[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000400

Length: 1,758

Sequence [FASTA format sequence]
GTCTACGGCC ATACCACCCT GAACGCGCCC GATCTCGTCT GATCTCGGAA GCTAAGCAGG
GTCGGGCCTG GTTAGTACTT GGATGGGAGA CCGCCTGGGA ATACCGGGTG CTGTAGGCTG
CCCCACTGGC TGGTCTGAAA AGCCATCTTT GCATTGTTCC CGTGCCCGGC TCTCCGCTCG
CCGCAGCCGC CTCCGCCGCG CGCCTCTTCT GCCGCCGCGG ACTCCGGCAG CTTTGTCGCC
AGAGTCCTTG GACTCCCGCT TCCTTTTTTA TCCGCTGCAT CGGATCACCG GCGTGCCCCA
TCATGTCAGA CGCGGCCGTG GACACCAGCT CCGAGATCAC CACCAAGGAC TTAAAAGAGA
AGAAGGAAGT CGTGGAGGAG GCGGAGAATG GGAGAGAGGC CCCTGCTAAT GGCAATGCTA
ATGAGGAAAA TGGGGAGCAG GAGGCTGACA ATGAGGTAGA TGAAGAAGAG GAAGAAGGTG
GGGAGGAAGA GGAGGAGGAG GAGGAAGGTG ATGGTGAGGA AGAGGATGGA GATGAAGATG
AGGAGGCTGA GGCAGCTACA GGCAAACGGG CAGCTGAAGA TGATGAGGAC GACGATGTGG
ACACCAAGAA GCAGAAGACC GATGAGGATG ACTAGACAGC AAAAAAGGAA AAGCTAAAAC
TTAACAGAAA AAAAAAAAAA AAAAAAAGGC CACCGTGACC TATTCACCCT CCACTTCCCG
TCTCAGAAGA ATCCTAAACG TGGTCACCTT CGAGTAGAGA GTCGCCTGCC CGCCCGCCCA
CCGCGGGCAG CGCCACCCGC AGATGACGTG CGCTCTCCAC CACCCCACCA AAACCACAAC
GTGAATTTGC CACAGGGAAG GAAAGAAAGA ACCAAAACTT CCAAGGCCCT GCTTTTTTTC
TTAAAGTACT TTAAAAAGGA AAATTTGTTT GTATTTTTTA TTTACATTTT ATATTTTTGT
ACATATTGTT AGGGGTCAGC CATTTTTAAT GATCTCGGAT GACCAAACCA GCCTTCGGAG
CGTTCTCTGT CCTACTTCTG ACTTTACTTG TGGTGTGACC ATGTTCATTA TAATCTCAAA
GGAGAAAAAA AACCTTGTAA AAAAAGCAAA AACCACAACA AAAAAAAAAA CAATCTTATT
CCGAGCATTC CAATAACTTT TTTTGTGTAT GTACTTAGCT GTACTATAAG TAGTTGGTTT
GTATGAGATG GTTAAAAAGG CCAAAGATAA AAGGTTTCTT TTTTTTCCTT TTTTTTGTCT
ATGAAGTTGC TGTTTATTTT TTTTTGGCCT GTTTGATGTA TGTGTGAAAC AATGTTGTCC
AACAATAAAC CGGAATTTTA TTTTGCTGAG TTGTTCTAAC AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAACCTGGCT GGTCTGAAAA GCCATCTTTG CATTGTTCCC GTGCCCGGCT
CTCCGCTCGC CGCAGCCGCC TCCGCCGCGC GCCTCTTCTG CCGCCGCGGA CTCCGGCAGC
TTTGTCGCCA GAGTCCTTGG ACTCCCGCTT CCTTTTTTAT CCGCTGCATC GGATCACCGG
CGTGCCCCAT CATGTCAGAC GCGGCCGTGG ACACCAGCTC CGAGATCACC ACCAAGGACT
TAAAAGAGAA GAAGGAAGTC GTGGAGGAGG CGGAAAATGG GAAAAAGGCC CCTGCTAATG
GCAATGCTAA TGAGGAAAAT GGGGAGCAGG AGGCTGACAA TGAGGTAGAT GAAAAAAAGG
AAAAAGGGGG GGGAGGAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611067PREDICTED: similar to prothymosin, alpha (gene sequence 28) [Canis familiaris]. 70.91e-13O
Contig/Assembly ProteinLOC609022PREDICTED: hypothetical protein XP_846202 [Canis familiaris]. 50.45e-08O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 454      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010009A08ADR01_0009_A08.bDB782284 
ADR010014E06ADR01_0014_E06.bDB782779 
ADR010014H02ADR01_0014_H02.bDB782809 
ADR010065H02ADR01_0065_H02.bDB787322 
ADR010091C09ADR01_0091_C09.bDB789568 
ADR010099H04ADR01_0099_H04.bDB790335 
AMP010020C03AMP01_0020_C03.bBW956482 
AMP010076G04AMP01_0076_G04.bBW960496 
BFLT10003C01BFLT1_0003_C01.bFS640184 
BFLT10007C04BFLT1_0007_C04.bFS640521 
BFLT10013H10BFLT1_0013_H10.bFS641083 
BFLT10017H02BFLT1_0017_H02.bFS641409 
BFLT10020B01BFLT1_0020_B01.bFS641594 
BFLT10022G03BFLT1_0022_G03.bFS641818 
BFLT10028F08BFLT1_0028_F08.bFS642300 
BFLT10034G10BFLT1_0034_G10.bFS642812 
BFLT10035H09BFLT1_0035_H09.bFS642900 
BFLT10038E01BFLT1_0038_E01.bFS643101 
BFLT10040B10BFLT1_0040_B10.bFS643241 
BFLT10061F07BFLT1_0061_F07.bFS644856 
BFLT10064H06BFLT1_0064_H06.bFS645132 
BFLT10071D11BFLT1_0071_D11.bFS645647 
BFLT10073A05BFLT1_0073_A05.bFS645760 
BFLT10074G08BFLT1_0074_G08.bFS645895 
BFLT10076E06BFLT1_0076_E06.bFS646004 
BFLT10082C10BFLT1_0082_C10.bFS646470 
BFLT10084G02BFLT1_0084_G02.bFS646664 
BFLT10088C09BFLT1_0088_C09.bFS646966 
BFLT10091G01BFLT1_0091_G01.bFS647246 
BFLT10092E12BFLT1_0092_E12.bFS647313 
BFLT10095F04BFLT1_0095_F04.bFS647575 
BFLT10097E01BFLT1_0097_E01.bFS647734 
BFLT10104G02BFLT1_0104_G02.bHX202088 
BFLT10105D06BFLT1_0105_D06.bHX202143 
BFLT10117B07BFLT1_0117_B07.bHX203120 
BFLT10118A04BFLT1_0118_A04.bHX203193 
BFLT10118C01BFLT1_0118_C01.bHX203209 
BFLT10133A12BFLT1_0133_A12.bHX204393 
BFLT10133B03BFLT1_0133_B03.bHX204396 
BFLT10140E03BFLT1_0140_E03.bHX204911 
BKFL10021A10BKFL1_0021_A10.bFS649137 
BKFL10041C06BKFL1_0041_C06.bFS650901 
BKFL10074F02BKFL1_0074_F02.bFS652966 
BMWN10001G02BMWN1_0001_G02.bHX205705 
BMWN10009G05BMWN1_0009_G05.b  
BMWN10010B07BMWN1_0010_B07.bHX206202 
BMWN10012E11BMWN1_0012_E11.bHX206351 
BMWN10025D05BMWN1_0025_D05.bHX207082 
BMWN10026A03BMWN1_0026_A03.bHX207125 
BMWN10027H05BMWN1_0027_H05.b  
BMWN10028F12BMWN1_0028_F12.bHX207311 
BMWN10034F04BMWN1_0034_F04.bHX207697 
BMWN10063A12BMWN1_0063_A12.bHX209379 
BMWN10066A04BMWN1_0066_A04.bHX209556 
BMWN10066F10BMWN1_0066_F10.b  
BMWN10074A06BMWN1_0074_A06.bHX210074 
BMWN10090E04BMWN1_0090_E04.bHX211129 
BMWN10097B02BMWN1_0097_B02.bHX211542 
CBLT10002F08CBLT1_0002_F08.bHX211889 
CBLT10003E03CBLT1_0003_E03.bHX211954 
CBLT10009F09CBLT1_0009_F09.bHX212447 
CBLT10022B03CBLT1_0022_B03.bHX213355 
CBLT10025F01CBLT1_0025_F01.bHX213612 
CBLT10029G01CBLT1_0029_G01.bHX213883 
CBLT10061C01CBLT1_0061_C01.bHX215967 
CBLT10071B12CBLT1_0071_B12.bHX216797 
CBLT10073B07CBLT1_0073_B07.bHX216960 
CBLT10085B05CBLT1_0085_B05.bHX217871 
CBLT10097D05CBLT1_0097_D05.bHX218889 
CBLT10099G02CBLT1_0099_G02.bHX219080 
CLNT10005G01CLNT1_0005_G01.bFS657458 
CLNT10017H05CLNT1_0017_H05.b  
CLNT10020G10CLNT1_0020_G10.bFS658663 
CLNT10021E10CLNT1_0021_E10.bFS658717 
CLNT10029G01CLNT1_0029_G01.bFS659351 
CLNT10049C01CLNT1_0049_C01.bFS660914 
CLNT10052A01CLNT1_0052_A01.bFS661134 
CLNT10072H09CLNT1_0072_H09.bFS662798 
CLNT10075G03CLNT1_0075_G03.bFS663029 
CLNT10076G04CLNT1_0076_G04.bFS663109 
CLNT10080A10CLNT1_0080_A10.b  
CLNT10083H08CLNT1_0083_H08.b  
CLNT10086F08CLNT1_0086_F08.bFS663271 
CLNT10099G01CLNT1_0099_G01.bFS664285 
CLNT10100F05CLNT1_0100_F05.bFS664349 
CLNT10105A12CLNT1_0105_A12.bHX219507 
CLNT10108A12CLNT1_0108_A12.bHX219746 
CLNT10112C09CLNT1_0112_C09.bHX220065 
CLNT10112C11CLNT1_0112_C11.bHX220067 
CLNT10118A01CLNT1_0118_A01.bHX220504 
CLNT10132G02CLNT1_0132_G02.bHX221630 
CLNT10134G12CLNT1_0134_G12.bHX221799 
CLNT10138E11CLNT1_0138_E11.bHX222073 
CLNT10140H07CLNT1_0140_H07.bHX222258 
CLNT10142A09CLNT1_0142_A09.bHX222355 
CLNT10143C12CLNT1_0143_C12.bHX222451 
CLNT10149B05CLNT1_0149_B05.bHX222910 
DCI010053D09DCI01_0053_D09.bDB794514 
DCI010076G08DCI01_0076_G08.bDB796351 
HTMT10003B12HTMT1_0003_B12.bFS664508 
HTMT10006A03HTMT1_0006_A03.bFS664663 
HTMT10046A09HTMT1_0046_A09.bFS667398 
HTMT10048A05HTMT1_0048_A05.bFS667550 
HTMT10076B12HTMT1_0076_B12.bFS669605 
HTMT10084B03HTMT1_0084_B03.bFS670098 
HTMT10092D12HTMT1_0092_D12.bFS670707 AK392648
HTMT10117D05HTMT1_0117_D05.bHX224389 
HTMT10150E12HTMT1_0150_E12.bHX226577 
ILNT10009F01ILNT1_0009_F01.bHX227424 
ILNT10010A01ILNT1_0010_A01.bHX227452 
ILNT10021C07ILNT1_0021_C07.bHX228315 
ILNT10021F08ILNT1_0021_F08.bHX228348 
ILNT10021G12ILNT1_0021_G12.bHX228362 
ILNT10023B10ILNT1_0023_B10.bHX228463 
ILNT10024D02ILNT1_0024_D02.bHX228556 
ILNT10025E07ILNT1_0025_E07.bHX228651 
ILNT10027D09ILNT1_0027_D09.bHX228801 
ILNT10031A03ILNT1_0031_A03.bHX229087 
ILNT10031B11ILNT1_0031_B11.bHX229101 
ILNT10035E12ILNT1_0035_E12.bHX229471 
ILNT10040G10ILNT1_0040_G10.bHX229902 
ILNT10041E09ILNT1_0041_E09.bHX229963 
ILNT10043C10ILNT1_0043_C10.bHX230105 
ILNT10043F01ILNT1_0043_F01.bHX230128 
ILNT10046F08ILNT1_0046_F08.bHX230360 
ILNT10050A10ILNT1_0050_A10.bHX230644 
ILNT10053H09ILNT1_0053_H09.bHX230962 
ILNT10061G05ILNT1_0061_G05.bHX231610 
ILNT10065A09ILNT1_0065_A09.bHX231883 
ILNT10067A02ILNT1_0067_A02.bHX232044 
ILNT10067A03ILNT1_0067_A03.bHX232045 
ILNT10067A12ILNT1_0067_A12.bHX232052 
ILNT10069F12ILNT1_0069_F12.bHX232274 
ILNT10072C08ILNT1_0072_C08.bHX232478 
ILNT10076E08ILNT1_0076_E08.bHX232823 
ILNT10076H09ILNT1_0076_H09.bHX232858 
ILNT10077A12ILNT1_0077_A12.bHX232872 
ILNT10081C11ILNT1_0081_C11.bHX233198 
ILNT10081G03ILNT1_0081_G03.bHX233232 
ILNT10082D05ILNT1_0082_D05.bHX233284 
ILNT10082H10ILNT1_0082_H10.bHX233331 
ILNT10085B06ILNT1_0085_B06.bHX233514 
ILNT10086A05ILNT1_0086_A05.bHX233587 
ILNT10090G07ILNT1_0090_G07.bHX233971 
ILNT10093C01ILNT1_0093_C01.bHX234162 
ILNT10093D12ILNT1_0093_D12.b  
ILNT10094B03ILNT1_0094_B03.bHX234226 
ILNT10094C01ILNT1_0094_C01.bHX234233 
ILNT10098D02ILNT1_0098_D02.bHX234537 
ILNT10099B03ILNT1_0099_B03.bHX234598 
ITT010001E01ITT01_0001_E01.bBW976081 
ITT010008B05ITT01_0008_B05.bBW976691 
ITT010016C07ITT01_0016_C07.bBW977428 
ITT010018E08ITT01_0018_E08.bBW977629 
ITT010027A10ITT01_0027_A10.bBW978408 
ITT010041E06ITT01_0041_E06.bBW979702 
ITT010042E02ITT01_0042_E02.bBW979788 
ITT010043B11ITT01_0043_B11.bBW979852 
ITT010048F10ITT01_0048_F10.bBW980265 
ITT010053B09ITT01_0053_B09.bBW980678 
ITT010053H08ITT01_0053_H08.bBW980747 
ITT010061E03ITT01_0061_E03.bBW981429 
ITT010074H05ITT01_0074_H05.bBW982632 
ITT010074H07ITT01_0074_H07.bBW982634 
ITT010078E03ITT01_0078_E03.bBW982936 
ITT010087F02ITT01_0087_F02.bBW983738 
ITT010090D07ITT01_0090_D07.bBW983991 
ITT010094B09ITT01_0094_B09.bBW984327 
ITT010096A04ITT01_0096_A04.bBW984493 
ITT010100E01ITT01_0100_E01.bBW984904 
ITT010102E05ITT01_0102_E05.bBW985088 
KDN010007B09KDN01_0007_B09.bFS671694 
KDN010019C03KDN01_0019_C03.bFS672608 
KDN010067C09KDN01_0067_C09.bFS675770 
KDN010073H05KDN01_0073_H05.bFS676288 
KDN010096B08KDN01_0096_B08.b  
LNG010076E12LNG01_0076_E12.bBP437918 
LVR010103B01LVR01_0103_B01.bBP441932 
LVRM10081B08LVRM1_0081_B08.bCJ002433 
LVRM10094D09LVRM1_0094_D09.bCJ003532 
LVRM10148C06LVRM1_0148_C06.bBP450100 
LVRM10199B11LVRM1_0199_B11.bCJ006921 
MLN010010G06MLN01_0010_G06.bCJ008510 
MLN010020A01MLN01_0020_A01.bCJ009114 
MLN010021G11MLN01_0021_G11.bCJ009269 
MLN010023D12MLN01_0023_D12.bCJ009401 
MLN010027C12MLN01_0027_C12.bCJ009723 
MLN010031A01MLN01_0031_A01.bCJ010018 
MLN010035B11MLN01_0035_B11.bCJ010358 
MLN010035B12MLN01_0035_B12.bCJ010359 
MLN010038E06MLN01_0038_E06.bCJ010621 
MLN010040C07MLN01_0040_C07.bBW963540 
MLN010040C11MLN01_0040_C11.bCJ010781 
MLN010042C10MLN01_0042_C10.b  
MLN010045B08MLN01_0045_B08.bCJ011174 
MLN010052A06MLN01_0052_A06.bCJ011664 
MLN010061D04MLN01_0061_D04.bBW963675 
MLN010068B04MLN01_0068_B04.bCJ012999 
MLN010068B05MLN01_0068_B05.bCJ013000 
MLN010068E11MLN01_0068_E11.bCJ013039 
MLN010068H09MLN01_0068_H09.bCJ013071 
MLN010071A04MLN01_0071_A04.bCJ013252 
MLN010072E04MLN01_0072_E04.bCJ013383 
MLN010077H07MLN01_0077_H07.bCJ013785 
MLN010086H02MLN01_0086_H02.bCJ014553 
MLN010087A01MLN01_0087_A01.bCJ014564 
MLN010087C07MLN01_0087_C07.bBW963826 
MLN010088C01MLN01_0088_C01.bCJ014670 
MLN010091F10MLN01_0091_F10.bCJ014953 
MLN010096F11MLN01_0096_F11.bCJ015381 
MLN010097F05MLN01_0097_F05.bCJ015460 
MLN010097F06MLN01_0097_F06.bBW963896 
MLN010098F11MLN01_0098_F11.bCJ015553 
MLN010102A03MLN01_0102_A03.bCJ015850 
MLN010102G04MLN01_0102_G04.bCJ015919 
MLN010102H07MLN01_0102_H07.bCJ015933 
MLN010103B07MLN01_0103_B07.bBW963913 
OVR010001F03OVR01_0001_F03.bBP143550 
OVR010004D06OVR01_0004_D06.bBP142778 
OVR010009E03OVR01_0009_E03.bBP143116 
OVR010014H12OVR01_0014_H12.bBP144818 
OVR010019A05OVR01_0019_A05.bBP141412 
OVR010035D05OVR01_0035_D05.b  
OVR010037H06OVR01_0037_H06.bBP144609 
OVR010043H12OVR01_0043_H12.b  
OVR010044D01OVR01_0044_D01.bBP142620 
OVR010047B03OVR01_0047_B03.bBP141798 
OVR010051B08OVR01_0051_B08.bBW964133 
OVR010059B08OVR01_0059_B08.bBW964852 
OVR010064E04OVR01_0064_E04.bBW965326 
OVR010104B06OVR01_0104_B06.bBW968469 
OVRM10001B09OVRM1_0001_B09.bBP456216 
OVRM10052H09OVRM1_0052_H09.bBP154583 
OVRM10108G07OVRM1_0108_G07.bBP153068 
OVRM10113B05OVRM1_0113_B05.bBP146633 
OVRM10114B03OVRM1_0114_B03.bBP146422 
OVRM10114H12OVRM1_0114_H12.bBP154973 
OVRM10118E09OVRM1_0118_E09.bBP150793 
OVRM10121E11OVRM1_0121_E11.bBP151021 
OVRM10131F12OVRM1_0131_F12.bBP152378 
OVRM10137E09OVRM1_0137_E09.bBP150812 
OVRM10151G07OVRM1_0151_G07.bBP460913 
OVRM10191E12OVRM1_0191_E12.bBP459363 
OVRT10002E06OVRT1_0002_E06.bFS686544 
OVRT10009G08OVRT1_0009_G08.bFS687156 
OVRT10015F05OVRT1_0015_F05.bFS687644 
OVRT10019A09OVRT1_0019_A09.bFS687920 
OVRT10020H10OVRT1_0020_H10.b  
OVRT10021G09OVRT1_0021_G09.bFS688139 
OVRT10027H08OVRT1_0027_H08.bFS688658 
OVRT10031C02OVRT1_0031_C02.bFS688900 
OVRT10032B04OVRT1_0032_B04.bFS688972 
OVRT10032F02OVRT1_0032_F02.bFS689005 
OVRT10034F08OVRT1_0034_F08.bFS689182 AK395596
OVRT10040C12OVRT1_0040_C12.bFS689661 
OVRT10048G10OVRT1_0048_G10.bFS690352 
OVRT10049H03OVRT1_0049_H03.bFS690444 
OVRT10055D09OVRT1_0055_D09.bFS690893 
OVRT10057H05OVRT1_0057_H05.bFS691095 
OVRT10062E02OVRT1_0062_E02.bFS691475 
OVRT10072E04OVRT1_0072_E04.bFS692279 
OVRT10076G10OVRT1_0076_G10.bFS692632 
OVRT10079E08OVRT1_0079_E08.bFS692857 
OVRT10087D10OVRT1_0087_D10.bFS693495 
OVRT10087E12OVRT1_0087_E12.bFS693508 
OVRT10088B01OVRT1_0088_B01.bFS693548 
OVRT10088G09OVRT1_0088_G09.bFS693604 
OVRT10093C02OVRT1_0093_C02.bFS693967 
OVRT10093D01OVRT1_0093_D01.bFS693978 
OVRT10094G03OVRT1_0094_G03.bFS694097 
OVRT10102E03OVRT1_0102_E03.bHX234955 
OVRT10105A05OVRT1_0105_A05.bHX235156 
OVRT10109E08OVRT1_0109_E08.bHX235533 
OVRT10110G04OVRT1_0110_G04.bHX235636 
OVRT10110G05OVRT1_0110_G05.bHX235637 
OVRT10119D04OVRT1_0119_D04.bHX236360 
PBL010007E07PBL01_0007_E07.bBW968889 
PBL010048E11PBL01_0048_E11.bBW970920 
PBL010055E12PBL01_0055_E12.bBW971374 
PBL010077F09PBL01_0077_F09.bBW973026 
PCT010001A11PCT01_0001_A11.bFS694628 
PCT010001F04PCT01_0001_F04.bFS694675 
PCT010002G06PCT01_0002_G06.bFS694754 
PCT010003D11PCT01_0003_D11.bFS694788 
PCT010004D06PCT01_0004_D06.bFS694862 
PCT010007F11PCT01_0007_F11.bFS695106 
PCT010009D07PCT01_0009_D07.bFS695240 
PCT010010E03PCT01_0010_E03.bFS695318 
PCT010011A03PCT01_0011_A03.bFS695358 
PCT010011B09PCT01_0011_B09.bFS695371 
PCT010016D01PCT01_0016_D01.bFS695705 
PCT010016E02PCT01_0016_E02.bFS695715 
PCT010017B09PCT01_0017_B09.bFS695763 
PCT010017C05PCT01_0017_C05.bFS695765 
PCT010017F03PCT01_0017_F03.bFS695790 
PCT010019H01PCT01_0019_H01.bFS695928 
PCT010021D05PCT01_0021_D05.bFS696023 
PCT010024B09PCT01_0024_B09.bFS696226 
PCT010024C03PCT01_0024_C03.bFS696230 
PCT010024G08PCT01_0024_G08.b  
PCT010024H05PCT01_0024_H05.bFS696275 
PCT010031H12PCT01_0031_H12.bFS696720 
PCT010032E04PCT01_0032_E04.bFS696755 
PCT010033A04PCT01_0033_A04.bFS696779 
PCT010033C05PCT01_0033_C05.bFS696798 
PCT010033G02PCT01_0033_G02.bFS696826 
PCT010033H12PCT01_0033_H12.b  
