGCCCGTGCAGGGCATAAAAATGGGTGTGGCCTCCAGCCTCCCTTGGGTTTCTTTCGGG*
HTMT1_0106_E05.b : GCCC*GTGCAGGNCATANAGATGT*GTGGGCT**CAAGCTTCCTT*GGTTTCTTTCGGG*
HTMT1_0099_C09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0101_E05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNA**GCTTCTTTGGTTTCTTTCGTG*
HTMT1_0021_A08.b : GCCC*GTTGCAGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGGG*
HTMT1_0128_G08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGNTTCCTTCGTG*
HTMT1_0120_B12.b : *CCC*GTGCAGGNCATANAGATGG*TGTGGCT**CAAGCTTCCTT*GGTTTCTTTCGTG*
HTMT1_0028_G05.b : CCCC*GTGCAAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0060_C11.b : GGCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTTGGTTCTTTCGTG*
HTMT1_0044_H10.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTNGGNTTCTTNNCGT*
HTMT1_0026_D07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCNAAGC*TCCTTTGGGTTCTTTCGTG*
CBLT1_0060_G12.b : GCCCCGTGCAAGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCCTTGGTTTCTTTCGTG*
HTMT1_0105_B03.b : GCCC*GTGCAGGGCAAANAAATGG*TGTGGCTCCCAA*CTCCCTTTGGGTTTCTTCGTG*
CBLT1_0011_E06.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCTCCAAGCTTTCCTTGGGTTTCTTTCGGG*
HTMT1_0135_B04.b : *CCN*GTGCAGGNCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTTCT*TCGTG*
CBLT1_0080_E02.b : GC*C*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0064_A08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCGAGCTCCTTTTGGTTTCT*TCGTG*
HTMT1_0139_E01.b : GCCC*GTGCAGGGCATANANATGG*TGTGGGCTCAAAGC*TCCTTTGGTTTCTTTCGTG*
CBLT1_0090_F01.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0034_H09.b : GCCC*GTGCAGGACATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGGG*
CBLT1_0014_C12.b : GCCC*GTGCAGGCCATAGAGATGG*TGTGGCTCCAAGCCTTCTTTTGGTTTNTTTGGTG*
CBLT1_0088_A03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0106_B11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTCCNTTTGGTTTCTTTCGTG*
HTMT1_0064_G04.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCCAGCTTNCTTTGGTTTCTTTCGTG*
HTMT1_0062_E07.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTTCTTCGTG*
HTMT1_0095_A12.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGCTCCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0150_D11.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTTGTG*
HTMT1_0122_B12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGCTCCNAGCTNC*TTTGGNTTTCTTCGTG*
HTMT1_0141_H07.b : GGCCCGTGCAGGGCAATAAAATGG*TGTGGCTCCCAACCTCCTTTTGGTTTCTTTCGTG*
CBLT1_0040_B05.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTCCNTTTGGTTTCTTTCGTG*
CBLT1_0052_A10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0025_C06.b : GCCC*GTGCAGGGCATAAAAATGG*TGGGGCT*CCAAGCTTCCTTTGGTTTCATTCGTG*
HTMT1_0067_H07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0082_A09.b : GCCC*GTGCNAGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTGGGTT*CTTTCGTG*
HTMT1_0013_F01.b : GCC**GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0130_C05.b : CCCC**TGCAGGGCATAAAGATGG*TGTGGCT**CCAACTTCCCTTGGTTTCTTTCGTG*
HTMT1_0099_A06.b : GCCC*GTGCAGGGCATAAAGAGGG*GGTGGCT*CCCAGCTTCCTTTGGGTTCTTTCGGG*
CBLT1_0036_C05.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0037_B04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*TCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0132_A04.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGC*TCAAGCTCCCTTTGGTTTCTTTCGTG*
HTMT1_0070_G03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTNCCTTGGTTNNCTTCGTG*
HTMT1_0111_H01.b : GCCC*GTGCAGGGCATAAAAAGGG*GGTGCCT*CAAAGCTTCCTTTTGTTTCTTTCGGG*
HTMT1_0100_F01.b : GCCC*GTGCAGGGCATANAGATGG*TGTGCT**CCNAGCTTC*TTNGGTTTCTTNCGTG*
CBLT1_0044_C08.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCTCCCAGCTTCCCTTTGGTTTCTTTCGTG*
HTMT1_0133_A10.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTNCCTTGGTTTCTTTCGTG*
CBLT1_0075_B12.b : GCCC*GTGCAGGGCATA*AGATGG*TGTGGCT*CCAAGCTTCCTTTTGGTTCTTTCGTG*
HTMT1_0027_B01.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0088_G06.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0048_A11.b : GGCC*GTGCAAGGCATAGAGATGG*TGTGGCTCCCAGCTTCCTTTTGGTTTCTTTCGTG*
CBLT1_0046_H09.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCCTCTTTTGGTTTTCTTCGTG*
CBLT1_0004_D05.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0103_C12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0035_B11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0076_B06.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT**CCAAGCTCCTTTGGGTTTCTTCGTG*
HTMT1_0095_F01.b : GCCC*GTGCAGGNCATAAAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTT*CTTNCGTG*
CBLT1_0013_B03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0095_H06.b : GGCC*GTGCAGGNCATANAGATGG*TGTGGCTCCCAAGCT*CCTTNGGNTTCTTCCGTG*
HTMT1_0016_G09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0019_D11.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0025_B07.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGNTTCTTTCGTG*
HTMT1_0028_H02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0085_H01.b : GCCC*GTGCAAGGCATANAGATGG*TGTGGGCTCAAGCTTTCCTTTGGTTTCTTTCGTG*
HTMT1_0054_B11.b : GCCC*GTGCAGGCCATANAGATGG*TGTGGCT**CCAGCNTCCTTTGGTTTCTTTCGTG*
CBLT1_0051_A01.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCGAGCTTCTTTTGG*TTCTTTCGTG*
HTMT1_0014_G11.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0134_G05.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTCCNTTTGGTTTCNTTCGTG*
HTMT1_0034_E03.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTCCCTTTGGTTTCTTCCTGG*
HTMT1_0084_E09.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0061_C12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0149_F10.b : GCCCCGTGCA*GGCATAGAGATGG*TGTGGCT*CAAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0039_D07.b : NCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0034_F10.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCCAGCTCCTTTTGGTTTCTTTCGTG*
HTMT1_0051_A10.b : NCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGGTCTTNNCGTG*
CBLT1_0039_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCAAGCCTTCTTTGGGTTTCTTTCGTG*
HTMT1_0022_F01.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0015_E12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0041_B02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0075_F07.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0020_H06.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT**CAAGCTTCCTTTGGTTTNCTTCGTG*
HTMT1_0074_H09.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0014_A01.b : GCCC*GTGCANGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTG*TTTCTTTCGTG*
HTMT1_0037_H11.b : GCC**GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0066_D08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTNGGTTNCTTNNCGT*
CBLT1_0038_C06.b : GCCC*GTGCAAGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0034_C01.b : GCCC*GTGCAAGGCATAGAGATGG*TGTGGGC*TCAAGCTTCCTTTGG*TTCTTTCGTG*
CBLT1_0060_G03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCCTTGGTTTCTTTCGTG*
CBLT1_0062_H04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0096_A11.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0075_C10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGGGTTCTTCGTG*
CBLT1_0025_E08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0004_G05.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0054_G01.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0053_A07.b : GCCC*GTGCANGGCATANAGATGG*TGTGGNC*TCAAGCTTCCTTTGGTNNTCTTCGTG*
HTMT1_0073_B07.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0094_C01.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTT*CTTTCGTG*
HTMT1_0027_A10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0017_E05.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCTCCNA**GCTCCTTTGGTTTCTTTCGTG*
HTMT1_0063_D12.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0045_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGGGGCT*CCAAGCTTCTTTTGGTTTCTTTCGTG*
HTMT1_0073_A06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0061_H05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTGGGTT*CTTTCGTG*
HTMT1_0089_D09.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGTTTTCTTTCGTG*
CBLT1_0062_D02.b : GCCC*GTGCAAGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0043_E02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCTTTTGGTTTCTTTCGTG*
CBLT1_0059_H04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0043_G10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTNNCGT*
HTMT1_0067_A10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGNTTCTTNNCGT*
CBLT1_0037_H08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0084_G04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCTCCAAAGCT*CCTTTGGGTTCTTTCGTG*
HTMT1_0071_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGNTTCTTTCGTG*
HTMT1_0014_H06.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTTCTTTGGTTTCTTTCGTG*
CBLT1_0006_A07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTCTTTCGTG*
CBLT1_0055_D08.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0004_H12.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0042_F11.b : GCCC*GTGCNAGGCATANAGATGG*TGTGGCT*CCAAGCTTCCCTTGGTTTCTTTCGTG*
HTMT1_0016_H08.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTNCTTTCGTG*
CBLT1_0081_G11.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCC*TCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0015_A09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTNCTTTCGTG*
HTMT1_0040_B10.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
BFLT1_0007_D04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAAGCTCCTTTGGTTTCTTTCGTG*
HTMT1_0024_B03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCCTTGGGTTCTTTCGTG*
CBLT1_0007_C02.b : gggcatacaacagtgtgtgttccggctccaagggtcaatgaagtcagtcacggaccctgc
CBLT1_0028_F01.b : GCCC*GTGCAGGGCAAAAAAAAGG*GTGGGGCTCCAAGCTCCCTTTGGTTTCTTTtcggg
HTMT1_0056_D12.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCNTCC*AGCTTCCTTNGGNTTCTTNCGTG*
HTMT1_0131_B02.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTCCNTTTGGTTNCTTTCGTG*
HTMT1_0104_G12.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGC*TCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0042_B11.b : GCCC*GTGCAGGNCATAAAGATGG*TGTGGCT*CCNAGCTTCCNTTTGGNTTCTTCGTG*
HTMT1_0068_B12.b : GCCC*GTGCAGGGCATAGAGAGGG*TGTGGCT**CCAAGCTCCTTTGGGTTCTTTCGTG*
CBLT1_0054_F08.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0085_H05.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGGTTCTTTCGTG*
HTMT1_0064_C09.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0047_B04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0068_D07.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTGGGTTTCTTTCGTG*
CBLT1_0053_G06.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0026_F11.b : GCCC*GTGCAGGCCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0049_A09.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCNAGCTTCCNTTGGTTNCTTTCGTG*
CBLT1_0080_H12.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0104_F09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CAAGCTTC*TTTGGTTTCNTTCGTG*
HTMT1_0071_A04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCNTTGGTTNCTTNNCGT*
HTMT1_0034_F11.b : GCCC*GTGCAGGGCATANAGATGG*GGTGGCTCCAAGCTTCCTTTTGGTTTCTTTCGTG*
HTMT1_0146_C12.b : GCCC*GTGCAGGNCATANAGATGG*TGTGGCT*CCAAGCTTTCTTTGGTTTCTTTCGTG*
HTMT1_0136_G04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTT*GGTTTCTTTCGTG*
HTMT1_0120_B01.b : aaatgggggggttccaagcttcttggggttcttccagccccccccctcccaccccctaag
CBLT1_0006_H07.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0036_D12.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCCAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0133_G04.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0036_E11.b : GCCC*GGGCAGGGC*TAAAGATGG*GGTGGC**CCCAACCTTCTTTGGTTTCTTTCGTG*
CBLT1_0062_A01.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTCCTT*CGTG*
HTMT1_0085_D02.b : gaaaaaaaagggggggcccccaacctccctgggtttctttggggcccccccccctccccg
HTMT1_0063_E09.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0024_D10.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CAAAGCTTCCTTTGGTTTCTTTCGTGG
CBLT1_0024_B03.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT**CAAGCTTCCTTTGTTTTCTTTCGTG*
CBLT1_0069_G11.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCNAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0075_E09.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0052_G05.b : GCCC*GTGCAGGGCATANAGATGG*TGTGGGC*TCCAGCTTCCTTTGGTTTCT*TCGTG*
CBLT1_0074_H03.b : GCCC*GTGCAGGGCATAAAGATGG*TGTGGGC*TCAAGCTCCTTTGGTTTNCTTTCGTG*
CBLT1_0052_H03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0052_H02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0042_B03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
CBLT1_0075_G03.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
HTMT1_0086_E02.b : GCCC*GTGCAGGGCATAGAGATGG*TGTGGCT*CCAAGCTTCCTTTGGTTTCTTTCGTG*
20110601C-000217 : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
---------+---------+---------+---------+---------+---------+ 994
CBLT1_0023_A08.b : G**CCTCCCCCcccccaccgccaaagttttttaacttcctaaaaggttcgggccctcgaa
HTMT1_0050_B08.b : C**TCCTCCCTCTacccgctaagtaattaatcttctaaaagggtcgggccgtcgaaaagc
CBLT1_0068_D11.b : ccccctccaccccctaaatatttttatctcccaaaaaggtcgggccctccgaaagggctt
CBLT1_0077_C07.b : C**TCCTCCCTCTCACCG*CTAAGTAT*TTA*TCTtcctacaggttcgggccttcngaaa
HTMT1_0126_A09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCNTTCTAA*Cnggtcggggcgtcnga
HTMT1_0038_C01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCTAA*CAGGTTCGGG*CCC*TT
HTMT1_0038_D01.b : CC*TCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCCTCCCTA*CAGGGTCGGG*CCC*TC
CBLT1_0055_F02.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTT*AATCTCCTAA*CAGGGTCGGG*CCG*TC
HTMT1_0079_B03.b : CC*TCCTCCCTCTCCCCG*CTAAAGTA*TTT*ATCCTCCTAA*CAGGTTCGGG*CCG*TC
HTMT1_0145_A10.b : C**TCCTCCCTCTCACCG*CTAAAGTA*TTA*ATCTTCCTAA*CAGGtcggccctcggaa
CBLT1_0042_C01.b : CCTCCTCCCTCTCACCCC*GCTAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCGCTC
HTMT1_0012_E08.b : CCTCCTCCCTCTAA*CCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGG*CCGTTC
HTMT1_0012_F03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0006_A04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCGTCG
HTMT1_0003_B02.b : CCTCCTCCCTCTCANCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCG*TC
HTMT1_0005_F06.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCG*TC
HTMT1_0111_E01.b : C**TCTTCCTCTCACCCG*CTAAA*TA*TTTTATCTTCtaacagggtcgggccctcgaaa
HTMT1_0037_B01.b : CCTCCTCCCTCTCACCGG*TTAAAGTA*TTTAATCTTCCTAAaaagggtcgggcccgtcc
HTMT1_0035_E04.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGG*CCCGTC
CBLT1_0040_F03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA**TTAATCCTCCCTA*CAGGGTCCGG*CCGTTC
HTMT1_0027_C08.b : CCTCCTCCCTCTC*CCCG*CTAAGGTA*TTTAATCTTC*TAA*CAAGGTCGGG*CCGTCC
HTMT1_0012_H10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0011_B07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGNTCGGG*CCGTCG
CBLT1_0093_A09.b : cccccctccccacccgcaaagtatttaacctccctaacggggtcgggccctcggaaaagc
HTMT1_0144_G09.b : cctcccccccaccgccaaagtatttatcttccaacaggttcggccctcgaaaagcttgcg
CBLT1_0068_C08.b : CCTCCTCCTCTtcccccgctaagatattaatctccctaaaagttcgggcctccgaaaagg
HTMT1_0109_F08.b : CTCCTCCCCTCACCCGCAAAGTATTTA*Ttctcctaacagggtgggccctcgaaaagctt
CBLT1_0038_E04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTAATCctcctacaaggtcgggccntcngaaa
HTMT1_0089_E09.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTAATCTccctacaggttcggccgttcgaaag
HTMT1_0014_H01.b : C**TCCTCCTCTCACCGG*CTAAGATA*ATTAATCTTCCTAattgggccgggcaatcacg
HTMT1_0087_A04.b : CCTCCT*CCTCTCACCCG*CTAA*GTA*TTT*ATCTTCCTAcaggttcggccgtcggaaa
CBLT1_0078_G12.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTTAATCCTCCTAA*CAGGTTCCCG*CCcttc
HTMT1_0050_A03.b : CCT*CTCCCTCTCACCNG*CTAANGTA*TTTATCTTTC**TA*CAGGGTCGGG*Cccgtc
CBLT1_0086_E03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCCTTCTAA*CAGGGTCGGG*CCCTTC
HTMT1_0028_C05.b : CCTC*TCCCCCTCACCCG*CTAAAGTA*TTT*ATCCTCCTAA*CAGGGTCGGG*CCCTCC
HTMT1_0042_F09.b : CCCTCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0109_A05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCNTA*CAGGNTCCGG*CCNNTC
