[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000333

Length: 1,311

Sequence [FASTA format sequence]
GGAGCAAGAT GGCTGCGCCC GAAGCTGCCA CGGTGCCGCA AGCTTCCGGG GGTCCCCGGG
CTCCGGCGTG CCTGTTGGTG CTGGGAATGG CGGGGTCTGG GAAAACCACC TTTGTACAGA
GGCTCACCGG ACATCTGCAT AGTCAAGGCT CTCCACCTTA TGTGATCAAC CTGGACCCAG
CTGTGCATGA AGTTCCCTTT CCTGCCAATA TTGATATTCG TGACACTGTG AAGTATAAAG
AAGTCATGAA ACAGTATGGA CTTGGACCGA ACGGCGGCAT AGTGACCTCA CTCAATCTCT
TTGCTAGCCT GGAGCCCCGG CTTCTCAGAC AACATGAAGA CTCTCCTCGT TCTTGCGCTT
CTCCTCCTTT CTGTCTCTGT ACAGGCCAAG GTCTATGATC GGTGCGAGTT CGCCAGAATT
CTGAAAAAGT CTGGCATGGA CGGCTATAGG GGAGTCAGCC TGGCGAACTG GGTGTGTTTG
GCCAAGTGGG AAAGTGATTT TAACACAAAA GCTATAAACC ACAATGTTGG AAGCACTGAT
TATGGAATAT TTCAAATTAA TAGCCGCTAC TGGTGTAATG ATGGCAAGAC ACCCAAAGCA
GTTAATGCCT GTCACATATC CTGCAAAGTT TTGCTGGACG ATGACCTCAG TCAAGATATA
GAATGTGCAA AGAGGGTTGT CAGAGATCCA CTAGGCGTTA AAGCATGGGT GGCATGGAGA
GCTCATTGTC AGAACAAAGA TGTCTCGCAG TACATTCGGG GTTGCAAACT GTAACTGTGC
AGTTTTCCTT CTTCAGCTCA CCTTGTCTCT TTTTCATATT TAGGAAATAA TAGTTGAATG
AAAGGTCATA CTACCATTCT TGCGAACAAA TCATGGTTTT ACCGAAGCAA GAGCATAAGG
TCTTTCTTTA AGAGGCTTAA TGTTTACCTA ATGTGTTTAT TGTTTGTGTT TATTGTTTTA
TAGGCCTACA ATATTTTTCA ATTTGCTAAG AGAATTATTG TTGGTCTGAA ATCTTAATTA
TCAAATATAC CTCCAGTACA TTCAGTTCTT AATCAAAGAA ATAAACCAGA AACAGTCTTC
ATCTGTTCAG TTATCTCTAA AAACAGTAAA AGATAACCAG TCTTTGTTGG GTAATATAAA
ATTTTAAAAG GAGCAGAATG CCAGATGGCT TAAAATGAAG ACAACCTGAA TTAAGAATTT
TGCTTTCATA AAGTGTGACC TTTGGCTTAA ATGTTTTCTC AAAGATGATT CGTTCATTTA
AACGAATTTT AAAATAGTCT CACATTTAGG TATCCATCTC TTTTAGCCTT T


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLYZlysozyme C precursor [Homo sapiens]. 2132e-55O
Contig/Assembly ProteinGPN1GPN-loop GTPase 1 isoform a [Homo sapiens]. 1864e-47
Contig/Assembly ProteinSPACA5Bsperm acrosome-associated protein 5 precursor [Homo sapiens]. 1425e-34O
Contig/Assembly ProteinSPACA5sperm acrosome-associated protein 5 precursor [Homo sapiens]. 1425e-34O
Contig/Assembly ProteinSPACA3sperm acrosome membrane-associated protein 3 [Homo sapiens]. 1403e-33O
Contig/Assembly ProteinLYZL1lysozyme-like protein 1 [Homo sapiens]. 1364e-32O
Contig/Assembly ProteinLYZL6lysozyme-like protein 6 precursor [Homo sapiens]. 1342e-31O
Contig/Assembly ProteinLYZL6lysozyme-like protein 6 precursor [Homo sapiens]. 1342e-31O
Contig/Assembly ProteinLYZL2lysozyme-like protein 2 [Homo sapiens]. 1342e-31O
Contig/Assembly ProteinGPN1GPN-loop GTPase 1 isoform b [Homo sapiens]. 1333e-31O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLyz2lysozyme C-2 precursor [Mus musculus]. 2142e-55O
Contig/Assembly ProteinLyz1lysozyme C-1 precursor [Mus musculus]. 2087e-54O
Contig/Assembly ProteinGpn1GPN-loop GTPase 1 [Mus musculus]. 1802e-45O
Contig/Assembly Protein9530003J23Riklysozyme C-like [Mus musculus]. 1741e-43O
Contig/Assembly ProteinSpaca5sperm acrosome-associated protein 5 precursor [Mus musculus]. 1403e-33O
Contig/Assembly ProteinLyzl1lysozyme-like protein 1 precursor [Mus musculus]. 1394e-33O
Contig/Assembly ProteinSpaca3sperm acrosome membrane-associated protein 3 [Mus musculus]. 1396e-33O
