
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000400

Length: 1,758

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611067PREDICTED: similar to prothymosin, alpha (gene sequence 28) [Canis familiaris]. 70.91e-13O
Contig/Assembly ProteinLOC609022PREDICTED: hypothetical protein XP_846202 [Canis familiaris]. 50.45e-08O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL

Assembly Members: 454      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
HTMT10092D12HTMT1_0092_D12.bFS670707 AK392648
OVRT10034F08OVRT1_0034_F08.bFS689182 AK395596
UTR010011E02UTR01_0011_E02.bBP171548 AK239921


SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b :
BFLT1_0133_B03.b : ctctctggcccgagaatntatactctactttcttctgaaaaaaaaaaagnnnnttttttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : actcctcccccccggagaattacaacccttttttttttacccccgt
BFLT1_0133_B03.b : ttttttaatgggttgttggagagaataaaaaaaagagggcccctcacacaacctctgtta
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : gggtgagatcccccccccccgcgggaaaattaaaactttctttttttgtgaacataattg
BFLT1_0133_B03.b : tttatggggaacccccccccccaattaaaatctctttatcacacgggaatcccctccccc
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : ccccaaaattcccctccccccctaataccccctttgcccctttttccccccggggggaat
BFLT1_0133_B03.b : cggaaaataaaatttatttttttagattttccccaatttccccctccccaaaatcccatt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : tttttttttttatggagggggggggcccccttcgtctttgggattttccaaaaggggagg
BFLT1_0133_B03.b : ttgcctattttccccgggggaaattttttttttggaggggggccccctgctctttatttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : gggtttttttggggccttggttttacaaaaaattcttaatgagggggttgattttttttt
BFLT1_0133_B03.b : ccaaaattggggaggtttttggggcttgttttcaaaaagtttttaatgggggttggtttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : taaggggccggcggcctactgagggcggctatcccacccggtgagttgggttttcccxxx
BFLT1_0133_B03.b : ttttttagggcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b : nttttccg
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b : ttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b : nnnnncgatactatagggctxxxxxxxxxxxxxxx
DCI01_0053_D09.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : aaactatagcgtatctatagggctgctcxxxxxxxxxxxx
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b : ctt
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b : ntttaacgactcttxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
---------+---------+---------+---------+---------+---------+ 56
CLNT1_0118_A01.b : xxxxgtctacggccataccaccctgaacgcgcccgatctcgtctgatctcggaagctaag
SMG01_0004_A08.b : nnnggga
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b : nnnnccgt
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b : n
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b : ttttaggatgg
OVRT1_0031_C02.b : nnnccccgtt
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b : ggaaccgt
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b : nggatac
UTR01_0011_E02.b : atttatggtgxxxxxxxxxxx
OVR01_0037_H06.b : ggggtttttggggcacxxx
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b : nggcnccg
OVRT1_0062_E02.b : nnnncccg
LVRM1_0199_B11.b :
OVRT1_0002_E06.b : ggaatcg
KDN01_0096_B08.b :
MLN01_0087_A01.b : ncctggtaggact
MLN01_0102_G04.b : nnnaagttgtgact
SPL01_0083_C09.b : nnggcttggactata
SPL01_0089_H08.b : ntttgcttggactatgacx
DCI01_0076_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0053_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0058_B09.b :
MLN01_0038_E06.b : nnnnggctaggactat
THY01_0034_B05.b : gtggaccctattagx
PCT01_0001_F04.b :
OVRT1_0057_H05.b : ng
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C11.b : nnnnggcta
MLN01_0077_H07.b : ntgctaggacta
UTR01_0107_D01.b : nnnnggctagtg
MLN01_0072_E04.b : nngggttgtgac
UTR01_0003_A08.b : gggggxxxxxxxxx
OVR01_0019_A05.b : tggggtgaacctatxxx
UTR01_0052_B12.b : xxxxxxxxxxxxxxxxxxxxx
SPL01_0035_D03.b : aaaacttacngtccnxxxxxxxxxxxx
OVR01_0035_D05.b : ttttttttttttttctttttttttttttttttttttctttttttttttttccttggacta
THY01_0065_A03.b : ctxxxxxxxxxxxxxxxxxxx
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b : nat
UTR01_0098_H05.b : nnnttgcta
MLN01_0091_F10.b : nnggttgtgac
MLN01_0068_B04.b : ttaggggctaggacttgacagtttg
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b : ng
OVRT1_0048_G10.b : nntt
BMWN1_0010_B07.b : nnngggcgag
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b : gaat
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b : ga
BFLT1_0061_F07.b : gact
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b : gcttc
OVR01_0104_B06.b : nttgcttgga
SPL01_0033_G05.b : nnnngggctggact
SPL01_0071_B10.b : nnnggcttggac
TCH01_0098_A09.b : nnggctaggac
MLN01_0071_A04.b : nnnnggctaggactatgacxx
OVR01_0043_H12.b : agggcxxxxxxxxxxxxxxxx
THY01_0009_H11.b : attttgctgxxxxxxxx
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b : tttggggggaccaxxxxxx
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b : gga
THY01_0011_F06.b : tggacxx
CLNT1_0099_G01.b : ggtt
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b : n
BMWN1_0028_F12.b : nttta