PCT010034G07PCT01_0034_G07.bFS696911 
PCT010035G02PCT01_0035_G02.bFS696979 
PST010003A11PST01_0003_A11.bFS697207 
PST010005B08PST01_0005_B08.bFS697366 
PST010009G08PST01_0009_G08.bFS697726 
PST010011F05PST01_0011_F05.bFS697875 
PST010012D06PST01_0012_D06.bFS697938 
PST010016B09PST01_0016_B09.bFS698230 
PST010019F03PST01_0019_F03.bFS698486 
PST010023G02PST01_0023_G02.bFS698827 
PST010026H09PST01_0026_H09.bFS699075 
PST010027B03PST01_0027_B03.bFS699089 
PST010031D04PST01_0031_D04.b  
PST010036B08PST01_0036_B08.bFS699635 
PST010039A10PST01_0039_A10.bFS699857 
PST010039B04PST01_0039_B04.bFS699863 
PST010040A05PST01_0040_A05.bFS699936 
PST010044F03PST01_0044_F03.bFS700313 
PST010044G07PST01_0044_G07.bFS700327 
PST010047D01PST01_0047_D01.bFS700523 
PST010051D09PST01_0051_D09.bFS700861 
PST010055C05PST01_0055_C05.bFS701174 
PST010056C06PST01_0056_C06.bFS701252 
PST010058B12PST01_0058_B12.bFS701403 
PST010060D08PST01_0060_D08.bFS701579 
PST010062B07PST01_0062_B07.bFS701714 
PST010063B11PST01_0063_B11.bFS701801 
PST010063E01PST01_0063_E01.bFS701822 
PST010065E03PST01_0065_E03.bHX239169 
PST010067D02PST01_0067_D02.bFS702126 
PST010072G02PST01_0072_G02.bFS702532 
PST010073D02PST01_0073_D02.bFS702572 
PST010078B11PST01_0078_B11.bFS702978 
PST010083B07PST01_0083_B07.bFS703382 
PST010086H10PST01_0086_H10.bFS703688 
PST010090F03PST01_0090_F03.bFS703983 
PST010095E02PST01_0095_E02.bFS704352 
PTG010043H08PTG01_0043_H08.bFS708248 
PTG010044A02PTG01_0044_A02.bFS708254 
PTG010044H08PTG01_0044_H08.bFS708338 
PTG010065F04PTG01_0065_F04.bFS710061 
PTG010103G04PTG01_0103_G04.bFS712806 
PTG010105B07PTG01_0105_B07.bFS712913 
SKNB10015D06SKNB1_0015_D06.b  
SKNB10028G07SKNB1_0028_G07.bDB801529 
SKNB10037H12SKNB1_0037_H12.bDB802050 
SKNB10039A04SKNB1_0039_A04.bDB802117 
SKNB10042F07SKNB1_0042_F07.bDB802356 
SKNB10046E03SKNB1_0046_E03.bDB802624 
SKNB10047H09SKNB1_0047_H09.bDB802721 
SKNB10049G07SKNB1_0049_G07.bDB802855 
SKNB10053E08SKNB1_0053_E08.bDB803132 
SKNB10056B07SKNB1_0056_B07.b  
SKNB10056B09SKNB1_0056_B09.b  
SKNB10056F07SKNB1_0056_F07.bDB803354 
SKNB10061B03SKNB1_0061_B03.b  
SKNB10064B10SKNB1_0064_B10.b  
SKNB10069E09SKNB1_0069_E09.bDB804197 
SKNB10069G02SKNB1_0069_G02.bDB804209 
SKNB10071G04SKNB1_0071_G04.bDB804348 
SKNB10091D02SKNB1_0091_D02.bDB805476 
SKNB10091E01SKNB1_0091_E01.bDB805486 
SKNB10097B03SKNB1_0097_B03.bDB805814 
SMG010004A08SMG01_0004_A08.bFS713745 
SMG010006C05SMG01_0006_C05.bFS713939 
SMG010051D02SMG01_0051_D02.b  
SMG010053G11SMG01_0053_G11.bFS717911 
SMG010071H02SMG01_0071_H02.bFS719440 
SMG010079B05SMG01_0079_B05.bFS720073 
SMG010079C01SMG01_0079_C01.bFS720081 
SMG010079D05SMG01_0079_D05.bFS720096 
SMG010084A06SMG01_0084_A06.bFS720488 
SMG010100D08SMG01_0100_D08.bFS721855 
SPL010001F06SPL01_0001_F06.bBP158511 
SPL010001F09SPL01_0001_F09.bBP158598 
SPL010012H05SPL01_0012_H05.bBP159160 
SPL010016D10SPL01_0016_D10.bBP157938 
SPL010019B01SPL01_0019_B01.bBP157004 
SPL010019H05SPL01_0019_H05.bBP159166 
SPL010020F07SPL01_0020_F07.bBP158557 
SPL010021A06SPL01_0021_A06.bBP156820 
SPL010023E05SPL01_0023_E05.bBP158155 
SPL010025B12SPL01_0025_B12.bBP157311 
SPL010026F11SPL01_0026_F11.bBP158670 
SPL010033G05SPL01_0033_G05.bCJ016636 
SPL010035D03SPL01_0035_D03.bBP157748 
SPL010039B05SPL01_0039_B05.bBP157129 
SPL010048A02SPL01_0048_A02.bCJ017300 
SPL010057F01SPL01_0057_F01.bCJ018159 
SPL010071B10SPL01_0071_B10.bCJ019384 
SPL010074B09SPL01_0074_B09.bCJ019652 
SPL010076D04SPL01_0076_D04.bCJ019853 
SPL010078F05SPL01_0078_F05.bCJ020060 
SPL010079G10SPL01_0079_G10.bCJ020165 
SPL010083C09SPL01_0083_C09.bCJ020486 
SPL010084B09SPL01_0084_B09.bCJ020568 
SPL010089H08SPL01_0089_H08.bCJ021074 
SPL010091C10SPL01_0091_C10.bCJ021199 
SPL010099D09SPL01_0099_D09.bCJ021929 
SPLT10004D10SPLT1_0004_D10.bHX239530 
SPLT10007F05SPLT1_0007_F05.bHX239766 
SPLT10012H01SPLT1_0012_H01.bHX240161 
SPLT10017F03SPLT1_0017_F03.bHX240524 
SPLT10030A08SPLT1_0030_A08.bHX241491 
SPLT10033D08SPLT1_0033_D08.bHX241744 
SPLT10034H07SPLT1_0034_H07.bHX241867 
SPLT10036E09SPLT1_0036_E09.bHX241998 
SPLT10039E11SPLT1_0039_E11.bHX242239 
SPLT10043H02SPLT1_0043_H02.bHX242582 
SPLT10058B09SPLT1_0058_B09.bHX243671 
SPLT10059E05SPLT1_0059_E05.bHX243779 
SPLT10074B01SPLT1_0074_B01.bHX244928 
SPLT10076G10SPLT1_0076_G10.bHX245141 
SPLT10078H11SPLT1_0078_H11.bHX245311 
SPLT10085G07SPLT1_0085_G07.bHX245848 
TCH010037A04TCH01_0037_A04.bCJ025155 
TCH010047A11TCH01_0047_A11.bCJ025920 
TCH010098A09TCH01_0098_A09.bCJ029576 
TES010003G04TES01_0003_G04.bCJ030205 
TES010082G05TES01_0082_G05.bCJ035312 
TES010106H06TES01_0106_H06.bCJ037034 
THY010009A04THY01_0009_A04.bBP159674 
THY010009H11THY01_0009_H11.bBP169176 
THY010011F06THY01_0011_F06.bBP166119 
THY010026C04THY01_0026_C04.bBP162162 
THY010027G02THY01_0027_G02.bBP166950 
THY010034B05THY01_0034_B05.bBP161018 
THY010049H06THY01_0049_H06.bBP168674 
THY010054C01THY01_0054_C01.bBP161873 
THY010065A03THY01_0065_A03.bBP159620 
THY010068F01THY01_0068_F01.bBP165630 
THY010069H01THY01_0069_H01.bBP168153 
THY010082B08THY01_0082_B08.bBP161369 
THY010105C08THY01_0105_C08.bBP162637 
THY010125D10THY01_0125_D10.bBP164100 
UTR010003A08UTR01_0003_A08.bBP169664 
UTR010011E02UTR01_0011_E02.bBP171548 AK239921
UTR010023E05UTR01_0023_E05.bBP171694 
UTR010031E07UTR01_0031_E07.bBP171789 
UTR010044C02UTR01_0044_C02.bBP170504 
UTR010046G10UTR01_0046_G10.bBP173000 
UTR010052B12UTR01_0052_B12.bBP463228 
UTR010068B07UTR01_0068_B07.bBP463121 
UTR010098H05UTR01_0098_H05.bCJ038996 
UTR010099F01UTR01_0099_F01.bCJ039063 
UTR010101G03UTR01_0101_G03.bCJ039263 
UTR010107D01UTR01_0107_D01.bCJ039779 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
269A24140.089ONTTA/L
T38520.911TTT/F


Alignment:      TOP

20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b :
BFLT1_0133_B03.b : ctctctggcccgagaatntatactctactttcttctgaaaaaaaaaaagnnnnttttttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : actcctcccccccggagaattacaacccttttttttttacccccgt
BFLT1_0133_B03.b : ttttttaatgggttgttggagagaataaaaaaaagagggcccctcacacaacctctgtta
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : gggtgagatcccccccccccgcgggaaaattaaaactttctttttttgtgaacataattg
BFLT1_0133_B03.b : tttatggggaacccccccccccaattaaaatctctttatcacacgggaatcccctccccc
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : ccccaaaattcccctccccccctaataccccctttgcccctttttccccccggggggaat
BFLT1_0133_B03.b : cggaaaataaaatttatttttttagattttccccaatttccccctccccaaaatcccatt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : tttttttttttatggagggggggggcccccttcgtctttgggattttccaaaaggggagg
BFLT1_0133_B03.b : ttgcctattttccccgggggaaattttttttttggaggggggccccctgctctttatttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : gggtttttttggggccttggttttacaaaaaattcttaatgagggggttgattttttttt
BFLT1_0133_B03.b : ccaaaattggggaggtttttggggcttgttttcaaaaagtttttaatgggggttggtttt
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : taaggggccggcggcctactgagggcggctatcccacccggtgagttgggttttcccxxx
BFLT1_0133_B03.b : ttttttagggcccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b :
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b : nttttccg
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b :
DCI01_0053_D09.b :
AMP01_0076_G04.b :
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b :
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b :
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b :
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0118_A01.b : ttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0004_A08.b :
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b :
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b :
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b :
OVRT1_0031_C02.b :
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b :
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b :
UTR01_0011_E02.b :
OVR01_0037_H06.b :
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b :
OVRT1_0062_E02.b :
LVRM1_0199_B11.b :
OVRT1_0002_E06.b :
KDN01_0096_B08.b :
MLN01_0087_A01.b :
MLN01_0102_G04.b :
SPL01_0083_C09.b :
SPL01_0089_H08.b :
DCI01_0076_G08.b : nnnnncgatactatagggctxxxxxxxxxxxxxxx
DCI01_0053_D09.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : aaactatagcgtatctatagggctgctcxxxxxxxxxxxx
SPLT1_0058_B09.b :
MLN01_0038_E06.b :
THY01_0034_B05.b :
PCT01_0001_F04.b :
OVRT1_0057_H05.b :
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0040_C11.b :
MLN01_0077_H07.b :
UTR01_0107_D01.b :
MLN01_0072_E04.b :
UTR01_0003_A08.b :
OVR01_0019_A05.b :
UTR01_0052_B12.b :
SPL01_0035_D03.b :
OVR01_0035_D05.b : ctt
THY01_0065_A03.b :
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b :
UTR01_0098_H05.b :
MLN01_0091_F10.b :
MLN01_0068_B04.b :
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b :
OVRT1_0048_G10.b :
BMWN1_0010_B07.b :
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b :
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b :
BFLT1_0061_F07.b :
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b :
OVR01_0104_B06.b :
SPL01_0033_G05.b :
SPL01_0071_B10.b :
TCH01_0098_A09.b :
MLN01_0071_A04.b :
OVR01_0043_H12.b :
THY01_0009_H11.b :
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b :
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b :
THY01_0011_F06.b :
CLNT1_0099_G01.b :
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b :
BMWN1_0028_F12.b :
AMP01_0020_C03.b : ntttaacgactcttxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b :
BFLT1_0118_A04.b :
BFLT1_0073_A05.b :
OVRT1_0019_A09.b :
UTR01_0101_G03.b :
MLN01_0068_E11.b :
SPL01_0001_F09.b :
SPL01_0026_F11.b :
THY01_0069_H01.b :
SMG01_0100_D08.b :
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b :
CLNT1_0105_A12.b :
OVRT1_0087_D10.b :
OVRT1_0087_E12.b :
OVRT1_0088_G09.b :
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b :
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b :
OVRT1_0109_E08.b :
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b :
CLNT1_0108_A12.b :
OVRT1_0055_D09.b :
OVRT1_0088_B01.b :
OVRT1_0032_F02.b :
CLNT1_0021_E10.b :
CLNT1_0138_E11.b :
OVRT1_0072_E04.b :
BMWN1_0026_A03.b :
OVRT1_0032_B04.b :
OVRT1_0105_A05.b :
OVRT1_0110_G04.b :
OVRT1_0094_G03.b :
CLNT1_0112_C09.b :
OVRT1_0040_C12.b :
OVRT1_0093_C02.b :
CLNT1_0076_G04.b :
CLNT1_0072_H09.b :
CLNT1_0075_G03.b :
OVRT1_0110_G05.b :
ADR01_0091_C09.b :
CLNT1_0049_C01.b :
CLNT1_0029_G01.b :
CLNT1_0052_A01.b :
BFLT1_0118_C01.b :
CLNT1_0020_G10.b :
BFLT1_0140_E03.b :
LVR01_0103_B01.b :
ITT01_0087_F02.b :
SPL01_0025_B12.b :
THY01_0105_C08.b :
OVRT1_0079_E08.b :
OVR01_0004_D06.b :
BFLT1_0064_H06.b :
CLNT1_0143_C12.b :
MLN01_0098_F11.b :
BFLT1_0028_F08.b :
UTR01_0044_C02.b :
BFLT1_0097_E01.b :
CLNT1_0134_G12.b :
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b :
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b :
CLNT1_0132_G02.b :
BFLT1_0091_G01.b :
MLN01_0052_A06.b :
BFLT1_0034_G10.b :
BFLT1_0035_H09.b :
MLN01_0088_C01.b :
BFLT1_0013_H10.b :
MLN01_0087_C07.b :
OVRT1_0027_H08.b :
OVRT1_0076_G10.b :
UTR01_0023_E05.b :
MLN01_0086_H02.b :
MLN01_0010_G06.b :
SPL01_0084_B09.b :
MLN01_0021_G11.b :
MLN01_0061_D04.b :
SPL01_0020_F07.b :
SPL01_0057_F01.b :
SPL01_0074_B09.b :
SPL01_0078_F05.b :
SPL01_0079_G10.b :
LNG01_0076_E12.b :
OVR01_0059_B08.b :
SPL01_0001_F06.b :
MLN01_0068_B05.b :
MLN01_0102_A03.b :
OVR01_0064_E04.b :
SPL01_0021_A06.b :
SPL01_0091_C10.b :
MLN01_0020_A01.b :
SPL01_0099_D09.b :
MLN01_0027_C12.b :
MLN01_0068_H09.b :
SPL01_0019_B01.b :
MLN01_0035_B11.b :
SPL01_0019_H05.b :
SPL01_0048_A02.b :
MLN01_0040_C07.b :
MLN01_0031_A01.b :
MLN01_0035_B12.b :
UTR01_0068_B07.b :
OVRT1_0049_H03.b :
UTR01_0031_E07.b :
SPL01_0012_H05.b :
SPL01_0016_D10.b :
SPL01_0023_E05.b :
MLN01_0023_D12.b :
OVR01_0047_B03.b :
TCH01_0047_A11.b :
MLN01_0042_C10.b :
SPL01_0039_B05.b :
THY01_0027_G02.b :
OVR01_0044_D01.b :
OVR01_0001_F03.b :
MLN01_0102_H07.b :
THY01_0068_F01.b :
THY01_0009_A04.b :
THY01_0049_H06.b :
UTR01_0046_G10.b :
THY01_0026_C04.b :
THY01_0054_C01.b :
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b :
THY01_0082_B08.b :
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b :
PCT01_0024_G08.b :
CLNT1_0005_G01.b :
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b :
OVR01_0009_E03.b :
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b :
TCH01_0037_A04.b :
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b :
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b :
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : ....GTCTACGGCCATACCACCCTGAACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAG
---------+---------+---------+---------+---------+---------+ 56
CLNT1_0118_A01.b : xxxxgtctacggccataccaccctgaacgcgcccgatctcgtctgatctcggaagctaag
SMG01_0004_A08.b : nnnggga
PBL01_0077_F09.b :
CBLT1_0009_F09.b :
ILNT1_0081_G03.b :
ILNT1_0077_A12.b :
SPLT1_0043_H02.b :
ILNT1_0009_F01.b :
ILNT1_0021_F08.b :
OVRT1_0102_E03.b : nnnnccgt
ILNT1_0072_C08.b :
BMWN1_0066_F10.b :
CBLT1_0029_G01.b :
ILNT1_0043_C10.b :
ILNT1_0085_B06.b :
ILNT1_0094_B03.b : n
HTMT1_0046_A09.b :
HTMT1_0092_D12.b :
BMWN1_0063_A12.b :
BMWN1_0066_A04.b : ttttaggatgg
OVRT1_0031_C02.b : nnnccccgtt
SPLT1_0004_D10.b :
ILNT1_0053_H09.b :
CBLT1_0085_B05.b :
BFLT1_0095_F04.b : ggaaccgt
ILNT1_0093_C01.b :
ILNT1_0094_C01.b :
ILNT1_0093_D12.b :
BFLT1_0003_C01.b : nggatac
UTR01_0011_E02.b : atttatggtgxxxxxxxxxxx
OVR01_0037_H06.b : ggggtttttggggcacxxx
SKNB1_0091_D02.b :
SKNB1_0028_G07.b :
PST01_0036_B08.b :
PST01_0065_E03.b :
PST01_0023_G02.b :
LVRM1_0081_B08.b :
CBLT1_0099_G02.b :
ILNT1_0082_H10.b :
ILNT1_0067_A02.b :
SPLT1_0078_H11.b :
ILNT1_0061_G05.b :
SMG01_0071_H02.b :
ILNT1_0041_E09.b :
SPLT1_0036_E09.b :
SPLT1_0033_D08.b :
CBLT1_0003_E03.b :
BMWN1_0009_G05.b :
ILNT1_0086_A05.b :
CLNT1_0086_F08.b : nggcnccg
OVRT1_0062_E02.b : nnnncccg
LVRM1_0199_B11.b :
OVRT1_0002_E06.b : ggaatcg
KDN01_0096_B08.b :
MLN01_0087_A01.b : ncctggtaggact
MLN01_0102_G04.b : nnnaagttgtgact
SPL01_0083_C09.b : nnggcttggactata
SPL01_0089_H08.b : ntttgcttggactatgacx
DCI01_0076_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0053_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0058_B09.b :
MLN01_0038_E06.b : nnnnggctaggactat