Contig/Assembly ProteinLyzl6lysozyme-like protein 6 precursor [Mus musculus]. 1355e-32O
Contig/Assembly ProteinLyzl4lysozyme-like protein 4 precursor [Mus musculus]. 1095e-24O
Contig/Assembly ProteinLalbaalpha-lactalbumin precursor [Mus musculus]. 1042e-22O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474442PREDICTED: similar to lysozyme precursor [Canis familiaris]. 2181e-56O
Contig/Assembly ProteinLOC475707PREDICTED: similar to XPA binding protein 1 isoform 1 [Canis familiaris]. 1857e-47O
Contig/Assembly ProteinLOC475707PREDICTED: similar to XPA binding protein 1 isoform 2 [Canis familiaris]. 1857e-47O
Contig/Assembly ProteinLOC608308PREDICTED: similar to XPA binding protein 1 isoform 6 [Canis familiaris]. 1857e-47O
Contig/Assembly ProteinLOC608308PREDICTED: similar to XPA binding protein 1 isoform 1 [Canis familiaris]. 1857e-47O
Contig/Assembly ProteinLOC610638PREDICTED: similar to XPA binding protein 1 [Canis familiaris]. 1658e-41O
Contig/Assembly ProteinLOC609038PREDICTED: similar to lysozyme [Canis familiaris]. 1651e-40O
Contig/Assembly ProteinSPACA3sperm acrosome membrane-associated protein 3 [Canis lupus familiaris]. 1427e-34O
Contig/Assembly ProteinLOC480901PREDICTED: similar to PNPK6288 [Canis familiaris]. 1372e-32O
Contig/Assembly ProteinLOC487083PREDICTED: similar to lysozyme-like protein 2 [Canis familiaris]. 1342e-31O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLYZ1lysozyme C, milk isozyme precursor [Bos taurus]. 2094e-54O
Contig/Assembly ProteinLYZlysozyme C, non-stomach isozyme precursor [Bos taurus]. 2056e-53O
Contig/Assembly ProteinLYZ1lysozyme C-1 precursor [Bos taurus]. 1903e-48O
Contig/Assembly ProteinGPN1GPN-loop GTPase 1 [Bos taurus]. 1896e-48O
Contig/Assembly ProteinLYZ3lysozyme C-3 precursor [Bos taurus]. 1895e-48O
Contig/Assembly ProteinLYZ2lysozyme C-2 precursor [Bos taurus]. 1896e-48O
Contig/Assembly ProteinLOC785803PREDICTED: lysozyme 14D [Bos taurus]. 1794e-45O
Contig/Assembly ProteinLOC785803PREDICTED: lysozyme 14D [Bos taurus]. 1794e-45O
Contig/Assembly ProteinLYSBlysozyme C, intestinal isozyme precursor [Bos taurus]. 1788e-45O
Contig/Assembly ProteinLOC781146lysozyme C, tracheal isozyme precursor [Bos taurus]. 1763e-44O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLYZlysozyme C-3 precursor [Sus scrofa]. 2823e-76O
Contig/Assembly ProteinLOC100521316PREDICTED: GPN-loop GTPase 1-like [Sus scrofa]. 2041e-52O
Contig/Assembly ProteinSPACA3sperm acrosome membrane-associated protein 3 [Sus scrofa]. 1493e-36O
Contig/Assembly ProteinSPACA5sperm acrosome-associated protein 5 [Sus scrofa]. 1432e-34O
Contig/Assembly ProteinLOC100517051PREDICTED: lysozyme-like protein 1-like [Sus scrofa]. 1425e-34O
Contig/Assembly ProteinLOC100522642PREDICTED: lysozyme-like protein 4-like isoform 1 [Sus scrofa]. 1202e-27O
Contig/Assembly ProteinLOC100522642PREDICTED: lysozyme-like protein 4-like isoform 2 [Sus scrofa]. 1202e-27O
Contig/Assembly ProteinLALBAalpha-lactalbumin precursor [Sus scrofa]. 1094e-24O
Contig/Assembly ProteinGPN3GPN-loop GTPase 3 [Sus scrofa]. 58.58e-09O