AMP01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b : ngac
BFLT1_0118_A04.b : ncca
BFLT1_0073_A05.b : ngaa
OVRT1_0019_A09.b : nnaa
UTR01_0101_G03.b : nnnttgctagg
MLN01_0068_E11.b : tttgtgggct
SPL01_0001_F09.b : tttggggtgxxxx
SPL01_0026_F11.b : ctttagggtgxxxxx
THY01_0069_H01.b : gcxxxxxxxxxxxxxxx
SMG01_0100_D08.b : n
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b : nnnn
CLNT1_0105_A12.b : nttt
OVRT1_0087_D10.b : nnnn
OVRT1_0087_E12.b : nnnt
OVRT1_0088_G09.b : nnnt
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b : nnnnn
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b : nnnn
OVRT1_0109_E08.b : nnnc
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b : nnn
CLNT1_0108_A12.b : nntt
OVRT1_0055_D09.b : nnnn
OVRT1_0088_B01.b : nnncc
OVRT1_0032_F02.b : nttt
CLNT1_0021_E10.b : g
CLNT1_0138_E11.b : n
OVRT1_0072_E04.b : ngaa
BMWN1_0026_A03.b : nnnaaa
OVRT1_0032_B04.b : nnn
OVRT1_0105_A05.b : nn
OVRT1_0110_G04.b : nnn
OVRT1_0094_G03.b : nnncct
CLNT1_0112_C09.b : nnnn
OVRT1_0040_C12.b : ncct
OVRT1_0093_C02.b : nncc
CLNT1_0076_G04.b : nncct
CLNT1_0072_H09.b : ngta
CLNT1_0075_G03.b : nggt
OVRT1_0110_G05.b : nnnn
ADR01_0091_C09.b :
CLNT1_0049_C01.b : nngggctttnnngnnn
CLNT1_0029_G01.b : tt
CLNT1_0052_A01.b : nggcgttnnnnngcc
BFLT1_0118_C01.b : nnn
CLNT1_0020_G10.b : t
BFLT1_0140_E03.b : nnnn
LVR01_0103_B01.b : ttttttttaggcatagtgxxx
ITT01_0087_F02.b :
SPL01_0025_B12.b : gctttatxxxxxxxxx
THY01_0105_C08.b :
OVRT1_0079_E08.b : nntt
OVR01_0004_D06.b : gagaacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_H06.b : gac
CLNT1_0143_C12.b : nn
MLN01_0098_F11.b : ntttggatagga
BFLT1_0028_F08.b : ggac
UTR01_0044_C02.b : tttttgctgxxxxxxx
BFLT1_0097_E01.b : tt
CLNT1_0134_G12.b : nttt
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b : tttagctgg
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b : ga
CLNT1_0132_G02.b : nnnn
BFLT1_0091_G01.b : gat
MLN01_0052_A06.b : aatttagcttgga
BFLT1_0034_G10.b : ggat
BFLT1_0035_H09.b : gaac
MLN01_0088_C01.b : nnngggctgtgct
BFLT1_0013_H10.b : gaata
MLN01_0087_C07.b : ggttg
OVRT1_0027_H08.b : nnntt
OVRT1_0076_G10.b : nggac
UTR01_0023_E05.b : ggttgcactat
MLN01_0086_H02.b : nnttgctag
MLN01_0010_G06.b : nntttgtg
SPL01_0084_B09.b : nnggctagga
MLN01_0021_G11.b : nnnggtag
MLN01_0061_D04.b : nggtagtg
SPL01_0020_F07.b : xxxxxxxxxxxx
SPL01_0057_F01.b : nnttgcttgtg
SPL01_0074_B09.b : nnnggctagga
SPL01_0078_F05.b : nnnggcttgga
SPL01_0079_G10.b : nnnggctagga
LNG01_0076_E12.b : nnntttgatg
OVR01_0059_B08.b : tggctaggac
SPL01_0001_F06.b : ctttaagatgxxxxx
MLN01_0068_B05.b : ttagggtgctag
MLN01_0102_A03.b : nnnnaagtagga
OVR01_0064_E04.b : nnnnggcttgga
SPL01_0021_A06.b : xxxxxxxxxxxx
SPL01_0091_C10.b : nnttgcttggac
MLN01_0020_A01.b : nntttccgtgg
SPL01_0099_D09.b : nnnggcttgga
MLN01_0027_C12.b : nnnngggttgtga
MLN01_0068_H09.b : ntcggttgttggc
SPL01_0019_B01.b : gxxxxxxxxxxx
MLN01_0035_B11.b : nnnggctagga
SPL01_0019_H05.b : ggttggcactatta
SPL01_0048_A02.b : nnnnnggctagtg
MLN01_0040_C07.b : nnnttgctagga
MLN01_0031_A01.b : nntttggtagg
MLN01_0035_B12.b : nnnnggctagg
UTR01_0068_B07.b : catttttggttgxxxxx
OVRT1_0049_H03.b : ngggcttnnnnnnnn
UTR01_0031_E07.b : ttgggggacxxxxx
SPL01_0012_H05.b : cxxxxxxxxxxxxxxxx
SPL01_0016_D10.b : ctxxxxxxxxxxxxxx
SPL01_0023_E05.b : tttttgggggxxxxx
MLN01_0023_D12.b : nnnngggctggacttga
OVR01_0047_B03.b : gggctcxxxxxxxxxxx
TCH01_0047_A11.b : nggggggcttgga
MLN01_0042_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_B05.b : agggcxxxxxxxxxxxxxxx
THY01_0027_G02.b : ttxxxxxxxxxxxxx
OVR01_0044_D01.b : ggacattaagcxxxxxxxx
OVR01_0001_F03.b : gaaaaattgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_H07.b : nnggtggtaggac
THY01_0068_F01.b : ccatatggtggacxxxx
THY01_0009_A04.b : atttgggtgxxxxx
THY01_0049_H06.b : tttaggatgxxxxxx
UTR01_0046_G10.b : ggggaaactatt
THY01_0026_C04.b : gggggtacxxxx
THY01_0054_C01.b : ttxxxxxxxxxxxxx
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b : nn
THY01_0082_B08.b : gcxxxxxxxxxxxxxxxxxxx
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b : ntt
PCT01_0024_G08.b :
CLNT1_0005_G01.b : gg
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b : nnnt
OVR01_0009_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b : ngg
TCH01_0037_A04.b : nnnng
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b : nnnaaatt
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b : gggggnnnnnnntaacaaaanngnnngaanncnncagttaatnnngcatt
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
---------+---------+---------+---------+---------+---------+ 116
CLNT1_0118_A01.b : cagggtcgggcctggttagtacttggatgggagaccgcctgggaataccgggtgctgtag
