[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000430

Length: 1,398

Sequence [FASTA format sequence]
CCTGGGTTGG GGTATATAGG ATCTCTCGAC TCCGCTGCTG CTCTCAATAC TTCTCCCCCA
GACTCCTTGG TAGTCTGTCA GTGGGAGGTC TTCGTAGCAG TCCCTTCGCT TCCTCCAGCC
TCGCGGAACC CTACAGGTTT CAGTCATGCG TGAGTGCATC TCCATCCACG TTGGCCAAGC
TGGTGTCCAG ATCGGCAATG CCTGCTGGGA GCTCTACTGC CTGGAACACG GCATCCAGCC
CGATGGCCAG ATGCCGAGTG ACAAGACCAT TGGGGGAGGA GATGACTCCT TCAACACCTT
CTTCAGTGAG ACAGGCGCTG GCAAGCATGT GCCCAGGGCA GTGTTTGTAG ACCTGGAACC
CACAGTCATT GATGAAGTTC GCACTGGCAC CTACCGCCAG CTCTTCCACC CTGAGCAGCT
CATCACAGGC AAGGAAGATG CTGCCAATAA CTATGCCCGA GGTCACTACA CCATTGGCAA
GGAGATCATT GACCTCGTCT TGGACCGAAT TCGGAAACTG GCTGACCAGT GCACAGGTCT
TCAGGGCTTC TTGGTTTTCC ACAGCTTTGG CGGGGGAACG GGTTCTGGGT TCACCTCCCT
GCTGATGGAA CGTCTCTCTG TCGATTATGG CAAGAAGTCC AAGCTGGAGT TCTCCATTTA
CCCAGCCCCC CAGGTTTCCA CAGCTGTAGT TGAGCCCTAC AACTCCATCC TCACCACCCA
CACCACCCTG GAGCACTCTG ATTGTGCCTT CATGGTAGAC AATGAGGCCA TCTACGACAT
CTGTCGTAGA AACCTTGATA TTGAACGCCC AACCTACACT AATCTGAACC GCCTCATGAG
CCAAATTGTG TCCTCCATCA CTGCTTCCCT GAGGTTTGAT GGGGCCCTGA ATGTTGATCT
GACAGAATTC CAGACCAACC TGGTGCCCTA CCCCCGCATC CATTTCCCTC TGGCCACATA
CGCCCCCGTC ATCTCTGCTG AGAAAGCCTA CCATGAACAG CTTACTGTAG CAGAGATCAC
TAATGCTTGC TTTGAGCCAG CCAACCAGAT GGTGAAATGT GACCCTCGCC ATGGTAAATA
CATGGCCTGC TGCCTGTTGT ACCGTGGTGA CGTGGTTCCC AAAGACGTCA ATGCTGCCAT
TGCCACCATC AAGACCAAGC GCAGCATCCA GTTTGTGGAC TGGTGCCCCA CTGGCTTTCA
GGTTGGCATT AATTACCAGC CCCCCACTGT GGTCCCTGGT GGAGACCTGG GCAAAGTACA
GCGGGCAGTG TGCATGCTGA GCAACACCAC AGCCATCGCT GAAGCCTGGG CTCGCCTGGA
CCAAAAGTTT GACCTGATGT ATGCCAGCGT GCCTTTGTTC ACTGGTACGT GGGTGAGGGC
ATGGAAGAAG GAAAGTTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Homo sapiens]. 7830.0O
Contig/Assembly ProteinTUBA1Ctubulin alpha-1C chain [Homo sapiens]. 7830.0O
Contig/Assembly ProteinTUBA1Atubulin alpha-1A chain [Homo sapiens]. 7810.0O
Contig/Assembly ProteinTUBA3Ctubulin alpha-3C/D chain [Homo sapiens]. 7750.0O
Contig/Assembly ProteinTUBA3Dtubulin alpha-3C/D chain [Homo sapiens]. 7750.0O
Contig/Assembly ProteinTUBA4Atubulin alpha-4A chain [Homo sapiens]. 7670.0O
Contig/Assembly ProteinTUBA3Etubulin alpha-3E chain [Homo sapiens]. 7670.0O
Contig/Assembly ProteinTUBA8tubulin alpha-8 chain isoform 1 [Homo sapiens]. 7170.0O
Contig/Assembly ProteinTUBA8tubulin alpha-8 chain isoform 2 [Homo sapiens]. 6120.0O