Contig/Assembly ProteinLOC100525877PREDICTED: GPN-loop GTPase 2-like [Sus scrofa]. 572e-08O


Assembly Members: 6      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
CLNT10016A08CLNT1_0016_A08.bFS658302 
CLNT10032E01CLNT1_0032_E01.bFS659567 AK390972
CLNT10054F02CLNT1_0054_F02.bFS661336 
CLNT10063B05CLNT1_0063_B05.bFS661999 
CLNT10083G02CLNT1_0083_G02.b  
SKNB10065D10SKNB1_0065_D10.bDB803953 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
396C200.333WSTAC/Y
T400.667TAT/Y
853A400.667W-
G200.333


Alignment:      TOP

20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0032_E01.b : ttttacgtctgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0063_B05.b :
CLNT1_0016_A08.b :
CLNT1_0054_F02.b :
CLNT1_0083_G02.b :
SKNB1_0065_D10.b :
20110601C-000333 : ............GGAGCAAGATGGCTGCGCCCGAAGCTGCCACGGTGCCGCAAGCTTCCG
---------+---------+---------+---------+---------+---------+ 48
CLNT1_0032_E01.b : xxxxxxxxxxxxGGAGCAAGATGGCTGCGCCCGAAGCTGCCACGGTGCCGCAAGCTTCCG
CLNT1_0063_B05.b :
CLNT1_0016_A08.b :
CLNT1_0054_F02.b :
CLNT1_0083_G02.b :
SKNB1_0065_D10.b :
20110601C-000333 : GGGGTCCCCGGGCTCCGGCGTGCCTGTTGGTGCTGGGAATGGCGGGGTCTGGGAAAACCA
---------+---------+---------+---------+---------+---------+ 108
CLNT1_0032_E01.b : GGGGTCCCCGGGCTCCGGCGTGCCTGTTGGTGCTGGGAATGGCGGGGTCTGGGAAAACCA
CLNT1_0063_B05.b :
CLNT1_0016_A08.b :
CLNT1_0054_F02.b :
CLNT1_0083_G02.b :
SKNB1_0065_D10.b :
20110601C-000333 : CCTTTGTACAGAGGCTCACCGGACATCTGCATAGTCAAGGCTCTCCACCTTATGTGATCA
---------+---------+---------+---------+---------+---------+ 168
CLNT1_0032_E01.b : CCTTTGTACAGAGGCTCACCGGACATCTGCATAGTCAAGGCTCTCCACCTTATGTGATCA
CLNT1_0063_B05.b :
CLNT1_0016_A08.b :
CLNT1_0054_F02.b :
CLNT1_0083_G02.b :
SKNB1_0065_D10.b :
20110601C-000333 : ACCTGGACCCAGCTGTGCATGAAGTTCCCTTTCCTGCCAATATTGATATTCGTGACACTG
---------+---------+---------+---------+---------+---------+ 228
CLNT1_0032_E01.b : ACCTGGACCCAGCTGTGCATGAAGTTCCCTTTCCTGCCAATATTGATATTCGTGACACTG
CLNT1_0063_B05.b :
CLNT1_0016_A08.b :
CLNT1_0054_F02.b : ngatt
CLNT1_0083_G02.b : nnngggt
SKNB1_0065_D10.b :
20110601C-000333 : TGAAGTATAAAGAAGTCATGAAACAGTATGGACTTGGACCGAACGGCGGCATAGTGACCT
---------+---------+---------+---------+---------+---------+ 288
CLNT1_0032_E01.b : TGAAGTATAAAGAAGTCATGAAACAGTATGGACTTGGACCGAACGGCGGCATAGTGACCT
CLNT1_0063_B05.b : nnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0016_A08.b : nntttcgtctgcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0054_F02.b : ttnnnnnnanacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0083_G02.b : acttnnnnnnnacgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0065_D10.b : ngg
20110601C-000333 : CACTCAATCTCTTTGCTAGCCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCTCCTC
---------+---------+---------+---------+---------+---------+ 348
CLNT1_0032_E01.b : CACTCAATCTCTTTGCTAGCCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCTCCTC
CLNT1_0063_B05.b : xxxxxxxxxxxxxxxxxxGCCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCTCCTC
CLNT1_0016_A08.b : xxxxxxxxxxxxxxxxxxGCCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCTCCTC
CLNT1_0054_F02.b : xxxxxxxxxxxxxxxxxxGCCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCTCCTC
CLNT1_0083_G02.b : xxxxxxxxxxxccctaacaaCTGGAGCCCCGGCTTCTCAGACAACATGAAGACTCCTTTC
SKNB1_0065_D10.b : ggcctgacgttggctatgcacctggagCCCGGCTTCTCAGACA*CATGAAGACTCTCCTC
20110601C-000333 : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTATGATCGGTGCGAG
---------+---------+---------+---------+---------+---------+ 408
CLNT1_0032_E01.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTATGATCGGTGCGAG
CLNT1_0063_B05.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTATGATCGGTGCGAG
CLNT1_0016_A08.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTACGATCGGTGCGAG
CLNT1_0054_F02.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTATGATCGGTGCGAG
CLNT1_0083_G02.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTACGATCGGTGCGAG
SKNB1_0065_D10.b : GTTCTTGCGCTTCTCCTCCTTTCTGTCTCTGTACAGGCCAAGGTCTATGATCGGTGCGAG
20110601C-000333 : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
---------+---------+---------+---------+---------+---------+ 468
CLNT1_0032_E01.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
CLNT1_0063_B05.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
CLNT1_0016_A08.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
CLNT1_0054_F02.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
CLNT1_0083_G02.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
SKNB1_0065_D10.b : TTCGCCAGAATTCTGAAAAAGTCTGGCATGGACGGCTATAGGGGAGTCAGCCTGGCGAAC
20110601C-000333 : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
---------+---------+---------+---------+---------+---------+ 528
CLNT1_0032_E01.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCGCAATGTT
CLNT1_0063_B05.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
CLNT1_0016_A08.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
CLNT1_0054_F02.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
CLNT1_0083_G02.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
SKNB1_0065_D10.b : TGGGTGTGTTTGGCCAAGTGGGAAAGTGATTTTAACACAAAAGCTATAAACCACAATGTT
20110601C-000333 : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
---------+---------+---------+---------+---------+---------+ 588
CLNT1_0032_E01.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
CLNT1_0063_B05.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
CLNT1_0016_A08.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
CLNT1_0054_F02.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
CLNT1_0083_G02.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
SKNB1_0065_D10.b : GGAAGCACTGATTATGGAATATTTCAAATTAATAGCCGCTACTGGTGTAATGATGGCAAG
20110601C-000333 : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
---------+---------+---------+---------+---------+---------+ 648
CLNT1_0032_E01.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
CLNT1_0063_B05.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
CLNT1_0016_A08.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
CLNT1_0054_F02.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
CLNT1_0083_G02.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