SMG01_0004_A08.b : cttttnnnnnggacgatacagcggntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_F09.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0009_F09.b : ttttttagacggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0081_G03.b : nnnnttgcgagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0077_A12.b : nnnncgacggtacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0043_H02.b : nnnngggcggtacgcggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0009_F01.b : nnnaaagctggttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_F08.b : nnnnccaagggacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0102_E03.b : ctgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0072_C08.b : nnngggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0066_F10.b : ttttaggagagtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0029_G01.b : ttttccgcaggaagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0043_C10.b : nnnggggacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0085_B06.b : nnnggagcgagtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0094_B03.b : nnaggcaggttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A09.b : ttttacgaggtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_D12.b : nttccgatgtgacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_A12.b : nnnaacgagagtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0066_A04.b : tacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_C02.b : cagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0004_D10.b : nnnnaagcaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0053_H09.b : nnnncgacggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_B05.b : ttttacgacggagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0095_F04.b : ctgcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0093_C01.b : nnnaagcaggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0094_C01.b : nnnnacgaggtgagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0093_D12.b : ntttagcagagtagaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0003_C01.b : gttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0011_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgt
SKNB1_0091_D02.b : nttcgcgtt
SKNB1_0028_G07.b : nnnnggtggctgtggc
PST01_0036_B08.b : tggcgtt
PST01_0065_E03.b : gcgtt
PST01_0023_G02.b : tccgctgtt
LVRM1_0081_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0099_G02.b : nnnggctggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0082_H10.b : nngggcgcgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A02.b : nnnncgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0078_H11.b : nnnnnggctggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0061_G05.b : nnnnaagagagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_H02.b : nttttggataaagcagcggnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0041_E09.b : nnnaaagacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0036_E09.b : nnnccgccggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0033_D08.b : nnaaagctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0003_E03.b : ttttaacgcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0009_G05.b : nnttaccaggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0086_A05.b : nnngaagcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0086_F08.b : tcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0062_E02.b : tctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_B11.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_E06.b : tttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0096_B08.b : nnnncctgctgt
MLN01_0087_A01.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_G04.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_C09.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0089_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0053_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0058_B09.b : nnccgcgaggagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_E06.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0034_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_F04.b : ttgnnnncctgcggtgt
OVRT1_0057_H05.b : gatacgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0125_D10.b : gttgtcaaaacagcggtxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0030_A08.b : nnnggagcagtagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0021_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C11.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_H07.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_D01.b : acttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_E04.b : ttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0035_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_D05.b : tcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccctt
THY01_0065_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0053_E08.b : nnnncccacgt
SKNB1_0091_E01.b : ntttgcgt
SKNB1_0069_G02.b : nnnttttcgcg
SKNB1_0042_F07.b : nnnnntcagcgg
SKNB1_0064_B10.b : nnnnnctcgctg
SKNB1_0061_B03.b : nnnncctcgcgt
SKNB1_0056_B07.b : nttttnctcgctg
SKNB1_0039_A04.b : nnnnnctcgcggtgg
SKNB1_0037_H12.b : nnaaatacttgcgt
SKNB1_0015_D06.b : nnnaattcgctg
SKNB1_0056_F07.b : nngggatttnnnnnnaacgcgt
PST01_0039_B04.b : gcgt
PST01_0027_B03.b : nnnaatggctg
PST01_0040_A05.b : tggcgtt
PST01_0058_B12.b : nntttactgcgg
PST01_0044_F03.b : nnnttcgctg
PST01_0047_D01.b : ttaactgctg