THY01_0034_B05.b : gtggaccctattagx
PCT01_0001_F04.b :
OVRT1_0057_H05.b : ng
THY01_0125_D10.b :
SPLT1_0030_A08.b :
BKFL1_0021_A10.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C11.b : nnnnggcta
MLN01_0077_H07.b : ntgctaggacta
UTR01_0107_D01.b : nnnnggctagtg
MLN01_0072_E04.b : nngggttgtgac
UTR01_0003_A08.b : gggggxxxxxxxxx
OVR01_0019_A05.b : tggggtgaacctatxxx
UTR01_0052_B12.b : xxxxxxxxxxxxxxxxxxxxx
SPL01_0035_D03.b : aaaacttacngtccnxxxxxxxxxxxx
OVR01_0035_D05.b : ttttttttttttttctttttttttttttttttttttctttttttttttttccttggacta
THY01_0065_A03.b : ctxxxxxxxxxxxxxxxxxxx
SKNB1_0053_E08.b :
SKNB1_0091_E01.b :
SKNB1_0069_G02.b :
SKNB1_0042_F07.b :
SKNB1_0064_B10.b :
SKNB1_0061_B03.b :
SKNB1_0056_B07.b :
SKNB1_0039_A04.b :
SKNB1_0037_H12.b :
SKNB1_0015_D06.b :
SKNB1_0056_F07.b :
PST01_0039_B04.b :
PST01_0027_B03.b :
PST01_0040_A05.b :
PST01_0058_B12.b :
PST01_0044_F03.b :
PST01_0047_D01.b :
PST01_0012_D06.b :
PST01_0016_B09.b :
KDN01_0067_C09.b :
PST01_0060_D08.b :
PST01_0011_F05.b :
PST01_0044_G07.b :
PST01_0019_F03.b :
PST01_0063_E01.b :
KDN01_0007_B09.b :
PST01_0005_B08.b :
PST01_0067_D02.b :
PST01_0009_G08.b :
PST01_0003_A11.b :
PST01_0072_G02.b :
PST01_0051_D09.b :
PST01_0063_B11.b :
PCT01_0016_D01.b :
PST01_0062_B07.b :
PST01_0031_D04.b :
ILNT1_0090_G07.b :
PST01_0090_F03.b :
TES01_0106_H06.b :
PST01_0078_B11.b :
PST01_0095_E02.b :
PST01_0086_H10.b :
BFLT1_0092_E12.b : nat
UTR01_0098_H05.b : nnnttgcta
MLN01_0091_F10.b : nnggttgtgac
MLN01_0068_B04.b : ttaggggctaggacttgacagtttg
SKNB1_0046_E03.b :
SKNB1_0056_B09.b :
PST01_0039_A10.b :
PST01_0055_C05.b :
HTMT1_0003_B12.b :
PCT01_0024_C03.b :
PCT01_0024_B09.b :
CBLT1_0097_D05.b :
ILNT1_0031_B11.b :
ILNT1_0076_E08.b :
BMWN1_0034_F04.b :
ILNT1_0021_G12.b :
ILNT1_0023_B10.b :
ILNT1_0050_A10.b :
ILNT1_0067_A03.b :
ILNT1_0067_A12.b :
ILNT1_0046_F08.b :
CBLT1_0022_B03.b :
CBLT1_0002_F08.b :
ILNT1_0021_C07.b :
SPLT1_0017_F03.b :
SPLT1_0085_G07.b :
SPLT1_0034_H07.b :
BMWN1_0097_B02.b :
CBLT1_0025_F01.b :
ILNT1_0043_F01.b :
SPLT1_0012_H01.b :
BMWN1_0074_A06.b :
BMWN1_0012_E11.b :
HTMT1_0084_B03.b :
SPLT1_0039_E11.b :
HTMT1_0117_D05.b :
ILNT1_0024_D02.b :
SPLT1_0007_F05.b :
ILNT1_0010_A01.b :
ILNT1_0025_E07.b :
ILNT1_0027_D09.b :
ILNT1_0099_B03.b :
HTMT1_0076_B12.b :
PTG01_0103_G04.b :
SMG01_0084_A06.b :
HTMT1_0150_E12.b :
HTMT1_0048_A05.b :
CBLT1_0061_C01.b : ng
OVRT1_0048_G10.b : nntt
BMWN1_0010_B07.b : nnngggcgag
CBLT1_0071_B12.b :
BMWN1_0001_G02.b :
BFLT1_0038_E01.b : gaat
SPLT1_0076_G10.b :
SPLT1_0074_B01.b :
BFLT1_0074_G08.b : ga
BFLT1_0061_F07.b : gact
CBLT1_0073_B07.b :
TES01_0003_G04.b :
BFLT1_0071_D11.b : gcttc
OVR01_0104_B06.b : nttgcttgga
SPL01_0033_G05.b : nnnngggctggact
SPL01_0071_B10.b : nnnggcttggac
TCH01_0098_A09.b : nnggctaggac
MLN01_0071_A04.b : nnnnggctaggactatgacxx
OVR01_0043_H12.b : agggcxxxxxxxxxxxxxxxx
THY01_0009_H11.b : attttgctgxxxxxxxx
BMWN1_0090_E04.b :
ITT01_0090_D07.b :
OVR01_0014_H12.b : tttggggggaccaxxxxxx
PST01_0056_C06.b :
KDN01_0073_H05.b :
BFLT1_0082_C10.b :
BFLT1_0076_E06.b : gga
THY01_0011_F06.b : tggacxx
CLNT1_0099_G01.b : ggtt
CLNT1_0149_B05.b :
BFLT1_0117_B07.b :
OVRT1_0009_G08.b :
BFLT1_0020_B01.b : n
BMWN1_0028_F12.b : nttta
AMP01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b :
ITT01_0001_E01.b :
ADR01_0014_H02.b :
ADR01_0099_H04.b :
BFLT1_0017_H02.b : ngac
BFLT1_0118_A04.b : ncca
BFLT1_0073_A05.b : ngaa
OVRT1_0019_A09.b : nnaa
UTR01_0101_G03.b : nnnttgctagg
MLN01_0068_E11.b : tttgtgggct
SPL01_0001_F09.b : tttggggtgxxxx
SPL01_0026_F11.b : ctttagggtgxxxxx
THY01_0069_H01.b : gcxxxxxxxxxxxxxxx
SMG01_0100_D08.b : n
SKNB1_0097_B03.b :
PST01_0026_H09.b :
LVRM1_0094_D09.b :
OVRM1_0052_H09.b :
OVRM1_0114_H12.b :
OVRM1_0001_B09.b :
OVRM1_0118_E09.b :
OVRM1_0151_G07.b :
ITT01_0078_E03.b :
LVRM1_0148_C06.b :
OVRM1_0108_G07.b :
OVRM1_0113_B05.b :
ITT01_0061_E03.b :
OVRM1_0131_F12.b :
BFLT1_0105_D06.b : nnnn
CLNT1_0105_A12.b : nttt
OVRT1_0087_D10.b : nnnn
OVRT1_0087_E12.b : nnnt
OVRT1_0088_G09.b : nnnt
ITT01_0053_B09.b :
ITT01_0018_E08.b :
SMG01_0079_B05.b :
SMG01_0079_D05.b :
CLNT1_0140_H07.b : nnnnn
BFLT1_0084_G02.b :
PTG01_0043_H08.b :
BFLT1_0104_G02.b : nnnn
OVRT1_0109_E08.b : nnnc
SMG01_0006_C05.b :
PTG01_0044_H08.b :
SMG01_0053_G11.b :
CLNT1_0112_C11.b : nnn
CLNT1_0108_A12.b : nntt
OVRT1_0055_D09.b : nnnn
OVRT1_0088_B01.b : nnncc
OVRT1_0032_F02.b : nttt
CLNT1_0021_E10.b : g
CLNT1_0138_E11.b : n
OVRT1_0072_E04.b : ngaa
BMWN1_0026_A03.b : nnnaaa
OVRT1_0032_B04.b : nnn
OVRT1_0105_A05.b : nn
OVRT1_0110_G04.b : nnn
OVRT1_0094_G03.b : nnncct
CLNT1_0112_C09.b : nnnn
OVRT1_0040_C12.b : ncct
OVRT1_0093_C02.b : nncc
CLNT1_0076_G04.b : nncct
CLNT1_0072_H09.b : ngta
CLNT1_0075_G03.b : nggt
OVRT1_0110_G05.b : nnnn
ADR01_0091_C09.b :
CLNT1_0049_C01.b : nngggctttnnngnnn
CLNT1_0029_G01.b : tt
CLNT1_0052_A01.b : nggcgttnnnnngcc
BFLT1_0118_C01.b : nnn
CLNT1_0020_G10.b : t
BFLT1_0140_E03.b : nnnn
LVR01_0103_B01.b : ttttttttaggcatagtgxxx
ITT01_0087_F02.b :
SPL01_0025_B12.b : gctttatxxxxxxxxx
THY01_0105_C08.b :
OVRT1_0079_E08.b : nntt
OVR01_0004_D06.b : gagaacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_H06.b : gac
CLNT1_0143_C12.b : nn
MLN01_0098_F11.b : ntttggatagga
BFLT1_0028_F08.b : ggac
UTR01_0044_C02.b : tttttgctgxxxxxxx
BFLT1_0097_E01.b : tt
CLNT1_0134_G12.b : nttt
PBL01_0048_E11.b :
ITT01_0042_E02.b :
ADR01_0014_E06.b :
ITT01_0096_A04.b :
ITT01_0043_B11.b :
ITT01_0074_H05.b :
ITT01_0074_H07.b :
PBL01_0055_E12.b :
MLN01_0103_B07.b : tttagctgg
ADR01_0065_H02.b :
ITT01_0027_A10.b :
ITT01_0053_H08.b :
ITT01_0102_E05.b :
ADR01_0009_A08.b :
PBL01_0007_E07.b :
ITT01_0016_C07.b :
ITT01_0048_F10.b :
ITT01_0008_B05.b :
OVRM1_0121_E11.b :
BFLT1_0022_G03.b : ga
CLNT1_0132_G02.b : nnnn
BFLT1_0091_G01.b : gat
MLN01_0052_A06.b : aatttagcttgga
BFLT1_0034_G10.b : ggat
BFLT1_0035_H09.b : gaac
MLN01_0088_C01.b : nnngggctgtgct
BFLT1_0013_H10.b : gaata
MLN01_0087_C07.b : ggttg
OVRT1_0027_H08.b : nnntt
OVRT1_0076_G10.b : nggac
UTR01_0023_E05.b : ggttgcactat
MLN01_0086_H02.b : nnttgctag
MLN01_0010_G06.b : nntttgtg
SPL01_0084_B09.b : nnggctagga
MLN01_0021_G11.b : nnnggtag
MLN01_0061_D04.b : nggtagtg
SPL01_0020_F07.b : xxxxxxxxxxxx
SPL01_0057_F01.b : nnttgcttgtg
SPL01_0074_B09.b : nnnggctagga
SPL01_0078_F05.b : nnnggcttgga
SPL01_0079_G10.b : nnnggctagga
LNG01_0076_E12.b : nnntttgatg
OVR01_0059_B08.b : tggctaggac
SPL01_0001_F06.b : ctttaagatgxxxxx
MLN01_0068_B05.b : ttagggtgctag
MLN01_0102_A03.b : nnnnaagtagga
OVR01_0064_E04.b : nnnnggcttgga
SPL01_0021_A06.b : xxxxxxxxxxxx
SPL01_0091_C10.b : nnttgcttggac
MLN01_0020_A01.b : nntttccgtgg
SPL01_0099_D09.b : nnnggcttgga
MLN01_0027_C12.b : nnnngggttgtga
MLN01_0068_H09.b : ntcggttgttggc
SPL01_0019_B01.b : gxxxxxxxxxxx
MLN01_0035_B11.b : nnnggctagga
SPL01_0019_H05.b : ggttggcactatta
SPL01_0048_A02.b : nnnnnggctagtg
MLN01_0040_C07.b : nnnttgctagga
MLN01_0031_A01.b : nntttggtagg
MLN01_0035_B12.b : nnnnggctagg
UTR01_0068_B07.b : catttttggttgxxxxx
OVRT1_0049_H03.b : ngggcttnnnnnnnn
UTR01_0031_E07.b : ttgggggacxxxxx
SPL01_0012_H05.b : cxxxxxxxxxxxxxxxx
SPL01_0016_D10.b : ctxxxxxxxxxxxxxx
SPL01_0023_E05.b : tttttgggggxxxxx
MLN01_0023_D12.b : nnnngggctggacttga
OVR01_0047_B03.b : gggctcxxxxxxxxxxx
TCH01_0047_A11.b : nggggggcttgga
MLN01_0042_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_B05.b : agggcxxxxxxxxxxxxxxx
THY01_0027_G02.b : ttxxxxxxxxxxxxx
OVR01_0044_D01.b : ggacattaagcxxxxxxxx
OVR01_0001_F03.b : gaaaaattgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_H07.b : nnggtggtaggac
THY01_0068_F01.b : ccatatggtggacxxxx
THY01_0009_A04.b : atttgggtgxxxxx
THY01_0049_H06.b : tttaggatgxxxxxx
UTR01_0046_G10.b : ggggaaactatt
THY01_0026_C04.b : gggggtacxxxx
THY01_0054_C01.b : ttxxxxxxxxxxxxx
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b :
HTMT1_0006_A03.b :
OVRM1_0137_E09.b :
CLNT1_0017_H05.b :
CLNT1_0142_A09.b : nn
THY01_0082_B08.b : gcxxxxxxxxxxxxxxxxxxx
SKNB1_0047_H09.b :
SKNB1_0071_G04.b :
PCT01_0001_A11.b :
PCT01_0010_E03.b :
PCT01_0011_B09.b :
PCT01_0021_D05.b :
PCT01_0011_A03.b :
PCT01_0017_F03.b :
PCT01_0019_H01.b :
PCT01_0017_C05.b :
PCT01_0003_D11.b :
PCT01_0033_A04.b :
PCT01_0016_E02.b :
PCT01_0031_H12.b :
PCT01_0033_H12.b :
PCT01_0004_D06.b :
PCT01_0035_G02.b :
PCT01_0002_G06.b :
PCT01_0032_E04.b :
PCT01_0024_H05.b :
KDN01_0019_C03.b :
PST01_0083_B07.b :
CLNT1_0083_H08.b : ntt
PCT01_0024_G08.b :
CLNT1_0005_G01.b : gg
PST01_0073_D02.b :
ITT01_0100_E01.b :
OVRT1_0020_H10.b : nnnt
OVR01_0009_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0114_B03.b :
OVRT1_0119_D04.b :
OVRT1_0093_D01.b :
BFLT1_0088_C09.b :
OVRT1_0021_G09.b :
OVRT1_0015_F05.b :
MLN01_0097_F06.b : ngg
TCH01_0037_A04.b : nnnng
SKNB1_0069_E09.b :
PCT01_0017_B09.b :
PCT01_0007_F11.b :
PCT01_0033_C05.b :
PCT01_0033_G02.b :
CLNT1_0080_A10.b : nnnaaatt
PCT01_0034_G07.b :
SKNB1_0049_G07.b :
SMG01_0079_C01.b :
ITT01_0041_E06.b :
SPL01_0076_D04.b :
OVR01_0051_B08.b :
PTG01_0105_B07.b :
MLN01_0096_F11.b :
PCT01_0009_D07.b :
PTG01_0065_F04.b :
TES01_0082_G05.b :
MLN01_0045_B08.b :
MLN01_0097_F05.b :
SMG01_0051_D02.b : gggggnnnnnnntaacaaaanngnnngaanncnncagttaatnnngcatt
CLNT1_0100_F05.b :
BFLT1_0007_C04.b :
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : CAGGGTCGGGCCTGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGGGTGCTGTAG
---------+---------+---------+---------+---------+---------+ 116
CLNT1_0118_A01.b : cagggtcgggcctggttagtacttggatgggagaccgcctgggaataccgggtgctgtag
SMG01_0004_A08.b : cttttnnnnnggacgatacagcggntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_F09.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0009_F09.b : ttttttagacggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0081_G03.b : nnnnttgcgagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0077_A12.b : nnnncgacggtacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0043_H02.b : nnnngggcggtacgcggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0009_F01.b : nnnaaagctggttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_F08.b : nnnnccaagggacgaggccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0102_E03.b : ctgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0072_C08.b : nnngggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0066_F10.b : ttttaggagagtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0029_G01.b : ttttccgcaggaagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0043_C10.b : nnnggggacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0085_B06.b : nnnggagcgagtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0094_B03.b : nnaggcaggttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A09.b : ttttacgaggtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_D12.b : nttccgatgtgacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0063_A12.b : nnnaacgagagtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0066_A04.b : tacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_C02.b : cagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0004_D10.b : nnnnaagcaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0053_H09.b : nnnncgacggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0085_B05.b : ttttacgacggagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0095_F04.b : ctgcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0093_C01.b : nnnaagcaggtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0094_C01.b : nnnnacgaggtgagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0093_D12.b : ntttagcagagtagaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0003_C01.b : gttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0011_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgt
SKNB1_0091_D02.b : nttcgcgtt
SKNB1_0028_G07.b : nnnnggtggctgtggc
PST01_0036_B08.b : tggcgtt
PST01_0065_E03.b : gcgtt
PST01_0023_G02.b : tccgctgtt
LVRM1_0081_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0099_G02.b : nnnggctggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0082_H10.b : nngggcgcgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A02.b : nnnncgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0078_H11.b : nnnnnggctggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0061_G05.b : nnnnaagagagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_H02.b : nttttggataaagcagcggnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0041_E09.b : nnnaaagacggtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0036_E09.b : nnnccgccggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0033_D08.b : nnaaagctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0003_E03.b : ttttaacgcaggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0009_G05.b : nnttaccaggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0086_A05.b : nnngaagcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0086_F08.b : tcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0062_E02.b : tctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_B11.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_E06.b : tttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0096_B08.b : nnnncctgctgt
MLN01_0087_A01.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_G04.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_C09.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0089_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0076_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0053_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0058_B09.b : nnccgcgaggagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_E06.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0034_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_F04.b : ttgnnnncctgcggtgt
OVRT1_0057_H05.b : gatacgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0125_D10.b : gttgtcaaaacagcggtxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0030_A08.b : nnnggagcagtagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0021_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C11.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_H07.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_D01.b : acttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0072_E04.b : ttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0035_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_D05.b : tcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccctt
THY01_0065_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0053_E08.b : nnnncccacgt
SKNB1_0091_E01.b : ntttgcgt
SKNB1_0069_G02.b : nnnttttcgcg
SKNB1_0042_F07.b : nnnnntcagcgg
SKNB1_0064_B10.b : nnnnnctcgctg
SKNB1_0061_B03.b : nnnncctcgcgt
SKNB1_0056_B07.b : nttttnctcgctg
SKNB1_0039_A04.b : nnnnnctcgcggtgg
SKNB1_0037_H12.b : nnaaatacttgcgt
SKNB1_0015_D06.b : nnnaattcgctg
SKNB1_0056_F07.b : nngggatttnnnnnnaacgcgt
PST01_0039_B04.b : gcgt
PST01_0027_B03.b : nnnaatggctg
PST01_0040_A05.b : tggcgtt
PST01_0058_B12.b : nntttactgcgg
PST01_0044_F03.b : nnnttcgctg
PST01_0047_D01.b : ttaactgctg
PST01_0012_D06.b : nnnaatcgctg
PST01_0016_B09.b : ttttccggctg
KDN01_0067_C09.b : nnnnncctgcgt
PST01_0060_D08.b : ttttggctgcgg
PST01_0011_F05.b : nnnttcgctg
PST01_0044_G07.b : nnccagcgt
PST01_0019_F03.b : ttgtcgcgt
PST01_0063_E01.b : ttttcgctg
KDN01_0007_B09.b : tttttcctgctg
PST01_0005_B08.b : nnncctgcgg
PST01_0067_D02.b : nnnttcgctg
PST01_0009_G08.b : nttctgctg
PST01_0003_A11.b : tttttactgcag
PST01_0072_G02.b : nnnncctgcgg
PST01_0051_D09.b : nnnttcgctg
PST01_0063_B11.b : gcgg
PCT01_0016_D01.b : nnnngggaaannnntnnttactgcag
PST01_0062_B07.b : tcacgt
PST01_0031_D04.b : cgcgttgg
ILNT1_0090_G07.b : nnnaatgcaggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0090_F03.b : nnnccggcgg
TES01_0106_H06.b : nttagcgttgg
PST01_0078_B11.b : nnncctgcgg
PST01_0095_E02.b : nnnncctgctg
PST01_0086_H10.b : nnncctacgg
BFLT1_0092_E12.b : tggttcagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0098_H05.b : ggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0091_F10.b : ttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_B04.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtttgg
SKNB1_0046_E03.b : ncctaacgttgg
SKNB1_0056_B09.b : nnnnncctcgctg
PST01_0039_A10.b : gt
PST01_0055_C05.b : ntcgctgtt
HTMT1_0003_B12.b : nccgatatcttaggatta
PCT01_0024_C03.b : nnngggaatattntnnnnccttacg
PCT01_0024_B09.b : nngggaacttttnnnnnnnacatgcgttg
CBLT1_0097_D05.b : nnccgtgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0031_B11.b : nnnccgcaggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0076_E08.b : nnncgacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0034_F04.b : tttttacgagggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_G12.b : nnnttcgagggacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_B10.b : nnnttcgaaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0050_A10.b : nnnnccgagattagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A03.b : nnnncgatggtacgacgccgntaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0067_A12.b : nnnnncgcgagtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0046_F08.b : nnnnaatgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0022_B03.b : nnnnccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_F08.b : tttttnggcaggagcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0021_C07.b : nnnccgaaggtagaggccgtagtattxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_F03.b : nnnggagcaggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0085_G07.b : nnnnggcggttagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0034_H07.b : nnnnccgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0097_B02.b : ttggccgcaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0025_F01.b : tttttggcaggtagacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0043_F01.b : nnnnaaagacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0012_H01.b : nnnnggcgagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0074_A06.b : tttggaggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0012_E11.b : tttttacgaggtacgacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_B03.b : ttttggagagtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0039_E11.b : nnnnntgctggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0117_D05.b : nnntatgatggtacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0024_D02.b : nnaaaggacaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0007_F05.b : ntttggcgagtagacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0010_A01.b : nnttgcgcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0025_E07.b : nnnggtgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0027_D09.b : nnnaacgaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0099_B03.b : nnnggggcaggaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_B12.b : ttttagtaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0103_G04.b : ntttttgctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0084_A06.b : nnttttggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0150_E12.b : ttttttagacggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0048_A05.b : ntttgacgacggtacgacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_C01.b : gggtttnnntnnggtcggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_G10.b : tcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_B07.b : agtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0071_B12.b : nttttggctagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0001_G02.b : ttttcgagagtacgcggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0038_E01.b : acgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0076_G10.b : nnnncgcgagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0074_B01.b : nnnnccgcgagtagcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0074_G08.b : atcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0061_F07.b : acgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0073_B07.b : ttttggacggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_G04.b : ncggcgt
BFLT1_0071_D11.b : cgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_B06.b : ctatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0033_G05.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_B10.b : tatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0098_A09.b : tatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
OVR01_0043_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtta
THY01_0009_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_E04.b : nttttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0090_D07.b : nnnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0014_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0056_C06.b : nnnnttcgctgtg
KDN01_0073_H05.b : nnncctgcggt
BFLT1_0082_C10.b : cgttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0076_E06.b : tacgttcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0011_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0099_G01.b : tccgttcagcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0149_B05.b : nncctctgcgcacgnaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_B07.b : ncccgtcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_G08.b : acttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0020_B01.b : gattccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0028_F12.b : cgcaggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_E01.b : nntttgagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0014_H02.b : nnnttgctgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0099_H04.b : ntttttgataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0017_H02.b : tacgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_A04.b : tcgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0073_A05.b : tccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_A09.b : cccattcggctgcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0101_G03.b : acttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_E11.b : ggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0100_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0097_B03.b : nnnccctgg
PST01_0026_H09.b : nnncctgcgg
LVRM1_0094_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_H09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0001_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_G07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_E03.b : nnnggactaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_C06.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_G07.b : cagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_B05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E03.b : nnnaaagttagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_F12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0105_D06.b : nggctcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0105_A12.b : tcgttcggcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_D10.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_E12.b : ttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_G09.b : ttcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_B09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0018_E08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0079_B05.b : tttggctatagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0079_D05.b : nttnggctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_H07.b : ccgtacagcgntngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0084_G02.b : tacgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0043_H08.b : tttttttgatcaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0104_G02.b : nagtataggcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0109_E08.b : cccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0006_C05.b : aaaattnggagctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_H08.b : nnntttgataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_G11.b : ngcgttatnntnntgctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_C11.b : naagtcagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_A12.b : tacgacagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0055_D09.b : nccgttagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_B01.b : acgttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_F02.b : ccgttctgcgnacngatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_E10.b : ggtcccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_E11.b : ctacgttgcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0072_E04.b : aacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0026_A03.b : gacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_B04.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_A05.b : nccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_G04.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_G03.b : tcgttcgctgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_C09.b : nccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_C12.b : ccgttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_C02.b : tccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0076_G04.b : agtttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_H09.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0075_G03.b : tccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_G05.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0091_C09.b : nnnnnnggactgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_C01.b : ccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0029_G01.b : tccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0052_A01.b : cacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_C01.b : ncccgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0020_G10.b : tcttctgctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0140_E03.b : ccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_F02.b : nttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0025_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0105_C08.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_E08.b : cgcatactgctgcagagtgcgcgacagctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_H06.b : ttgttctgcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0143_C12.b : ccccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_F11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0028_F08.b : ttcgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0097_E01.b : acgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_G12.b : ccgttcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0048_E11.b : nggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0042_E02.b : nnggatatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0014_E06.b : nnttgctaaacggctggtxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_A04.b : nngatgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0043_B11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0074_H05.b : ntttgtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0074_H07.b : ntttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0055_E12.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0103_B07.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0065_H02.b : nnnnnccgatgaacggcggtacgcgtcccgattctccgcactgttgg