HTMT1_0006_E11.b : CCTCCTCCCTCTCACCGG*CTAAAGTA*TTTAATCTTTCTAA*CAAGGTCGGG*CCGTCG
HTMT1_0134_F06.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCCGTC
CBLT1_0042_E07.b : CCCCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0134_C07.b : CCTCCCTCCTCTCANCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
CBLT1_0072_C10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
ILNT1_0001_B08.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0078_C11.b : CCTCTTCCCTCTCACCCG*CTTAGGTA*TTTAATCCTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0061_E10.b : CCTCCTTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0002_C03.b : CCTCCTCCCTCTCCACCC*GCTAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTTC
HTMT1_0025_D10.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTTAATCTTCCTAA*C*GGGTCGGG*CCCGTC
HTMT1_0002_F07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCAA*CAGGGTCGGG*GCCGTC
HTMT1_0128_H06.b : CCTCCTCCCTCTCACCGG*CTAA*GTA*TTTAATCTTCCT*A*CAGGGTCGGG*CCNTCG
HTMT1_0064_A02.b : CCTCCTCCCTCTCNACCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCGTCN
CBLT1_0073_C05.b : tcctctccccgctaagtattaatcttcaaacgggtcgggcttcggaaagcttgcggcgga
HTMT1_0138_A04.b : cctctcaccgctaaagtattatcttctaacaggtcggncnntcgannagctgcngcggga
HTMT1_0025_F09.b : CCCCCcccccccacccctaaagtattttatcttcctaacaggtcgggccctcgaaaaggt
HTMT1_0105_A01.b : CCCTCCCCCcccccccgctaagtaattaatcctcctaacaggtccggccttcgaaaaggc
HTMT1_0120_E04.b : CCCCCTCCCTCccccggctaaagtattaatcttcctaaaggttcggccntccgaaaaggc
HTMT1_0010_E11.b : CCTCTTCCCTCTCACCCGGCTAAAGAA*TTTAATCTTCCTAA*CAGGGTCCGG*GCcacc
CBLT1_0039_B10.b : C*TTCTCCCTCTCACCgctaagtatttaatcttctaacagggtcgggcccgtcgaaaggc
HTMT1_0117_G02.b : CCCTCTCCCTCCCACCCGtaaatttttatccttcctaaaaggttcggcccttggaaaggc
HTMT1_0107_A07.b : CCTC*TCCCTCTCCCCGCctaagtattaatctcctaacaggtcgggcctcggaaagcttg
HTMT1_0106_C10.b : CCTCCTCCTCTCCCCGCTAAataattattcttcctacagggtccggccgtcagaaagctt
HTMT1_0104_B07.b : CCTCCCTCCTCCCACCCG*Cctaaagtattttaatctcccaacagggtccggccctcggg
HTMT1_0106_A11.b : CCTCCTCCCTCTCAACCG*CTtaaagtattaaatcttccttaacggggtccggcccttcc
HTMT1_0137_G02.b : CCTC*TCCCTCTCACCCG*CTAAGTAT*Taatcctccaaacaggtcggccctcggaaagc
HTMT1_0057_G09.b : CC*CCCCCCTCCCACCCC*GTAAAGTA*TTT*Accttcctaacagggtccggccctccga
HTMT1_0047_D10.b : CTCTCCCTCTCACCGCTA*AGGTATTA*ATCTTcctacaggttcgggcctccgaaaggct
CBLT1_0056_D12.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTtaacagggtcgggcccgtcg
HTMT1_0047_F01.b : C*TCCCTCCTCTCACCCG*CTAAAGTA*TT*AATCTTCCTAC*AGGntcnggccgtcgga
HTMT1_0044_G09.b : GNNCTCTCCTCTCACCCG*CTAGTATT*TATCTTCctacagggtcggccgtcggaaagct
HTMT1_0141_E10.b : CCTCCTCCCTCTCACCGG*CTAA*GTA*TTAAATCTTCCTAA*Cgggtcggggcctcgga
HTMT1_0149_G10.b : CCTCCTCCCTCTCACCCG*CTAA*GTA*TTTAATCTTCCTAA*CAGGGTCGGcccttcga
CBLT1_0055_C05.b : CCTC*TCCCTCTCACCCG*CTAAAGTA*TTTAATCTTC*TAA*CAGGGTCGGccgtccga
CBLT1_0021_D08.b : CCTCCTTCCTCTCCCCCC*GCTAAGTA*ATTAATCTTCC*AA*CAGGGTCGGG*Ccttgg
HTMT1_0099_B11.b : CCTCCCCCTCCCCACCCG*CTTAAGTA*TTTAATCTTCCTAA*AAGGGCCGGG*Cttcga
HTMT1_0121_B03.b : C*TCCTCCCTCTCA*CCG*CTAAAGTA*TTTATCCTCCC**A*CAGGGTCGgccttccga
HTMT1_0151_F05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCCTCCTAA*CAGGGTCGGccctccga
HTMT1_0011_A04.b : GCTCCT*CCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTTC
HTMT1_0010_H05.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTTATCTTTCTTACCAGGNTCGGG*CCGCTC
HTMT1_0025_A07.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTTAATCTTCCTAA**AAGGTCGGG*CCGTCN
HTMT1_0021_A06.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTTATCTT**CTAA*CAGGGTCGGG*CCGTCC
HTMT1_0095_B10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*ATTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0021_G07.b : CATCCCCCCTCTACCCCG*ATAA*GTA*TTTAGACCTCCTAA*AAGGGTCGGG*CCCTCC
HTMT1_0086_H08.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCNTA*CAGGGTCGGN*CCGTCG
HTMT1_0037_B06.b : CCTCCTCCTTCTCACCCG*CTAAAGTA*TTTAATCTTTCCTAACAGGGTCCGGCCCGTCG
HTMT1_0013_B03.b : GCCTCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0065_B01.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGNTCGGG*CCGTCN
HTMT1_0028_B11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCGTCC
CBLT1_0037_B12.b : CCTCCTCCCTCTCACCCG*CAAAATTA*TTTATCCTCCCTAA*CAGGGTCGGGCCCTCCG
HTMT1_0118_B12.b : GCTC*TCCCTCTCACCCG*CTAAAG*A*TTTAATCTTC*TAA*CAGGGTCGGG*CCCTCA
HTMT1_0117_E09.b : CCCCCTCCCTCTCACCCG*CTAAAGTA*TA*ATTCTTCCTAA*CAGGGTCGGG*CCCTCG
CBLT1_0046_C06.b : CCTCC*CCCTCTCACCGG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
CBLT1_0028_G06.b : CCTCCCCCCTCTCCCCGG*CTAAAGTA*TTTAATCCTCCTAA*CAGGGTCGGGCCCTCCG
HTMT1_0111_D11.b : CCCTCTCCCTCTCACCCG*C*AAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCTTCG
HTMT1_0092_C07.b : CCTCCTCCCTCTCACCGG*CTAAAGTA*TTTATCCTTCCT*A*CAGGGTCGGG*CCTTCG
HTMT1_0013_D07.b : CCTCCTCCCTCTCCCCGG*CTA*AGTA*TTTAATCCTCCTAA*CAGGGTCGGG*CCGTCA
CBLT1_0076_G10.b : CCTCCTCCCTCTCAACCG*CTAAAGTA*TTTAATCTTCCAAA*CAGGTTCGGG*CCTTCG
HTMT1_0098_B07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCT*A*CAGGGTCGGG*CCGTCC
HTMT1_0064_B07.b : CCT*CTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0133_A12.b : CCTCCT*CCTCTCACCCN*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0048_C02.b : CT**CCTCCTCTCACCNG*CTAAAGTA*TTTAATCTTCCTA**CAGGNTCGGG*CCGTTC
ILNT1_0002_G10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCGTCG
HTMT1_0094_D10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTT*CTAA*CAAGGTCGGG*CCGTCG
HTMT1_0046_G11.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0034_A11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAAACAGGTTCGGG*CCCGTC
HTMT1_0083_G02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCT*CCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0042_A07.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0056_H09.b : CCTCCTCCCTCTCACCNG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGN*CCGTCG
HTMT1_0087_A03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTNC
HTMT1_0060_E10.b : CCTCCTCCCTCTCACCNG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGN*CCGTCN
CBLT1_0044_D03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0016_A07.b : CCCTCTCCCTCTCNACCG*CTAAAGTA*TTTAATCTTCCTAAACAGGGTCGGC*CCGTCC
HTMT1_0061_H06.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0139_A10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0053_F07.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGGCCCGTCG
CBLT1_0034_F12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0076_H02.b : actcctcccctcttcaccgttaaaattttttatcttcctaacagggtcgggccctccgaa
CBLT1_0067_B02.b : cccccccccccccccccgctaaaattatttaaccctccctaacaggggccgggccctccg
HTMT1_0007_C05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTCTCT*A*CAAGGTCGGG*CCtccg
HTMT1_0041_C07.b : CCCCCTCCCTCTCCCCCG*TT*AAGTA*TTAAACCTCCTAAcagggccggggcgtccgaa
HTMT1_0036_E07.b : C*TCCTCCCTCTCACCCG*CT*AAGTA*ATTAATCTTCtaaaaaggtcggggcctcggag
HTMT1_0010_C06.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCCTCCTAACAGGGGTCGGG*CCGTCC
HTMT1_0126_H07.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0113_A02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGG*GCG*TC
HTMT1_0120_A12.b : ctccctccacccgctaagtatttaacctcctacaggtcgggcttcgaaaagcttgcggcg
CBLT1_0024_B08.b : CCTCCTCCCTCTAACCCG*CTAAgtatttatccttctaaaagggccggcccttcgaaaag
HTMT1_0118_H02.b : CCTCCCCCCTC*CCCCCG*CTAAAGTA*TTTATCCTTC*TAA*CAGGGTCCGG*Cctccg
HTMT1_0045_F04.b : CCTC*TCCCTCTCACCGG*CTAAAGTA*TTTATCTT**CCAA*CAGGGCCGGG*CCGCCG
HTMT1_0053_C11.b : GCT*CTCCCTCTCAACCG*CTAAAGTA*TTTAATCTTCCCTA*ACAGGTCCGG*CCGTCG
HTMT1_0042_E11.b : CCTCCTACCTCTCACCCG*CTAAAGTA*TTAATCTTtcatacagggttcggacgtcggaa
CBLT1_0067_E11.b : ctcccaccccaaagttttaatcttccaaaaggtcgggcccctcgaaggctggggggggga
CBLT1_0074_F01.b : ccccccctctaacccgctaagtatttaatctccctacagggtcgggccctcgaaaaggct
HTMT1_0136_H12.b : CCTCCTCCCTCcacccgctaaattatttatctcccaacagggtcggccctttcgaaagct
HTMT1_0126_E03.b : CTCTCCCTCTCACCGCTA*AGTATTTAtctcctaacaggtcggccgtcnganagcttggc
HTMT1_0147_C10.b : CCT*CTCCCTCTCA*CCG*CTAAAGTA*TTAATCTTcctaacaggtcgggccttcgaaag
HTMT1_0041_H02.b : CCTCCTCCCTCTCACCCG*GTTAAGTA*TTTAATCTTCCCTAacaggtccggccctccga
HTMT1_0117_D03.b : CCCCCCCCCTCTCCCCCG*CTAAAGTA*TTTAACCTCCCTAA*CGGGTTCGGccccccga
HTMT1_0034_B04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGGCCCTCCG
CBLT1_0077_E12.b : CCTCCCCCCTCTC*CCCG*CTAAAATT*ATTAATCCTCCTAA*CAGGGTCGGG*CCcgtc
HTMT1_0118_F12.b : CCTCCCTCCTCCCACCCG*CTAAAGAA*TTTAA*CTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0066_C01.b : CCTCCTCCCTCTCACCCG*CTAAAAGT*ATTAATCTTCCCTA*CAGGNTCGGG*CCGTCN
HTMT1_0073_B12.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTT*ATCTTCCTA**CAGGGTCGGG*CCGTCN
CBLT1_0072_H09.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTTATCCTTC**TA*CAGGGTCGGG*CCGTCG
HTMT1_0041_A02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTTCCTA*CAGGGTCGGG*CCGTCC
CBLT1_0005_E10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0111_A02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCT*A*CAGGGTCGGG*CCNTCN
HTMT1_0076_C01.b : cgctaagtatttatcttcctaaaagggtcgggcctcgaaaagctttggcggggaaccttg
HTMT1_0122_D09.b : CTCCCCCTCTtcacccgcaaagtaattaaccttcttaacgggtccggcctcggaaaagct
CBLT1_0009_G11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0093_H12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0060_B12.b : nnnagttatatttcatctacaggcgcgcgnnctcagtgcgggnnnnncgatnnnctgtgt
CBLT1_0034_H05.b : ctcacccgcaaaagtttttatcttcccaaaagggccgggcctcgaaaaggctttgcggcg
HTMT1_0059_D04.b : tcaccgctaagtatttatcttctaacagttcgggccccgaaaggctggcggcgaactttg
CBLT1_0068_G08.b : cccccccttcccaccggctaagtttttaatccttccaacagggttcggccttccgaaaag
HTMT1_0115_B01.b : ctccccccgctaagtattttcctccctacagggtcgggcctcgaaaagcttgcggcggga
HTMT1_0058_C04.b : ctctcaccgctaagtatttaaactcctacagggccggnccgtcgaaaagcttgccggcgg
CBLT1_0073_F08.b : cctctcaccgctaaagtattatcttcctacagggtcggccttcgaaaagcttggcggcgg
HTMT1_0013_A02.b : tgtctctcccccactaaaatatttatcctccacaaagggtccgacctacaaaaaggctgg
CBLT1_0067_B11.b : cccccctccccccccaaagttttaactttctaaaagggtcgggccctcgaaaagcttggc
HTMT1_0119_B12.b : nannannnnaanaaannngnccccnnattcccctttnntnanggttaattggtcccccaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : ctctcctctcaccgctaagtattaatctnncctacaggtcggccgtcngananngctgcg
HTMT1_0111_F07.b : tctccctctccccgctaaataataaatcttccaacacggtcgggcctccgaaaggttggc
HTMT1_0105_F06.b : tctccccttcaccgctaaagtattttatctcctaacagggtcggccctcggaaagctttg
HTMT1_0117_H09.b : tcctcctcccaccgctaaatatttaatctccaacagggtcggccgtccgaaagcctggcg
CBLT1_0073_B11.b : cccccccccttccacccgcctaaattatttaatctttcctaacagggtccggcccctccg
HTMT1_0119_D08.b : CCTCCTCCCctccccccgtaaaatttttaacttctccaaacggtccgggcccccgaaatg
HTMT1_0126_F11.b : tccctctcaccgctaagtatttatcttcctacaggtcgggcctcngaaagcttggcgcng
HTMT1_0128_E02.b : C*TCCTCCCTCTCACCGC*TAAagtattaatcttctacagggtcgggcgtccgaaagctt
CBLT1_0050_C05.b : C**TCCTCCTCTCACCCG*CTAAgtatttatcctcctaacagggtcgggcgtcggaaagc
HTMT1_0035_H01.b : CCCCCCCCC*CTCCCCCG*GTAAAGAA*TTTAatcctcctaaacggggtcggggccttcg
HTMT1_0035_D11.b : CCTCCTCCCTCTCACCCG*CTAAGGTA*TTTAACCTTCCTAA*CAGGGTCCGGGCcctcc
CBLT1_0096_H03.b : *CTCCTCCCTCTCACCCG*CTAAGTAT*TTATCttctaacaaggtcggggcctcgaaagc
HTMT1_0140_H10.b : C*TCCCTCCTCTCACCGC*TAAgtattaatcttctaacagggtcgggccgtcgaaaggct
CBLT1_0038_D11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTtaacaggttcgggccctccg
HTMT1_0132_F08.b : CCTCCTCCCTCTC*CCCG*CTAAAGTA*TTTA*TCTTCCTAcaaggtcggccgtccgaaa
HTMT1_0016_D05.b : CCTCCT*CCTCTCACCCG*CAAAAG*A*TTTATCCTTCCTAcagggtcggcccttcgaaa
HTMT1_0097_G08.b : CCTCCTCCCTCTCCCCCG*CTAAAGTATTTTATCCTTCCTAacagggttcgggccgtcgg
CBLT1_0041_C10.b : CCTCCTTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTAacagggtcgggcctccgg
HTMT1_0121_B01.b : CCTCCTCCCTCTCCCCCG*CTAAA*TA*TTTAATCTTCCTAcagggtcgggcctcggaaa
HTMT1_0113_B09.b : CCTCCTCCCTCTC*CCCG*CCTAAGTA*TTAAATCTTCCTAA*Cgggtcggcccttcgga
HTMT1_0077_E08.b : CCCCCTCCCTCTCCCCCG*CTAA*GTA*TTTATCCTTCCTAA*Cgggtccgggcgtccga
CBLT1_0041_D07.b : CCTC*TCCCTCTCACCCG*CTAA*GTA*TTTAATCTTCCTAA*CAGGtcgggccgtcgga
HTMT1_0148_A09.b : CCCCCTCCCTCTCACCC**CTAAAGTA*TTTAtctccctacagggtcgggccctcgaaag
HTMT1_0132_F03.b : CCTCCTCCCTCTCACCCG*CTTAAGTA*TTTTATCTTCCTAA*CGGGTccgccgtcggaa
HTMT1_0140_C12.b : CCT*CTCCCTCTCA*CCG*CTAAGTAT*TTATCTCCctacagggtcgggcgtcggaaagc
HTMT1_0140_F06.b : CCTCCTCCCTCTC*CCCG*CTAAAGTA*TTTAATCTccaacaggttccgggcgtcngaaa
CBLT1_0024_F01.b : CCTCCTCCCTCTCACCCC*GCAAATTA*TTTAATCTTCCTAA*AAGGGTggggccctcga
HTMT1_0106_E05.b : CCT*CTCCCTCTCACC*G*CTAAAGTA*TTT*ATCTTCC*AA*CAGGGTCGgccttcgga
HTMT1_0099_C09.b : C*TCCTCCCTCTCA*CCG*CTAAAGTA**TTAATCTTCCTAC*AGGGTCcggccgtcgga
HTMT1_0101_E05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCC*AA*CAGGGTCcgggcctccg
HTMT1_0021_A08.b : CCT*CTCCCTCTCACCCG*CTAAAGTA**TTAATCTTCCTAA*CAGGGTCGGccgtcgaa
HTMT1_0128_G08.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTTAATC*TCCTAA*CAGGGTCngggcgtcng
HTMT1_0120_B12.b : CCTCCTCC*TCTCACCCG*CTAAAGTA*ATTAATCTTCCT*A*CAGGGTCGGGgctctcg
HTMT1_0028_G05.b : C*TCCCCCCTCTCACCCG*CTAAGTA***TTAATCTTCCTAA*CGGGTCGggcctcggaa
HTMT1_0060_C11.b : CCTCCTCCCTCTCACCCG*CTAANGTA*TTT*ATCTCCCTAcaggntcgggcccgtcgaa
HTMT1_0044_H10.b : GCT*CTCCNTCTCACCCG*CTAAAGTA*TTTAATCTTCCTACAggntcnngncgtcngan
HTMT1_0026_D07.b : CCTCCT*CCTCTCA*CCG*CTAAAGTA*TTT*ATCTTCCTA**CAGGGTCGGG*Ccgtcg
CBLT1_0060_G12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCcgtc
HTMT1_0105_B03.b : CCTCCTCCCTCCCACCCG*CTTAAGTA*TTAAATCTTCCTAA*C*GGGTCGGG*GCGTCC
CBLT1_0011_E06.b : GCCTCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*ACAGGTCGGGCCCGTCG
HTMT1_0135_B04.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTTA**TCTTCTAA*CAGGGTCGGG*Cctcgg
CBLT1_0080_E02.b : CCTCCT*CCTCTCA*CCG*CTAAAGTA*TTAAACCT*CCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0064_A08.b : CCTCCT*CCTCTCACCCG*GCTAAGTA*TTTAATCTTC*TAA*CAGGGTCGGG*CCGTCg
HTMT1_0139_E01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0090_F01.b : CTTCCT*CCTCTCACCCG*CTTAAGTA*TTTATCCTTCCTAA*CAGGTCCGGG*CCCTCC
HTMT1_0034_H09.b : CCTCCTTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGGGCCGTCG
CBLT1_0014_C12.b : GCTCCTCCCTCTCACCGG*TT*AAGTA*ATTAATCTTCCTAACAGGGGTCGGG*CCGTCG
CBLT1_0088_A03.b : CCTCCTCCCTCTCAC*CG*CTAAAGTA*TTTAATCT*CCTAA*CAGGGTCGGG*CCNTCC
HTMT1_0106_B11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGTTCGGG*CCTTCG
HTMT1_0064_G04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTAAATCTTC*TAA*CAGGGTCGGG*CCCGTC
HTMT1_0062_E07.b : GCTCCCTCCTCTCAACCG*CTAAAGTA*TTTTATCT*CCTAA*CAGGNTCGGG*CCGTCN
HTMT1_0095_A12.b : CCTCCTCCCTCCTCACCG*CTAAAGTA*TTTATTCTTCCTAACAGGGGTCGGG*CCGTCC
HTMT1_0150_D11.b : CCTCCTCCCTCTTACCCG*CTAAAATA*ATTAATCTTTCTAAACAGGGTCGGG*CCCTCG
HTMT1_0122_B12.b : CCTCCTCCCTC*CACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCNTCN
HTMT1_0141_H07.b : CCTCCCTCCTCTCACCCG*CATAAATA*TTTAATCTTCCTAA*CAGGGTCAGG*CCGTCG
CBLT1_0040_B05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA**TTAATCTTCCCTA*CAGGGTCGGG*CCGTCG
CBLT1_0052_A10.b : CCTCC*CCCTCTCACCCG*CTAAAGTA*TTT*ATCTTTCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0025_C06.b : GCTCCTCCCTCTCCCCCG*CTAAAGTA**TTAATCTTCCTAA*AAGGATCGGG*CCTACG
HTMT1_0067_H07.b : CCTCCCTCCTCTCACCGG*CTAAAGTT*ATTAATCTCCCT*A*CAGGGTCGGG*CCGTCA
CBLT1_0082_A09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAAGGTCGGG*CCCTCC
HTMT1_0013_F01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCGTCG
HTMT1_0130_C05.b : CC*CCTCCCTCTCACCCG*CTAA*GTA*TTTTATCTTCCTAA*CAGGG*CCGG*CCTTCC
HTMT1_0099_A06.b : CCTCCTCCCTCTCACCGG*CTAAGGTA*T*TAATCTTCCTAA*AAGGCTCGGG*CCTTCA
CBLT1_0036_C05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCTAA*CAGGGTCGGC*CCNNTC
CBLT1_0037_B04.b : CCTCCTCCCTC*CACCCG*CTAAGGTA*TTTAATCTTCTTAC*CAGGGTCGGG*CCGTCG
HTMT1_0132_A04.b : CCCCCTCCCTCCCAC*CG*CTAAAGTA*TTTACTCTTCCAAA*CAGGGTC*CG*CCCTCG
HTMT1_0070_G03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCG
HTMT1_0111_H01.b : CCCTCCCCCTCCCCCCCG*CTAAAGTA*TTTATCCTCCCTAA*CAGGTTCGGG*CCTTCG
HTMT1_0100_F01.b : CCTCCTCCCTCTCAC*CG*CTAAAGTA*TTTA*TCTTCCTAA*CAGGTTCGGG*CCGTCG
CBLT1_0044_C08.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCCTCCTAA*CAGGGTCGGGGCCTTCG
HTMT1_0133_A10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGTTCGGC*CCGTCG
CBLT1_0075_B12.b : CCTCCT*CCTCTCCACCG*CTAAAGTA*TTTAATCTTCTTA**CAGGGTCGGG*CCGTCC