SKNB1_0065_D10.b : ACACCCAAAGCAGTTAATGCCTGTCACATATCCTGCAAAGTTTTGCTGGACGATGACCTC
20110601C-000333 : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
---------+---------+---------+---------+---------+---------+ 708
CLNT1_0032_E01.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACAAGGCATTAAAGCATGG
CLNT1_0063_B05.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
CLNT1_0016_A08.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
CLNT1_0054_F02.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
CLNT1_0083_G02.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
SKNB1_0065_D10.b : AGTCAAGATATAGAATGTGCAAAGAGGGTTGTCAGAGATCCACTAGGCGTTAAAGCATGG
20110601C-000333 : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
---------+---------+---------+---------+---------+---------+ 768
CLNT1_0032_E01.b : GTGGCATGGAGAACTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
CLNT1_0063_B05.b : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
CLNT1_0016_A08.b : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
CLNT1_0054_F02.b : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
CLNT1_0083_G02.b : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
SKNB1_0065_D10.b : GTGGCATGGAGAGCTCATTGTCAGAACAAAGATGTCTCGCAGTACATTCGGGGTTGCAAA
20110601C-000333 : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTAGGAAAT
---------+---------+---------+---------+---------+---------+ 828
CLNT1_0032_E01.b : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTGGGAAAT
CLNT1_0063_B05.b : CTGTAACTGTGCAGTTCTCCTTCTTCAGCTCACCCTGTCTCTTTTTCATATTTAGGAAAT
CLNT1_0016_A08.b : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTAGGAAAT
CLNT1_0054_F02.b : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTAGGAAAT
CLNT1_0083_G02.b : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTAGGAAAT
SKNB1_0065_D10.b : CTGTAACTGTGCAGTTTTCCTTCTTCAGCTCACCTTGTCTCTTTTTCATATTTAGGAAAT
20110601C-000333 : AATAGTTGAATGAAAGGTCATACTACCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
---------+---------+---------+---------+---------+---------+ 888
CLNT1_0032_E01.b : AATAGTTGAATGAAAGGTCATACTACCATTCTTGTGAACAAATCATGGTTTTACCGAAGC
CLNT1_0063_B05.b : AATAGTTGAATGAAAGGTCATACTACCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
CLNT1_0016_A08.b : AATAGTTGAATGAAAGGTCATACTGCCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
CLNT1_0054_F02.b : AATAGTTGAATGAAAGGTCATACTACCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
CLNT1_0083_G02.b : AATAGTTGAATGAAAGGTCATACTGCCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
SKNB1_0065_D10.b : AATAGTTGAATGAAAGGTCATACTACCATTCTTGCGAACAAATCATGGTTTTACCGAAGC
20110601C-000333 : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
---------+---------+---------+---------+---------+---------+ 947
CLNT1_0032_E01.b : AAGAGCATAAGGTCTTTCTTTTAAGAGGCTTAATGTTTACCTAAAGGGNTTATGGGTTGG
CLNT1_0063_B05.b : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
CLNT1_0016_A08.b : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
CLNT1_0054_F02.b : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
CLNT1_0083_G02.b : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