Contig/Assembly ProteinTUBAL3tubulin alpha chain-like 3 isoform 1 [Homo sapiens]. 611e-178O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTuba1ctubulin alpha-1C chain [Mus musculus]. 7840.0O
Contig/Assembly ProteinTuba1btubulin alpha-1B chain [Mus musculus]. 7830.0O
Contig/Assembly ProteinTuba1atubulin alpha-1A chain [Mus musculus]. 7810.0O
Contig/Assembly ProteinTuba3atubulin alpha-3 chain [Mus musculus]. 7750.0O
Contig/Assembly ProteinTuba3btubulin alpha-3 chain [Mus musculus]. 7750.0O
Contig/Assembly ProteinTuba4atubulin alpha-4A chain [Mus musculus]. 7670.0O
Contig/Assembly ProteinGm5620PREDICTED: tubulin alpha-1B chain isoform 1 [Mus musculus]. 7590.0O
Contig/Assembly ProteinGm5620PREDICTED: tubulin alpha-1B chain isoform 4 [Mus musculus]. 7590.0O
Contig/Assembly ProteinTuba8tubulin alpha-8 chain [Mus musculus]. 7170.0O
Contig/Assembly ProteinTubal3tubulin alpha chain-like 3 [Mus musculus]. 610e-177O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608138PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) isoform 2 [Canis familiaris]. 7850.0O
Contig/Assembly ProteinLOC608864PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) [Canis familiaris]. 7810.0
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 13 [Canis familiaris]. 7810.0O
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 12 [Canis familiaris]. 7810.0O
Contig/Assembly ProteinLOC608147PREDICTED: similar to tubulin, alpha 1 isoform 1 [Canis familiaris]. 7810.0O
Contig/Assembly ProteinLOC610636PREDICTED: similar to Tubulin alpha-2 chain (Alpha-tubulin 2) [Canis familiaris]. 7780.0O
Contig/Assembly ProteinLOC608051PREDICTED: similar to Tubulin alpha-3 chain (Alpha-tubulin 3) isoform 1 [Canis familiaris]. 7750.0O
Contig/Assembly ProteinLOC477570PREDICTED: similar to Tubulin alpha-3 chain (Alpha-tubulin 3) [Canis familiaris]. 7750.0O
Contig/Assembly ProteinLOC478918PREDICTED: similar to Tubulin alpha-4 chain (Alpha-tubulin 4) (Alpha-tubulin isotype M-alpha-4) isoform 1 [Canis familiaris]. 7670.0O
Contig/Assembly ProteinLOC608138PREDICTED: similar to Tubulin alpha-6 chain (Alpha-tubulin 6) (Alpha-tubulin isotype M-alpha-6) isoform 9 [Canis familiaris]. 7630.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Bos taurus]. 7830.0O
Contig/Assembly ProteinTUBA1Ctubulin alpha-1C chain [Bos taurus]. 7810.0O
Contig/Assembly ProteinTUBA1Atubulin alpha-1B chain [Bos taurus]. 7810.0O
Contig/Assembly ProteinTUBA1Dtubulin alpha-1D chain [Bos taurus]. 7790.0O