PST01_0012_D06.b : nnnaatcgctg
PST01_0016_B09.b : ttttccggctg
KDN01_0067_C09.b : nnnnncctgcgt
PST01_0060_D08.b : ttttggctgcgg
PST01_0011_F05.b : nnnttcgctg
PST01_0044_G07.b : nnccagcgt
PST01_0019_F03.b : ttgtcgcgt
PST01_0063_E01.b : ttttcgctg
KDN01_0007_B09.b : tttttcctgctg
PST01_0005_B08.b : nnncctgcgg
PST01_0067_D02.b : nnnttcgctg
PST01_0009_G08.b : nttctgctg
PST01_0003_A11.b : tttttactgcag
PST01_0072_G02.b : nnnncctgcgg
PST01_0051_D09.b : nnnttcgctg
PST01_0063_B11.b : gcgg
PCT01_0016_D01.b : nnnngggaaannnntnnttactgcag
PST01_0062_B07.b : tcacgt
PST01_0031_D04.b : cgcgttgg
ILNT1_0090_G07.b : nnnaatgcaggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0090_F03.b : nnnccggcgg
TES01_0106_H06.b : nttagcgttgg
PST01_0078_B11.b : nnncctgcgg
PST01_0095_E02.b : nnnncctgctg
PST01_0086_H10.b : nnncctacgg
BFLT1_0092_E12.b : tggttcagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0098_H05.b : ggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0091_F10.b : ttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_B04.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtttgg
SKNB1_0046_E03.b : ncctaacgttgg
SKNB1_0056_B09.b : nnnnncctcgctg
PST01_0039_A10.b : gt
PST01_0055_C05.b : ntcgctgtt
HTMT1_0003_B12.b : nccgatatcttaggatta
PCT01_0024_C03.b : nnngggaatattntnnnnccttacg
PCT01_0024_B09.b : nngggaacttttnnnnnnnacatgcgttg
CBLT1_0097_D05.b : nnccgtgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0031_B11.b : nnnccgcaggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0076_E08.b : nnncgacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0034_F04.b : tttttacgagggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_G12.b : nnnttcgagggacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_B10.b : nnnttcgaaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0050_A10.b : nnnnccgagattagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A03.b : nnnncgatggtacgacgccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A12.b : nnnnncgcgagtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0046_F08.b : nnnnaatgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0022_B03.b : nnnnccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_F08.b : tttttnggcaggagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_C07.b : nnnccgaaggtagaggccgtagtattxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_F03.b : nnnggagcaggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0085_G07.b : nnnnggcggttagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0034_H07.b : nnnnccgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0097_B02.b : ttggccgcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_F01.b : tttttggcaggtagacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0043_F01.b : nnnnaaagacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0012_H01.b : nnnnggcgagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0074_A06.b : tttggaggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0012_E11.b : tttttacgaggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_B03.b : ttttggagagtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0039_E11.b : nnnnntgctggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_D05.b : nnntatgatggtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0024_D02.b : nnaaaggacaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0007_F05.b : ntttggcgagtagacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0010_A01.b : nnttgcgcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0025_E07.b : nnnggtgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0027_D09.b : nnnaacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0099_B03.b : nnnggggcaggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_B12.b : ttttagtaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0103_G04.b : ntttttgctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0084_A06.b : nnttttggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0150_E12.b : ttttttagacggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_A05.b : ntttgacgacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_C01.b : gggtttnnntnnggtcggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_G10.b : tcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_B07.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0071_B12.b : nttttggctagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0001_G02.b : ttttcgagagtacgcggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0038_E01.b : acgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0076_G10.b : nnnncgcgagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0074_B01.b : nnnnccgcgagtagcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0074_G08.b : atcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0061_F07.b : acgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_B07.b : ttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_G04.b : ncggcgt