HTMT1_0027_B01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTTA*CAGGGTCGGG*CCGTCG
CBLT1_0088_G06.b : CCTCCTCCCTCTCA*CCG*CTAAAGTA*TTTA*TCTTCCTAC*CAG*GTCCGG*CCGTCG
HTMT1_0048_A11.b : CCTCCCTCCTCTCACCCG*CNTAAGTA*TTTTATCTTCCTAA*CAAGGTCGGG*GCGTCC
CBLT1_0046_H09.b : GCTCCT*CCTCTCACCCG*CTAAAGTA*TT**AATCTCCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0004_D05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0103_C12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCGTCG
CBLT1_0035_B11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCGTCG
HTMT1_0076_B06.b : CC*CCTCCCTCCCACCCG*CTAAAGGA*TTTAAACCTCCTAA*CAGGGTCCGGGCCGTCG
HTMT1_0095_F01.b : CCNTCTCCCTCTCACCCG*CTAA*GTA*TTTAATCTTCCTA**CAGGGTCGGG*CCCGTC
CBLT1_0013_B03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGGGCCGTCA
CBLT1_0095_H06.b : CCTCCTCCCTCTCNACCG*CTAAAGTA*TTTAAATCTTCCTA*CAGGGTCGGN*CCGTCN
HTMT1_0016_G09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*AAGGGTCGGG*GCGTCG
HTMT1_0019_D11.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGTTCGGG*CCGTCG
CBLT1_0025_B07.b : CCTCCT*CCTCTCACCGG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0028_H02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGC*CCGTCG
CBLT1_0085_H01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTTC
HTMT1_0054_B11.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
CBLT1_0051_A01.b : CCTCCT*CCTCTCACCCG*CTAAAG*A*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0014_G11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAAATCTCCTAA*CAGGGTCGGC*CCGTCC
HTMT1_0134_G05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0034_E03.b : CC*CCTCCCTCCCAC*CG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGCCGGG*CCGTCC
HTMT1_0084_E09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA**AAGGTCNGG*CCGTTC
CBLT1_0061_C12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTCCCT*A*CAGGTTCGGG*CCCTCN
HTMT1_0149_F10.b : CCCTCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGTTCGGG*CCGTCG
CBLT1_0039_D07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTC*TAA*CAGGGTCGGG*CCGTCG
CBLT1_0034_F10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGGTCGG*CCCTCG
HTMT1_0051_A10.b : C*TCCCTCCTCTCNACCG*CTAAAGTA*TTT*ATCTTCCCTA*CAGGNTCGGN*CCGTCN
CBLT1_0039_D10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTAAATCTCCCTAA*CAGGGTCGGGGCCGTCC
HTMT1_0022_F01.b : GCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAACCTCCCTAA*CAGGGTCCGG*GCCCTC
CBLT1_0015_E12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTAAATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0041_B02.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGGTCGG*CCGTTC
HTMT1_0075_F07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTC*TAN*CAGGNTCGGG*CCGTCG
HTMT1_0020_H06.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCT*CCTAA*CAGGGTCCGG*CCGTCG
HTMT1_0074_H09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*GCCGTC
HTMT1_0014_A01.b : CCT*CTCCCTCTCACCCG*CTAA*GTA*TTT*ATCTTCCTA**CAGGGTCGGG*CCGTCG
HTMT1_0037_H11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTTCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0066_D08.b : GCTCCTCCNTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGN*CCGTCN
CBLT1_0038_C06.b : CCTCCTCCCTCTCACCCG*CTAA*GTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
CBLT1_0034_C01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCTTCCTAA*CAGGGTCGGG*CCGTCC
CBLT1_0060_G03.b : C*TCCTCCCTCTCACCCG*CT*AAGTA*TTTAAATCTCCTAA*CAGGGGTCGG*GCGTCG
CBLT1_0062_H04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0096_A11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*ATTAAATCTCCTAA*CAGGGTCGGG*CCCGTC
CBLT1_0075_C10.b : CCTCCTCCCTCTCACCCG*CTAAGGTA*TTTAATCTTCCTAA*AAGGGTCGGG*GCCTCN
CBLT1_0025_E08.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0004_G05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCNGGGCCGTCN
CBLT1_0054_G01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0053_A07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0073_B07.b : CCTCCTCCCTCTCACCCG*CTTAAGTA*TTTA*TCCTCCTAA*CAGGGTCGGG*CC**TC
HTMT1_0094_C01.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTTATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0027_A10.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCCTTCTAA*CAGGGTTCGG*GCGTCG
HTMT1_0017_E05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCGTC
HTMT1_0063_D12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAAGGTCGGC*CCGTCC
HTMT1_0045_D10.b : CCTCCTCCCTCTCACCCG*CTAA*GTA*TTTAATCCTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0073_A06.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCG
CBLT1_0061_H05.b : CCTCCT*CCTCTCACCCG*CTAAAGTA*TTAAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0089_D09.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCTTAA*CANGGTCGGG*CCGTCC
CBLT1_0062_D02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAAGGTCGGC*CCTTCG
HTMT1_0043_E02.b : CCTCCCTCCTCTCACCNG*CTAAAGTA*TTT*ATCTTCCCTA*CAGGNTCGGG*CCGTCG
CBLT1_0059_H04.b : CCTCCCCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0043_G10.b : GCTCCTCCCTCTCACCCC*GCTAAGTA*TTTAATCTTC*TAA*CAGGNTCGGG*GCGTCN
HTMT1_0067_A10.b : GCTCCTCCCTCTCACCCG*CTAANGTA*TTTNATCNTNCCTA*CAGGNTCNGG*NCGTCG
CBLT1_0037_H08.b : GCTCCTCCCTCTCACCCG*CTAAAGTATTTAATCCTTCCTAA*CAAGGTCGGG*CCTTCG
CBLT1_0084_G04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCG
HTMT1_0071_D10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
HTMT1_0014_H06.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCCTCCCTA*CAGGNTCGGG*CCGTCG
CBLT1_0006_A07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGTTCGGG*CCGTCN
CBLT1_0055_D08.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCNGG*CCGTCN
CBLT1_0004_H12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTA*TCTTCCTAA*CAGGNTCGGG*CCGTCN
HTMT1_0042_F11.b : CCTCCTCCCTCTCAACCG*CTTAAGTA*TTTAATCTTTCTAA*CAGGNTCGGG*CCGTCN
HTMT1_0016_H08.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCT*CCTAA*CAGGGTCGGG*CCCTCG
CBLT1_0081_G11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAAACAGGGTCGGG*CCGTCN
HTMT1_0015_A09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
HTMT1_0040_B10.b : CCTCCTCCCTCTCACCCG*CTAAAGTATTTTAATCTTCCTAC*CAGGTTCGGG*CCGTCA
BFLT1_0007_D04.b : CCT*CTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTA**CAAGGTCGGG*CCGTCC
HTMT1_0024_B03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTT*ATCTTNCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0007_C02.b : catatctgtacacccgaaagcaggcgaagatatttgaggttgccgagcgcatcacctgta
CBLT1_0028_F01.b : ccccctccctcctccccgctaaagtatttaacctcccaaaaggggccggccctccgaaaa
HTMT1_0056_D12.b : CCTCCTCCCTCTCA*CCG*CTTAAGTA*TTaatctccctacagggtcgggccctcggaaa
HTMT1_0131_B02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA**TTAATCNTCCTAA*CNAGGGTCGG*CCGTCG
HTMT1_0104_G12.b : CCTCCTCCCTCCCCACCCGCTAAGTTA*TTTATTCTTCCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0042_B11.b : CCTCCCTCCTCTCACCGG*CTAAAGTA*TTTAATCTTCCCTA*CAGGNTCGGG*GCGTCG
HTMT1_0068_B12.b : CCTCCTCCCTCTCACC*G*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
CBLT1_0054_F08.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0085_H05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*ATTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0064_C09.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*GCGTCG
HTMT1_0047_B04.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTA**CAGGGTCGGG*CCGTCG
HTMT1_0068_D07.b : CCCTCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCG
CBLT1_0053_G06.b : CCTCCNTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCCTCG
HTMT1_0026_F11.b : CCTCCT*CCTCTCACC*G*CTAAAGTA**TTAATCTTCCTAA*CAGGGTTCGGCCCTTCC
HTMT1_0049_A09.b : CCTCCTCCCTCTC*CCCG*CTAAAGTA*TTT*ATCTTCCTAcaggntcgggccgtcggaa
CBLT1_0080_H12.b : CCTCCT*CCTCTCACCCG*GCTAAGTA*TTTAATCTTCCTAA*CAAGGTCGGG*CCCTCC
HTMT1_0104_F09.b : CC*CCTCCCTCTCCCCGG*CTAAGTA***TTAATCTTCCTAA*CAGGGTCGGG*CCTTCC
HTMT1_0071_A04.b : GCNNTCTCCTCTCACCNG*CTAAAGTA*TTTAATCTTCCCTA*CAGGNTCGGG*CCGTCN
HTMT1_0034_F11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0146_C12.b : CCTCCCTCCTCTCACCCG*CTAAAGTT*ATTAATCTTTCCTA*CAGGGTCGGG*CCG*TC
HTMT1_0136_G04.b : CCTCCTCCTCTCCCCGCT*AAAtatttatcttcctaccgggtcgggccntcgaaaggctt
HTMT1_0120_B01.b : gttttaacctctccaacgggcccggccttcgaaatgcttgccgccggacttctgatatat
CBLT1_0006_H07.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAAGGTCGGG*CCGTCC
HTMT1_0036_D12.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0133_G04.b : CCTCCNTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCG*TC
HTMT1_0036_E11.b : CCT*CTCCCTCTCACCgctaaagattaaacctcccaacaagtctggccctcgaaaaggct
CBLT1_0062_A01.b : CCTCCTCCCTCTCACCCG*CTTAAGTA*TTT*ATCTTCCTAA*CAGGGTCGGG*CCGTCC
HTMT1_0085_D02.b : cggaaaaatttaaccttccaaaagggggccggcccccaaaaaagttttgggggggaacct
HTMT1_0063_E09.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCNTA*CAGGGTCGGG*CCGTCG
CBLT1_0024_D10.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*ATTAATCTTCCTTAACAGGGTCGGG*CCGTCC
CBLT1_0024_B03.b : CCCTCTCCCTCTCCACCG*CTTAAGTA*TTTATTCTTCCTAA*CAGGGTCCGG*CCCTCC
CBLT1_0069_G11.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCCGG*CCGTCN
CBLT1_0075_E09.b : CCCTCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTTA*CAGGGTCGGG*CCGTCN
CBLT1_0052_G05.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCCTA*CAGGGTCGGG*CCGTCN
CBLT1_0074_H03.b : CCTCCTCCCTCTCAACCG*CTAAAGTA*TTAAATCTTCCCTA*CAAGGTCGGG*CCGTCC
CBLT1_0052_H03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0052_H02.b : CCTCCCTCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCN
CBLT1_0042_B03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
CBLT1_0075_G03.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
HTMT1_0086_E02.b : CCTCCTCCCTCTCACCCG*CTAAAGTA*TTTAATCTTCCTAA*CAGGGTCGGG*CCGTCG
20110601C-000217 : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAG
---------+---------+---------+---------+---------+---------+ 1050
CBLT1_0023_A08.b : aagcttggcgggcggaaccttggtatttgactttgggcgggcacgggaaaagccccgggg
HTMT1_0050_B08.b : ttggcggcggaactttggtatgtactgggggccggcaccgaaaagccccgtggccgtgct
CBLT1_0068_D11.b : tgggcggggacctttttgtatttaacattgtggcgcgccaccgggaaaaagccccgggtg
CBLT1_0077_C07.b : ggcttggcgcggaagcttggtatgtgacatgtggcgggcaaccggaaagccccggtggcc
HTMT1_0126_A09.b : aaggctggncngcggggactttngttgtgacatgtggcgggcaccggagaagccccgttg
HTMT1_0038_C01.b : CGAAAGGCTTGGCGGCGGGgagctttggtaggtgaactgtgggccgggcaccggggaaag
HTMT1_0038_D01.b : GGAAAAGCTTGGCGGGCGGGACCTTTGG*TATGTGACATGgtgggcgggcaacgggaaaa
CBLT1_0055_F02.b : CGAAAGGCCTGGCGG*CGGGAGCTTTGG*TATGTGACATGTGGGC*GGCCACCGGGAAAG
HTMT1_0079_B03.b : GGAAAGcttggccgcgggagctttggtagtgacatggggcccgcacacggaaaagccccg
HTMT1_0145_A10.b : agcttgccgccgaagctttggttgtgacatgtgggcggcaacgggaaagccccgtggccc
CBLT1_0042_C01.b : GGAAAGGCTTGGCGGCGGGGAGCTTTGG*TATGTGACATGTGGGC*GGccaccgggaaaa
HTMT1_0012_E08.b : GAAGAGGCTTGGCGGCGGGAANCTTTGG*TATGTGAcattgggggcgggccaacggaaga
HTMT1_0012_F03.b : GAGAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCAACCGGAAAA
HTMT1_0006_A04.b : GAGAAGCTTGGCGG**CGGAAGCTTTGG*TATGTGACATGTGGGC*GGGCANC*GGAGAA
HTMT1_0003_B02.b : NGAGAGGCTTGGCGG*CGGGAGCTTTGG*TATGTGACATGTGGGC*CGGCACCGGGAGAG
HTMT1_0005_F06.b : CGAAAGGCTTGGCGG*CGGGAACTTTGG*TATGTGACATtgtggccggcaccggaaaagg
HTMT1_0111_E01.b : aggctggcggcggaactttggtattgacagtgggcgggcaccggaaagcccccgtggcct
HTMT1_0037_B01.b : gataggcttgggcgccgggagctttggtatgggacaaggtgggccggccaacgggaaaag
HTMT1_0035_E04.b : *GAAAGGCTTGGCG*CCGGGACCTTTGG*AATGgacttgggggcggccaccggaaaagcc
CBLT1_0040_F03.b : GAAAGGCTTGCCGG**GCGGAACTTTGG*TATGTGACATGTGGGC*CGGCAACGGGAgag
HTMT1_0027_C08.b : GAGAGGCTTGGCCG**CGGGAGCTTTG**TATGTGACATGTGGGC*GGGCACCGGGAGAG
HTMT1_0012_H10.b : GAAAAGCTTTGGCG**CGGGAGCTTTG**TATGTGACATGTGGGC*GGGCANCGGAAGAG
HTMT1_0011_B07.b : GAAAGCTTGGGCGG**CGGGACCTTTGG*TATGTGACATGTGGGC*GGGCACCGGGAGAG
CBLT1_0093_A09.b : tggcgcggggaacttggtatttgacattggggcggcacgggaaagcccccggggccctgc
HTMT1_0144_G09.b : gcggaactttttattaaattgggcgcaccggaaagcccccttgccttgtccccccccacc
CBLT1_0068_C08.b : ctgggggcggaacttttgttttaacattgggcgggcaccggaaaagcccgggggccctgg
HTMT1_0109_F08.b : gccggcggacctttggtttttaaatgggggcggccaacggaaaagccccgtggccttggc
CBLT1_0038_E04.b : gggctggcggcggaaccttggtatgtgactgtgggccggcancgggaaagccccggtggc
HTMT1_0089_E09.b : ccttggcgcgggacctttggtatgtgacatgtggcgggcaacgggaaagccgcggtggcc
HTMT1_0014_H01.b : aaaggctgacagccggagctttggtaatgtgaacagtgggcaggccccgatagagccccc
HTMT1_0087_A04.b : gcttgggcgcggacttgggtatgtactgtgggcggcaacggagaggcccgtgccgtgctc
CBLT1_0078_G12.b : ggaaaagcctgggggcgggaacttttggtatgtgaactgtgggccggcacccggaaaggc
HTMT1_0050_A03.b : gaaagctttgcgcngnagctttgtatgtgactgtggcggnnncacggaaagccgcggtgg
CBLT1_0086_E03.b : GGAAAGCTTGGCGG**CGGGAGCTTTGG*TAgtaacatgtgggccggcaacggggaaagc
HTMT1_0028_C05.b : GAGAGGCTTGGCGG**CCGGAACTTTGG*TAAGTGAatgtggggcggcaacgggaaaggc
HTMT1_0042_F09.b : GAAGAGGCTGGNCG**CGGGAGCTTTGG*TATGTGACtgtgggcgggcaacgggaaaagc
HTMT1_0109_A05.b : NGANNAGCT*GGCCNGCGGNAGCTTTGG*TATGTGACATGTGGGC*GGGCAacggaaaag
HTMT1_0006_E11.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGCC*GGGCACCGGGAAAG
HTMT1_0134_F06.b : NGAAAGGCTTGGCGGCCG*GAGCTTTTG*TATGTGACATGTGGGC*GGGCCACGGGAAAG
CBLT1_0042_E07.b : GAAAGGCTTGGCNG**CGGGAACTTTGG*TATGTGACATGTGGCC*GGGCAACGGGAAAA
HTMT1_0134_C07.b : GANNAGC**TGGNCGGCGGNANCTTTTN*TATGTGACATGTGGGC*GGGCAACCGGAGAA
CBLT1_0072_C10.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACCTGTGGGC*GGGCAACCGGGAAA
ILNT1_0001_B08.b : GAAAAGGCTGGCGG**CGGGAGCTTTGG*TATGTGAAATGTGGGC*GGGCACCGGGAAAG
CBLT1_0078_C11.b : GAAAAGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCAACGGAAAAG
CBLT1_0061_E10.b : GAAAAGCTTGGCCGG*CGGGAACTTTGG*TATGTGACATGTGGGC*CGGCACCGGGAAAA
HTMT1_0002_C03.b : GAGAAGGCTTGACGG*CGGGAGCTTTGG*TATGTGACATGTGTGC*GGCCACGGGAAGAG
HTMT1_0025_D10.b : GAGAGGCTTGCCGG**CGGGAGCTTTGtatgtgaaatggggccgggcacggaaaagcccc
HTMT1_0002_F07.b : GATAGGCTTTGGCG**CGGAACCTTTGG*AATGGGACATGTGGGC*GGGCAGCGGGAAAA
HTMT1_0128_H06.b : GAAAGcttgccggcgggactttggtattgacatgttggcgggcacgggaaaagccccgtt
HTMT1_0064_A02.b : GAGAAGCTTGGCCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGNCANCGGGAAAG
CBLT1_0073_C05.b : ctttgttatttacattggccggcacggaaaaggcccgtggcctgctcccccccccaccaa
HTMT1_0138_A04.b : ctttgtagtgactgtgggcggcacggaaagccccgtggccctgctcaccccccgctaccc
HTMT1_0025_F09.b : tggccgcggaactttgggatgtgaaatgtgggcgggcaacggaaaaagccccgtggcctt
HTMT1_0105_A01.b : tttggcggcggacctttgtatgtaaatttgggcgggcacggaaaaggccccgtgggcctg
HTMT1_0120_E04.b : tgccggcgggactttggtagtaacttggggcggccaacggaaaggcccggtggctggccc
HTMT1_0010_E11.b : ggaaaagctttggcggcgggaactttgggtatgtgacattgtggccgggcaaccggaaaa
CBLT1_0039_B10.b : ttggcggcgggaactttggttgtgactgtgggcgggcaacgggaaaggccccgtggccgt
HTMT1_0117_G02.b : tggggagcgggaacttgattaataattgtggccggtccaggtaaagctcctatgccttat
HTMT1_0107_A07.b : gcggcgggactttggtatttaaatgtgggcggcaaccggaaagccccggggccctggctc
HTMT1_0106_C10.b : ggcggccggagctttggtagtaactttggccggcaacaggaaaggcccgtggcctggccc
HTMT1_0104_B07.b : aaaggcttggcggccggaaccttggtttgttacaagtggggcgggccaccggaaaggccc
HTMT1_0106_A11.b : gaaaaagctgggcgggggggaacttttggtaagtaaaattggggccgggccaacgggaaa
HTMT1_0137_G02.b : ttggcgcggaactttgtaatggacatgtggcgggcaccgggaaaggcccggtggcttggc
HTMT1_0057_G09.b : aaagcttggccggcggaactttgttatgtaaatgggggcggcaacgggaaaaggcccggt
HTMT1_0047_D10.b : tgcggcgggactttggtagtaactgtgggcggccacggaaaagccccggggcttggctac
CBLT1_0056_D12.b : aaaaggcttggcggcgggaagcttttgtatgtgacatgtgggccgggcaccgggaaaggc
HTMT1_0047_F01.b : aagctttgccgcggacctttgtatgtgactgtgggccggcaccgggaaaggcgcggtggc
HTMT1_0044_G09.b : tggcgcgggagctttgtatgtgactgtgggcgggcacggaaaagcccggtgccctgctca
HTMT1_0141_E10.b : aaggctggcggccgggaccttggtatgtgacatgtgggcggcacacggaaaggccccgtg
HTMT1_0149_G10.b : aaggcttgccgcgggagctttgtttgtaactgtgggccggcaccggaaaagcccccgtgc
CBLT1_0055_C05.b : aagcttggcggccggaacttggtatgtgacatgtgggccggcaacggaaaagcccccgtg
CBLT1_0021_D08.b : aaaggcttggcggcggaactttggtagtgactttgggcgggcaccgggaaaggcccggtg
HTMT1_0099_B11.b : aaaggttgggcggcggaacttttggtatgtgactggggggcgggccacgggaaaagcccc
HTMT1_0121_B03.b : aggctggcggcggaaccttgtatgtactgttggccgcacggaaaagcccgtggcctgctc
HTMT1_0151_F05.b : aaaggctggcggcgggagctttgaatgtgacatgtggcgggccacggaaaaagcccggtg
HTMT1_0011_A04.b : CGATAAGGCTTGGCGGCGGGAGCTTTGG*TATGTGACATGgtgggggggcaaccggaaga
HTMT1_0010_H05.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*CGccancggaaaag