Contig/Assembly ProteinLOC100141266PREDICTED: tubulin alpha-1C chain-like [Bos taurus]. 7780.0O
Contig/Assembly ProteinLOC787568PREDICTED: tubulin alpha-1C chain-like isoform 1 [Bos taurus]. 7780.0O
Contig/Assembly ProteinLOC787568PREDICTED: tubulin alpha-1C chain-like [Bos taurus]. 7760.0O
Contig/Assembly ProteinLOC100295712PREDICTED: GL12416-like [Bos taurus]. 7750.0O
Contig/Assembly ProteinLOC100295712PREDICTED: GL12416-like [Bos taurus]. 7750.0O
Contig/Assembly ProteinTUBA3Etubulin alpha-3 chain [Bos taurus]. 7730.0O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 1 [Sus scrofa]. 7860.0O
Contig/Assembly ProteinTUBA1Btubulin alpha-1B chain [Sus scrofa]. 7830.0O
Contig/Assembly ProteinTUBA3DPREDICTED: tubulin alpha-3 chain [Sus scrofa]. 7750.0O
Contig/Assembly ProteinLOC100510930PREDICTED: tubulin alpha-3 chain-like [Sus scrofa]. 7750.0O
Contig/Assembly ProteinTUBA1APREDICTED: tubulin alpha-1D chain [Sus scrofa]. 7750.0O
Contig/Assembly ProteinTUBA4APREDICTED: tubulin alpha-4A chain [Sus scrofa]. 7670.0O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 3 [Sus scrofa]. 7100.0O
Contig/Assembly ProteinLOC100127131PREDICTED: tubulin alpha-1C chain isoform 2 [Sus scrofa]. 7100.0O
Contig/Assembly ProteinLOC100518253PREDICTED: tubulin alpha-8 chain-like [Sus scrofa]. 629e-180
Contig/Assembly ProteinLOC100621514PREDICTED: tubulin alpha-8 chain-like [Sus scrofa]. 607e-179


Assembly Members: 264      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010008C05ADR01_0008_C05.bDB782216 
ADR010052D12ADR01_0052_D12.bDB786131 
ADR010055D02ADR01_0055_D02.bDB786389 
ADR010057C08ADR01_0057_C08.bDB786560 
ADR010096D11ADR01_0096_D11.bDB790033 
ADR010096H10ADR01_0096_H10.bDB790079 
BFLT10125D09BFLT1_0125_D09.bHX203798 
CLNT10021C09CLNT1_0021_C09.bFS658701 
CLNT10072C04CLNT1_0072_C04.bFS662741 
CLNT10082C07CLNT1_0082_C07.b  
CLNT10107D11CLNT1_0107_D11.bHX219697 
CLNT10110G04CLNT1_0110_G04.bHX219948 
CLNT10115F05CLNT1_0115_F05.bHX220327 
DCI010046F12DCI01_0046_F12.bDB794312 AK399556
ITT010028E04ITT01_0028_E04.bBW978537 
ITT010034G07ITT01_0034_G07.bBW979094 
ITT010047H12ITT01_0047_H12.bBW980198 
ITT010052D12ITT01_0052_D12.bBW980612 
ITT010053E04ITT01_0053_E04.bBW980708 
ITT010053F06ITT01_0053_F06.bBW980721 
ITT010070A11ITT01_0070_A11.bBW982204 
ITT010078C07ITT01_0078_C07.bBW982917 
ITT010087E12ITT01_0087_E12.bBW983736 