ITT01_0027_A10.b : nnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_H08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_E05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0009_A08.b : nnnnggtgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0007_E07.b : aaacttccggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0016_C07.b : nnngggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_F10.b : nnnnggtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_B05.b : nnnggataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0022_G03.b : ctacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0132_G02.b : ccgttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0091_G01.b : tggttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0052_A06.b : atataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0034_G10.b : tacgttagcgnacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0035_H09.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0088_C01.b : atnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0013_H10.b : cgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_C07.b : gctatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_H08.b : tcgtttgctntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G10.b : tcctattgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_E05.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0086_H02.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_G06.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0084_B09.b : ctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0021_G11.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_D04.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_F01.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_B09.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_F05.b : ctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_G10.b : cttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_E12.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_B08.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_B05.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_A03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_E04.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0021_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0091_C10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_A01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0099_D09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_C12.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0068_H09.b : acttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_H05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_A02.b : acttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_C07.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0031_A01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_B12.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0068_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_H03.b : nccgttcgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0031_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0012_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0016_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0023_D12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0047_A11.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0102_H07.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0009_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0049_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_G10.b : agxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0026_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0054_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0133_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0006_A03.b : nnnnngcatacttgggatttaat
OVRM1_0137_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0017_H05.b : ncttctgctgtcngagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0142_A09.b : nccgttcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0082_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0047_H09.b : nnttaatgg
SKNB1_0071_G04.b : nnnncccttnnnnnnnnccacgc
PCT01_0001_A11.b : ntttttaactgcg
PCT01_0010_E03.b : nnnnnnaactgag
PCT01_0011_B09.b : nnnnnncctgcg
PCT01_0021_D05.b : aattttccttacgg
PCT01_0011_A03.b : nnnnggactgcgt
PCT01_0017_F03.b : ataatnnccctacg
PCT01_0019_H01.b : nnnnaaaatannnnnnnncctgcg
PCT01_0017_C05.b : ggactttnnnnnnncctgac
PCT01_0003_D11.b : ngggcttannnnnnncctgcgt
PCT01_0033_A04.b : nggggccacnnnnnncctacg
PCT01_0016_E02.b : nnnttggatannnnnnnaactgcgt
PCT01_0031_H12.b : nnnngggatannnnnntnaccagag
PCT01_0033_H12.b : nnnccgcatnnnttnntactgcgtt
PCT01_0004_D06.b : nnnccggaatnnnnnnngctgcg
PCT01_0035_G02.b : nnnggggatttnnnnnnnncctgacgg
PCT01_0002_G06.b : nnnggggcaatnnnnnnncctgcg
PCT01_0032_E04.b : nnnnaggccatnnnnnnnnccgcgacg
PCT01_0024_H05.b : nnngggccannnnnnnncactgacg
KDN01_0019_C03.b : nnnngggacttacgg
PST01_0083_B07.b : nncctgcg
CLNT1_0083_H08.b : ttccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0024_G08.b : nnngggactatnnnnnnnaact
CLNT1_0005_G01.b : atccgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0073_D02.b : ncctacg
ITT01_0100_E01.b : nggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_H10.b : ttcgttatgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_B03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_D04.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_D01.b : nntttcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0088_C09.b : gacacgtatagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_G09.b : nggatccgttctgcgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0015_F05.b : nnnccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_F06.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_A04.b : gctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0069_E09.b : nnnnngggattttnnnnnnnc
PCT01_0017_B09.b : nnnntttacctacgt
PCT01_0007_F11.b : ngggcattnnnnnnncctacgt
PCT01_0033_C05.b : nngggctttanannnncctgcgt
PCT01_0033_G02.b : nnggggggataanatnnnaactgacg
CLNT1_0080_A10.b : cccnggtttccgtcgcgtcgaggttcttcgctctxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0034_G07.b : nnngggggctttnnannnnnactgac
SKNB1_0049_G07.b : nnnn
SMG01_0079_C01.b : nntttgcgtaagcagcggtxxxxxxxxxx
ITT01_0041_E06.b : nnggatgaacaxxxxxxxxxxxxx
SPL01_0076_D04.b : nnggctaggactatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_B08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0105_B07.b : nggcgtttnnnnnnngggtcaagcagcggna
MLN01_0096_F11.b : ngctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0009_D07.b :
PTG01_0065_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0082_G05.b :
MLN01_0045_B08.b : nnnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_F05.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0051_D02.b : tacnnntgggactcatacagncgtgntacggntccgaanttcntcnagcactgntgtgcc
CLNT1_0100_F05.b : nggatacgtttgctgtcgxxxx
BFLT1_0007_C04.b : nnnccgtcagc
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : GCTGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
---------+---------+---------+---------+---------+---------+ 172
CLNT1_0118_A01.b : gctttCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0004_A08.b : xxTACTGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PBL01_0077_F09.b : xcTACTGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0009_F09.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0081_G03.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0077_A12.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0043_H02.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0009_F01.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0021_F08.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0102_E03.b : xxxCCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0072_C08.b : xxgCCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0066_F10.b : xxxGCCCCACTCGGTTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0029_G01.b : xxxGCCCCACT*GGCTC*GTTTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0043_C10.b : xxgTCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0085_B06.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0094_B03.b : xxxGCCCCACTGGGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0046_A09.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0092_D12.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0063_A12.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0066_A04.b : xxgGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0031_C02.b : xxxTCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0004_D10.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0053_H09.b : xxxGCCCCACT*GCCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0085_B05.b : xxgTCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0095_F04.b : xxxCCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0093_C01.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0094_C01.b : xxxGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0093_D12.b : xxxGCCCCACTGGCCCG*TTCTGAGAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0003_C01.b : ctgGCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0011_E02.b : xxxTCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0037_H06.b : ttaACTGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATTCGTTCCCG*TGCCCGGCTC
SKNB1_0091_D02.b : ggctCTGGACT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0028_G07.b : tatgGCCCCCT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0036_B08.b : ggctCTGGACT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0065_E03.b : ggctCTGGACT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0023_G02.b : ggctCTGGACT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LVRM1_0081_B08.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0099_G02.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0082_H10.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0067_A02.b : xxxxGCCCACTGGCTGT*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0078_H11.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0061_G05.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0071_H02.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0041_E09.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0036_E09.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0033_D08.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0003_E03.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0009_G05.b : xxxxGCCCACT*GGCCG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0086_A05.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0086_F08.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0062_E02.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LVRM1_0199_B11.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0002_E06.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
KDN01_0096_B08.b : ggctCTGGCCT*GGCTG*GTCTGAAAG**CATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0087_A01.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0102_G04.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0083_C09.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0089_H08.b : ggggTGGCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
DCI01_0076_G08.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
DCI01_0053_D09.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
AMP01_0076_G04.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0058_B09.b : xxxxGCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0038_E06.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCACT*GTTCCCG*TGCCCGGCTC
THY01_0034_B05.b : xxxxCCCCACT*GGCTG*GTCTGAAAAGCCATCTTCGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0001_F04.b : gcaggCCCCCT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0057_H05.b : xxxxxTGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0125_D10.b : xxxxxTGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0030_A08.b : xxxxtGGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BKFL1_0021_A10.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0040_C11.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0077_H07.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0107_D01.b : xxctgGGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0072_E04.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0003_A08.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0019_A05.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0052_B12.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0035_D03.b : cctatGGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0035_D05.b : taatgGGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0065_A03.b : xxxxxCCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0053_E08.b : tggctaTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0091_E01.b : tggctcTGGAT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0069_G02.b : tggctaTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0042_F07.b : tggctaTGGAT*GGCTG*GTCTGAA**GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0064_B10.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0061_B03.b : tggctcTGGAT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0056_B07.b : tggctcTGGAT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0039_A04.b : ctatggCCACT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTT
SKNB1_0037_H12.b : tggctcTGGAC*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0015_D06.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0056_F07.b : tggctaTGGAT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0039_B04.b : tggctcTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0027_B03.b : tggctaTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTCCCCG*TGCCCGGCTC
PST01_0040_A05.b : ggctttGGTCT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0058_B12.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0044_F03.b : tggctcTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0047_D01.b : tggctcTGGAT*GGCTG*GTCTGAAAG**CATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0012_D06.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0016_B09.b : tggctcTGGAT*GGCTG*GTCTGAA**GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
KDN01_0067_C09.b : tggctcTGGAT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0060_D08.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0011_F05.b : tggctcTGGAC*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0044_G07.b : tggctcTGGAT*GGCTG*GTCTGAAAG**CATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0019_F03.b : tggctcTGGAT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0063_E01.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
KDN01_0007_B09.b : tggctcTGGAT*GGCTG*GTCTGAAA**GCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0005_B08.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0067_D02.b : tggctcTGGAT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0009_G08.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0003_A11.b : gtgctcTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0072_G02.b : tggctcTGGAC*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0051_D09.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0063_B11.b : tggctcTGGAT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0016_D01.b : tgtgccTGGAC*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0062_B07.b : tggctcTGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0031_D04.b : ctctggCCACT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0090_G07.b : xxxxxgCCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0090_F03.b : tggctcTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