HTMT1_0025_A07.b : GAAAGcttgccggcggagctttggtatgtacatttggcgggcaccggaaaagccccgggg
HTMT1_0021_A06.b : GAAAGcttggcggcggaactttggtagtaaactgtggcgggcaccggaaaagcccccggt
HTMT1_0095_B10.b : GAAAGGCctggnccgcgggacttttggtatgtaactgtgggcggncancggaaaagcccc
HTMT1_0021_G07.b : GAAAAGgctttggcggcgggaacttttgtatgtgaaatggtgggccgggcaaacggaaag
HTMT1_0086_H08.b : GANAAGCTggncgcggnnagctttgtatgtgnacatgtggcggnncacgggaaaagccgc
HTMT1_0037_B06.b : GAAAGGCTTGGCcggcggaaactttggtaggtgacatgggggccggcaacgggaaaagcc
HTMT1_0013_B03.b : GAAAGGCTTTGGCGgcgggaactttgtaagggacatgtgggccggcaccggaaaaggccc
HTMT1_0065_B01.b : GANAGcttggnncgcggagctttgtatgtgacatngtggcggncancgggaaagccgccg
HTMT1_0028_B11.b : GAAAGGCCTGGCGGCcgggacctttggtagtgaacttgtggccgggcaaccggaaaagcc
CBLT1_0037_B12.b : GAAAGGCTTGGCGG**CGGGAACTTttggtatggaacatgggggcgggcacccggaaagg
HTMT1_0118_B12.b : GATAGGCTTGGCGG**CGGGAACTTTGtttgtgaacatggggccgccaacgggaaaagcc
HTMT1_0117_E09.b : GAAAGGCTTGCCGG**CGGGACCTTTGttattgaacagggggcgggcaccggaaaggccc
CBLT1_0046_C06.b : GAAAAGCTTGGCGG**CGGGACCTTTGtatgtgactgtgggccggcacgggaaagccccg
CBLT1_0028_G06.b : AAAAGGCTTGGCGG**CCGGAGCTTTGG*Ttatgtaacatgtgggcgggcaaccgggaaa
HTMT1_0111_D11.b : AAAAGGCTTGGCGG**CGGGAGCTTTGG*Ttagtaaatttgggcgggccacgggaaagcc
HTMT1_0092_C07.b : GAAAAGCTGTGCGG**CGGGAACTTTGG*Ttgtgaacatgggggcggcaccgggaaaggc
HTMT1_0013_D07.b : GAAAGGCTTGGCGG**CGGAACCTTTGG*TATGgacatgggggcgggcaccgggaaaagc
CBLT1_0076_G10.b : G*AAGGCTTGGCGG**CGGGGACTTTGG*TATGTacatgtggccggccaccggaaaggcc
HTMT1_0098_B07.b : GAAAGGCTTGGCCG**CGGGAGCTTTGG*TATGgaactgtgggcgggcaccggagaagcc
HTMT1_0064_B07.b : GAAAGGCTTGNCGG**CGGGAGCTTTG**TATGTGACATGTGGccggccaacggggaaag
HTMT1_0133_A12.b : GAAAGGCTTGGCGG***CGGGAGTTTTG*TATGTtaaatgtgggccggcaacgggaaagg
HTMT1_0048_C02.b : GAAAAGCTTGGCGG**CGGNAGCTTTGG*TATGTGACTTGTGGccggcaacgggaaaggc
ILNT1_0002_G10.b : GAAAAGCTTGGCGG**CCGGAGCTTTGG*TATGTGACATGTTGGC*CGGgcaccggaaaa
HTMT1_0094_D10.b : GAAAAGCTTTGGCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*CGGCAACGGaaaag
HTMT1_0046_G11.b : GAAAAGCTTGGNCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCANCGGGAGAG
CBLT1_0034_A11.b : GGAAAGGCTTGGCGG*CGGGACCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAA
HTMT1_0083_G02.b : GAAAAGGCTTGGCGGCGGGAAGCTTTGG*TA*GTGACATGTGGGC*GGGCAACCGGAAAA
HTMT1_0042_A07.b : GAAAAGCTTGGCNG**CGGNAGCTTTTG*TATGTGACATGTGGGC*GGNCACCGGAAAAG
HTMT1_0056_H09.b : GAAAAGCTTGGCG***CGGAAGCTTTGG*TATGTGACATGTGGGC*GGGCANCGGAAAAG
HTMT1_0087_A03.b : GAGAGGCTTGGCCG**CGGGAGCTTTGT*TA*GTGACATGTGGGC*GGGCANCGGGAAAA
HTMT1_0060_E10.b : GANNAGCTTGGCGG**CGGNAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAG
CBLT1_0044_D03.b : GAAAAGCTTGGCGG**CNGGAAGCTTTG*TATGTGACATTGTGGC*GGGCACCGGGAAAA
HTMT1_0016_A07.b : GAAAAGCTTGGCCG**CCGGAACTTTGG*TATGTGAACTGTGGGC*GGGCACCGGAAAAG
HTMT1_0061_H06.b : GAAAGGCTTGGNCG**CGGNAGCTTTGG*TATGTGACATGTGGGC*GGGCACCGGAAAAG
HTMT1_0139_A10.b : GAANAGCTGGGNCGGCGN**AGCTTTGG*TAT*TGACATGTGGGC*GGGCANCGGGAAAA
CBLT1_0053_F07.b : GAAAAGCTTGGCGG**CGGGAGCTTTTG*TAAGTGACATGTGGGC*GGGCACCGGGAAAA
CBLT1_0034_F12.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGCGGCCANCNGGAAAAG
HTMT1_0076_H02.b : aaggttgggacgggggaagcttttgggtatgggaaattgggggccggccaccggaaaaag
CBLT1_0067_B02.b : aaaaggctttggcggggcggaactttggtatttgaaatgttgggcgggccccccggaaaa
HTMT1_0007_C05.b : aaaaggctggcggcgggactttggtatgtgacatgtgggcggccaacgggaaaggcccgg
HTMT1_0041_C07.b : aagcttggcgggcgggaactttggatgtaaaaggggggcgggcaacggaaaaagcccggg
HTMT1_0036_E07.b : aggctgggcggcgggacctttggtatgtaacatgttggcgggcaaccgggaaaggccccg
HTMT1_0010_C06.b : GAAAGGCTTGCCCGC*CGGGAACTTTGG*TATGTGACATGTGGGCGGNCANCCGGGAAAA
HTMT1_0126_H07.b : GAANAGCTTGGCNG**CGGNAGCTTTGG*TATGTGACATGTGGGC*GGGgcacggagaag
HTMT1_0113_A02.b : NGAAAAGCTTGCCGGCGGGAAC**TTGG*TAAGTGACATGTGGGC*GGGCANCGGGAAAG
HTMT1_0120_A12.b : gacctttggtattaactttggccggcaaccgaaaacccccgtgtgctggcctaccccccc
CBLT1_0024_B08.b : cttgccggccggaacttggtatgtgacattgggccggcaccggaaaggccccggtggcct
HTMT1_0118_H02.b : gaaaagcttgcgggcgggatctttgtatgtaaatgggggccggcaatcggaaaggccccg
HTMT1_0045_F04.b : GAAAAGCTTGGCGGCGGgaactttggatgtgacatgtgggccggcaaccggaaaagccgc
HTMT1_0053_C11.b : GAAAAGCTTGGCGG**CNGGAGCTTTGG*T*TGTGACATGTGGGcggccaccgggaaagc
HTMT1_0042_E11.b : aggctggcagcgggagcttggtatgtgaatgtgggcgggcacgagagaggcgcggtggcc
CBLT1_0067_E11.b : cctttgattttaaaatggggggggacccggaaagcccccggggccttgcccccccccccc
CBLT1_0074_F01.b : tgggggcggaactttggtattgacattgggggcgggacccggaaaagccccggtggcctg
HTMT1_0136_H12.b : tggcgggcgaacctttggtatgtaacaggggggcggcaacgggaaagccccggtgcccgt
HTMT1_0126_E03.b : gcgggacttnngttgtgacatgtggcgggcacggaaagcccggtggcgtgctcacaccca
HTMT1_0147_C10.b : gcttgccgccggagctttggtagtgactgtgggcggcaccggaaaggcccggtggcgtgg
HTMT1_0041_H02.b : ataagcttgccggccggaactttggtaggggaaatgggggcgggaaccggaagaagcccc
HTMT1_0117_D03.b : aaagctctggcggcggaacccttggaatttaactgtgggccggacaccaggaaacccgcg
HTMT1_0034_B04.b : GGAAGCCTTGGCGG**CGGGAACTTTGG*TAatgggacatgggggcgggcaaccggaaaa
CBLT1_0077_E12.b : ggaaaaagcttggcggcgggaccttgggttgttaaaatgtgggggggcaaacggaaaaag
HTMT1_0118_F12.b : GAAAGGCTTGccgcgggaactttggtatgtacatgtgggcgggcaaccggaaaagccccg
HTMT1_0066_C01.b : GAAAAGCTTGGCGG**CGGGAGCTTggtatgtgacattgtggcggncancggaaaagccc
HTMT1_0073_B12.b : GAAAAGCTTGCCGG**CGGGAGCTTTGtaagtgacatgtggcgggcaacggaaaaagccc
CBLT1_0072_H09.b : GAAAGGCTGGCGG***CGGGAGCTTTGG*TA*GTGACATGTGGGC*GGGCANCCGGAAAA
HTMT1_0041_A02.b : GAAAAGCTTGGGCG**CGGGAGCTTTGN*TATGTGACATGTGGGC*GGGCAACGGGAAAG
CBLT1_0005_E10.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAA
HTMT1_0111_A02.b : GAAAGGCTTGGCCG**CGGGACCTTTGG*TATGTacatgtggccggcaaccgaaaaggcc
HTMT1_0076_C01.b : gtattgaaaaatgggggggccacggaaaagcccgggggcctgggttccccccccccttct
HTMT1_0122_D09.b : ttggcggcggaactttggtatttaacattggcgggcaacggaaaagccccgtggccttgg
CBLT1_0009_G11.b : GAAAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*CGGCANCGGGAAAa
HTMT1_0093_H12.b : GAAAGGGCTGGGCG***CGGGACTTTTG*TATGTGACATGTGGGC*GGGCAACGGGAAAG
HTMT1_0060_B12.b : gatatgcgcnnnngagaannagagcgggctggnnnnnnnnncnnccaccatccanntaca
CBLT1_0034_H05.b : ggactctttgattgtaaatttgtgggggcacccggaaaacccccgggggcctggcttcac
HTMT1_0059_D04.b : tatttacatgtggcggcaccggaaggccggtggccgtgctccaccccactcacgagaggg
CBLT1_0068_G08.b : ctttggcggcgggaacttttggtatttaacctgtgggccgggccccgggaaaggccccgg
HTMT1_0115_B01.b : cttttggattgaactggggcggccaccggaaagcccgttggcctggccccccccccgctc
HTMT1_0058_C04.b : actttgtaatgtacatggggcgggcacgggaaagccccggtggcctgtttcaccccccaa
CBLT1_0073_F08.b : aactttggttttaaatgtggccgggcaccgggaaagccccggtgccgtggcccccccccc
HTMT1_0013_A02.b : gcggcgaaaccttggtatagacatgaggacggattattataaaccctagttgctttgttc
CBLT1_0067_B11.b : ggggggaacctttgttatttaaaattggggcgggccacgggaaaggccccggggtgccgt
HTMT1_0119_B12.b : ttaaaaaaatctttttgagtttggccaccccacctcaaagtgggggaaaaaagggctcat
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : cngnagcttngtatgtgacatgtggcggggcacggaaagccccgtggccntgctcacacc
HTMT1_0111_F07.b : ggcgggagctttgtatgtaaatgtggccgggcacgggaaaggccccgtggcccttgctac
HTMT1_0105_F06.b : cggcggaacttggtatttgaaatgggggcgggcacggaaaagccccggggccttggccac
HTMT1_0117_H09.b : ccggaccttggttaggacttgtgggcgggcacgggaaagccccggggccttgcccccccc
CBLT1_0073_B11.b : aaaagccttggcgggggggaccctttggtttgtaacattgtggccggccaaccgggaaag
HTMT1_0119_D08.b : cttggcgacgggatctttggcatgtgactagtggccggcccccagaaagcctcgggggct
HTMT1_0126_F11.b : gactttgtattttaatttggccggccacggaaaagcccggtgccctgctcaccaccccat
HTMT1_0128_E02.b : gcggcgggactttgtagtgacttggggcgcaccggaaagcccggtgccttgctacccccc
CBLT1_0050_C05.b : ttggcggcgggagctttggtagtgacatgtggcgggcaacgggaaggcgcgttgcccntg
HTMT1_0035_H01.b : aaaaaggcttggcgggcgggaacctttggttaggggaaatgtgggccgggcaaccggaaa
HTMT1_0035_D11.b : aaaaggcttggcgggcggaaacttttggtatgtgacatgggggccggacaacaggaaaag
CBLT1_0096_H03.b : ttggcgcggaacttggtagtgacatgtggcgggcacggaaagccccggtgcctgctcaca
HTMT1_0140_H10.b : ggcgccgagctttgtagtgactgtggcgggcancggaaaggccccgtgccntgctcccac
CBLT1_0038_D11.b : aaaaggcttggcggcgggaactttggtatgttaacatgtgggccggcaaccggaaaaggc
HTMT1_0132_F08.b : gcttgccggccggagctttgttagtgacttgtggccggcaacgggaaagcccctgtggcc
HTMT1_0016_D05.b : agcttgccggccggaccttggtatgtgaatgtgggcgggcacggagaagccccggggccg
HTMT1_0097_G08.b : aaaaggcttgggggggggacctttggttgtgacatgtgggcgggcaaccggaaaaggccc
CBLT1_0041_C10.b : aaagcctggccgccggagctttggtaggtaaatgtgggcgggcaccgggagaggccccgg
HTMT1_0121_B01.b : aggctggcggcggaactttggtagtgaaatgtgggcggcaaccggaaagtcccggtgtcc
HTMT1_0113_B09.b : aaagctggcggcgggaactttgttattaaattttggcgggccacggaaaagcccccgtgg
HTMT1_0077_E08.b : aagcttgccggccggagcttggtatggaaatgtgggccggccacggaaaggcccggtggc
CBLT1_0041_D07.b : gaagcttggcgcgggaccttgttattgacatgtgggcgggcaccgggaaaggccccgtgg
HTMT1_0148_A09.b : gcttgcggcggaactttgtatttacatttggcggcaccgggaaagcccccttgccctggc
HTMT1_0132_F03.b : aagcttggcggcgaaactttggatgtgactgtgggccgcaaccggaaaggcccggtgccg
HTMT1_0140_C12.b : ttggcgcggaactttggagtgactgtgggcgggcacggaaaagccccgttggctgctccc
HTMT1_0140_F06.b : ggctggcngcggnagccttggtagtgacatgtggccggcacgggaaaagccccgtggccg
CBLT1_0024_F01.b : aaaaggctggcggcgggaactttgttatggaattgtggccggcaccgggaaaaggccccg
HTMT1_0106_E05.b : aagcttggcggcgggactttgttagtaaatgtgggcggcaacgggaaagccccggtgcct
HTMT1_0099_C09.b : aaggctggcggcggaaccttggtatgtgacatgtgggcggcaacggaaaggccgcgtggc
HTMT1_0101_E05.b : agaagctggccggcgggaacttttgtatgtaacatggggcgggcaccgggaaaagcccgg
HTMT1_0021_A08.b : aagcttggcgccggaacctttggttttgacattgtggcgggcaacggaaaggcccggtgg
HTMT1_0128_G08.b : annagctggncgcgggagctttgtatgtgactgtgggcgggcacngaaaaagcccgtggc
HTMT1_0120_B12.b : aaagcttgccggcgggacctttgtaagtgacatgtgggcgggcaaccggaaaaggcccgt
HTMT1_0028_G05.b : agcttggccggcggaccttggtatgtgacatgtgggcggcaccggaaaagccccggtgcc
HTMT1_0060_C11.b : aggctggncgcggaacttttgtatgtgacatgtgggcggcanccggaaaagccccggtgg
HTMT1_0044_H10.b : nagcttgnncgcnggagctttgtatgtgacaatgtgggcgggcacggaaaagcccccgtg
HTMT1_0026_D07.b : aaaagcttggcgncgggagctttggatgtgactgtggccggcaccgggaaaggccccggg
CBLT1_0060_G12.b : cgaaaaggcttgccggcgggaactttggttatgtgaaatgtggggcgggcaaccggaaaa
HTMT1_0105_B03.b : GAAAagcctggccggcggaacctttggtattgaactgtgggccgggcacgggaaaaggcc
CBLT1_0011_E06.b : GAAAagcttggccggcggaagctttggtatgtgacatgtgggcgggcaacgggaaaaggc
HTMT1_0135_B04.b : aaaggctggcggcggactttgttatgtacatgtggcgggcacggaaagcccccgtggcgt
CBLT1_0080_E02.b : GAAAGGCTggcggcgggaacttggtatgtgaatgtgggcggcaaccggaaaggcccggtg
CBLT1_0064_A08.b : aaaggctggcggcgggagcttggtatgtgacatgtgggcgggcaacgggaaaggccccgt
HTMT1_0139_E01.b : GAAAGCTTGccggcgggactttggtatgtgacagtgggcgggcacgggaaaggccccgtt
CBLT1_0090_F01.b : GAAAGGCTTGGtcggcgggacctttggtagtgacattgtggccggccaccgggaaaaccc
HTMT1_0034_H09.b : GAAAAGCTTGGCCGgcggaagctttggtaagtgacattgtgggcgggcaacgggaaaagc
CBLT1_0014_C12.b : GAAAGGCCTGGCcggcgggaacttttggtagttgacatgtgggccgggccaccggaaaag
CBLT1_0088_A03.b : GAAAGGCTGGGCGcgggagctttggtagtgaaatgtgggccgccacccggaaaaggcccg
HTMT1_0106_B11.b : GAAAAGGCTGGCGGgcgggacctttgggtattgaattgtggccgggcaacgggaaaaagc
HTMT1_0064_G04.b : GAAAGGCTGGGCGcgggagctttgtatgtgactgtgggccggcacgggaaagccgccgtg
HTMT1_0062_E07.b : GAAAAGCTTGGCGcnggagctttgtatgtgacatgtgggcggcaacgggagaggccgcgt
HTMT1_0095_A12.b : GAAAAGCTTGGCCGgcggaacctttggtatgggaaatgtggggcgggcaaccggaaaagc
HTMT1_0150_D11.b : GAAAAGCTTGGCGGCcgggaactttggtatggaaatgggggccgggcaccgggaaaaggc
HTMT1_0122_B12.b : GAAAAGCTTGCCCGCGGagccttgggtagtgacatgtggcgggcaccgggaaagccccgg
HTMT1_0141_H07.b : GAAAGGCTTTGCGGCcgaaaccttgtatgtaacctgtgcgcgggcaccaggaaaaccacg
CBLT1_0040_B05.b : GAAAAGCTTGGCCGGCGGAACTTtggtaagtgaacatgtggcgggcaacgggaaaggccc
CBLT1_0052_A10.b : GAAAAGCTTGGCCG**CGGGAGCTTTGtatgtgacatgtggcccggcaccgggaaaggcc
HTMT1_0025_C06.b : AAAAGGCTTGGGGG**CGGAAGCTTTGGaagtgacatgtgggcggcaaccgggaaagccc
HTMT1_0067_H07.b : GAAAGGCTTGGCGG**CGGGACCTTggtatggaactgtgggcgggcaccggaaaagcccc
CBLT1_0082_A09.b : GAAAAGCTTGGCCG**CCGGAGCTTTGG*TAgtgaactgtgggcgggccacgggaaaagc
HTMT1_0013_F01.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TAgtgaaatgggggcgggcaaccggaaaagc
HTMT1_0130_C05.b : GAAAAGCTTGGCGG**CGGGAGCTTTTG*TATGTtcatgtgggcgggcaccggaaaagcc
HTMT1_0099_A06.b : AAAAGGTTTGGCGG**CGGAACCTTTGG*TAgtgactgttggcgggcaccggaaaagacc
CBLT1_0036_C05.b : GANAAGCTTGGCGG**CGGGAACTTTGG*TATGTtaacatggggcggccaaccggaaagg
CBLT1_0037_B04.b : GAAAGGCTTGCCGG**CGGNAGCTTTGG*TATGTacatgtgggcgggcaccgggaaagcc
HTMT1_0132_A04.b : GAAAAGCTTGGCGG**CGGGAACTTTGG*AATGTaattgtgggcggccaacggaaaaggc
HTMT1_0070_G03.b : GAAAAGCTTTGGCG**CGGNAGCTTTGN*TATGTtgacatgtggcggncancggagaagc
HTMT1_0111_H01.b : AAAAGGCTTGGCGG**CGGGACCTTTGT*TATGTaaaagtgggccgggcaccggaaaagc
HTMT1_0100_F01.b : GAAAAGGCTGGGCG**CGGGAGCTTTGG*TATGTGAatgttggccggcaccgggaaaagc
CBLT1_0044_C08.b : GAAAGGCTTGGCGG**CGGGACCTTTGG*TATGTGACATGgtgggcgggcaacgggaaaa
HTMT1_0133_A10.b : GAAAAGCTTGGCGG**CGGGAGCTTTGtatttgacatgtgggcgggcacgggaaagcccc
CBLT1_0075_B12.b : GAAAAGCTTGGGCG**CGGGACCTTTGG*TATGTGACATGTtggccgggcaacggaaaaa
HTMT1_0027_B01.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTtgggcggcacccggagaag
CBLT1_0088_G06.b : GAAAGGCTTGGCGG**CGGGAACTTTTG*TATGTAACATTTGGccggccaccggaaaagc
HTMT1_0048_A11.b : GAAAAGCCTGGCCG**CGGGAGCTTTGG*TATGTGACATGgtgggcggcaccgggagagc
CBLT1_0046_H09.b : GAAAGGCTTGGCGG**CCGGAGCTTTGT*TATGTAACATGTGGGCcggcaccggaaaagc
CBLT1_0004_D05.b : GAANAGGCTGGCGGC*CGGGACCTTTGG*TATGTGACATGTGGGgccggcaccgggaaaa
HTMT1_0103_C12.b : GAAAAGGTTGGCGG*CCGGGAGCTTTTG*TATGTGACATGTGGGgcgggccacgggaaag
CBLT1_0035_B11.b : GAAAGGCTTGGGCG**CGGGAACTTTGG*TAAGTGACATGTGGGCcggccaccgggaaga
HTMT1_0076_B06.b : GAGAGCTTGGGCGG**CGGGACTTTTGG*TAAGTGACATGTGGGCcgggaaccgggaaag
HTMT1_0095_F01.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGcgggcaacgggaaagcc
CBLT1_0013_B03.b : GAAAGGCTTGGCGG**CGGGAGCTTGGG*TATGTGACATGTGGGCcggccaccgggaaag
CBLT1_0095_H06.b : GANNAGCTTGGCNG**CGGNAGGCTTNG*TATGTGACATGTGGGC*GGGncaacggaaaa
HTMT1_0016_G09.b : GAAAGGCTTGGCCG*CGGGGAGCTTTGG*TATGTGACATGTGGGC*GGccaaccgggaaa
HTMT1_0019_D11.b : GAGAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCcacggaaaag
CBLT1_0025_B07.b : GAAAGGCCTGGCGG**CGGAAACTTTGG*TATGTGACATGTGGGC*GGGCAcacggaaaa
HTMT1_0028_H02.b : GAGAGGCTTGGCCG*CGGGGAGCCTTGG*TATGTGACATGTGGGC*CGGgcanccggaaa
CBLT1_0085_H01.b : GAAAGGCTTTGCGG**CGGGAACCTTGG*TATGTGACATGTGGGC*GGGCACCGGaaaag
HTMT1_0054_B11.b : GAAAGGCTTGCCGG**CGGGAACTTTGG*TATGTGACATGTGGGgcggcaacggaaaagg
CBLT1_0051_A01.b : GAAAGGCTTGGCGG**CGGGAGCTTTGT*TA*GTGACATGTGGGC*GGGCACCGGaaaaa
HTMT1_0014_G11.b : GAAAAGCCTGGCGG**CCGGAGCTTTTG*TATGTGACATGTGGGC*GGGCAACGGaaaaa
HTMT1_0134_G05.b : GAAAGGCTTGGCNG***CGGNAGCTTGG*TATGTGACATGTNGGC*GGccaccggaaaag
HTMT1_0034_E03.b : GAAAAGCTTGGCGG**CGGGAACCTTGG*TATGGTAAATGTGGGC*GGGCAACGGGAAAA
HTMT1_0084_E09.b : GAAAGGCTGGGNCG**CGGNAGCTTTGG*TATGTGACATGTGGGC*GGCCAACGGGAAAG
CBLT1_0061_C12.b : GAAAGGCTTGGCCG**CGGGAACTTTGG*TATGTGAAATGTGGGC*GGGCAaccgggaaa
HTMT1_0149_F10.b : GAAAGGCTGGGCGG**CGGGAACCTTGG*TATGTGACATGTGGGC*GGGCACCGGGAAAa
CBLT1_0039_D07.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTTACATGTGGGC*GGACAACGGAAAAG
CBLT1_0034_F10.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAg
HTMT1_0051_A10.b : GAAAGGCTTGGCCG**CGGGAGCCTTGG*TATGTGACATGTGGCC*GGGCAACCGGAAAg
CBLT1_0039_D10.b : GAAAGGCCTGGCGG**CGGGAGCTTTGG*TATGTTACATGTGGGC*GGGCANCCGGAAAG
HTMT1_0022_F01.b : GGAAAGGCTTGGCGG*CGGGAACTTTGG*TATGTGAACTGTGGGC*GGGCACCGGGAAAG
CBLT1_0015_E12.b : GAAAAGCTGGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCCACCGGAAAA
HTMT1_0041_B02.b : GAAAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAA
HTMT1_0075_F07.b : GAAAGGCTGGNNCG**CGGGAGCTTTTG*TATGTGACATGTGGGC*GGGCANCGGGAGAG
HTMT1_0020_H06.b : GAAAGCNTGGCGGG***CGGAACTTTGG*TATGTGACTTGTGGGC*GGGCACCGGGAAAG
HTMT1_0074_H09.b : GAAAAGCTTGGCGG**CGGGAGCTTTTG*TATGTGACATGTGGGC*GGGCAACCGGAAAA
HTMT1_0014_A01.b : GAAAAGCTTGGCNG**CNGNAGCTTTGG*TATGTGACATGGTGGC*GGGCANCGGGAAAG
HTMT1_0037_H11.b : GAAAAGCTTGGCGG**CGGGAGCTTTGG*TATGGGACATGTGGGC*GGGCAACGGGAAAA
HTMT1_0066_D08.b : GAAAAGCTTGGNNCG*CNGNAGCTTTGG*TATGTGACATGTGGGC*GGNCANCGGGAAAA
CBLT1_0038_C06.b : GAAAAGCTTGGCCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGCCANCCGGAGAG
CBLT1_0034_C01.b : GAAAGGCTTGGCGG***CGGGAACTTGG*TAAGTGACATGTGGGC*GGGCACCGGGAAAG
CBLT1_0060_G03.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAG
CBLT1_0062_H04.b : GAAAAGCTTGGNCG**CGGGGAGCTTGG*TATGTGACATGTGGGC*GGCCACCCGGAAAG
HTMT1_0096_A11.b : *GAAAGGCTTGGCGG*CGGGAGCTTTGG*TATGTGACATGTGGGC*CGGCAACGGAAAAA
CBLT1_0075_C10.b : GAAAAGCTTGNCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*CGGCANCGGGAAAA
CBLT1_0025_E08.b : GAAAAGCTTGNCGG**CGGGAGCTTTGG*TATGTGACATGTGGCC*GGGCACCGGGAGAA