ITT010100F02ITT01_0100_F02.bBW984917 
KDN010038A04KDN01_0038_A04.b  
KDN010049B07KDN01_0049_B07.b  
LNG010080D10LNG01_0080_D10.bBP436721 
LNG010092H05LNG01_0092_H05.bBP440355 
LVR010060G01LVR01_0060_G01.bBP446355 
LVR010079A11LVR01_0079_A11.bBP441773 
LVRM10014G01LVRM1_0014_G01.bBP452981 
LVRM10034C06LVRM1_0034_C06.bCJ001319 
LVRM10035A11LVRM1_0035_A11.bCJ001386 
LVRM10049B08LVRM1_0049_B08.bBP449399 
LVRM10098A12LVRM1_0098_A12.bCJ003823 
LVRM10116G08LVRM1_0116_G08.bBP453482 
LVRM10126B10LVRM1_0126_B10.bBP449568 
LVRM10133B02LVRM1_0133_B02.bBP449033 
LVRM10146D06LVRM1_0146_D06.bBP450948 
LVRM10181D01LVRM1_0181_D01.bCJ005527 
LVRM10191G11LVRM1_0191_G11.bCJ006320 
MLN010087D07MLN01_0087_D07.bCJ014605 
OVR010015B12OVR01_0015_B12.bBP142095 
OVR010020C07OVR01_0020_C07.bBP142372 
OVR010020H10OVR01_0020_H10.bBP144748 
OVR010035G03OVR01_0035_G03.bBP144045 
OVR010042E12OVR01_0042_E12.bBP143467 
OVR010046D09OVR01_0046_D09.bBP142916 
OVR010070D03OVR01_0070_D03.bBW965848 
OVR010071D03OVR01_0071_D03.bBW965942 
OVR010088F01OVR01_0088_F01.bBW967251 
OVR010091B03OVR01_0091_B03.bBW967435 
OVR010091E09OVR01_0091_E09.bBW967470 
OVR010096C09OVR01_0096_C09.bBW967825 
OVR010100D01OVR01_0100_D01.bBW968143 
OVR010100H04OVR01_0100_H04.bBW968176 
OVRM10001D06OVRM1_0001_D06.bBP457880 
OVRM10001F04OVRM1_0001_F04.bBP459643 
OVRM10002C10OVRM1_0002_C10.bBP457241 
OVRM10005B03OVRM1_0005_B03.bBP455714 
OVRM10011H04OVRM1_0011_H04.bBP154000 
OVRM10013G05OVRM1_0013_G05.bBP152785 
OVRM10018F03OVRM1_0018_F03.bBP459569 
OVRM10030E04OVRM1_0030_E04.bBP150229 
OVRM10034H01OVRM1_0034_H01.bBP153691 
OVRM10035G11OVRM1_0035_G11.bBP153464 
OVRM10041E08OVRM1_0041_E08.bBP459022 
OVRM10042H04OVRM1_0042_H04.bBP461610 
OVRM10043B10OVRM1_0043_B10.bBP456308 
OVRM10049E08OVRM1_0049_E08.bBP150631 
OVRM10049F09OVRM1_0049_F09.bBP151988 
OVRM10059F03OVRM1_0059_F03.bBP151374 
OVRM10060F06OVRM1_0060_F06.bBP151691 
OVRM10064A05OVRM1_0064_A05.bBP145294 
OVRM10064A11OVRM1_0064_A11.bBP145953 
OVRM10064G12OVRM1_0064_G12.bBP153600 
OVRM10065D04OVRM1_0065_D04.bBP149002 
OVRM10066A06OVRM1_0066_A06.bBP145404 
OVRM10069B02OVRM1_0069_B02.bBP146280 
OVRM10069B12OVRM1_0069_B12.bBP147346 
OVRM10070E05OVRM1_0070_E05.bBP150348 
OVRM10072E01OVRM1_0072_E01.bBP149958 
OVRM10075C08OVRM1_0075_C08.bBP148153 
OVRM10076A09OVRM1_0076_A09.bBP145738 
OVRM10083G07OVRM1_0083_G07.bBP153044 
OVRM10085F12OVRM1_0085_F12.bBP152337 
OVRM10085G02OVRM1_0085_G02.bBP152518 