BFLT1_0071_D11.b : cgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_B06.b : ctatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0033_G05.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_B10.b : tatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0098_A09.b : tatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
OVR01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtta
THY01_0009_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_E04.b : nttttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0090_D07.b : nnnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0014_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0056_C06.b : nnnnttcgctgtg
KDN01_0073_H05.b : nnncctgcggt
BFLT1_0082_C10.b : cgttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0076_E06.b : tacgttcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0011_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0099_G01.b : tccgttcagcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0149_B05.b : nncctctgcgcacgnaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_B07.b : ncccgtcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_G08.b : acttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0020_B01.b : gattccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0028_F12.b : cgcaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_E01.b : nntttgagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0014_H02.b : nnnttgctgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0099_H04.b : ntttttgataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0017_H02.b : tacgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_A04.b : tcgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0073_A05.b : tccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_A09.b : cccattcggctgcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0101_G03.b : acttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_E11.b : ggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0100_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0097_B03.b : nnnccctgg
PST01_0026_H09.b : nnncctgcgg
LVRM1_0094_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_H09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0001_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_G07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_E03.b : nnnggactaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_C06.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_G07.b : cagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_B05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E03.b : nnnaaagttagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_F12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0105_D06.b : nggctcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0105_A12.b : tcgttcggcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_D10.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_E12.b : ttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_G09.b : ttcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_B09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0018_E08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0079_B05.b : tttggctatagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0079_D05.b : nttnggctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_H07.b : ccgtacagcgntngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0084_G02.b : tacgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0043_H08.b : tttttttgatcaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0104_G02.b : nagtataggcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0109_E08.b : cccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0006_C05.b : aaaattnggagctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_H08.b : nnntttgataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_G11.b : ngcgttatnntnntgctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_C11.b : naagtcagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_A12.b : tacgacagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0055_D09.b : nccgttagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_B01.b : acgttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_F02.b : ccgttctgcgnacngatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_E10.b : ggtcccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_E11.b : ctacgttgcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0072_E04.b : aacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0026_A03.b : gacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_B04.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_A05.b : nccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_G04.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_G03.b : tcgttcgctgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_C09.b : nccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_C12.b : ccgttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_C02.b : tccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0076_G04.b : agtttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_H09.