SKNB1_0065_D10.b : AAGAGCATAAGGTCTTTCTTT*AAGAGGCTTAATGTTTACCTAATGTGTTTATTGTTTGT
20110601C-000333 : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
---------+---------+---------+---------+---------+---------+ 1007
CLNT1_0032_E01.b : GTTTTATGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAAAAAATTATTGTTGGTCT
CLNT1_0063_B05.b : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
CLNT1_0016_A08.b : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
CLNT1_0054_F02.b : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
CLNT1_0083_G02.b : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
SKNB1_0065_D10.b : GTTTATTGTTTTATAGGCCTACAATATTTTTCAATTTGCTAAGAGAATTATTGTTGGTCT
20110601C-000333 : GAAATCTTAATTATCAAATATACCTCCAGTACATTCAGTTCTTAATCAAAGAAATAAACC
---------+---------+---------+---------+---------+---------+ 1067
CLNT1_0032_E01.b : GAAATCTTTATTATCAAATATACCTTCAGTACATTCAttcttaatcaaagaaatacccca
CLNT1_0063_B05.b : GAAATCTTAATTATCAAATATACCTCCAGTACATTCAGTTCTTAATCAAAGAAATAAACC
CLNT1_0016_A08.b : GAAATCTTAATTATCAAATATACCTCCAGTACATTCAGTTCTTAATCAAAGAAATAAACC
CLNT1_0054_F02.b : GAAATCTTAATTATCAAATATACCTCCAGTACATTCAGTTCTTAATCAAAGAAATAAACC
CLNT1_0083_G02.b : GAAATCTTAATTATCAAATATACCTCCNGTACATTCAGTTCTTAATTCAAGAAATAAACC
SKNB1_0065_D10.b : GAAATCTTAATTATCAAATATACCTCCAGTACATTCAGTTCTTAATCAAAGAAATAAACC
20110601C-000333 : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTAAAAGATAACCAGTCTTT*G
---------+---------+---------+---------+---------+---------+ 1126
CLNT1_0032_E01.b : aaccgtcttcttctgttcattttctctaaaaacagtaaagataaccaggcttgttgggaa
CLNT1_0063_B05.b : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTAAAAGATAACCAGTCTTT*G
CLNT1_0016_A08.b : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTAAAAGATAACCAGTCTTT*G
CLNT1_0054_F02.b : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTAAAAGATAACCAGTCTTT*G
CLNT1_0083_G02.b : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTAAAAGATAACCAGTCTTTTG
SKNB1_0065_D10.b : AGAAACAGTCTTCATCTGTTCAGTTATCTCTAAAAACAGTANAAGATAACCAGTCTTT*G
20110601C-000333 : TTGGGTAATATAAAATTTTAAAAGGAGCAGAATGCCAGATGGCTTAAAATGAAGACAACC
---------+---------+---------+---------+---------+---------+ 1186
CLNT1_0032_E01.b : aataaattttaaaggaacaaaatgccaaagggtaaaaggaaaacaccggattaaaaattt
CLNT1_0063_B05.b : TTGGGT*AATATAAAATTTTAAAGGAGCAGAATGCCAGATGGNCTAAAATGAAGACNACC
CLNT1_0016_A08.b : NTGGGTAAATATAAATTTTAAAAAGAGCAGAATGCCAGATGGCTAANAATGAAGACAACC
CLNT1_0054_F02.b : TTGGGGTATATAAAATTTTAAAAGGAGCAGAATGCCAGAATGGCTAAAAATGAGAACACC
CLNT1_0083_G02.b : TTGGGTAATATAAAATTTTAAAAGGAGCAGAATGCCAGATGGCTAAAAATGAAGACAACC
SKNB1_0065_D10.b : TTGGGTAATATAAAATTTTAAAAGGAGCAGAATGCCAGATGGCTAANAATGAAGACNACC
20110601C-000333 : TGAA*TTAAGAATTTTGCTTTCATAAAGTGTGACCTTTGGCTTAAATGTTTTCTCAAAGA
---------+---------+---------+---------+---------+---------+ 1245
CLNT1_0032_E01.b : gcttcaaaagggaacctttggcttagggtttccaaaaaaa
CLNT1_0063_B05.b : TGAA*TTNAGAATTTTTGCTTCATAAAGTGTGACCTTTGGCTTAAATGTTTTCcaaagat
CLNT1_0016_A08.b : TGAA*TT*AGAAATTTGCTTTCATAAAGTGTGACCTTTGGCTTAAATGTTTTCTCAAAGA
CLNT1_0054_F02.b : TGNA*TTTAGAATTTTGCTTTCATAAAGTGTGACCTTTGGCTTAAATGTTTTCTCGA*GA