OVRM10087A05OVRM1_0087_A05.bBP145315 
OVRM10087B11OVRM1_0087_B11.bBP147257 
OVRM10089B02OVRM1_0089_B02.bBP146297 
OVRM10090A11OVRM1_0090_A11.bBP145978 
OVRM10096E06OVRM1_0096_E06.bBP150470 
OVRM10099H11OVRM1_0099_H11.bBP154846 
OVRM10104H04OVRM1_0104_H04.bBP154071 
OVRM10109E02OVRM1_0109_E02.bBP150079 
OVRM10110B03OVRM1_0110_B03.bBP146418 
OVRM10110E03OVRM1_0110_E03.bBP150188 
OVRM10112H12OVRM1_0112_H12.bBP154971 
OVRM10114E11OVRM1_0114_E11.bBP151015 
OVRM10115E01OVRM1_0115_E01.bBP149994 
OVRM10116D08OVRM1_0116_D08.bBP149464 
OVRM10118A05OVRM1_0118_A05.bBP145345 
OVRM10119E03OVRM1_0119_E03.bBP150197 
OVRM10122G07OVRM1_0122_G07.bBP153082 
OVRM10130F05OVRM1_0130_F05.bBP151650 
OVRM10133E11OVRM1_0133_E11.bBP151033 
OVRM10140G10OVRM1_0140_G10.bBP153439 
OVRM10150B09OVRM1_0150_B09.bBP456234 
OVRM10150G06OVRM1_0150_G06.bBP460827 
OVRM10162B11OVRM1_0162_B11.bBP456399 
OVRM10165B09OVRM1_0165_B09.bBP456248 
OVRM10168B02OVRM1_0168_B02.bBP455665 
OVRM10171F06OVRM1_0171_F06.bBP459847 
OVRM10174E04OVRM1_0174_E04.bBP458732 
OVRM10175A11OVRM1_0175_A11.bBP455431 
OVRM10182H08OVRM1_0182_H08.bBP461943 
OVRM10184B11OVRM1_0184_B11.bBP456417 
OVRM10185E11OVRM1_0185_E11.bBP459280 
OVRM10190F11OVRM1_0190_F11.b  
OVRM10192C10OVRM1_0192_C10.bBP457289 
OVRM10196H11OVRM1_0196_H11.bBP462194 
OVRM10199B07OVRM1_0199_B07.bBP456111 
OVRM10200C07OVRM1_0200_C07.bBP457067 
OVRM10203G10OVRM1_0203_G10.bBP461185 
OVRM10204A07OVRM1_0204_A07.bBP455167 
OVRM10207C12OVRM1_0207_C12.bBP457464 
OVRM10208B12OVRM1_0208_B12.bBP456511 
OVRM10209H07OVRM1_0209_H07.bBP461883 
OVRM10211H02OVRM1_0211_H02.bBP461509 
OVRM10212A03OVRM1_0212_A03.bBP454869 
OVRM10212B09OVRM1_0212_B09.bBP456281 
OVRM10214E04OVRM1_0214_E04.bBP458764 
OVRM10215B06OVRM1_0215_B06.bBP456038 
OVRM10217G03OVRM1_0217_G03.bBP460633 
OVRM10218H11OVRM1_0218_H11.bBP462215 
OVRT10002A01OVRT1_0002_A01.bFS686498 
OVRT10009A06OVRT1_0009_A06.bFS687098 
OVRT10010D08OVRT1_0010_D08.bFS687203 
OVRT10013A03OVRT1_0013_A03.bFS687422 
OVRT10018F04OVRT1_0018_F04.bFS687887 
OVRT10023E01OVRT1_0023_E01.bFS688283 
OVRT10023H04OVRT1_0023_H04.bFS688320 
OVRT10041F07OVRT1_0041_F07.bFS689766 
OVRT10043H01OVRT1_0043_H01.bFS689946 
OVRT10046F01OVRT1_0046_F01.bFS690166 
OVRT10052C03OVRT1_0052_C03.bFS690640 
OVRT10066A01OVRT1_0066_A01.bFS691772 
OVRT10077F07OVRT1_0077_F07.bFS692698 
OVRT10077G06OVRT1_0077_G06.bFS692709 
OVRT10084D06OVRT1_0084_D06.bFS693243 