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0075_G03.b : tccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_G05.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0091_C09.b : nnnnnnggactgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_C01.b : ccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0029_G01.b : tccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0052_A01.b : cacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_C01.b : ncccgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0020_G10.b : tcttctgctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0140_E03.b : ccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_F02.b : nttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0025_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0105_C08.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_E08.b : cgcatactgctgcagagtgcgcgacagctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_H06.b : ttgttctgcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0143_C12.b : ccccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_F11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_F08.b : ttcgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0097_E01.b : acgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_G12.b : ccgttcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0048_E11.b : nggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0042_E02.b : nnggatatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0014_E06.b : nnttgctaaacggctggtxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_A04.b : nngatgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0043_B11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0074_H05.b : ntttgtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0074_H07.b : ntttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0055_E12.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0103_B07.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0065_H02.b : nnnnnccgatgaacggcggtacgcgtcccgattctccgcactgttgg
ITT01_0027_A10.b : nnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_H08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_E05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0009_A08.b : nnnnggtgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0007_E07.b : aaacttccggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0016_C07.b : nnngggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_F10.b : nnnnggtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_B05.b : nnnggataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0022_G03.b : ctacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0132_G02.b : ccgttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0091_G01.b : tggttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0052_A06.b : atataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0034_G10.b : tacgttagcgnacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0035_H09.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0088_C01.b : atnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0013_H10.b : cgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_C07.b : gctatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_H08.b : tcgtttgctntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G10.b : tcctattgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_E05.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0086_H02.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_G06.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0084_B09.b : ctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0021_G11.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_D04.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_F01.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_B09.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_F05.b : ctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_G10.b : cttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_E12.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_B08.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_B05.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_A03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_E04.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0021_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0091_C10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_A01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0099_D09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_C12.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_H09.b : acttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_H05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_A02.b : acttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C07.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0031_A01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B12.