CBLT1_0004_G05.b : GAAAGGCTTTGGCG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCACCGGGAAAA
CBLT1_0054_G01.b : GANAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTTGGC*GGGGCACGGGGAGA
HTMT1_0053_A07.b : GAAAAGCTTTGGCG**CGGNAGCTTTGG*TATGTGACATGTGGGC*GGNCACCGGGAGAG
HTMT1_0073_B07.b : CGAAAAGCTTGGCGG*CGGGAGCCTTGG*TATGTGAACTGTGGGC*GGGCACCGGGAAAG
HTMT1_0094_C01.b : GAANAGCTTGGNCGGCGGGAG**TTTGG*TATGTGAAATGTGGGC*GGGCAACCGGAAAA
HTMT1_0027_A10.b : GAAAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGNCANCGGGAAAG
HTMT1_0017_E05.b : GGAAAGCTTGCCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*GGGCANCGGGAAAA
HTMT1_0063_D12.b : GAAAGGCTTGCCGGG**GGGAAGCTTGG*TATGTGACATGGGGGC*GGGCAACGGAAAAG
HTMT1_0045_D10.b : GAGAGGCTTGCCG***CGGGAACTTTGG*TATGTGACTTGTGGGC*CGGCCACGGGAAAG
HTMT1_0073_A06.b : GAAAGGCTTGGCGG***CGGNACTTTGG*TATGTGACATGTGGGC*GGGCAACCGGAAAA
CBLT1_0061_H05.b : GAAAAGCTTGGCCG**CGGGGAACTTTG*GAAGTGACATGTGGGC*GGGCAACGGGAAAA
HTMT1_0089_D09.b : GAAAAGCTTGGCGG**CGGGGACTTTGG*TATGTGACATGTGGGC*CGGCCACGGGAAAG
CBLT1_0062_D02.b : GAAAGGCTGGGCGG**CGGAAACCTTGG*TTTGTGACATGTGGGC*GGGCACCGGGAAAG
HTMT1_0043_E02.b : GAAAAGCTTGGCGG**CGGGAGCTTTTG*TATGTGACATGTGGGC*CGGGCACCGGAGAA
CBLT1_0059_H04.b : GAAAGGCTTGGCCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGCCACCGGGAAAA
HTMT1_0043_G10.b : GAAAAGCTGNNC***GCGGNAGCTTTGG*TATGTGACATGTGGGC*GGNCANCGGGAGAA
HTMT1_0067_A10.b : GAAAGGCTTGGNCG**CGGGAGCTTTGN*TATGTGACATGTNGGC*GGGCANCGGGAGAA
CBLT1_0037_H08.b : GAGAAGCTTGCCGG**CGGGAACTTTGG*TATGTTACATGTGGGC*GGGCAACGGGAAAA
CBLT1_0084_G04.b : GAAAAGGCTTGCCGG*CGGGAGCTTTTG*TATGTGACATGTTGGCCGGGCACCGGGAAAA
HTMT1_0071_D10.b : GAAAGGCTTGGNCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAAACGGAAAG
HTMT1_0014_H06.b : GAAAAGCTTGGCCG**CGGGAGCTTTGG*TATGTGACTTGTGGGC*GGGCAACGGAAAAG
CBLT1_0006_A07.b : GAAAGGCTTTGGCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCACCGGAAGAG
CBLT1_0055_D08.b : GAAAGGCTTGGNCG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCANCGGGAAAG
CBLT1_0004_H12.b : GAAAAGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGC*CGGCACCGGGAAAG
HTMT1_0042_F11.b : GAAAAGCTTGGCCCG*CGGGAGCTTTGG*TATGTGAAATGTGGGC*GGGCANCGGGGAAA
HTMT1_0016_H08.b : GAAAAGCTTGGGCGG*NGGAAGCTTTGG*TATGTGACTGGTGGGC*GGGCAACGGAAAAG
CBLT1_0081_G11.b : GAAAAGCTTGGCGG**CCGGAACTTTTG*GTATTGACATGTGGCC*GGGCAACGGGAAAG
HTMT1_0015_A09.b : GAAAGGCTTGGGCC**GCGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAGAG
HTMT1_0040_B10.b : GAAAAGCTTGGCCG**CGGGAGCCTTGG*TATGTGACATGTGGGC*CGGCACACGGAAAA
BFLT1_0007_D04.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTaaatgtggccggccaccggaaaggcc
HTMT1_0024_B03.b : GAAAAGCCTGGNNC**GCGGAGCTTTGG*TATGTGACCTGTGGGgcgccaccgggaaagg
CBLT1_0007_C02.b : cgtgatcatgcccggcctgtccacaagagaggagcctagtctaatcaactgtgaccatcg
CBLT1_0028_F01.b : gcttggccgccggaacttttggatgtgaattgggggcgggcacccggaaaggcccccggg
HTMT1_0056_D12.b : ggcttggccgcggaaactttggaatggaaattggggcgggcaacggaaaagccccggtgg
HTMT1_0131_B02.b : GAAAGGCTTGGCGG**CGGGAGCTTggtattgacatgtgggccgccacgggaaaggcgcg
HTMT1_0104_G12.b : GAAAAGGCTTGGCGG*CGGGACCTTTTG*TATGTaaaattgggcgggccacgggaaaagc
HTMT1_0042_B11.b : GAAAAGCTTGGGCG**GCGGAGCTTTGtatgtgacatgtgggcgggcnacggagaaggcc
HTMT1_0068_B12.b : AAAAGC***TTGCCGGCGGGAGCTTTTG*TATGTGACATGTGGGC*GGGCACCGGaaaag
CBLT1_0054_F08.b : GAGAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*CGGCANCGGGAAAa
CBLT1_0085_H05.b : GAAAGGCTTGCCGG**CGGGAACTTTGG*TATGTAACATGTGGGC*CGGCAACGGGAAAG
HTMT1_0064_C09.b : GAGAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCANCGGGAGA*
HTMT1_0047_B04.b : GAAAGGCTTGGCGC**CGGGAAGCTTGG*TATGTGACATGTGGGC*GGGCACCGG*AAAA
HTMT1_0068_D07.b : GAGGAGCCTTGGCGG*CGGGAGCTTTGG*TATGTGACATGTGGCC*GGGCACCGGAAAAG
CBLT1_0053_G06.b : GAAAGGCTTGGCGG**CGGGAACTTTGG*TATGTGACATGTGGGG*CGGCAACGGGAGAG
HTMT1_0026_F11.b : GAAAGGCTTGCCGG**GCGGAGCTTTTG*TATGTGAAATGTGGGC*GGGCAACGGGAAAA
HTMT1_0049_A09.b : agctttggcgcnggagctttgtatgtgacatgtgggcggcaacggaaaagccccggtggc
CBLT1_0080_H12.b : GAAAAGCTTGGCGG**CCGGAACTTTGG*Ttattaaattgtgggccgggcaaccggaaaa
HTMT1_0104_F09.b : GAAAGGCTTGGCGG**CCGGAGCTTTGG*TATGTaactttgggcggccaccgggaaagcc
HTMT1_0071_A04.b : GAAAGGCTTGGCNG**CNGGAGCTTTNG*TATGTGACnatgtggcggccancgggaaagc
HTMT1_0034_F11.b : GGAAAGGCCTTGGCGGCGGGAGCTTTGG*TATGTGACAGGTGGGC*GGcccaccggaaaa
HTMT1_0146_C12.b : GGAAAGGCTTGGCGGCCG*GAGCTTTGG*TATGTGACATGTGGGC*GGGCAACGGGAAAG
HTMT1_0136_G04.b : ggcgcggaagcttggttttaacatttggccggcccggaaaagcccggtggcttgctccca
HTMT1_0120_B01.b : taaacgttgccgggaacggaaaaatcctcggggcctttctcccccccctattcttacaaa
CBLT1_0006_H07.b : GAAAAGCTTGGCGG**CGGGAGCCTTGG*GTAGTGACATGTGGGC*GGGCAACCGGAGAG
HTMT1_0036_D12.b : GAAAAagcttggcgggcggaaccttgggtatgggaaatgtggggccggcaacgggaaaag
HTMT1_0133_G04.b : GGAAAGGCTTGGCGGCCGGA**CTTTTG*TATGTGACATGTGGCC*GGGCAACGGGAAAG
HTMT1_0036_E11.b : ggccggcggaacttgggaagtgaaatgtggccgaaaacgaaaagcccccggggccctgtt
CBLT1_0062_A01.b : GAAAGGCTTGGCGG**CGGGACCTTTGG*TATGTGACATGTGGGC*GGGCACCGGGAAAA
HTMT1_0085_D02.b : tttattttgaatttggggcggacacaggaaaaagcccggggggggtgggttacccccccc
HTMT1_0063_E09.b : GAGAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGNCAcgggagaag
CBLT1_0024_D10.b : GGAAAGgcttggcggccgggaactttggtaagttacatgtgggcggggcacgggaaaggc
CBLT1_0024_B03.b : GAAAGGCTTGGCGG**CCGGAGCTTTTG*TAAGTAAACTGTGGGCcggccaccggaaaag
CBLT1_0069_G11.b : GANAAGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGgcaacggagag
CBLT1_0075_E09.b : GAAAAGCTTGGCNG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCCACGGGAAAG
CBLT1_0052_G05.b : GAAAGGCTTGGCGG**CGGNNAGCTTGG*TATGTGACATGTGGGC*GGGCANCNGGAGNA
CBLT1_0074_H03.b : GAAAAGGCTGGCGG**CGGGAGCTTTGG*TATGTGACAgtgggcgggcaaccggaaaagc
CBLT1_0052_H03.b : GAAAGGCTTGGCGG**CGGGAGCTTTGGGTATGTGACATGTGGCG*GGCANNCGG**AGA
CBLT1_0052_H02.b : GAAAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGNCANCGGGAGAG
CBLT1_0042_B03.b : GAGAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAGCGGGAGAG
CBLT1_0075_G03.b : GAGAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAGCGGGAGAG
HTMT1_0086_E02.b : GAGAGGCTTGGCGG**CGGGAGCTTTGG*TATGTGACATGTGGGC*GGGCAGCGGGAGAG
20110601C-000217 : GCCCCGGTGG*CCGTGGCTCACCACCCCCAGCTCAGCCGAAAGGGGATGCGGGGGCAGA*
---------+---------+---------+---------+---------+---------+ 1108
CBLT1_0023_A08.b : gcctggtcctccccccccctctaccaaaggggggggggggggcaaaccggccccgggggg
HTMT1_0050_B08.b : ccccaccccactcancaaaagggaaggggggcaatccggccctggggttgcgaagaaacg
CBLT1_0068_D11.b : gccttggctctcccccccccccttccccaaaaaggggaggcggggggcaaactcggcccc
CBLT1_0077_C07.b : tggctcacaccccccctcacccaaaagggagcggggcgaatcgggccatggggcgcggag
HTMT1_0126_A09.b : ccntgctcccacccccacttacccgaaaggatgcggggcaactcggcccgtggggtgccg
HTMT1_0038_C01.b : gccccggtggccttggtttccccccccccatcttaacccaaaaggggattggcggggcca
HTMT1_0038_D01.b : ggcccgggtggcctgtggttctccacccccactttcccccaaagagggatgcggggccaa
CBLT1_0055_F02.b : GCCCCGGTGG*CCGTGCTTCACCACCCCCgctcacccaaaagggattgcggggcaaactc
HTMT1_0079_B03.b : gggccctggctcaccaccccgctaaccaaaagggatgcggggcaaacccggcccgggggg
HTMT1_0145_A10.b : tgctcacaccccacctcaacaaaagtggaggggggcaaccgggcccatggggcgcgaaag
CBLT1_0042_C01.b : gccgcgcgtggccgtggctccccacccccacctcaactaaaaggggatccgggggcaaac
HTMT1_0012_E08.b : agccgcggtggcccggggctcacccacccccaacttcacccaaagaggaatccgggggca
HTMT1_0012_F03.b : GCCCCGGTGG*CCTTGGTTCACCACCCCagctcacccaaaggggatgcgggggcaaactc
HTMT1_0006_A04.b : GCCGCGGTGG*CCGTGGCTCACAACCCCagctcaccgaaaagggatgcggggcaaactgg
HTMT1_0003_B02.b : GCCCCGGTGC*CCTTGGCTCCCACCCCCAGC*TCACCCGAGAGGGGAGCGGGGGCAAAC*
HTMT1_0005_F06.b : ccgccgtggccgtgctcaacaccccagctcacccaaaaggaagcgggggcaatcgggccc
HTMT1_0111_E01.b : tgccccccccccccgctcccccaaggggaggggggcaaacccggcccgtggggtccgaaa
HTMT1_0037_B01.b : gccccggtgggcctggtttacccccccccatttcaacccaaagggggatggcgggggaaa
HTMT1_0035_E04.b : ccgttggccctggcccccccccccgactcacccaaagggatgcgggggcacacccggccc
CBLT1_0040_F03.b : cccgcgtggccctggctcacaaccccagctccncccaaagggatccgggggcaactcggc
HTMT1_0027_C08.b : CCCCCGGTGG*CCGTGctcacccccccacctcacccaaaggggatgcggggccaactctg
HTMT1_0012_H10.b : CCCGCGGTGG*CCGTGGCTCACAACCCCagctcacccaaaaggggagcgggggcagactc
HTMT1_0011_B07.b : GCCGCCGTGGGCCGTGGCTCACCACCCCAGC*TCACCCAAAAGGGgatgcggggccgaat
CBLT1_0093_A09.b : tcccccccccgcctccccagaggggggcggggccaaacgggccctggggggtgcgaaaag
HTMT1_0144_G09.b : tccccaaaaggaaccggggcaactggcccagggggccgcaaaaaaagtttctttgaatcg
CBLT1_0068_C08.b : ctcacccccccccctcacccaaaagggagggggggaaaactcggcccgtggggcgcggaa
HTMT1_0109_F08.b : tccccccccctctcaccaaaggggaagggggggcaaaccgggcccggggggtgcgaaagg
CBLT1_0038_E04.b : ctggctcacacccccgctcacccaaaggggatgcggggcaaactcggcccaggggctgcg
HTMT1_0089_E09.b : ctgcttcacaccccagtctaccaaagggatgcggggcaaatccggcccagggggctgcga
HTMT1_0014_H01.b : ggggaccttgccccaccaccccattttatccaaaagtggagttggggacaaaatcggttc
HTMT1_0087_A04.b : acaccccgctcnccaaagggatgcgggcaatcggcccatggctgcgacagacagtcttct
CBLT1_0078_G12.b : cccggtggccttggctcaaccccccccacttcaacccaaaggggaagccggggccaaaat
HTMT1_0050_A03.b : ccgtggctcacaccccagctcanccgaaaggggagcgggggcaaactcggcccatgggcc
CBLT1_0086_E03.b : cccgttggccctggctcacacccccgctcacccaaaagggatgcgggggcaaatccggcc
HTMT1_0028_C05.b : ccgggggcctggcctcacacccccattcaaccaaaagggatgcggggcagaccgggccca
HTMT1_0042_F09.b : cgcgtggccgttgctcccacccccgctcaaccgaaaaggtatgccgggcagactcgggcc
HTMT1_0109_A05.b : ccccccgtggcnttgctcaccaccccaactaaccgaaggggatgcggggcaaatcgggcc
HTMT1_0006_E11.b : CCCCCGTGGG*CCCTGGCTCACCACCCCCActtaacccaaaggggaatcgggggccaaat
HTMT1_0134_F06.b : GCCcggtggncgtggctccccacccccacctcacccaaaggggatgcggggcaaactcgg
CBLT1_0042_E07.b : GCCCCCGGTGGCCGTGGCTCACCCCCCCagctcaaccaaaagggatgcgggggcaaactc
HTMT1_0134_C07.b : GCCCCGTTGG*CCGTGctccccaccccaactcaccaaaaagggagcggggcaaatcgggc
CBLT1_0072_C10.b : GGCCGCGGTGCCCGTGGCTCACCACCCCCgctcaacccaaaggggatccggggcaaactg
ILNT1_0001_B08.b : GCCCCGGTGG*CCTTGGCTCACCACCCCAAC*TCAACCgaaaagggatgcggggcaaact
CBLT1_0078_C11.b : GCCCCCGTGG*CCTTGGCTCACCACCCCCACCTCAACCAAAAGGGGATGCCGGGGCCAA*
CBLT1_0061_E10.b : GCCCCGGTGG*CCTGGCCCTACCACCCCACC*TCACCCAAAAGGGGATGCGGGGGCAAA*
HTMT1_0002_C03.b : GCCCGGTGGC*CGTGGCTTACCCCCCCCAGC*TCACCCGAAAGGGGATCCGGGGGCAaat
HTMT1_0025_D10.b : gggggccgtggctcacccccccgctcacccaaagggaagggggggcaactcgggcccatg
HTMT1_0002_F07.b : GCCCCGGTGG*CCGGGGCTCCCCCCCCCCActtaaccaaaggggagccggggcaaactcg
HTMT1_0128_H06.b : ggcctggctcacaccccactccacgaaagggatgcgggcaactcgggccgtgggcgcgaa
HTMT1_0064_A02.b : GCCGCGtgggcgtgcctcacaacccccactcaaccaaaagggatgcgggggcaactcggg
CBLT1_0073_C05.b : ccaaagggaacggggcaaatcggcccatgggtccgaaagaaacggcctcttgaaacgggg
HTMT1_0138_A04.b : aaaggatgcggggcaacccggccaggggggtcgaggaaaaggcttctgaatgggggggaa
HTMT1_0025_F09.b : gcctcccacccccacttcaccaaaagggaagcggggcaaaactgggcccggggggcgcgg
HTMT1_0105_A01.b : gctcccccccccgcccacccgaaggggatggcggggcaaacccggccagtgggctgcgaa
HTMT1_0120_E04.b : ccccccccactccccaaaaggaatgcggggcaactcggccaagggggtcggaaggaaaag
HTMT1_0010_E11.b : ggccccggtggcctttgctcacccccccccgctctacccaaaaggggatgcgggggcaaa
CBLT1_0039_B10.b : ggctcacacccccaccccacccaaaagggaagcgggggcaaactcggccccatggggctg
HTMT1_0117_G02.b : tctaccccccaatctaccaaaaggaatggagggacaactccgcccgggggctttgaatgg
HTMT1_0107_A07.b : cccccccactctaccaaagggatgggggggcaactcggcccgggggccccgaaagaaaag
HTMT1_0106_C10.b : ccacccccgcctaccaaaaggggaggcggggcaactcggcccttggggcgcgaaagaaaa
HTMT1_0104_B07.b : gcgtgccttgctccaccccccccacccaccccaagggggatgggggggcaaaatcgggcc
HTMT1_0106_A11.b : aagcccccggtgggccttggtttccccccccccatctcacccaaaagggaatgcgggggc
HTMT1_0137_G02.b : tcccacccccactcacccaaaagggaggcgggggaaacccggcccggggggctccaacgg
HTMT1_0057_G09.b : gggctgggtttcccccccccgttacaccaaagggaagggggggcaaacccgggccccggg
HTMT1_0047_D10.b : cccccccgttaaccaaaagggaagcggggcaatccggcccagggggtggggaaagaaaag
CBLT1_0056_D12.b : cccggttggccttggcttcacccccccagctctaccaaaaagggaaagcgggggcaaaat
HTMT1_0047_F01.b : ctggctcacacccccactcaacgaaaggggatgcggggcaactcggcccatggggctgcg
HTMT1_0044_G09.b : cacccccgctaccgaaagggatgcggggcaatcgggccatggggctcggaagaaaaggtc
HTMT1_0141_E10.b : cccttgctccccccccccctcaacctaaggggatgggggcaaactcgcccgtggggccgc
HTMT1_0149_G10.b : cttgctcaccaccccactcaccccaaagggatgccgggcaaaccgggccatggggcgcgg
CBLT1_0055_C05.b : gccttggtaacaccccagctcacccaaagggaagcgggggccaaccggcccaatgggctg
CBLT1_0021_D08.b : gccttgcccacaccccacctcaccaaaaggggagcgggggcaaacccggccccgtgggcg
HTMT1_0099_B11.b : ggtggcccgggctccccacccccatctcaccaaaagggggatgcgggccaaaacccggcc
HTMT1_0121_B03.b : cccccccgctaacccaagggatgcgggccaccggcccgttggggcggaagaaaaggtttc
HTMT1_0151_F05.b : gcgtggctcacccccccaactaacgaaaggggatgcggggcaaactccgcccgaggggct
HTMT1_0011_A04.b : ggccccggtggcccggggctcaccacccccaccttcaccaaaaagggaaagcggggggca
HTMT1_0010_H05.b : gccccggtgggcctgggttcaaccaccccagctcaaccaaaaaggggatgcgggggcaaa
HTMT1_0025_A07.b : cctggctcccaccccaacttaaccaaaagggaggggggggcaactcggcccatggggtgc
HTMT1_0021_A06.b : gccttggttcacacccccattttacccaaaggggaagcgggggcaaaactccggcccggg
HTMT1_0095_B10.b : ggtgggcttggctcacccccccatttaacaaaaagggatgcgggggcaactcggcccgtg
HTMT1_0021_G07.b : gccccgggtggccgtgggtccaccacccccggctttaccaaaaggagtaagggggggcaa
HTMT1_0086_H08.b : gtggccgtggctcaccaccccaactcanccgaaagggatgcgggggcaaactcggcccat
HTMT1_0037_B06.b : ccgggggccctgggtcaccccccccagcctccccaaaagggtatgcgggggcaaatcggg
HTMT1_0013_B03.b : cgtgggccgtggctcacaaccccagctcaccgaaagggggatgcgggggcaaaatccggc
HTMT1_0065_B01.b : tggcgtggctcaccaccccagctcacccgaaagggatgcgggggcagactcgggccagtg
HTMT1_0028_B11.b : ccggtggccttggctcccacccccccttcacccaaaggggatccggggcaaattgggccc
CBLT1_0037_B12.b : ccccgggggccgtgggctcccacccccaatttaaccaaaaggggatgcgggggccaaatc
HTMT1_0118_B12.b : ccgttgcccgtggctcccaccccccgctcaaccaagagggaagggggggcaaatcgggcc
HTMT1_0117_E09.b : cgtggccgggctccccaccccacccaaccgaaggggatgcggggcaactccgccccgggg
CBLT1_0046_C06.b : gtgccctggccacccccccacttcaccaaggggagcggggccaatcggcccaggggctgc
CBLT1_0028_G06.b : ggccccgtggccctgggctcacaccccccacttaacccaaaagggaatccgggggcaaac
HTMT1_0111_D11.b : ccggtggccctggctccccaccccacctcccccagagggaatgcgggggcaaacccggcc
HTMT1_0092_C07.b : cccggtggcggtgctcccccccccacttaccaaaaggggagccggggcaaatcgggccag
HTMT1_0013_D07.b : cccggtggcctgggctcacacccccagcctccccaaaaggggagcgggggcaaatccggg
CBLT1_0076_G10.b : ccgtggcccttgctcaccaccccccactcaacccaaagggatgccggggccaaaccgggc
HTMT1_0098_B07.b : gcggtgccgtggctcccaccccagctcacccaaagggatgcggggcaaaccgggcccatg
HTMT1_0064_B07.b : ccgcgggtggccgtggctcacacccccagcttcaccaaaagggatgcggggcagaactcg
HTMT1_0133_A12.b : ccccggtgccctttttccccaccccagctcaccccaaaggggaggcggggcaaactcggg
HTMT1_0048_C02.b : cgcggggccgtggttcacaaccccactcanccaaaagggaagtcggggcaactccgccca
ILNT1_0002_G10.b : gcgccgttggcctggctcaccaccccacctcacccaagaggggagcgggggcaaatcggg
HTMT1_0094_D10.b : ccccggtgggnttggcttaccacccccactcaaccaaaagggaatgcggggccaactcgg
HTMT1_0046_G11.b : GCgcggntggcgtggctcaccacccccactcaccngagagggatgcgggggcaaactcgg
CBLT1_0034_A11.b : GCCCCCGTggcccgtggctcaccacccccaacttaacccaaaaggggaatgcgggggcaa
HTMT1_0083_G02.b : GCCCCCGtgggccgtggttccacaccccccacttacaccgaaaggggatgccggggcaaa
HTMT1_0042_A07.b : ccccggtggccgtggctcaccaccccagctcacccggaagggatgcgggggccgactcgg
HTMT1_0056_H09.b : Gccgcgtggccntgcctcaccaccccagctcaccnaaaagggatggcggggcaaactcgg
HTMT1_0087_A03.b : GCCCCGGTGG*Cgtggctcaccaccccagctcacccgaaaggaatgcgggggcaaatcgg
HTMT1_0060_E10.b : GCCGCGGTGC*CCGTGctcacacccccagctcanccgaaagggatgcgggggcagactcc
CBLT1_0044_D03.b : GCCGCGGTGG*CCTTGGCTCACCACCCCagctcaacccagagggatgcgggggcaactcg
HTMT1_0016_A07.b : CCCCCGTTGG*CCTTGGCTCACCACCCCCAccttaccaaaagggatgccggggcaacccc
HTMT1_0061_H06.b : CCCCCGGTGG*CCTTGGCTCACAACCCCaattcaaccaaaagggatgcgggggcaactcg
HTMT1_0139_A10.b : GCCCCGGTGG*CCNTGCCTCACACCCCCactcaaccaaaagggatgcggggcaaactcgg
CBLT1_0053_F07.b : GCCCCGGTGG*GCGTGGCTCACCCCCCCAGC*TCACCCGAGAGGGGATGCGGGGcagaat
CBLT1_0034_F12.b : GCCGCGGTTGCCCTTGGCTCACCACCCCCAGCTTCACCAAAAGGGGATGCGGGGGCCAA*
HTMT1_0076_H02.b : cccccggtggcccgtggtttctccccccccctatttttatccaaaatggaattgtggtgg
CBLT1_0067_B02.b : ccccccgtgggccttggtccccccccccccttttaaacaaaagagggatccgggggcaaa
HTMT1_0007_C05.b : tggccgtggctcaccacccccactcaccaaaagggatgcggggcaaaaccggcccattgg
HTMT1_0041_C07.b : ggccttggttcaccccccccacttcacccaagggggaagcgggggcaaaatccggcccag
HTMT1_0036_E07.b : tgggcctggctcaccacccccagtttacacaaaagggaatgcgggggcaaatccggcccc
HTMT1_0010_C06.b : GCCCCGGTGG*GCGTGGCTCACCACCCCCAGCTCAACCAAAAGGGGATCCGGGGGCAAA*
HTMT1_0126_H07.b : cgncgtggccgtgctcancacccccactcaccgaaagggatgcggggcaaatcggccnag
HTMT1_0113_A02.b : GCCCCGGTGG*CCttgcccccaccccagctcacccaaaagggatgcggggcaacccgggc
HTMT1_0120_A12.b : cctacccaaaagggatgcgggccaatccgccccctggggtcggaaaagaaaaagtttttt
CBLT1_0024_B08.b : ggccccccccccccccttaccaaaaggggaggcgggggcaactccggcccatgggggcgc