OVRT10086F02OVRT1_0086_F02.bFS693428 
OVRT10090B01OVRT1_0090_B01.bFS693713 
OVRT10092G07OVRT1_0092_G07.bFS693928 
OVRT10093B03OVRT1_0093_B03.bFS693958 
OVRT10093H12OVRT1_0093_H12.bFS694029 
OVRT10095D04OVRT1_0095_D04.bFS694148 
OVRT10096B06OVRT1_0096_B06.bFS694213 
OVRT10097E07OVRT1_0097_E07.bFS694329 
OVRT10098B12OVRT1_0098_B12.bFS694387 
OVRT10105H12OVRT1_0105_H12.bHX235236 
OVRT10108F11OVRT1_0108_F11.bHX235461 
OVRT10112A06OVRT1_0112_A06.bHX235744 
OVRT10113G05OVRT1_0113_G05.bHX235886 
OVRT10120A10OVRT1_0120_A10.bHX236414 
OVRT10120G10OVRT1_0120_G10.bHX236462 
OVRT10125H11OVRT1_0125_H11.bHX236861 
OVRT10131C07OVRT1_0131_C07.bHX237289 
OVRT10132C05OVRT1_0132_C05.bHX237367 
OVRT10144E04OVRT1_0144_E04.bHX238369 
OVRT10150H05OVRT1_0150_H05.bHX238899 
PBL010089H02PBL01_0089_H02.bBW974117 
PBL010095G02PBL01_0095_G02.bBW974547 
PCT010014A08PCT01_0014_A08.bFS695549 
PCT010015A03PCT01_0015_A03.bFS695613 
PCT010034C11PCT01_0034_C11.bFS696874 
PCT010035F03PCT01_0035_F03.bFS696970 
PCT010036D05PCT01_0036_D05.bFS697030 
PST010004D12PST01_0004_D12.bFS697311 
PST010026D06PST01_0026_D06.bFS699032 
PST010027D03PST01_0027_D03.bFS699108 
PST010028D12PST01_0028_D12.bFS699195 
PST010031C02PST01_0031_C02.bFS699319 
PST010043C02PST01_0043_C02.bFS700201 AK396512
PST010046F11PST01_0046_F11.bFS700471 
PST010057D09PST01_0057_D09.bFS701337 
PST010075A07PST01_0075_A07.bFS702715 
PST010085B11PST01_0085_B11.bFS703551 
PST010096A11PST01_0096_A11.bFS704399 
PST010100B04PST01_0100_B04.bFS704675 
SKNB10019F02SKNB1_0019_F02.bDB801053 
SKNB10021B11SKNB1_0021_B11.b  
SKNB10030D07SKNB1_0030_D07.bDB801627 
SKNB10041C09SKNB1_0041_C09.bDB802269 
SKNB10069D07SKNB1_0069_D07.bDB804186 
SKNB10091H09SKNB1_0091_H09.bDB805514 
SKNB10100A08SKNB1_0100_A08.bDB806002 
SMG010018A04SMG01_0018_A04.bFS714782 
SMG010063H01SMG01_0063_H01.bFS718745 
SMG010092C04SMG01_0092_C04.bFS721207 
SMG010098F09SMG01_0098_F09.bFS721725 
SMG010101B05SMG01_0101_B05.bFS721891 
SPL010012H07SPL01_0012_H07.bBP159218 
SPL010072E09SPL01_0072_E09.bCJ019507 
SPL010097G02SPL01_0097_G02.bCJ021778 
SPL010099D05SPL01_0099_D05.bCJ021925 
TCH010020H12TCH01_0020_H12.bCJ023949 
TES010004H05TES01_0004_H05.bCJ030281 
TES010005D07TES01_0005_D07.bCJ030323 
TES010007H03TES01_0007_H03.bCJ030491 
TES010011A07TES01_0011_A07.bCJ030709 
TES010015F07TES01_0015_F07.bCJ031025 
TES010017A11TES01_0017_A11.bCJ031120 
TES010017C07TES01_0017_C07.bCJ031136 