CLNT1_0083_G02.b : TGAAATTAAAAATTTTGCTTTCATAAAGTGGGACCTTGGGGCTAAATGTTTTCTCAGAaa
SKNB1_0065_D10.b : TGAA*TTAAGAATTTTGCTTTCATAAAGTGTGACCTTGGGCTTAAATGGTTTCTCAGAGA
20110601C-000333 : TGATTCGTTCATTTAAACGAATTTTAAAATAGTCTCACATTTAGGTATCCATCTCTTTTA
---------+---------+---------+---------+---------+---------+ 1305
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : gaatcgttcattaaaacgattttaaatagtctcacatttaggtatcatctctttaacctt
CLNT1_0016_A08.b : TGATTCGNTCATTTAAACGAATTTTAAAatagtctcacattttaggtatccatctctttt
CLNT1_0054_F02.b : TGAATCGTTCATTAAAACGAATTTaaaataatcccaacatttaggttccatctcctttta
CLNT1_0083_G02.b : ataatccttcattaaaaacaattttaaaatagtctcaaaatttaggttacatctcctttt
SKNB1_0065_D10.b : TGATTCGTTCATTTAAACGAATTTTAAAATAGTCTCACATTTAGGTATCCATCTCTTTTA
20110601C-000333 : GCCTTT......................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : taaaactcattaagcttttgctgacttgaggaattaagagggattaatgagcttgctttc
CLNT1_0016_A08.b : accttttaaaaactcattttgcattttgctggacctgaaggaatttaagaagggataaat
CLNT1_0054_F02.b : gccttttaaaaactcctttatgattttgctgaacctgagggaattaaggggggattagat
CLNT1_0083_G02.b : acctttttaaaactcatttaggcttttgcggacctgaaggaattaaaaggggattaaata
SKNB1_0065_D10.b : GCCTTTtaaaactcatttatgcattttgctgaccatgaggaatataaagagggattagat
20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : ctgaacttacacctgaatctgcatagaacaatcaaaggaaagaatcccgggctgaaaatt
CLNT1_0016_A08.b : gaactgggcttccctgaactttacagcttgaatcctgcttaggacaaatccaaggcaatg
CLNT1_0054_F02.b : gactgggcttttccgaacttttcaacctggaatcttggctttttgaccaatttcaaggcg
CLNT1_0083_G02.b : acttgggttttcggaattttacggctgaattcgggcttagaaaaatttcaaggcaatgaa
SKNB1_0065_D10.b : gagctgtgcttttccgaactttatcacctggaatcatgcctatgactaattccaaggcga
20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : gctattacccgggtgaatttcctcggtaaaaacaaccttttttaaaatttggctttcnnn
CLNT1_0016_A08.b : aatccccggctttaaaaattgcaatttaccaggggggattttgcgggcgtaaaagtaaaa
CLNT1_0054_F02.b : aaagaattccggggcttgtaaatattgcaatttaacccaggggtggaatatttcgcgcgg
CLNT1_0083_G02.b : ttccgggtttgaaaatttgtatataccacagggtggattttgcgcggtaaaagaaaactt
SKNB1_0065_D10.b : gaattcccaggcttgaaataatgctaattaccccggggggaattttgcgtgcttaaaata
20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : nnnnnngnnnannnnaaaaaaaaaaannnnnnnnnnnnnnnnnnnngggggagggggtgg
CLNT1_0016_A08.b : ctttctttaaagcttggtttaaannnaaaaannnnnnnnnnnnnnnnnnnnnnnggggct
CLNT1_0054_F02.b : gaaaaaaaccaaattttctctaaaagttttcggtttaaaaaaaaaaaaaagaccagtgtt
CLNT1_0083_G02.b : ttcttaaagcttgctctcnaaaaaaaaaaaannnnnnannnnnnnnnnnnngggcngtgt
SKNB1_0065_D10.b : caacattttctttaaaacttggct
20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : gggggcgcgccaaaaaaaaaacccccccccacaaaagagtgtgttttttttttataaaaa
CLNT1_0016_A08.b : ttttcccatggtgggcgcctaaatataaa
CLNT1_0054_F02.b : tcttattggtggcggccccaaataa
CLNT1_0083_G02.b : tttaatggtggggccattatattaaaaaacccccct
SKNB1_0065_D10.b :
20110601C-000333 : ............................................................
---------+---------+---------+---------+---------+---------+ 1311
CLNT1_0032_E01.b :
CLNT1_0063_B05.b : aaaaaaaattatcgttt
CLNT1_0016_A08.b :
CLNT1_0054_F02.b :
CLNT1_0083_G02.b :
SKNB1_0065_D10.b :