HTMT1_0118_H02.b : ggggcctggttcccccccctanttcaccaaaagggatggggggcaaacccggccccgggg
HTMT1_0045_F04.b : ggtggcccgggttcaccaccccagctcacccaaagggaatgcgggggcaaactcggccca
HTMT1_0053_C11.b : ccccgttggcctggcctcaccacccaatctcaacaaaaggggatgcggggcaaactccgg
HTMT1_0042_E11.b : gggctcacaccccactcacccaaagggatggggggcaaatcgggccatggggtgcgaagg
CBLT1_0067_E11.b : cctacccaaaagggggcggggggaaaccgggcccaggggggcgcgaaaaaaaaaggggcc
CBLT1_0074_F01.b : ggtcaccccccccccttccccaaaggggatcgggggcaaaacggggcccgtgggggtggg
HTMT1_0136_H12.b : gcttcacccccccgcttcaccaaaagggatgcgggggcaaaccggcccaggggggcgcgg
HTMT1_0126_E03.b : gctcnccaagagggatgcgggcgactcggccatgggctgcgacagaacaagtctctggat
HTMT1_0147_C10.b : ctccccccccactcacccaaagggatgccgggccacccggcccgggggcgccaaaggaaa
HTMT1_0041_H02.b : gtgggcctgggtttaccacccccatctaacccaaaagggatgcgggggaaaacccggccc
HTMT1_0117_D03.b : ggggctagttctaacacctcccccctccccgaagggtatggggggccaaaccggccctag
HTMT1_0034_B04.b : ggccccggaggccgtggctcccccccccacgtccacccaaaaggggaagcgggggaaaac
CBLT1_0077_E12.b : cccccggtggccctgggtttcaccccccccacttaatcaaaaaggggaagcgggggccaa
HTMT1_0118_F12.b : gtggccttggctcacacccccccccaccgaaaagggaagcgggggcaactcggcccatgg
HTMT1_0066_C01.b : gcgtggcgtggctcacaccccagctcancgagagggatgcggggcaaactcggcccatgg
HTMT1_0073_B12.b : cggtgggcgtggttcacccccccagctaaccaaaaggggtgcggggcaaaatcgggccct
CBLT1_0072_H09.b : GCCCCCGtgggcgtggctcacaaccccagctcacccgaaagggatgcgggggcaactcgg
HTMT1_0041_A02.b : CCCCCGGTGG*CCGTGGCTCACAACCCCCAGCTCANCCAAAAAGGGATGCGGGGGCAAA*
CBLT1_0005_E10.b : GCCCCCGGTGGCCCTGGCTCACAACCCCCAGCTCACCCAAAAGGGGAAGCGGGGGCAAAA
HTMT1_0111_A02.b : ccggtgccttggctcccccccccactcaacaaaagggatgcggggcaaatcgggcccgtg
HTMT1_0076_C01.b : tccaaaaaggggtggggggggaaactcggccccgggggggggggaaaaaaaaagggtttt
HTMT1_0122_D09.b : tccccccccccccccaaccaaaagggatgcgggggcaaaatgggcccatgggggtccgaa
CBLT1_0009_G11.b : ggccccgtgccgtggctcacacccccagctcaaccaaaaggggagcgggggcaaactcgg
HTMT1_0093_H12.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCgctcancccaaaagggatggcggggcaaact
HTMT1_0060_B12.b : gatgggannnnnnngatcgcaggctggcgagaaaanaagaggttganctgatcgtgangt
CBLT1_0034_H05.b : cccccatttccccaagaggggatgcggggcaaacttggccccaggggggtcggaaaggaa
HTMT1_0059_D04.b : agggggaccacccgcgcagtggggtggacgaaaaggtctttgaattgnntggnaagggcc
CBLT1_0068_G08.b : tgcccttggctccccccccccctctaccccaaaaggggaccggggggaaaactgggcccc
HTMT1_0115_B01.b : cccaaaggggatggggggacaccccggccctggggccgcgaaaaaaaaggttttctggaa
HTMT1_0058_C04.b : ctcaacaaagggaatgcggggcaacccgggcaagggggctgggaaagaaaaggccctctg
CBLT1_0073_F08.b : accccacccaaaggggaccggggccaaacgggcccatggggtgcgaaagaaaaggtcctt
HTMT1_0013_A02.b : cacatcccttcctccccatacgggaatcgggccttacacaaccctttgaggtgcggaaat
CBLT1_0067_B11.b : gggttccccaccccaactttaacaaaagggggaatgggggggcaaaacccggccccaggg
HTMT1_0119_B12.b : tgggaaaattgggaaggtttggttttttttaacccttttagcggcaaaaaaaatttacaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : ccagctaccnaaagggatgcgggccaaatcggcccatggggctgcgaagaaacagtcttc
HTMT1_0111_F07.b : ccccccacttaaccaaaggggatggggggcaaaccgggcccgggggcgccaaaaaaaaag
HTMT1_0105_F06.b : cccccaactcaccaaaagggaagcggggcaaactcgccccgggggcgcgaaaaggaaagg
HTMT1_0117_H09.b : ccccccaccaaaggatggggggcaaactcggccagggggcgggaaagaacaggtctttgg
CBLT1_0073_B11.b : cccccggggggccctgggcccaccccccccacctcaccaaaaaaggggagccggggcaaa
HTMT1_0119_D08.b : atgtttcccacctcaattcacccaagaggagtggggggcaaaattcggccattggggtac
HTMT1_0126_F11.b : ctacccaagggggagcgggggaaaccggcccttggggtgcgaaagaaaggggcctttgga
HTMT1_0128_E02.b : caccaccaaaggaatgcgggcaacccgcccctggggcgcgaagaaacagtctctgaatcg
CBLT1_0050_C05.b : ctcacccccccactcacccaaaggggatcggggcaaatcggcccattgggctgcggcagg
HTMT1_0035_H01.b : aggcccccgggggcccgggcttcaccaccccccaacttaaacaaaaaggggattcggggg
HTMT1_0035_D11.b : cccccgttggccgtggttcacccccccccacttaaaccaaaaggggaatgcggggcaaaa
CBLT1_0096_H03.b : ccccactcacgaaagggatcggggcaatcggcccatggggctcgacgaaaggtctctgga
HTMT1_0140_H10.b : cccactcaccaaaggaagccgggcaaaccggcccgtggggtgcgaagaaaaagtttcttg
CBLT1_0038_D11.b : cccggtggccttgggtcaacaccccaaacttaaccaaaaagggaatccggggccaaaccc
HTMT1_0132_F08.b : gtgcctacccccccaactcaaccaaagggaagcgggggcaaatcgggcccgggggctgcg
HTMT1_0016_D05.b : ggcccaccccccccgctcaaccaaaggggatgcggggcaaaccgggcccggggggctgga
HTMT1_0097_G08.b : cgggggccttggttccaccaccccaatttaaccgaaaggggaagccgggggcaaatcggg
CBLT1_0041_C10.b : tgcccggggctcacacccccacctcaacccaaaggggatgcgggggcaaaccggggccca
HTMT1_0121_B01.b : ttgcttaccccccccacttcacccaaaggggatgcgggggcaaatcgggccccatggggc
HTMT1_0113_B09.b : ccctgcctcccacccccactaacccaaaagggatgccggggcaacccggcccatggggct
HTMT1_0077_E08.b : cttgctcccccccccactcacccaaagggagcggggcaaaccggccccttggggggcaaa
CBLT1_0041_D07.b : ccttgctcccccccccgctcacccaaagggatgcgggggcaaatcggcccattgggctgc
HTMT1_0148_A09.b : tccaccccccccctcaccaaaggggaggggggccaaaccggcccttgggggggccaacga
HTMT1_0132_F03.b : ttgctcaccccccctctcaaccaaaggggaagcggggcaacccggcccattgggctgcga
HTMT1_0140_C12.b : accccacttaccaaaagggagcgggggcaatcggcccatgggcgcgaaaagaaaagggcc
HTMT1_0140_F06.b : tgcccacacccccactcaccaaaggggatgcggggcaaactcggcccttgggctgcgaaa
CBLT1_0024_F01.b : gggccgtggtttcaccccccaattaaaccaaaaggggaaggcggggcaaaaccgggcccc
HTMT1_0106_E05.b : tgctaaccccccactcacccaaaggggagcggggcaaatcggcccgtggggcgggaaaga
HTMT1_0099_C09.b : cttgctcaccccccaactcacccaaaggggaagcgggggcaaactcggcccagggggctg
HTMT1_0101_E05.b : tggcctggccccaccccccacctcacccaaaagggatgccggggcaaactcggcccgtgg
HTMT1_0021_A08.b : cctgggtcaccacccccagttcaccaaaaagggatgcgggggcaaacccgggcccagtgg
HTMT1_0128_G08.b : gtgctcacacccccactccccagagggatgcgggcaatcgggcaatgggctgcgaagaac
HTMT1_0120_B12.b : ggccttgctcccccccccacctaacccaaagggatgcggggcaactcggccccgggggct
HTMT1_0028_G05.b : gtgctcaccaccccactcaaccaaaggggaacgggggaaaatcggcccatgggctgcgaa
HTMT1_0060_C11.b : ccttggctcacaccccccactcacccaaaagggattgcggggcaaactcggcccagtggg
HTMT1_0044_H10.b : gccntggctcacaccccccactcacccaaaagggatgcggggcgaaatcgggcccctggg
HTMT1_0026_D07.b : gcttggctcacaccccanctcaccaaaagggatcggggcaaactcgggccagggggctgc
CBLT1_0060_G12.b : agcccccggtgggcccttggctcaccaccccccaacctcaaccaaaagggggatgcgggg
HTMT1_0105_B03.b : cggttggcctggctcccccccccccacctcccccaaagggaagcgggggcaaatccggcc
CBLT1_0011_E06.b : cgcgtgtggccgtggctcaccacccccacctcaaccaaaaggggaatccggggccaaact
HTMT1_0135_B04.b : gctcacaccccactcaccgaaagggatcngggcaactcggccccatgggctcgacagaaa
CBLT1_0080_E02.b : gcctggctcaccaccccactcaaccaaaagggaaccgggggcaaccgggcccatggggcg
CBLT1_0064_A08.b : ggccgtggctcaccaccccagctcaccccaaggggagccggggccaactcggcccagtgg
HTMT1_0139_E01.b : gccttggctcacaccccactcaccgaaaggggatcggggccaatcgggccattgggctgc
CBLT1_0090_F01.b : ccgggggccttgttccacccccccctctcaacccaaaagggatgccgggggcaaacccgg
HTMT1_0034_H09.b : ccccgttggccggggttcaccaccccagctcaaccaaaaagggatggcgggggcaaaacc
CBLT1_0014_C12.b : gccccggtggccctggcctcaccccccccagcttaacccaaaaggggagccgggggcaaa
CBLT1_0088_A03.b : gtggcttggctcaccccccccgctcacccaaaagggaagcgggggcaaatcgggcccagt
HTMT1_0106_B11.b : cccgtggccctgggctccccccccccacctcaacaaaaggggaggcgggggcaaacccgg
HTMT1_0064_G04.b : gcgtggctccacaccccactctaccgaaagggaggcggggccaactcggcccaggggggt
HTMT1_0062_E07.b : ggcgtggctcacacccccactcaccaaaaggggagcggggcagatccgggccagtggggc
HTMT1_0095_A12.b : ccccggtgggccttggttcaaccccccccatttaaacaaaaagggggatgcggggggcaa
HTMT1_0150_D11.b : ccgggtgccctgggttccccccccccgcttaaccctaaaggggatgtcgggcgcaaatcc
HTMT1_0122_B12.b : tgccttggctcccacccccgctcaacaaaaaaggaatgcggggccaaaccggcccatggg
HTMT1_0141_H07.b : ttggccctggtcccccccccccacctcaccaagagggaagcgggggcaacccgggcccag
CBLT1_0040_B05.b : ggtggccctggctcaccaccccacccaaccgaaagggatgcgggggcaaaccgggccagg
CBLT1_0052_A10.b : cggtggcctggctcacacccccagctaacccaaaggggaagcggggcaaactcgggccca
HTMT1_0025_C06.b : cggtggcctgggctacccccccccaatcaaccaaaaggggatgcgggggcaaactcgggc
HTMT1_0067_H07.b : cgtggccgtgcttcaccccccgcttaaccaaaaggatgcggggcaaatcgggccaagggg
CBLT1_0082_A09.b : cccgtgggcctggctccccaccccagcccacccaaaggggatgcgggggcaactcggccc
HTMT1_0013_F01.b : ccccggtggccttggttcaccacccccactcaaccaaaaggggatccgggggcaactccg
HTMT1_0130_C05.b : ccggtggccttgatccccaccccactctaccaaagggaagccggggcaaaaccggccagg
HTMT1_0099_A06.b : ctggggccgtggctccacccccccctccacccaaagggaatgcggtggtaaacccggccc
CBLT1_0036_C05.b : ccccggtggcctggctcccaccccccgctcacccaaaagggaatcggggggcaaatcggc
CBLT1_0037_B04.b : ccgttggccgtggtcaccccccccacctcacccaaagggaagcgggggcaaatcgggccc
HTMT1_0132_A04.b : cacgtggccgtgggtccccccccccactctaccaaaaggggaaccgggggaaaatcggcc
HTMT1_0070_G03.b : cgcgntggccgtggctcacacccccagctcacccgagagggatgcgggggcgaactcggc
HTMT1_0111_H01.b : cccggtgggccttgttccccccccccctcctacccaaagggggatgggggggcaaaatcg
HTMT1_0100_F01.b : cccgtgggcttgcttcacacccccagctcaccgaaaagggatgcggggcaaatccgggcc
CBLT1_0044_C08.b : ggccccgttggcctggcttcacacccccaactcacccaagaggggagccggggcaaactc
HTMT1_0133_A10.b : ggtggccttggctcaccacccccacttaccgaaaggggaggcggggcaaactcggcccat
CBLT1_0075_B12.b : gccccgtgggccttgggttaccacccccttttaaacaaaagggggattcgggggcaaaac
HTMT1_0027_B01.b : gcgccgttgccgtggctcacacccccgctcacccaaaggggatgcggggcaaactccggc
CBLT1_0088_G06.b : ccccgggggccttggctccccccccccgctaaaccaaagggggagcgggggcaaatccgg
HTMT1_0048_A11.b : cccggtgcccctggttcccacccccagttcaaccaaaagggaatgcggggcaaactccgg
CBLT1_0046_H09.b : ccggggggcccgtgctcaccccccccgcttcaccaaaagggaatccgggggcaaatcggg
CBLT1_0004_D05.b : gccgcgtggcccttgcctcaccacccccactcaccccaaaggggatgcggggcaaaatcg
HTMT1_0103_C12.b : cccccggtgcccttggcctaccacccccacttaaccaaaagggatgcgggggcaaactcg
CBLT1_0035_B11.b : ggccgcgttggcctggcctccccaccccaactcaaccaaaggggaatcgggggcaaatcc
HTMT1_0076_B06.b : gccccggtggccgtggttcaacccccccagctcaaccaaaaagggaaggcggggcaaaac
HTMT1_0095_F01.b : gcggtggcgtggctcacaccccagctcacccagagggatgcggggccaaatccggcccag
CBLT1_0013_B03.b : gccccgggtgcccgtggctcacacccccagctcaaccaanaagggattcgggggcaactc
CBLT1_0095_H06.b : gcccggtgccctggctcacacccccactcaccaaaagggatgcggggcaaactcggccag
HTMT1_0016_G09.b : ggccgcggtggcccgtggctcccacccccagctcaaccaaaaggggaatgcgggggcaaa
HTMT1_0019_D11.b : gcccgggggccgttgctcaccacccccagctcacccaaaagggaatgcggggcaaactcc
CBLT1_0025_B07.b : gccgcgttggccttgcctcacaaccccagctcaacccaaaggggagcgggggacaacccg
HTMT1_0028_H02.b : ggcccccggggccctgggctcacacccccaactcacccaaaggggatgccggggcaactc
CBLT1_0085_H01.b : cccccgtggccttggttcccacccccaccttacccaaaaggggatgcggggccaactcgg
HTMT1_0054_B11.b : ccccgtggccgtggctcaccaccccagtttcaccaaaaggggatgcgggggccaacccgg
CBLT1_0051_A01.b : gcgcggtggccttgcttaccaccccacctaaccaaaaggggatcggggccaaccgggccc
HTMT1_0014_G11.b : gcccggtgggccggggttccacacccccacttaaccaagagggaagccgggggaaacctc
HTMT1_0134_G05.b : ccccggttgcccgtgctcaccccccagctcaccgaaagggatgcggggcagactcggcca
HTMT1_0034_E03.b : GCCgcgtgggccctggttccccacccccacttcacccaaaagggaagcgggggcaaactc
HTMT1_0084_E09.b : cccgcggggccgttgctcaccaccccagctcaccgaaaagggatgcggggccaactcggg
CBLT1_0061_C12.b : gccccggtgggcctggctcaccaccccaacctcacccaaaggggaggcgggggcaaaatc
HTMT1_0149_F10.b : ggccccgttgggcgtgcctaccccccccactcacccaaaggggatgccggggccaactcg
CBLT1_0039_D07.b : ccccggtggccgtggctcacccccccaactcacccaaaggggatgcggggccaaacccgg
CBLT1_0034_F10.b : cccccggtgccgtggctcaccaccccacctcaacccaaagggaatccggggccaaatcgg
HTMT1_0051_A10.b : cccccggtggcngtgctcaaccacccanctcaaccaaaaggggatcgggggcaacccggg
CBLT1_0039_D10.b : GCCgccggtgccctggcctccccacccccactcacccaaaagggatgcgggggcaaatcg
HTMT1_0022_F01.b : GCCccgtggccctggctcacccccccagtttacccaaaggggaagcgggggcaaacccgg
CBLT1_0015_E12.b : GCCCcgggtggcctggcttaccaaccccaacttaacccaaaaggggaagccgggggcaaa
HTMT1_0041_B02.b : GCCCCgtggccgtggctcaccaccccagcttaacccaaaggggatgcggggcaaactcgg
HTMT1_0075_F07.b : GCCGCGttgccgtggctcacacccccagctcanccgaaaggggatgcnggggcaaatccg
HTMT1_0020_H06.b : GCCCCCGtggcctggctcacaacccccgctccaccgaaaggggagcgggggccaactcgg
HTMT1_0074_H09.b : GCCCCggtgccgtggctcaccaccccagctcaaccgaaaggggagccggggcaaaatcgg
HTMT1_0014_A01.b : GCCGCGGTGG*Cgtggctcaccacccccgctcanccaaaagggatgcgggggcaaatcgg
HTMT1_0037_H11.b : GCCCCGGTGG*CCcttggcttcaccaccccagttcaaccaaaagggaatgcggggacaaa
HTMT1_0066_D08.b : GCCNGCGTGG*CCGTGGgctcacaccccagctcanccgagagggatgcgggggcagctcc
CBLT1_0038_C06.b : GCCGCCGTGG*CCGTGGCcaccaccccagctcanccgagaggggagcgggggcaaatcgg
CBLT1_0034_C01.b : GCCCCGGTGG*CCGTGGCTtcacaccccagcttcaccagaggggatgccggggccaactc
CBLT1_0060_G03.b : GCCCCGGTGG*CCTTGGCTCACaccccagctcaccaagagggatgcgggggcaactcggg
CBLT1_0062_H04.b : GCCGCGNTGG*GCCTGGCTCACacccccgctcaccgagaggggatgcgggggcaaactcg
HTMT1_0096_A11.b : GCCCCGGTGG*CCGTGCCTCccacccccagctcacccaaaagggatgcggggggcaactc
CBLT1_0075_C10.b : GGCCCGGTGG*CCGTGGCTCACCCCCCCaactcacccaaaggggatgcgggggccaactc
CBLT1_0025_E08.b : GCCCCCGTGG*CCGTGGCTCACCACCCCacctcacccaagaggggagcgggggcagacct
CBLT1_0004_G05.b : GGCCCGGTGG*CCNTGGCTCACCACCCCagctcaaccaagagggatgcggggcaaactcg
CBLT1_0054_G01.b : GCCGCGGTGG*CCGTGGCTCACCACCCCagctcacccaaaagggatgcgggggcaactcg
HTMT1_0053_A07.b : GCCNGCGTGG*CCGTGGCTCACCACCCCagctcnccgaaagggatgcgggggcgactcgg
HTMT1_0073_B07.b : GCCCCGTGGG*CCGTGCCTCACCACCCCagcttanccaaaagggaatgcggggcaaatcc
HTMT1_0094_C01.b : GCCCCGTTGG*CCTTGGCTCACCACCCCagctcacccaagaagggagcnggggcagatcc
HTMT1_0027_A10.b : GCCCCGGTGG*CCCTGGCTTCACACCCCCActcacccaaaagggatgccgggcaaactcc
HTMT1_0017_E05.b : GCCCCGGTGG*CCGTGCCTCACCACCCCCActcaaccaaagagggatgcggggcaaaatc
HTMT1_0063_D12.b : GCCCCGGTGC*CCGTGGCTCACCACCCCCAG*Cctaaccaaaagggatgcgggggccaaa
HTMT1_0045_D10.b : GCCCCGGTGG*CCCTGTCTCCCCACCCCCAG*CTCAacaaaaagggatggcgggggcaaa
HTMT1_0073_A06.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCAG*CTCAccgaaaggggatgcgggggcaact
CBLT1_0061_H05.b : GCCGCGGTGG*CCGTGGCTCACCACCCCacctcacccaaaaggggagcgggggcaaaccc
HTMT1_0089_D09.b : GCCCCGGTGG*GCGTGGCTCACCACCCCagctaaccaaaagggatgcggggccaactcgg
CBLT1_0062_D02.b : GCCCCGGTGG*CCGTGGCTCACCACCCCCActtaacccaaaggggatgcggggcaaaatc
HTMT1_0043_E02.b : GCCGCGTTGG*CCGTGGCTCACCACCCCagctcaccgaaaagggatgccggggcagactc
CBLT1_0059_H04.b : GCCCCGGTGG*CCTTGGCTCCACCCCCCAACTCACCCAAAAAGGgatgcgggggcaaatc
HTMT1_0043_G10.b : GCCCCCGTGG*GCGTGGCTCACCACCCCCActcanccaaaagggatgcgggggccaactc
HTMT1_0067_A10.b : GCCCCGGTGG*CCGTGGCTCACAACCCCAGC*TCANCCAAAAGGGgatgcgggggcaaat
CBLT1_0037_H08.b : GCCCCGGTGG*CCCTGGCTCACCCCCCCCACCTAACCCAAAAGGGGATGCGGGGgcaaac
CBLT1_0084_G04.b : GGCCCGGTGG*GCCTGGCTCACCACCCCCACCTCACCCGAAAGGGGATGCGGGGcctatc
HTMT1_0071_D10.b : CCCCCGGTGG*CCGTGGCTCACACCCCCAGC*TCAACCAAAAGGGGATGCGGGGGCAAA*
HTMT1_0014_H06.b : CCGCGGTGGC*CTTGGCTCACCACCCCCACC*TCACCCGAAAAGGGATGCGGGGGCAAA*
CBLT1_0006_A07.b : GCCCCGGTGG*CCGTGGCTCACCACCCC*AGCTCACCNAAAAGGGGATGCCGGGGCAAA*
CBLT1_0055_D08.b : GCCCGCGTGC*CCGTGGCTCACCACCCCCAC*TCAACCGAAAAGGGATGCGGGGGCAAA*
CBLT1_0004_H12.b : GCCGCGGTGG*CCTTGGCTCACCAACCCCACCTCAACCAAAAGGGGATGCGGGGGCAAA*
HTMT1_0042_F11.b : GCCCCCGGTGGCCGTGCCTCACAACCCCCAGCTCAACCGAAAGGGAATGCGGGGGCAGA*
HTMT1_0016_H08.b : CCCCCGGGGG*CCTTGGCTCACCACCCCCACCTCAACCGAGAAGGGAATGCGGGGCAAA*
CBLT1_0081_G11.b : GCCCCGGTGG*CCCTGGCTCACCACCCCCCGCTCACCCCAAAGGGGATGCGGGGGGCAA*
HTMT1_0015_A09.b : CCGCCGNTGG*NCGTGGCTCACCACCCCCAACTCAACCGAAAGGGGATGCGGGGGCAAA*
HTMT1_0040_B10.b : GCCCCCGGTG*GCCTGGTTCACCACCCCCAGCTCAACCGAAAGGGGATGCGGGGCCAAA*
BFLT1_0007_D04.b : cggtggcctggctcaccaccccgctcaaccaaaagggagcggggccaaatccggcccagg
HTMT1_0024_B03.b : cccggtgggcgtggctcaccaccccactcaaccaaaggggatgcggggcaaacccggccc
CBLT1_0007_C02.b : agggcgcattgtccgataccctgcactgagaccacgtagttaagaaacatcttggggaat
CBLT1_0028_F01.b : gccttggtctcccccccccctcttaacccaaaagggataccggggcaaacatcggccccg
HTMT1_0056_D12.b : cttggttcccccccccatttcacccaaaaggggggccgggcaaaacccggccccgggggg
HTMT1_0131_B02.b : gtgccgtgctcaccccccactcaccgaaagggagcggggcatactcggcccgggggtgcg
HTMT1_0104_G12.b : cccggggggccgtgtctcccccccccaacttaaccaaaggggatgcggggccaactcggg
HTMT1_0042_B11.b : cgttggcgtggctcaccacccccactcaacccaaagggatgcggggcaaactcggcccca
HTMT1_0068_B12.b : ccccggtggccgtggttcccccaccccaactcaaccaaaagggaagcgggggcacaaccc
CBLT1_0054_F08.b : ggccgcggtgccgtggctcaccaccccanctcaacccaaaagggagcgggggcaaactcg
CBLT1_0085_H05.b : GCCCCGGGGG*CCtggcccaccccccccgcctcaccaaaaagggatgccgggggaaactt
HTMT1_0064_C09.b : GCCGCGGTGG*GCGTGGCTCACCACCCCagctcaccgaagagggatgcgggggcagactc
HTMT1_0047_B04.b : GCCGCGGTGG*CCGTGGCTCACCACCCCaactcacccaagaggggagcgggggcaaactc
HTMT1_0068_D07.b : GCCGCGTTGG*CCGTGGCTCACACCCCCagctcacccaaaagggaggccgggcaaaatcg
CBLT1_0053_G06.b : GCCGCGGTGG*CCGTGCCTCACCACCCCCACCTCAccccaaagggatgccggggcaaaat
HTMT1_0026_F11.b : GCCCCGGTGG*CCGTGTCTCACCACCCCCACCTCAACCGAGAGGGGAAGCGGGGGCAAA*
HTMT1_0049_A09.b : ctggctccccaccccactcaaccaaaagggatccggggggcaaccggcccattggggcgc
CBLT1_0080_H12.b : gcccccgtgggccgtggttccacacccccacttaacccaaaggggatgcgggggcaaaac
HTMT1_0104_F09.b : ccggtggccttgccccccccccccaccacccaaaaggggatgcgggggcaactcggccca
HTMT1_0071_A04.b : cgncgtggncgtggctcacaccccagctcaccgaaaagggatgcggggcaaactcggccc