TES010019E09TES01_0019_E09.bCJ031289 
TES010021B11TES01_0021_B11.bCJ031392 
TES010021D01TES01_0021_D01.bCJ031402 
TES010027D11TES01_0027_D11.bCJ031792 
TES010028E07TES01_0028_E07.bCJ031856 
TES010031G02TES01_0031_G02.bCJ032072 
TES010032F01TES01_0032_F01.bCJ032131 
TES010032H09TES01_0032_H09.bCJ032150 
TES010034D07TES01_0034_D07.bCJ032240 
TES010036A01TES01_0036_A01.bCJ032348 
TES010039A04TES01_0039_A04.bCJ032543 
TES010040B10TES01_0040_B10.bCJ032585 
TES010042D02TES01_0042_D02.bCJ032713 
TES010047F04TES01_0047_F04.bCJ033036 
TES010051F11TES01_0051_F11.bCJ033279 
TES010054G01TES01_0054_G01.bCJ033452 
TES010057A01TES01_0057_A01.bCJ033609 
TES010057H08TES01_0057_H08.bCJ033671 
TES010058B12TES01_0058_B12.bCJ033695 
TES010062G10TES01_0062_G10.bCJ034010 
TES010065C12TES01_0065_C12.bCJ034179 
TES010065G08TES01_0065_G08.bCJ034210 
TES010065G09TES01_0065_G09.bCJ034211 
TES010077B03TES01_0077_B03.bCJ034942 
TES010079C09TES01_0079_C09.bCJ035077 
TES010079E03TES01_0079_E03.bCJ035090 
TES010080G09TES01_0080_G09.bCJ035184 
TES010081H07TES01_0081_H07.bCJ035254 
TES010082F11TES01_0082_F11.bCJ035308 
TES010083F01TES01_0083_F01.bCJ035370 
TES010084C12TES01_0084_C12.bCJ035423 
TES010085G10TES01_0085_G10.b  
TES010092A10TES01_0092_A10.bCJ035938 
TES010095F07TES01_0095_F07.bCJ036203 
TES010097B05TES01_0097_B05.bCJ036312 
TES010098E05TES01_0098_E05.bCJ036414 
TES010100B08TES01_0100_B08.bCJ036542 
TES010101E02TES01_0101_E02.bCJ036633 
TES010102H08TES01_0102_H08.bCJ036742 
TES010107A12TES01_0107_A12.bCJ037046 
TES010107D06TES01_0107_D06.bCJ037063 
TES010109G08TES01_0109_G08.bCJ037226 
TES010111A03TES01_0111_A03.bCJ037293 
TES010111D12TES01_0111_D12.b  
THY010022B02THY01_0022_B02.bBP160695 
THY010053H06THY01_0053_H06.bBP168678 
THY010071F03THY01_0071_F03.bBP165851 
THY010113A05THY01_0113_A05.bBP159855 
THY010126G03THY01_0126_G03.bBP167135 
UTR010068E12UTR01_0068_E12.bBP464103 
UTR010085C04UTR01_0085_C04.bCJ037826 

  

SNPs: 10      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
95A2100.086W-
T136860.914
96A137870.903W-
G2400.097
107C132860.869W-
T3300.131
316A5000.199WSGGA/G
C114870.801GGC/G
775C8260.662OSTAC/Y
T3960.338TAT/Y
796C1010.125OSCTC/L
T7520.875CTT/L
835C8910.909OSCTC/L
T810.091CTT/L
838G8110.901ONATG/M
T810.099ATT/I
892C710.229WSAAC/N
T2700.771AAT/N
967C700.467WSCCC/P
T710.533CCT/P


Alignment:      TOP