TES01_0106_H06.b : ctctgtCCCCT*GGCTG*GTCTGANA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0078_B11.b : tggctcTGGAC*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0095_E02.b : tggctcTGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0086_H10.b : tggctcTGGAT*GGCTG*GTCTGAAAG**CATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0092_E12.b : xxxxxxGGTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCGGGCTC
UTR01_0098_H05.b : xxxxxxGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0091_F10.b : xxxxxgGGTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0068_B04.b : cctactGGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0046_E03.b : ntatggnCCCT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0056_B09.b : tggctagGTCT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0039_A10.b : tggctctGGAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0055_C05.b : ggctctgGTCT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0003_B12.b : atgnattGACT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCTGGCTC
PCT01_0024_C03.b : ttgtgccGGAC*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0024_B09.b : gcnacgtGACT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0097_D05.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0031_B11.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0076_E08.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0034_F04.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0021_G12.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0023_B10.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0050_A10.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0067_A03.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0067_A12.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0046_F08.b : xxxxxxxGACT*GGCTG*CTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0022_B03.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0002_F08.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0021_C07.b : xxxxxxxGACT*GGCTG*GTCCGAATAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0017_F03.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0085_G07.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0034_H07.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0097_B02.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0025_F01.b : xxxxxxxGACT*GGCTG*GTCTGAAATGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0043_F01.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0012_H01.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0074_A06.b : xxxxxxxGACT*GGCTGTGTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0012_E11.b : xxxxxxxGACT*GGCTG*CTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0084_B03.b : xxxxxxxGACT*GGCCG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0039_E11.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0117_D05.b : xxxxxxxGACT*GGCTG*CTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0024_D02.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0007_F05.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0010_A01.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0025_E07.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0027_D09.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ILNT1_0099_B03.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0076_B12.b : xxxxxxxGACT*GGCTC*CTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0103_G04.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0084_A06.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0150_E12.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0048_A05.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0061_C01.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0048_G10.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0010_B07.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0071_B12.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0001_G02.b : xxxxxxxGACT*GGCCG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0038_E01.b : xxcccttGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0076_G10.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPLT1_0074_B01.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0074_G08.b : xxxccttGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0061_F07.b : xxxxxxtGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CBLT1_0073_B07.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
TES01_0003_G04.b : tggctctGGAT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0071_D11.b : xxxcgttCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0104_B06.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0033_G05.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0071_B10.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
TCH01_0098_A09.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0071_A04.b : atcgaggCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0043_H12.b : taaatggCACT*GGNTG*GTNTGAAAAGNCATCTTTGCCCT**TTTAAG*TGCCCGGCTC
THY01_0009_H11.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0090_E04.b : xxxxxxxGACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0090_D07.b : xxxxxxxCACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0014_H12.b : xxxxxxxxTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0056_C06.b : gctatggtACT*GGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
KDN01_0073_H05.b : ggctctggTCT*GGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0082_C10.b : xxxxcgttACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0076_E06.b : xxxxcttgTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0011_F06.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0099_G01.b : xxxxxxxtACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0149_B05.b : xxxxxxxxTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0117_B07.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0009_G08.b : xxxxxxxxTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0020_B01.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0028_F12.b : xxxxcattTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
AMP01_0020_C03.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0191_E12.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0001_E01.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0014_H02.b : xxxxxxxxTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0099_H04.b : xxxxxxxaACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0017_H02.b : xxxxcgttACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0118_A04.b : xxxxcgctACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0073_A05.b : xxxxxxxtACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0019_A09.b : xxxxxcgtACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCGCTGCCCGGCTC
UTR01_0101_G03.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0068_E11.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0001_F09.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0026_F11.b : xxxxxxxxACT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0069_H01.b : xxxxxxxxTCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0100_D08.b : xxxxxxxxxCT*GGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0097_B03.b : cgttggctcCT*GGCTG*GCCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0026_H09.b : tggctctanAT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LVRM1_0094_D09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0052_H09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0114_H12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0001_B09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0118_E09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0151_G07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0078_E03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LVRM1_0148_C06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0108_G07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0113_B05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0061_E03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0131_F12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0105_D06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0105_A12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0087_D10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0087_E12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0088_G09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0053_B09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0018_E08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0079_B05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0079_D05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0140_H07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0084_G02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0043_H08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0104_G02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0109_E08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0006_C05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0044_H08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0053_G11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0112_C11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0108_A12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0055_D09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0088_B01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0032_F02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0021_E10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0138_E11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0072_E04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BMWN1_0026_A03.b : xxxxcatgtCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0032_B04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0105_A05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0110_G04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0094_G03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0112_C09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0040_C12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0093_C02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0076_G04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0072_H09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0075_G03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0110_G05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0091_C09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0049_C01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0029_G01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0052_A01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0118_C01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0020_G10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCGTCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0140_E03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LVR01_0103_B01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0087_F02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0025_B12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0105_C08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0079_E08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0004_D06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0064_H06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0143_C12.b : xxxxxxxxxCT*GGCTG*GTCTGAGAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0098_F11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0028_F08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0044_C02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0097_E01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0134_G12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PBL01_0048_E11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0042_E02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0014_E06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0096_A04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0043_B11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0074_H05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0074_H07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PBL01_0055_E12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0103_B07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0065_H02.b : cctactggaCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGGCCGGGTC
ITT01_0027_A10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0053_H08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0102_E05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ADR01_0009_A08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PBL01_0007_E07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0016_C07.b : xxxxxxxxxCT*GGCTG*GTCTCAT*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0048_F10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0008_B05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0121_E11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0022_G03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0132_G02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0091_G01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0052_A06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0034_G10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0035_H09.b : xxxxxcgtgCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGTCCGGCTC
MLN01_0088_C01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0013_H10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0087_C07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0027_H08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0076_G10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0023_E05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0086_H02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0010_G06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0084_B09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0021_G11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0061_D04.b : xxxxxxxxgCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0020_F07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0057_F01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0074_B09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0078_F05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0079_G10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
LNG01_0076_E12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0059_B08.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0001_F06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0068_B05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0102_A03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0064_E04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0021_A06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0091_C10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0020_A01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0099_D09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0027_C12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0068_H09.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0019_B01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0035_B11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0019_H05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0048_A02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0040_C07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0031_A01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0035_B12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0068_B07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0049_H03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0031_E07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0012_H05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0016_D10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0023_E05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0023_D12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0047_B03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
TCH01_0047_A11.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0042_C10.b : nnnnnnnnnCT*GGCTG*GTCTCGAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0039_B05.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0027_G02.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0044_D01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0001_F03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0102_H07.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0068_F01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0009_A04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0049_H06.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
UTR01_0046_G10.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0026_C04.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0054_C01.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0133_A12.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0133_B03.b : xxxxxxxxxCT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0044_A02.b : nxxxxxxxxxT*GGCTG*GTCTGAGAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
HTMT1_0006_A03.b : gattgcccccT*GGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0137_E09.b : xxxxxxxxxxT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0017_H05.b : xxcataggagT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0142_A09.b : xxxxxxcgatT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
THY01_0082_B08.b : xxxxxxxxctT*GGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0047_H09.b : cgtggctcggacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0071_G04.b : gttgtgctcgacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0001_A11.b : gtggctacggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0010_E03.b : gttggctggcacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0011_B09.b : ttggctacggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0021_D05.b : tgtgctctggacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0011_A03.b : tgtgctctggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0017_F03.b : atggctctggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0019_H01.b : ttggctctggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0017_C05.b : gtgtgcactggcGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*CGCCCGGCTC
PCT01_0003_D11.b : tgtgctctggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0033_A04.b : gtgtgcacggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0016_E02.b : ttggcactggtcGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0031_H12.b : gtggctctggtcGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0033_H12.b : gtgcaggcccacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0004_D06.b : gtgtgcctggacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0035_G02.b : tgtgctcgtgacGGCTG*GTCTG*AAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0002_G06.b : gtggctctggacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0032_E04.b : tgtgctcgtgacGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0024_H05.b : ttgtgcacgggnGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
KDN01_0019_C03.b : tggccactggacGGCTG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0083_B07.b : gtggctctggtcGGCTG*GTCTGAAA*GCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0083_H08.b : xxxctcttcctaGGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCC*CTTCAGGGTC
PCT01_0024_G08.b : gcgttggcacggGGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0005_G01.b : xxxxxxxxxxccGGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PST01_0073_D02.b : ttggctacggacGGCTG*GTCTGA*AAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0100_E01.b : xxxxxxxxxxxgGGCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0020_H10.b : ttctatggagggGGCTG*GTCTGAAAAGCCATCTTTGCATT*GTCCCCT*TGCCCGGCTC
OVR01_0009_E03.b : xxxxxxxxxxccGGCCG*GTCTGAAAAGCCATCTTCGCATT*GTTCCCG*TGCCCGGCTC
OVRM1_0114_B03.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0119_D04.b : xxxxxxxxxxccgtCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0093_D01.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
BFLT1_0088_C09.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0021_G09.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVRT1_0015_F05.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0097_F06.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
TCH01_0037_A04.b : xxxxxxxxxxxxxxCTG*GTCTGAAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0069_E09.b : cagcgtgtgctcggctG*GTCTGAAA**CCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0017_B09.b : tggccactggactggcG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0007_F11.b : ttggcactggactggcG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0033_C05.b : tgtgctctggactggcG*GTCTGAA*AGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0033_G02.b : gtgncacgtgactggcG*GTCTG*GAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
CLNT1_0080_A10.b : xxxxxctcttacacagG*GTCTGAAAAGNNATNTTTGGATT*GTTNNNG*TGCCCTGAAA
PCT01_0034_G07.b : ggtgtgctcgtgactggcGGTCTGAAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SKNB1_0049_G07.b : nccagctgtggctactggctggCTGAAACCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
SMG01_0079_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxAAGCCATCTTTGCATT*GTTCCCG*TGCCCGGCTC
ITT01_0041_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
SPL01_0076_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
OVR01_0051_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTGCATT*GTTCCCG*TGCCCGGCTC
PTG01_0105_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATT*GTTCCCG*TGCCCGGCTC
MLN01_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATT*GTTCCCG*TGCCCGGCTC
PCT01_0009_D07.b : nnnnncctgcggtggctctggagcatctttgcTT*GTTCCCG*TGCCCGGCTC
PTG01_0065_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxTT*GTTCCCG*TGCCCGGCTC
TES01_0082_G05.b : gcTT*GTTCCCG*TGCCCGGCTC
MLN01_0045_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTT*GTTCCCG*TGCCCGGCTC
MLN01_0097_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GTTCCCG*TGCCCGGCTC
SMG01_0051_D02.b : tacnggnactggnctggntctnaaaagccatcntttgcattgnTTCCCG*TGCCCGGCTC
CLNT1_0100_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGCCCGGCTC
BFLT1_0007_C04.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
ILNT1_0081_C11.b :
ILNT1_0098_D02.b :
ILNT1_0076_H09.b :
BKFL1_0041_C06.b :
OVRT1_0034_F08.b :
BKFL1_0074_F02.b :
BMWN1_0027_H05.b :
ILNT1_0040_G10.b :
UTR01_0099_F01.b :
ITT01_0094_B09.b :
ILNT1_0035_E12.b :
BMWN1_0025_D05.b :
ILNT1_0031_A03.b :
ILNT1_0065_A09.b :
ILNT1_0082_D05.b :
BFLT1_0040_B10.b :
ILNT1_0069_F12.b :
SPLT1_0059_E05.b :
20110601C-000400 : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
---------+---------+---------+---------+---------+---------+ 231
CLNT1_0118_A01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0004_A08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PBL01_0077_F09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0009_F09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0081_G03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0077_A12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0043_H02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0009_F01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0021_F08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0102_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0072_C08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0066_F10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0029_G01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0043_C10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0085_B06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0094_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0046_A09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0092_D12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0063_A12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0066_A04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0031_C02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0004_D10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0053_H09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0085_B05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0095_F04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0093_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0094_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0093_D12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0003_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0011_E02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0037_H06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0091_D02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0028_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0036_B08.b : TCCGTTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0065_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0023_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
LVRM1_0081_B08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0099_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0082_H10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0067_A02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0078_H11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0061_G05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0071_H02.b : TCCGCTCGCCGCAGCCGCCTCCCCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0041_E09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0036_E09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0033_D08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0003_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0009_G05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0086_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0086_F08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0062_E02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
LVRM1_0199_B11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0002_E06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
KDN01_0096_B08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0087_A01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0102_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0083_C09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0089_H08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
DCI01_0076_G08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
DCI01_0053_D09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
AMP01_0076_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0058_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0038_E06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0034_B05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PCT01_0001_F04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0057_H05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0125_D10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0030_A08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BKFL1_0021_A10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0040_C11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0077_H07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0107_D01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0072_E04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0003_A08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0019_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0052_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0035_D03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0035_D05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0065_A03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGATTCC*GGCAGC