HTMT1_0034_F11.b : ggccccgttggccggggctccaccccccccacttaaaccaaaagggaaggccggggccaa
HTMT1_0146_C12.b : GCCCCCGTGG*CCCTTGCTCACCCCCCCaactcacccaaagggaagccggggcaaacccg
HTMT1_0136_G04.b : ccccgctcacggagaggatcggggcaacccggcccatgggctgcaaagaacaggtctctt
HTMT1_0120_B01.b : gggtagcgggtgcaaaccggttccgggggtggcaaaaaacaggtttttttgtaaacctcg
CBLT1_0006_H07.b : GCCCCGGTGG*CCTTGGCTCACCACCCCCActcaaccaaaggggatgcggggcaaacccg
HTMT1_0036_D12.b : gccccggtggcccttggctcaaccacccccatttcacccaaaaaggggatcgggggggca
HTMT1_0133_G04.b : GCCCCCGtggccttgctcaccacccccactcaccgaaaaggggagccggggcaaaccggg
HTMT1_0036_E11.b : tcccctccccatatcaccaaaagggaaagcggggaaaaattgacccatggggttggtaaa
CBLT1_0062_A01.b : GCCGCGGTGC*CCGTGctcaacaccccaacttacccaaaagggaagcgggggcaaactcg
HTMT1_0085_D02.b : ggtcctacccaaaggggatggggggggaaatctggcccaatggggctcccaaaaaaaaaa
HTMT1_0063_E09.b : ccgcggtggcgtggnctcacaccccagctcaccgaagaggggagcgggggcagactcggg
CBLT1_0024_D10.b : ccccggtggccgtggctcacacccccccctcacccaagagggaatcgggggcaaatccgg
CBLT1_0024_B03.b : cccccgttggccttggcttacacccccaacctaacccaaaagggatgcgggggcaaaacc
CBLT1_0069_G11.b : ccgcggtggccgtggctcacaaccccaactcaccaagaagggatgcgggggcaaactcgg
CBLT1_0075_E09.b : G*CGCGGTGG*CCGTGCCTCAC*ACCCCCAGCTCAACCAAGAGGGAATGCGGGGGCAAA*
CBLT1_0052_G05.b : GCCGCGGTGG*CCGTGGCTCACCACCCCANCTCAccaanaaggggagcgggggcaaactc
CBLT1_0074_H03.b : cccgtgggcttggttcacacccccacctccccaaaagggataggggggcaaatcgggccc
CBLT1_0052_H03.b : GGCGCGGTGG*CCGTGGCTCAACACCCCAGC*TCACCCGAGAGGGAATGCGGGGGCAGA*
CBLT1_0052_H02.b : GCCGCGGTGG*CCGTGGG*CTCACACCCCAGCTCACCCGAAAAGGGATGCGGGGGCAAA*
CBLT1_0042_B03.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCAGCTCAGCCGAGAGGGGATGCGGGGGCAGA*
CBLT1_0075_G03.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCAGCTCAGCCGAGAGGGGATGCGGGGGCAGA*
HTMT1_0086_E02.b : GCCGCGGTGG*CCGTGGCTCACCACCCCCAGCTCAGCCGAGAGGGGATGCGGGGGCAGA*
20110601C-000217 : CTCGGGCCCAGTGGGGCTGCGGACAGGAAACAGGGTCTTCTTGGAAATCGGGCTGGCAGA
---------+---------+---------+---------+---------+---------+ 1168
CBLT1_0023_A08.b : gtgcgaaaagaaaaaggtttttttgaaatagggtggggaaaggggccccggggccccctc
HTMT1_0050_B08.b : gttctttggaaatcggggggaaagggcccagggacccccccaaccctttctcttaggccc
CBLT1_0068_D11.b : atgggggttccgcaagagaaaaaggggttttttggaaaaagggggggagaaaaaggggcc
CBLT1_0077_C07.b : gaaaaggtcttctggaatggctgggaagggcccaggcacccccaacccttgtctaggccg
HTMT1_0126_A09.b : aaggaacaggctttcttgaatcgggtgggaacgggcccaggacccccccaccctttgcta
HTMT1_0038_C01.b : aacccgggccccgtggggcctggcggacagaaacacagggtctctctggaaatatgggct
HTMT1_0038_D01.b : accccggcccagggggggtggggaaaggaaaaaaggtctttcttggaaatcggctgggaa
CBLT1_0055_F02.b : cggcccatgggggtgcgaacggaaaaagggtcttttggaattgggctggcaaaacgggcc
HTMT1_0079_B03.b : ctgcggacaggaaagggtctcttgaaatcggctggcaaaagggcccagggaccccctctc
HTMT1_0145_A10.b : aaaaggcctctggaaatgggcggggaaaggcccagggaaccctaacccctttctgggccc
CBLT1_0042_C01.b : tcgggccaagtggggctgccgacaggaaaaagggtcttcttgaaaacgggcgtgggaaac
HTMT1_0012_E08.b : aactccggccccagtgggggtgcgaaacggaaacagggtctttttggaaaatgggctggc
HTMT1_0012_F03.b : ggccccaagggggctgcgaaaaggaaaaaggtctttctggaatatcggctgggcaaacgg
HTMT1_0006_A04.b : gcccatggggctgcgacagaaacgggtcttctggaatcggccgtgcgagcgggccaaggc
HTMT1_0003_B02.b : TCGGGCCCAtggggctggcgaaaggaaacggtcctcctggaaatcggctgcagaaggggc
HTMT1_0005_F06.b : atgggctgcgaacagaacgggtcttctgaaaccggtgggaaaacggcccaggcacccctc
HTMT1_0111_E01.b : ggaaaagggctctttaaaattgggcgggaaaggggccccaggacaccccccacccccttt
HTMT1_0037_B01.b : acccgggcccagtgtggttgcggaaaggaaaaagggttttcttggaaatcggggtgggaa
HTMT1_0035_E04.b : aggggggctgggaaagaaaaagggcctttggaaacgggtgggaaaggggcccagggaatc
CBLT1_0040_F03.b : cccagtgggctgcggacggaaacagggcttcttgaaaacgggtgggaaaagggccccaag
HTMT1_0027_C08.b : gccatggggctgccaacaggaacaggttctcttggaatgggctgaaaaaggccccaggga
HTMT1_0012_H10.b : ggggccagggggctgccgacagaaaacaggtctctggaaatcgggctgccaaaagggccc
HTMT1_0011_B07.b : ccggcccagggggctgcgaacgggaaaagggtcttcttggaatcgggctggcaaagcggg
CBLT1_0093_A09.b : aaaggggtctctgggaaaggggggggaaaggggccnggggaccctctacaccccttttct
HTMT1_0144_G09.b : gcggcaacgggccccgggaccccctgctctatttatgggcccggcgtttgggtgccanaa
CBLT1_0068_C08.b : aggaaaggggtctctttggaatggggtggggaaaagggccccaggggccccctccaaccc
HTMT1_0109_F08.b : aaagggtctttttgaaattggtgggaaagggggcccgggaaccctcccaacccttttcct
CBLT1_0038_E04.b : gaaggaacaggtcttctgaaatgggcggcaaaacggcccaggaacctcttcaacctttgt
HTMT1_0089_E09.b : aaggaaaagggcctctggaaatggggtgggaaagggcccagggaaccccccaaccccttt
HTMT1_0014_H01.b : cacgggggttcagaaagaaaaagggtcttcttgaaaacgggctttacgaaagggcccaag
HTMT1_0087_A04.b : gaaatcggtgggaacggccccggcactctcaccctgttctgggccggcggatggggaaag
CBLT1_0078_G12.b : ccgggcccagggggggcgcggaaaggaaaaaagggctttcctgggattccggggtgggaa
HTMT1_0050_A03.b : tgcggacagaaacaggtctcttgaaatcggcggggaaagggccaaggaacccctctancc
CBLT1_0086_E03.b : caggggggcgcggaaggaaaagggccttctggaatcgggctggaaaggggccccgggacc
HTMT1_0028_C05.b : ggggcttgcgaacggaaagggtcttctgaaatcgggggggaaagcggcccgggaactctc
HTMT1_0042_F09.b : atggggctgcggacagaaacagttcttctgaaatcgggttgaaaaagggcccaagggacc
HTMT1_0109_A05.b : agtggggctgcgaaggaaaaggtcttctgaaacggggtggaaaacggccccggcccctcc
HTMT1_0006_E11.b : ccggcccattggggcgtcgaaaggaaaagggtcttctggaaatcggggtggaaaacgggc
HTMT1_0134_F06.b : cccatggggctgcgaaagaaccagttcttctggaatcgggtggcaaacggcccagggcac
CBLT1_0042_E07.b : ggccccttggggcggcggaagggaaacgggtcctcttggaaaccgggttggaaaacgggc
HTMT1_0134_C07.b : cagtgggctgcgacagaacaagtcttcctgaatcgggctgcaaagggcccaggcnacctc
CBLT1_0072_C10.b : ggcccatggggctgcgaacggaaacaggtcttcttggaaccggctgggaaaacgggcccc
ILNT1_0001_B08.b : cggcccctggggctgccgacagaaacgggtctcctgggaaccgggtggcaaaaggggccc
CBLT1_0078_C11.b : ACTGGGGCCAGGGGGGCTGCGGAAAGGAAAAAAGTTCTTCTTGGAAtcgggcttggaaaa
CBLT1_0061_E10.b : CTCGGGCCCATGGGGGCTGCGGAACGGAAAAGGGGTTTTCTTGAAAATCGGGCggggaaa
HTMT1_0002_C03.b : ccggccccagggggctgccgaacagaaaacaggtcctctttaaaaccggctggaaaaaag
HTMT1_0025_D10.b : gggtgcgaaaggaaaagggctcttggaaatgggtgggaaagggccccgggaactcccacc
HTMT1_0002_F07.b : ggcccatggggctgcggaaagaaaaaggttttctggaaaatggctggaaaacggggccca
HTMT1_0128_H06.b : agaaaaggtctctgaatcgcttggcnaagggccaggacctctaacccttttctaggccgc
HTMT1_0064_A02.b : cccatggggctgcgaacagaaacgggtcttcttggaatcgggctggaaaaaagggcccag
CBLT1_0073_C05.b : ggaaagggcccgggaccctctaacccctttcctaggcccccggaattgggaatttccatt
HTMT1_0138_A04.b : aggggccaggacctcctcacccttttttaggcccccggattgggaaactccccaaaaggg
HTMT1_0025_F09.b : aaagagaacgggctttcttggaactggttgggaaaggggcccaggggacccctaaaccct
HTMT1_0105_A01.b : agaaaagggccttctggaatcggggggaaaaggggccagggcccccctcacccctgttct
HTMT1_0120_E04.b : gttttttggaatggtgggaaagggccaggaacctccaaccctttcctgggcccgccggat
HTMT1_0010_E11.b : aatccgggccaagtggggcttccgaacagaaaacaaggtctttcttggaaaatcggctgg
CBLT1_0039_B10.b : cggaaggaaacaggttttcttgaaatcggctggaaacgggccccaggcacctcctcaccc
HTMT1_0117_G02.b : aaaaggcccttttgataccgattgtaaacgggcccgtgctacacatccaaccttgcttta
HTMT1_0107_A07.b : gggcttcttgaaatggggggaaaggggcccagggccccctccaccctttttcttaggccc
HTMT1_0106_C10.b : ggggttttctgaattgggtgggaaacgggcccaggacccccctaccccctgttctagggc
HTMT1_0104_B07.b : cattgggctcgggaagaaacagggtcttctgtaaatgggcggggaaaggggccaagggcc
HTMT1_0106_A11.b : gaaaatccgggcccaggggggcctccgaaaagaaaaagggttttctgggaaatcgggggg
HTMT1_0137_G02.b : aaaaagggcttttggaaaggggggggaaagggccccggggaccccctaaccctgttctga
HTMT1_0057_G09.b : gggtgcgaaagaaaaagggttcttctgaaatacgggtgggaaaaagggcccaggggactc
HTMT1_0047_D10.b : ggctttttgaaatcgggtggaaaagggccccagaaaccccttcaacctttgtctaggccc
CBLT1_0056_D12.b : cgggcccatgggggcgtggcgacggaaaaagggtcttcttggaaatcgggctgggcaaaa
HTMT1_0047_F01.b : acaggaaaaagttcttctgaattcgggctggaaaggggcccagggcaccttctcaccccc
HTMT1_0044_G09.b : ttctgaatcgggggggaaagggccccgggacccctcaacctttttctaaggcccccggat
HTMT1_0141_E10.b : gaacgaaaagagtttttttgaattggggggaaaagggcctggctcccctcaacccctttc
HTMT1_0149_G10.b : aaaggaaacggtcttctggaatcgggtggaaaagggcccgggaaccccctcaaccctgtt
CBLT1_0055_C05.b : cgaaaggaaaagtccttctggaaatcgctgggaaagcggccccgggaccccctcaaccct
CBLT1_0021_D08.b : gccaacggaaacaggttttttggaaatggggtggaaaaggggcccggggacctccttaac
HTMT1_0099_B11.b : cctgggggttgcgaaaaggaaaaaggtctttttggaaaccggggtggaaagagggccccg
HTMT1_0121_B03.b : tggaattggggggaaaaggcccaggaccctccaaccctttcttaggcccccggatttgga
HTMT1_0151_F05.b : tcgacaggaaaaggccttctggaatcggcgggcaaaggggccaaggccccccccaaccct
HTMT1_0011_A04.b : gaatccgggccccagtggggctggcggaaaggaaacaaggtcttcttggaaaaccgggtt
HTMT1_0010_H05.b : ctcgggccccattggggctgcggacaggaaacagggtcctcttgggaaattcggctggga
HTMT1_0025_A07.b : gaacggaaagggtcttctgaaatcgggggaaaaggggccagggacctccccaacccttgt
HTMT1_0021_A06.b : gggttcggaaaggaaaaagggcttcctgggaacgggggtggaaaaaggggccccggggac
HTMT1_0095_B10.b : gggttgcgaaggaaacaggtcttctggaaatcggctggaaaagggcccagggaaccccct
HTMT1_0021_G07.b : aactcggccccctgtgggctgggacaagggaaacaggtcctcttgggaaatacggggtgg
HTMT1_0086_H08.b : ggggctgcgaaaggaacagggtctcttgggaatcggctgggaaaaggggcccaggcaacc
HTMT1_0037_B06.b : ccatggggggcggcgaaaggaaaaagggcctcttggaaaacggggtggaaaagggggccc
HTMT1_0013_B03.b : ccttggggctgcggaacggaacagggccttcttggaatccggctgtggaaaagggcccca
HTMT1_0065_B01.b : ggctgcggacaggaacggttcttctgaaaatcgctggnaaaagggcccaggcacctccca
HTMT1_0028_B11.b : aatgggctgcgaaagaaaaaagtcttcttggaatcggggtggaaagggcgcccgggaact
CBLT1_0037_B12.b : gggccccgtgggggcgcggaagggaaacaggtcttcctggaaacggggctgggaaaaggg
HTMT1_0118_B12.b : caggggggctgcggacagaaaacgggtctttttggaaaatgggctgggaaaaggggccca
HTMT1_0117_E09.b : gcgcggaacagaacaggtcttcttgaatcggctggaaaagggccccaggacctccccaac
CBLT1_0046_C06.b : gaagaaaagggcttctggaatcggctggaaagggcccgggcacccccctaccctgggtcc
CBLT1_0028_G06.b : tcgggcccagtgggggttcggaaaggaaaaaggggcttccttggaatacgggtgggaaaa
HTMT1_0111_D11.b : ccgtgggctgccgacagaaacagggttctctggaaacgggcgggaaaaagggccccaggg
HTMT1_0092_C07.b : tggggctccgaaagaaaaagggcctcttgaaatcgggtggaaaagggccccgggaacctc
HTMT1_0013_D07.b : cccgtggggctgcggaaagaaacaggtcttctggaaatcgggtgggaaaggggccccggg
CBLT1_0076_G10.b : ccatggggctgcgacaagaaaaggggtcttctggaaatcgggctgggaaacggggcccaa
HTMT1_0098_B07.b : gggcgcggaaggaaacaggcctcttggaatcggtgggaaaaggccccaggaaccctctaa
HTMT1_0064_B07.b : gccagtggggctgcngacagaaacagggtcctcttgaaatccggctgaagaacgggcccc
HTMT1_0133_A12.b : cccatggggccgcgaaaagaaaaaggttctttcgggaaaacgggctggaaaacgggccca
HTMT1_0048_C02.b : aggggctgcggaaggaacgggtctcttggaaatcggctggaaaagggcccaggcacctcc
ILNT1_0002_G10.b : cccatggggctgggaaaggaaacaggtcctctggaaatcggcctgcaaaagggcccaagg
HTMT1_0094_D10.b : gcccatgggtctgcgaacaggaaagggctctcttgaaatcggttgggaaaggggcccagg
HTMT1_0046_G11.b : gccagtggggctgcggacagaaacaggtcctcttggaatcgggctggcaaaggggcccca
CBLT1_0034_A11.b : actccggccccgtgggggcttccgaacaggaaaacagggtcttccttgaaatccggcgtg
HTMT1_0083_G02.b : atccgggcccatgggggctgcggacaagaaacaggtccttcttggaaatcgggcttgaca
HTMT1_0042_A07.b : ccccattgggcctgcgacgnaaacggggtcttctggaaatcggctggaaaacgggcccag
HTMT1_0056_H09.b : ccccgtggggctgccgaagaaaccgggtcttctggaaatcggctggaaaaagggccccag
HTMT1_0087_A03.b : gcccagggggctgcgaaagaaacagggtcttctggaatcggcttggaaagcngcccagga
HTMT1_0060_E10.b : ggccagtggggctgcggacggaaacgggtcttcctggaactcggctgccaacggggccca
CBLT1_0044_D03.b : ggcccaatgggctgcggacggaaacgggtcctctggaatcggtgggagacgggcccaggc
HTMT1_0016_A07.b : ggcccattggggctgcggaaagaacacagtcctcttggaaatcggctggaaaaaggggcc
HTMT1_0061_H06.b : ggcccagtggggctgcggacagaaaaaggtcttcttgaatacgtgggggaaaagggcccc
HTMT1_0139_A10.b : gccattgggctgcgacaggacagggtctcttgaaacggggtgggaaaggggcccagggac
CBLT1_0053_F07.b : cggggcccgggggcctgcgacagaaaaagggtcttcttgaaatcgggctgggagagcggg
CBLT1_0034_F12.b : CTCGGGCCCAATGGGGgctgccgaacaggaaacagggtcttcctggaaatcgggcgggca
HTMT1_0076_H02.b : actaaattctggacccagtgtgggtcgcgaaaaaatatactggtgtttctcttgaaaata
CBLT1_0067_B02.b : ccccgcccctatgggggtctccgaaagaaaaagggttctttttggaaataggggggggaa
HTMT1_0007_C05.b : ggttgcgaaagaaaagggtcttctggaaacgggtgggaaaggggcccaggcaacccccca
HTMT1_0041_C07.b : gggggtggcgaaaaggaaaagggtcttcttgggaaacgggtgggaaagggggcccaggga
HTMT1_0036_E07.b : gggggggttgcggaaagaaacagggtctccttgaaaacgcggcgggaaaaggggcccagg
HTMT1_0010_C06.b : ATCGGGCCCAGTGGGGCTGCGGAAAAGAAACAGGGTCTTCTTGAAAATCTGGCTGGgaaa
HTMT1_0126_H07.b : tgggctgcggacagaacaggtcttctggatcgggttggaaacggccccaggcactcctaa
HTMT1_0113_A02.b : cagtgggctggcgaaggaaccaggtcttctggaatcgggcgggaaacggcccagggaccc
HTMT1_0120_A12.b : gaataggggggaaaaagggcccgggaccccctcaccccttttttagcccccccggttttt
CBLT1_0024_B08.b : gaaaaggaaaaaggtcctttttgaaatggggtgggagaaagggcccaagggaccctccca
HTMT1_0118_H02.b : gctgggaaaaataaagggttttttggatagggcgggaaaggggcccgggaactcccccac
HTMT1_0045_F04.b : gggggctcgaacaggaacagggtcttctgaaaacgggtgggaaaaggggcccagggaacc
HTMT1_0053_C11.b : cccattggggctgcgaacgaaacggggcttcttgaaatgggctggaaaagggcgccagga
HTMT1_0042_E11.b : aaacaggtctcttggatcggttggaaaggggcccaggcacctcctcaaccctgttctgga
CBLT1_0067_E11.b : cttggaaataggggggaaaaaaggcccccgggacccccttaaccccctttttttaggccc
CBLT1_0074_F01.b : gaagggaacaggtccttctgaaaacgggggggaaaaaggccccagggaccccccaaaccc
HTMT1_0136_H12.b : aagggaacgggtcttctgggaatcggccgggaaagggggcccagggcccccctcaaccct
HTMT1_0126_E03.b : cgggcggngacggcccagcactcctcaccttgttctagcccgccggatgtggaaggccac
HTMT1_0147_C10.b : gggccttctgaaatcggtgggaaaggggccagggacccctccacccctggtctaaggccg
HTMT1_0041_H02.b : caggggggttcgaaaagaaaaaggttcttcttgaaatggggggggaaaagggcccaggga
HTMT1_0117_D03.b : tgggcctgagaagagaaagggctctctagaatagtgtggaagggggccagggctcctctc
HTMT1_0034_B04.b : tcgggcccagtggggttgcggaagagaaaagggtcttcttggaaatcgggtgggaaaagg
CBLT1_0077_E12.b : atccgggccccgtggggggtgcgaaccagaaaaaggggctttccggaaaatggggctggg
HTMT1_0118_F12.b : gggctgcgaaggaaaaggttcttctggaaaatggttggaaaaggggccccagggaccccc
HTMT1_0066_C01.b : ggctgcggacagaaacaggtcttctggaatcggnttgggnaagggccccaggcacctctc
HTMT1_0073_B12.b : ggggggtcgaaagaaaacagggtttttgggaacgggggggaaaaggggcccagggacccc
CBLT1_0072_H09.b : ccccatggggcttgcgaaggaaacagggtcttcctgaaatcggctgggaaaacgggcccc
HTMT1_0041_A02.b : CTCCGGCCCAGGGGGctgcggacaggaaaagggtcttcttgaaaatgggttgcgaaacgg
CBLT1_0005_E10.b : CCCGGGCCCAGTGGGGCTGCGGAAAGGAAACAGGGTTCTCCTGGAAATCGGGCTGGgaaa
HTMT1_0111_A02.b : gggctgcgaaagaaaagggtcttttggaaatgggcgggaaaggggccccggcaccccctt
HTMT1_0076_C01.b : ttgaaaacgggtggggaaaagggcccccgggaaccccccccacccttttttttggccccc
HTMT1_0122_D09.b : acgaaaaaaggtcctcttggaaaatggggggggaaaaggccccacgggccccctctaacc
CBLT1_0009_G11.b : cccattgggctgcggacaggaacaggttcttctggaaaatcgccttggaaaagggcccca
HTMT1_0093_H12.b : ccgggccattggggctgcgaaaaggaaacaggtcttcttgaaatcnggctgggaaagagg
HTMT1_0060_B12.b : gaggcnnnnnagcagcctnnnnnncccacctgctccggtcagccggnnnnnnnnnnnnna
CBLT1_0034_H05.b : aaggtctcttgtgaaaaggggtgggaagagggcccagggcccccccccccctttttttct
HTMT1_0059_D04.b : cggggactcccacacttgannaggncgcggaggtggggaagtcacaaaagagagggggtg
CBLT1_0068_G08.b : ttggggcctggaaaagaaaaaagggtttctggaaaatcgggggggaaaagggcgcccagg
HTMT1_0115_B01.b : aggggtgggaagggggcccggggcccccctacccttgttcaagggccgccggtttgggaa
HTMT1_0058_C04.b : gaaatcggctgggaaaaaggccccagaacccccccaacccttgttcctagggccgcccgg
CBLT1_0073_F08.b : ctgaaatgggtggggaaagggcccgggaacttcccaaccctttttttagggccccccgga
HTMT1_0013_A02.b : gaaaaagtcactccctaacaccgtaaagacagaaagtcctaacctcctttcgagatcttc
CBLT1_0067_B11.b : gggcgcgccaaaaaaaaaaagggtctttttgggaaacgggggggggaaaaaggggccccc
HTMT1_0119_B12.b : acaatttgctttctttttttttcaggtccggggagggtggggggttttttgcgtaaagaa
CBLT1_0023_G10.b :
HTMT1_0127_H12.b : tgaatcgntggggaaaggcccaaggacctcttaacccttttctagcccgccgggattggg
HTMT1_0111_F07.b : gtttttttgaattgggggggaaagggccccagggacccccccaaccctgttcctgggccc
HTMT1_0105_F06.b : tcttttaaaatcggcggcaaaggggcccaggcaccccccaacctttttctaggccggcgg
HTMT1_0117_H09.b : aaatggggggaaagggcccaggcacctcccccccctgttttagggcccccggattgggaa
CBLT1_0073_B11.b : acccgggccccgtggggggtcgcgaaagaaaaaagggttttttggaaaaacgggggtgga
HTMT1_0119_D08.b : caaacgaacaggtttttttgaaatagggtggaaaagggccccggagatcttccacacccc
HTMT1_0126_F11.b : acgggggggaaagggcccaggaacccctcacccttttcttgggcccccggaggtggggaa
HTMT1_0128_E02.b : gcggggaagggccccaggaccccccccccttgctagggccgccggaaggggaaagccccc
CBLT1_0050_C05.b : aacaggtctctgaatcggttgcaaggggcccaggcacctctcaacccttgtcctagggcg
HTMT1_0035_H01.b : gtaaaacccgggcccaggggggttgccggaaaaggaaacaagggcttctctgggaaaaac
HTMT1_0035_D11.b : ctcgggcccagtgggggttggcaaaaggaacaaggtcttctttgaaaatcggggtgaaaa
CBLT1_0096_H03.b : atcgggtggaaaagggcccggaccccctaaccctttctaggcccccggatttggaaaagc
HTMT1_0140_H10.b : aatggttgggaaagggcccgggacccctcaaccttgtccaagcccgcggggttgggaaag
CBLT1_0038_D11.b : cggcccttgggggctcgaaaagaaaaaggggcttcttggaaatcgggttgggaaaagggg
HTMT1_0132_F08.b : aaagaaaagggtcttctgggattcggctggaaaagggcccagggacctccccaccccgtg
HTMT1_0016_D05.b : aaggaaaaggtccttttggaatcggctggaaaaggggcccggggaccccctcacccctgt
HTMT1_0097_G08.b : cccagggggggtggggaaaggaaaaagggcccccttggaaatcggggtgggaaaaggggc