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0068_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_H03.b : nccgttcgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0031_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0012_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0016_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0023_D12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0047_A11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_H07.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0009_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0049_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_G10.b : agxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0026_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0054_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0006_A03.b : nnnnngcatacttgggatttaat
OVRM1_0137_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0017_H05.b : ncttctgctgtcngagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0142_A09.b : nccgttcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0082_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0047_H09.b : nnttaatgg
SKNB1_0071_G04.b : nnnncccttnnnnnnnnccacgc
PCT01_0001_A11.b : ntttttaactgcg
PCT01_0010_E03.b : nnnnnnaactgag
PCT01_0011_B09.b : nnnnnncctgcg
PCT01_0021_D05.b : aattttccttacgg
PCT01_0011_A03.b : nnnnggactgcgt
PCT01_0017_F03.b : ataatnnccctacg
PCT01_0019_H01.b : nnnnaaaatannnnnnnncctgcg
PCT01_0017_C05.b : ggactttnnnnnnncctgac
PCT01_0003_D11.b : ngggcttannnnnnncctgcgt
PCT01_0033_A04.b : nggggccacnnnnnncctacg
PCT01_0016_E02.b : nnnttggatannnnnnnaactgcgt
PCT01_0031_H12.b : nnnngggatannnnnntnaccagag
PCT01_0033_H12.b : nnnccgcatnnnttnntactgcgtt
PCT01_0004_D06.b : nnnccggaatnnnnnnngctgcg
PCT01_0035_G02.b : nnnggggatttnnnnnnnncctgacgg
PCT01_0002_G06.b : nnnggggcaatnnnnnnncctgcg
PCT01_0032_E04.b : nnnnaggccatnnnnnnnnccgcgacg
PCT01_0024_H05.b : nnngggccannnnnnnncactgacg
KDN01_0019_C03.b : nnnngggacttacgg
PST01_0083_B07.b : nncctgcg
CLNT1_0083_H08.b : ttccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0024_G08.b : nnngggactatnnnnnnnaact
CLNT1_0005_G01.b : atccgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0073_D02.b : ncctacg
ITT01_0100_E01.b : nggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_H10.b : ttcgttatgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_B03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_D04.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_D01.b : nntttcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0088_C09.b : gacacgtatagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_G09.b : nggatccgttctgcgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0015_F05.b : nnnccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_F06.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_A04.b : gctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0069_E09.b : nnnnngggattttnnnnnnnc
PCT01_0017_B09.b : nnnntttacctacgt
PCT01_0007_F11.b : ngggcattnnnnnnncctacgt
PCT01_0033_C05.b : nngggctttanannnncctgcgt
PCT01_0033_G02.b : nnggggggataanatnnnaactgacg
CLNT1_0080_A10.b : cccnggtttccgtcgcgtcgaggttcttcgctctxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0034_G07.b : nnngggggctttnnannnnnactgac
SKNB1_0049_G07.b : nnnn
SMG01_0079_C01.b : nntttgcgtaagcagcggtxxxxxxxxxx
ITT01_0041_E06.b : nnggatgaacaxxxxxxxxxxxxx
SPL01_0076_D04.b : nnggctaggactatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_B08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0105_B07.b : nggcgtttnnnnnnngggtcaagcagcggna
MLN01_0096_F11.b : ngctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0009_D07.b :
PTG01_0065_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0082_G05.b :
MLN01_0045_B08.b : nnnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_F05.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0051_D02.b : tacnnntgggactcatacagncgtgntacggntccgaanttcntcnagcactgntgtgcc
CLNT1_0100_F05.b : nggatacgtttgctgtcgxxxx
BFLT1_0007_C04.b : nnnccgtcagc
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
---------+---------+---------+---------+---------+---------+ 172
SMG01_0079_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0041_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0076_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0051_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0105_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0009_D07.b : nnnnncctgcggtggctctggagcatctttgcTT*GTTCCCG*TGCCCGGCTC
PTG01_0065_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxTT*GTTCCCG*TGCCCGGCTC
MLN01_0045_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTT*GTTCCCG*TGCCCGGCTC
MLN01_0097_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GTTCCCG*TGCCCGGCTC
SMG01_0051_D02.b : tacnggnactggnctggntctnaaaagccatcntttgcattgnTTCCCG*TGCCCGGCTC
CLNT1_0100_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGCCCGGCTC
BFLT1_0007_C04.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
---------+---------+---------+---------+---------+---------+ 231
OVR01_0064_E04.b : TCCGC