SKNB1_0053_E08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0091_E01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0069_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0042_F07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0064_B10.b : TCTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0061_B03.b : CCTTATCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCTGCGGACTCC*GGCAGC
SKNB1_0056_B07.b : CCTACTAGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCTCGGACTCC*GGCAGC
SKNB1_0039_A04.b : TTCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0037_H12.b : TCTGTTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0015_D06.b : TCTTCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0056_F07.b : TCCGCTCGCCGCAGCCACCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0039_B04.b : CCTTTTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0027_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0040_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0058_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0044_F03.b : TCCGCTCTCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0047_D01.b : TTTGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0012_D06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0016_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
KDN01_0067_C09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0060_D08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0011_F05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0044_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0019_F03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0063_E01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
KDN01_0007_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0005_B08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0067_D02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0009_G08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0003_A11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0072_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0051_D09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0063_B11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PCT01_0016_D01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0062_B07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0031_D04.b : CCCTATAGGCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCTTGGACTCC*GGCAGC
ILNT1_0090_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0090_F03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
TES01_0106_H06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0078_B11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0095_E02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0086_H10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0092_E12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0098_H05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0091_F10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0068_B04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0046_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0056_B09.b : CCCGTACAGGGCAGCCGCCTCCGTCGCGCGCCTCTTCTGCCGCCTTGGACACC*GGCAGC
PST01_0039_A10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0055_C05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0003_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PCT01_0024_C03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PCT01_0024_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0097_D05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0031_B11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0076_E08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0034_F04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0021_G12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0023_B10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0050_A10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0067_A03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0067_A12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0046_F08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0022_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0002_F08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0021_C07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0017_F03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0085_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0034_H07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0097_B02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0025_F01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0043_F01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0012_H01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0074_A06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0012_E11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0084_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0039_E11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0117_D05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0024_D02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0007_F05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0010_A01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0025_E07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0027_D09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ILNT1_0099_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0076_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PTG01_0103_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0084_A06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCATCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0150_E12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
HTMT1_0048_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0061_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0048_G10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0010_B07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0071_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0001_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0038_E01.b : TCCGCTCGCCGCAGCCGCCCCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0076_G10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPLT1_0074_B01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0074_G08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0061_F07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CBLT1_0073_B07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
TES01_0003_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0071_D11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0104_B06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0033_G05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0071_B10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
TCH01_0098_A09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0071_A04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0043_H12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0009_H11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0090_E04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0090_D07.b : TCCGCTCGCCGCAGCCGCCTCCGCTGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0014_H12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCCTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0056_C06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
KDN01_0073_H05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTTTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0082_C10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0076_E06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0011_F06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0099_G01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0149_B05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0117_B07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0009_G08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0020_B01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0028_F12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
AMP01_0020_C03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0191_E12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0001_E01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ADR01_0014_H02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ADR01_0099_H04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0017_H02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0118_A04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0073_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0019_A09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0101_G03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0068_E11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0001_F09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0026_F11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0069_H01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0100_D08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SKNB1_0097_B03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PST01_0026_H09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
LVRM1_0094_D09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0052_H09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGTGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0114_H12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0001_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0118_E09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0151_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0078_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
LVRM1_0148_C06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0108_G07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0113_B05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0061_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRM1_0131_F12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0105_D06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0105_A12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0087_D10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0087_E12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0088_G09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0053_B09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0018_E08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGGCTCC*GGCAGC
SMG01_0079_B05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0079_D05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0140_H07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0084_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PTG01_0043_H08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0104_G02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0109_E08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0006_C05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PTG01_0044_H08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SMG01_0053_G11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0112_C11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0108_A12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0055_D09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0088_B01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0032_F02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0021_E10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0138_E11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0072_E04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BMWN1_0026_A03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0032_B04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0105_A05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0110_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0094_G03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0112_C09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0040_C12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0093_C02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0076_G04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0072_H09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0075_G03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0110_G05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ADR01_0091_C09.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0049_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0029_G01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0052_A01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0118_C01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0020_G10.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0140_E03.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
LVR01_0103_B01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0087_F02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
SPL01_0025_B12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
THY01_0105_C08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVRT1_0079_E08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
OVR01_0004_D06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0064_H06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*AGCAGC
CLNT1_0143_C12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0098_F11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0028_F08.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
UTR01_0044_C02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
BFLT1_0097_E01.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
CLNT1_0134_G12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PBL01_0048_E11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0042_E02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ADR01_0014_E06.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0096_A04.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0043_B11.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0074_H05.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ITT01_0074_H07.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
PBL01_0055_E12.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
MLN01_0103_B07.b : TCCGCTCGCCGCAACCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACTCC*GGCAGC
ADR01_0065_H02.b : TCCGCTCGCCGCAGCCGCCTCCGCCGCGCGCCTCTTCTGCCGCCGCGGACT