CBLT1_0041_C10.b : tgggggctgcgaaaggaaaaggggcttcttggaaatcgggtgggggaaaggggcccaggg
HTMT1_0121_B01.b : tgcggaaaggaaaaggggtctcttggaaattgggtgggaaaaggggcccagggaaccccc
HTMT1_0113_B09.b : gcggaagaaaaagggttttttgaaatgggctggaaaggggcccagggaccctcccacccc
HTMT1_0077_E08.b : agaaaagggtttctggaaaggggtggaaaagggccccggggacccccccaccctgtctaa
CBLT1_0041_D07.b : ggaaggaaaaaggtcttctggaaatcgggttggaaaaggggccaggggaacctcctnaac
HTMT1_0148_A09.b : aaaaggtttctttgaaatgggggtgaaaagggccccnngncccccctacccctttttctt
HTMT1_0132_F03.b : acggaaaagggtctcttgaaatcggctgggaaaggggcccaagcgaaccccctaaccttg
HTMT1_0140_C12.b : tttgaaagggggggaaagggccccgggacctcccaccccttttttaggcccccggtttgg
HTMT1_0140_F06.b : ggaaaaggtctcttgaaatcgcggtggaaaaggggcccaggcaacccttaacccttgttc
CBLT1_0024_F01.b : ggggggtggcgaaaaggaaaagggtcttcttggaaatcgggggggaaaaggggcccccgg
HTMT1_0106_E05.b : aaagggtttttggaatgggtgggaaagggcccaggcccctttaacccttttctgaggccg
HTMT1_0099_C09.b : cggaaggaaaagggtcttctgaaaattggctggaaaagggccccagggaacctcttaaac
HTMT1_0101_E05.b : gctgcgaacagaaaggggtttctggaaatcggttgggaaacggccccagggaaccctcca
HTMT1_0021_A08.b : ggctgcggaaggaaaaagggcctttcttggaaatcggcgggaaaaagggccccagggcaa
HTMT1_0128_G08.b : agtcctctgaatcgntggggaaaggcccagggaccccaaccctttccaaggccgccggat
HTMT1_0120_B12.b : gcgaaagaaaaaggtcttctggaatcggggggaaaagggcccggggaccccccacccctt
HTMT1_0028_G05.b : aggaaaaggtctttctgaaacggcgggaaaaggggcccgggaacccctcaaccctggttc
HTMT1_0060_C11.b : gctgcgaaaggaaacagggtcttctggaaaactgttgggaaaagggggccccaggaacct
HTMT1_0044_H10.b : ggctggaaaggaaaaagggcttcttggaatctggggggaaaagggggcccaggaacccct
HTMT1_0026_D07.b : gaaggaaacggttctcttggaatcggcggcaaacgggcccgggaaactcctcaaccttgg
CBLT1_0060_G12.b : ggcaaacctcgggccccatgggggcctgccggaaaggaaaaagaggtcctccttggaaaa
HTMT1_0105_B03.b : agtggggtcgcgaaagaaaaaggttttttggaaatggggggggaaggggcccggggacct
CBLT1_0011_E06.b : cggcgccatgggggtttcggacaggaaccagggtcttctgtgaaatcggtttggagaaga
HTMT1_0135_B04.b : cagtctctggaatcggtgtgaaggggccagggaactcctcaccctgttctaggcccggcg
CBLT1_0080_E02.b : cggacggaaacggttctcctggaatcgggctggaaaacggccccaggcaccctcccaacc
CBLT1_0064_A08.b : ggttgcgaaaggaaaagggccttttggaaatcgggtgggaaagggggcccagggaacctc
HTMT1_0139_E01.b : ggaaggaacaggtctcctggaacggctgggaaaggggcccagggaacccccaacccctgt
CBLT1_0090_F01.b : ccccgtggggccgccgaaaggaaaaagggctttctggaaatgggttggtaaaaagggccc
HTMT1_0034_H09.b : cggcccaggggggctggggaaaaggaaaaagggtctcttggaaaaccgggtgggcaaaag
CBLT1_0014_C12.b : acccgggcccattggggcctgcggaacggaaaaaggggccttcttggaaatcggggttgg
CBLT1_0088_A03.b : gggttccgaagggaaaagggtctcttgaaaacgggggggaaaaggggccaggggaccccc
HTMT1_0106_B11.b : gccgttgggcctgcggaaggaaaaagggtctttttgaaaatcggggggaaaaggggcccc
HTMT1_0064_G04.b : ccgaacgaaacagggtctctggaaacggcttggnaaagggcccaagggaacccctcaaac
HTMT1_0062_E07.b : tgcgaaagaaacgggtcttctgaaaatcggtgggaaaacgggcccaggaaccccctaaac
HTMT1_0095_A12.b : aatccggcccagtgggggttgccaaaggaaacagggtctttctgggaatccggcggggaa
HTMT1_0150_D11.b : ggccccgtggggctccggccaggaaccaggtcctcctggaaaccgggcgggagaaagggc
HTMT1_0122_B12.b : ggcgcggaacgggaaagggtctcttgaaatgggctgggaaaggggcccgggggaccccct
HTMT1_0141_H07.b : ggggcttcgaaaaaaaacaggtctccttgaaatcggtaggcaaaccggcctagtgagctc
CBLT1_0040_B05.b : ggggtgcggacagaaacgggtctcttggaaacgggtgggagaggggcccaggaacctctc
CBLT1_0052_A10.b : tgggggtgccgaaggaaacagggccttcttgaaatccgggtggagaagcgcccccaggca
HTMT1_0025_C06.b : cctgtgggctgccgaaaagaaaacaggtcttcttggaaatcggtgttgaaaagagggccc
HTMT1_0067_H07.b : ctgcgaaagaaaagggtctcttgaatcgggttggagaagggccccaggaacccctccacc
CBLT1_0082_A09.b : agggggctgcggaaaggaacggggtcttctggaatcgggtggaaaacggggcccggggaa
HTMT1_0013_F01.b : ggcccatgggggctgcggacaggaaaacgggccttcttgggaatcgggctgggaaaaggg
HTMT1_0130_C05.b : gggctggcgaaggaaaagggcttctggaatgggcgggagaaggccccagggaccccccct
HTMT1_0099_A06.b : aatgggctcgcgaagagaaaaaggcttcttggaaaaggggtggaaaacggcccccggggc
CBLT1_0036_C05.b : ccaatggggctgcggacagaaaagggccttctggaatcgggtgtggaagggggcccaagg
CBLT1_0037_B04.b : caggggctgccgaaaggaaacaggtcttctggaaatcgggtggaaaacgggccccggcac
HTMT1_0132_A04.b : ccgtgggatggcggcaggaacagggcctcttggagactggggggcaaaggcgccaagaga
HTMT1_0070_G03.b : ccagtgggctgcggaagggaacggttcttctggaatcggnctggaaaacgggcccaggnc
HTMT1_0111_H01.b : ggcccaggggggccccaaaagaaaaagggtctttctagaaaatggggggggaaaaggggc
HTMT1_0100_F01.b : cgtgggctgcggaaagaacaaggtcttctggaatcgggcgggaaaagggcccaaggaacc
CBLT1_0044_C08.b : gggccccatggggctgcggaaagaaaacaggtcttttggaaatcgggttggaaaacggcc
HTMT1_0133_A10.b : ggggctgcggaaggaaaagggtctcttggaaacgggctggaaaacggcccccaggaacct
CBLT1_0075_B12.b : tcgggccccaggggggctcccgaaaaggaaaaagggtcttcttgggaaatggggggggaa
HTMT1_0027_B01.b : catggggctgcgaacagaacgggccttctggaatcngctggaaaacggcccaaggaacct
CBLT1_0088_G06.b : cccaatggggctgcggaaggaaacgggtctttcttgaaacgggctggaaaggggccccag
HTMT1_0048_A11.b : cccgtggggctgtcgaaaggaacaggtcttcttgaaaatcgggtggcnaaaggggcccag
CBLT1_0046_H09.b : cccatgggggctgcgaaaggaaaaggggcttttggaaatcggctggcaaaaggggcccag
CBLT1_0004_D05.b : ggccattggggctcggaaagaaaaaggttttcttggaaatcggctggaaaacgggcccag
HTMT1_0103_C12.b : ggcccgtggggctgcgaaaagaaaaaagggtcctttgtggatcggggtgggaaagcgggc
CBLT1_0035_B11.b : gggcccagggggggctgcgaaaaggaacagggtcttcttggaaatcggctgggaaaacgg
HTMT1_0076_B06.b : ccggccccagggggcctgcgaaaagaaaaagggttttcttggaaaccgggtggaagaaag
HTMT1_0095_F01.b : ggggctgcggacagaacagggtcttctggaaatcggctggaaacgggcccaggcagcctc
CBLT1_0013_B03.b : cggcccagtggggctgcggacggaaaaagggtctcttgaaatcgggctggcaaacgggcc
CBLT1_0095_H06.b : tgggctgcgacagaaacaggtctctggaatcggcctggaaacgggccaggcacttctcac
HTMT1_0016_G09.b : ttcgggcccatgggggctgcgaaaagaaaaaaggccctcttgaaatcggggcgggaaaac
HTMT1_0019_D11.b : gccccaggggggctgcgaaaggaaaaggggtcttcttgaaatcggggtggaaaaaggggc
CBLT1_0025_B07.b : ggcccttggggctcggaaagaaaaaaggtccttcttgaaatcgggcggggaaaaaggccc
HTMT1_0028_H02.b : gggccctgggggctgcgaacaggaacaggtcctcctggaaatcggctggaaaacgggccc
CBLT1_0085_H01.b : gcccaagggggctccggaaaggaaaaagggtcttctggaaaacggggtggaaaaaagggc
HTMT1_0054_B11.b : ccccagggggctgccgaaaggaaaggggcttcttgaaattcggctgggaaaaagggcccc
CBLT1_0051_A01.b : atggggctgcgaaggaaacaggtcttctgaaatcggctgggaaaacgggcccagggaccc
HTMT1_0014_G11.b : gggccaggggggctgcggaaagaaaacagggccttcttgaaaatcggctgggaaaacggg
HTMT1_0134_G05.b : tggggctgcgaaagaaacaggtctcttgaatcgggctggcaaagggccccaggaacctct
HTMT1_0034_E03.b : cggcccggggggctgcggacaggaaacagggcctcctgaaaaccgggttgggaaaggggg
HTMT1_0084_E09.b : ccaggggggctgcgaaagaaaaaggctctctgggaaatcggtgggcaaagcggccccggg
CBLT1_0061_C12.b : ggggcccatggggctgcggaaaggaaacagggccttttggaaaacgggcttgcaaaaagg
HTMT1_0149_F10.b : gcccaggggggctgcgaaaggaaaaaggtcttcctggaaatcggcggggaaacgggcccc
CBLT1_0039_D07.b : cccagtgggctgcgaacagaaacaggtcttcttgaaaatcgggtggcaaagggccccggg
CBLT1_0034_F10.b : gccaagggggctgcgaaaaggaaacggtccttcttgaaatcgggtgggaaaacgggcccc
HTMT1_0051_A10.b : ccaagggggctcggacggaaacagggcttctgtgaatggngtgggaaaggggcccaggaa
CBLT1_0039_D10.b : ggcccagtgggctgcggaaggaaacagttcttctggaaatggccgggaaaagggcccagg
HTMT1_0022_F01.b : gcccaggggggtgcggaaaggaaacggggtcttcttgaaaatcggcggggaaaacggggc
CBLT1_0015_E12.b : attcggggcccgtggggggctgcgaacaggaaaaagggttcttctggaaatcgggctgga
HTMT1_0041_B02.b : gccattggggctgccgaaaagaaaaagggtcttcttggaatcggcctgcgaaaggggccc
HTMT1_0075_F07.b : ggcccgtggggctgcggaaaggaaaaggtcttcttggaattcngnttggnaaaagggccc
HTMT1_0020_H06.b : cccaggggggcttcggaaggaaacaggtctttttgaaatcgggcttggaaagggggccca
HTMT1_0074_H09.b : gcccatggggctgcggaaggaaacagggccttcttgaaatcgggcgggcaaaaggggccc
HTMT1_0014_A01.b : gcccatggggctgccgacggaaacaggtcctcttggaatcgggttggcaaaagggccccg
HTMT1_0037_H11.b : atcgggcccagtggggctgcggaacggaaaaaggggcctcttggaaaacggcgtggcaaa
HTMT1_0066_D08.b : ggcccantggggctgcgaaagaaacagggtcttctggaantcngnctgnnaacgggcccc
CBLT1_0038_C06.b : gcccgtggggctgcgaaaggaacaggtcttcttggaactggggggcgaacgggccccggg
CBLT1_0034_C01.b : ggcccagtggggctgcgaacggaacaagggtctcctggaaatcggctggcaaacgggccc
CBLT1_0060_G03.b : cccgttgggctggcgacaggaaaagggtcttcttggaatcggcttggaaaaggggcccag
CBLT1_0062_H04.b : gcccagtgggctgcgacaggaaccgggtctcctggaatcgggcgggcaaaggggcccagg
HTMT1_0096_A11.b : cgggccagtgggctgcggaaggaaaaagggtcctctggaaatgggttggaaaaagggccc
CBLT1_0075_C10.b : ggcccactggggctggcgaaaggaaaagggtcttcttggaaatcggggggggaaaagggg
CBLT1_0025_E08.b : cgggccaatggggctgcggacaggaaacgggtcttcttggaatcgggtgggaaaacgggc
CBLT1_0004_G05.b : ggccattgggctgcgaacagaaacaggtctcttgaaatcggctggcaagggggcccagga
CBLT1_0054_G01.b : gggccatggggctgcggacagaaaagggtcttctggaatcggctggacaaacgggcccag
HTMT1_0053_A07.b : cccagggggctgcggaaagaaaagggtctccttgaatcgggtgggaaaaggggccaggga
HTMT1_0073_B07.b : gggcccgtggggctgcgaacagaaaagggcctcctggaatcgggctggaaaaggggccca
HTMT1_0094_C01.b : ggccagtggggctgcgacaggaacaggtcttcttggaatcggcctgcaaacgggccccgg
HTMT1_0027_A10.b : gcccaatgggctgcggaaagaaacaggtcttctggaaaacggcttggaaagcgggcccag
HTMT1_0017_E05.b : gggcccatggggctgcggacaggaaaagggtcttctgggaaccgccgtggcnaacgggcc
HTMT1_0063_D12.b : tcggccccagggggcctgcggacagaaacaggccttcctgaaaatcggctggaaaagggg
HTMT1_0045_D10.b : ctgggcccaggggggtgcaaaaggaacagggtcttcttaaaatcggctgtgaaaaggggc
HTMT1_0073_A06.b : cgggcccagggggctgcggacaggaaacgggtcttcttggaaatcggtggggaaaaggcc
CBLT1_0061_H05.b : ggcccagtggggctgcggacagaaaacaggtctttctggaaatcggcttggcaaaagggg
HTMT1_0089_D09.b : cccaggggggctgcggaaggaaacagggcttcttggaaacgggcggggaaaacgccccca
CBLT1_0062_D02.b : ggcccagtggggctgccgacaggaacagggttttcttggaacgggccgggcaaacggggc
HTMT1_0043_E02.b : gggcccgtgggggtgcggaaagaaaaagggcttcctggaatcgggctgcaaaacgggccc
CBLT1_0059_H04.b : gggcccattggggctgccgaaagaaaaggggtcttcttggaatccgctgggaaaacgggc
HTMT1_0043_G10.b : cggcccatggggctgcggacagaaacaggggcttctggaaatcgggtggggaaaagggcc
HTMT1_0067_A10.b : cgggcccatggggctgcggacagaaaacaggttctcttggaaacggncntgaaaaagggc
CBLT1_0037_H08.b : tcggcccagggggcctgcgaaagaaacagggccttctgaaatcgggtgggaaaaggggcc
CBLT1_0084_G04.b : cgggccagtggggctgcgaaaggaaacaaggcctcttggaaacgggttgggaaaagggcc
HTMT1_0071_D10.b : CTCGGcccagtgggcctggcgacagaaaaaggttcttcttggaatcgggctggaaacggg
HTMT1_0014_H06.b : CTCGGGCCaggggggctgcgaaaggaaacagggccttcttggaatcgggcttggaagcgg
CBLT1_0006_A07.b : CTCGGGCCCAtggggctgcggaaggaaacgggtcttcctgaaatcgggctggcaaacggg
CBLT1_0055_D08.b : CTCCGGGCCAGTGGGGCTtgcgaaggaaacgggttcttctggaaatcggccgggcaaagg
CBLT1_0004_H12.b : CTCGGGCCCATTGGGGCTGCGaaaagaaaaagggtcttctggaaatccggctggcaaaac
HTMT1_0042_F11.b : CTCGGCCCCATGGGGGCTGCGaaaggaaacagggtcttcttggaatcgggttgcaaaaag
HTMT1_0016_H08.b : CTCGGGCCCAGTGGGGCTGCGGACAGGAAAagggtctccttggaatcnggctggaaaaag
CBLT1_0081_G11.b : ATCGGGCCCCATGGGGCTGCGAACGGAAAACAGGtcctcttggaaatcgggggggggaaa
HTMT1_0015_A09.b : CTCGGGCCAGTGGGGGCTGCGGAACAGAAACAGGGTCTTCTggaaatcggccttgggaaa
HTMT1_0040_B10.b : ATCCGGGCCCGTGGGGGTGCGGAACAGGAACAGGGTCTTCTTGGAAAcggcctggaaaaa
BFLT1_0007_D04.b : ggctgcggaagaaaaagtccttctgaaacgggctggaaacgggcccagggacctcctcaa
HTMT1_0024_B03.b : atggggctgcggaaggaaacaggcctcctggaaatgggtgggaaaacggcccaggcagct
CBLT1_0007_C02.b : ctccaattaattttagatgcacatccagtgcttcaaccgtgaggggtcatcaggacagta
CBLT1_0028_F01.b : ggggggccccaaaagaaaaagggtcttcttgaaaatgggggggaaaaggggccccaggga
HTMT1_0056_D12.b : tgcaaaaaaaaaggggcttcctgaaaaagggggggaaaaagggccccagaaacccccctc
HTMT1_0131_B02.b : aaagaaaagttctcttgaatcggcgggaaagggccaagcacctcctaacctggtctaagc
HTMT1_0104_G12.b : cccggggggcgtcagaaagaaaaggggttctttggaattgggggtgaagaggggccccgg
HTMT1_0042_B11.b : tggggctgcggacaggaacagggtctttctgaaaatgggtgtggaaaggggcccaggaac
HTMT1_0068_B12.b : ggcccagggggcctgcgcacagaaaacagggcctcctggaaatcgggtgtgaaaaagggg
CBLT1_0054_F08.b : ggcccttggggctgcggacaggaacagggtctcttgaaatcgggttgggaagcgggccca
CBLT1_0085_H05.b : cggcccattggggctgcggaaggaaaacgggtcctcttggaaatcggggtggcaaagggg
HTMT1_0064_C09.b : gggcccgtgggctgcgaacagaacagggtctcctgaattcgggctggagaacgggccaag
HTMT1_0047_B04.b : gggccaatggggctgcggacagaaccagggtcttcttgaaatcgggctgcaagaacgggc
HTMT1_0068_D07.b : ggcccatggggctgcggacagaaccaggtcttcttgaaatccggctggagaaggggcccc
CBLT1_0053_G06.b : ccggccccatggggctgcgaacaggaacagggtcttcttggaaatgggtgggcaaaaggg
HTMT1_0026_F11.b : ATCCGGCCCAGGGGGGCTGCGGAaggaaaaaagggccttcttggaatcgggtgtggaaaa
HTMT1_0049_A09.b : ggaaggaaaaggtcttcttgaaacgggtggaaaagggccccagggacccccctaaccctt
CBLT1_0080_H12.b : ccgggcccatgggggcttcgagaaagaacaaggggccttctgtgaaacggggggggcaaa
HTMT1_0104_F09.b : tgggggctcagaaagaaaaagggctttttgaaatcgggcggaaaaggggcccagggaacc
HTMT1_0071_A04.b : agggggctgcngacagaaccaggtctcctgnaaatcggctgcaaacgggccccagcacct
HTMT1_0034_F11.b : cccgggcccaggggggctgcggaaaggaaaaaaggcctttctggaaatacgggtgggaaa
HTMT1_0146_C12.b : gcccatggggctgcgaaaggaaacaggtctcttggaatcggctggaaaacgggcccaggg
HTMT1_0136_G04.b : gaatgggctggaaagggcccaggacccttccaccctttcttagcccgccggattgggaaa
HTMT1_0120_B01.b : gaaagaggtgccatgacccccccccccccttttttgaaggccccccagaatttggaacaa
CBLT1_0006_H07.b : gcccatggggctgcggaaagaaacaggtctcttggaaatcgggtgggaaaggggcccaag
HTMT1_0036_D12.b : aaactcgggcccagtgggggcctgccgaaaaagaaaaaagggtcctccttggaaaatcgg
HTMT1_0133_G04.b : cccatggggctgcggagggaacaggtcctctggaatcggggggaaaaggggcccaggcaa
HTMT1_0036_E11.b : aggaaaagggcctcttggaactggctgggaaaaaggacccaagaacccccctaaacccat
CBLT1_0062_A01.b : gcccattgggctgcgaaaggaaccaggtcttcttgaatcgggtgggaaaaggggcccagg
HTMT1_0085_D02.b : aggagtcttctagaaaacgggggggagaaagggccacgggagcccccccacacccctttt
HTMT1_0063_E09.b : cccagtgggctgcggacgggaccagggcctcttggaatcgggctggcaaaggggcccagg
CBLT1_0024_D10.b : cccatggggctgcgaaaggaacaagggttttttgaaatcgggggggagaaggggccccgg
CBLT1_0024_B03.b : cgggccccatggggcttccgaacagaaaaaggggtttccttgaaaaccggctggggaaaa
CBLT1_0069_G11.b : gcccattggggctgccggaaggaaaccgggtcttcctgggaatcgggctggccaaaccgg
CBLT1_0075_E09.b : CTC*GGCCCAGTGGGGCTGCGGACAGGAAACAGGtcttcttggaatcgggctggcaaaac
CBLT1_0052_G05.b : ggcccagtgggctgcggacggaaacagggtctctgaaatggcctggcaaacgggccccag
CBLT1_0074_H03.b : atggggctgcggaaagaaaaagggtcttttggaaaatgggctggaaaaggggcccaggga
CBLT1_0052_H03.b : CTCGGGCCCAGTGGGctggcgaacagaaaagggtcttctggaaatccggctggcaaaacg
CBLT1_0052_H02.b : CTC*GGCCCAGTGGGGCTGCGGACAGGAAACAGGGTCTTCTTGGAAATCGGcttggaaaa
CBLT1_0042_B03.b : CTCGGGCCCAGTGGGGCTGCGGACAGGAAACAGGGTCTTCTTGGAAATCGGGCTGGCAGA
CBLT1_0075_G03.b : CTCGGGCCCAGTGGGGCTGCGGACAGGAAACAGGGTCTTCTTGGAAATCGGGCTGGCAGA
HTMT1_0086_E02.b : CTCGGGCCCAGTGGGGCTGCGGACAGGAAACAGGGTCTTCTTGGAAATCGGGCTGGCAGA
20110601C-000217 : GCGGGCCCCAGGGCAGCCTCCTCGACGCCCTGTGTCCTGAGGGCCCGGCCGGGAGTGTGG
---------+---------+---------+---------+---------+---------+ 1228
CBLT1_0023_A08.b : ccccccctttttcttagggccgcgcgggagttggggaaggtgctcctcccagaggggggg
HTMT1_0050_B08.b : ccggaatggggaaaggctcctcaaaaggggggggtgtggtccccccgggggtggtgcccc
CBLT1_0068_D11.b : ccagggaacccccccctaaaccccctttttttaaaaggccccccgcggaggttgggggaa
CBLT1_0077_C07.b : gcggatttgggaaaggccatcaaagaggagggttggcccccccggggtggggcccgagca
HTMT1_0126_A09.b : ggcccgcggattggggaatgctaccaaaggagcgggttgtccccccggtgctgggccacc
HTMT1_0038_C01.b : ggaaaaaaggggccccagggaaccctccctcaacccctgttgtcctgagagcccgtcccg
HTMT1_0038_D01.b : aaaggggcccacggagaacccccctcaaaccctttgtttctagagcccccccggaaatgt
CBLT1_0055_F02.b : cagggcacctcctcaccccttgttctgaaggcccgccggaatttggggaatcgctaactc
HTMT1_0079_B03.b : accctggcctggggccccccggaattggggaaagcccacctccaagttggcgggtttggc
HTMT1_0145_A10.b : gcggaattggggaaagcccaccaaggaggggggttggccaccccggggggggggccccac
CBLT1_0042_C01.b : ggggccccagggcaccccctcacccccgggctccgagggccggcgggaattgggggaaag
HTMT1_0012_E08.b : aaaacgggccccaggcaccctccctcaaccccgtggttcctagggcccggccggggattg
HTMT1_0012_F03.b : gccccaaggtagcctcctcaagccctgtgtcctgaaggcccggcccggaggtgggggaaa
HTMT1_0006_A04.b : accttctcaaaccctggttctgaggcccgccggaattgggaatgctcaatccaaggatgc
HTMT1_0003_B02.b : ccaggggaacctcccaacccctgtttcctaagccccgccggatgtggggaatgcccaacc
HTMT1_0005_F06.b : aaccctgtttttaggcccccgggatggggaatggaaaccaaaaagagggggttgtccccc
HTMT1_0111_E01.b : ttctaggcccccccggaattggggaaaagcccctccaaggggggggggggtgggcccccc
HTMT1_0037_B01.b : gaggggccccagggaaccctcccttaacccctttttcttaaggccccccccggaattgtg
HTMT1_0035_E04.b : ccccaaaccccgttcctaaggcccgccgggaagggggaaagggcccccccaaaagggggg
CBLT1_0040_F03.b : acacctcctcaaccctttgtcctagggccggccggatgttgggaatagccacccaaaaga
HTMT1_0027_C08.b : acctctcaaacctgtttctgaggcccggcgggaatgtgggaattgccacccaaaggatgc
HTMT1_0012_H10.b : cgggaagcttcctaaacccctggttcttgaggcccgccgggaatgtgggaaaagcccaac
HTMT1_0011_B07.b : cccagggaagctccctcaccccctggtccttagggcccggccgggaagtggggaaaatgg
CBLT1_0093_A09.b : tgagccccgcggatgtggggaaaattcccctcaaaaggaggggggggtgtggcccctccg
HTMT1_0144_G09.b : gcgtgccgggttgtcccactagagctatgcggagataaggntgcgcgcgcacgcacagtc
CBLT1_0068_C08.b : cttttttctaggccccgccgggattgggggaatattcctccccaaaagggggggggggtt
HTMT1_0109_F08.b : tgggccggccgggattggggaatatccactcaaaggggggggggtttggccaccccgggg
CBLT1_0038_E04.b : ctaggcccgccggaattggggaaaggtcaaccaaggagggggggttgtcccccccgggcg
HTMT1_0089_E09.b : ccgagggccgccggattgggggaaggcc