20110601C-000430 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0046_F12.b : naataacgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0040_B10.b :
UTR01_0085_C04.b :
PST01_0043_C02.b :
OVRM1_0218_H11.b :
OVR01_0020_C07.b :
CLNT1_0082_C07.b :
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b :
OVRM1_0203_G10.b :
OVR01_0091_E09.b :
OVRT1_0002_A01.b :
THY01_0053_H06.b :
ITT01_0053_F06.b :
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b :
CLNT1_0115_F05.b :
OVRT1_0092_G07.b :
MLN01_0087_D07.b :
PBL01_0089_H02.b :
ITT01_0052_D12.b :
LNG01_0080_D10.b :
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b :
SMG01_0101_B05.b :
LNG01_0092_H05.b :
OVRM1_0002_C10.b :
TES01_0084_C12.b :
OVRT1_0120_A10.b :
OVR01_0046_D09.b :
CLNT1_0021_C09.b :
TES01_0039_A04.b :
OVRT1_0077_F07.b :
LVR01_0060_G01.b :
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b :
OVR01_0100_D01.b :
OVRT1_0066_A01.b :
OVR01_0071_D03.b :
OVRT1_0010_D08.b :
SKNB1_0100_A08.b :
OVRT1_0112_A06.b :
TES01_0005_D07.b :
TES01_0051_F11.b :
TES01_0065_C12.b :
TES01_0082_F11.b :
TES01_0095_F07.b :
TES01_0042_D02.b :
TES01_0011_A07.b :
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b :
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b :
OVR01_0096_C09.b :
SMG01_0092_C04.b :
OVR01_0015_B12.b :
SMG01_0063_H01.b :
OVRT1_0125_H11.b :
OVRT1_0132_C05.b :
OVRT1_0090_B01.b :
OVRT1_0105_H12.b :
OVRT1_0096_B06.b :
OVRT1_0150_H05.b :
OVRT1_0144_E04.b :
OVRT1_0108_F11.b :
SMG01_0018_A04.b :
ITT01_0100_F02.b :
BFLT1_0125_D09.b :
LVR01_0079_A11.b :
OVRT1_0009_A06.b :
OVRT1_0023_E01.b :
CLNT1_0110_G04.b :
CLNT1_0107_D11.b :
OVRT1_0120_G10.b :
OVRT1_0097_E07.b :
PCT01_0036_D05.b :
OVRT1_0098_B12.b :
OVRT1_0113_G05.b :
OVR01_0035_G03.b :
CLNT1_0072_C04.b :
OVRT1_0086_F02.b :
OVRT1_0095_D04.b :
OVRT1_0084_D06.b :
OVR01_0020_H10.b :
ADR01_0055_D02.b :
OVRT1_0077_G06.b :
OVR01_0070_D03.b :
ITT01_0087_E12.b :
THY01_0022_B02.b :
OVR01_0042_E12.b :
OVRT1_0046_F01.b :
OVRT1_0041_F07.b :
OVRT1_0018_F04.b :
ITT01_0078_C07.b :
OVRT1_0052_C03.b :
TES01_0065_G09.b :
TES01_0017_C07.b :
TES01_0028_E07.b :
OVRT1_0023_H04.b :
THY01_0071_F03.b :
UTR01_0068_E12.b :
OVRT1_0013_A03.b :
OVRT1_0093_B03.b :
ITT01_0070_A11.b :
OVRT1_0093_H12.b :
OVRT1_0043_H01.b :
ITT01_0034_G07.b :
ADR01_0052_D12.b :
ADR01_0096_H10.b :
OVR01_0091_B03.b :
ADR01_0057_C08.b :
ITT01_0047_H12.b :
TCH01_0020_H12.b :
OVR01_0088_F01.b :
SPL01_0099_D05.b :
OVRM1_0110_E03.b :
TES01_0034_D07.b :
LVRM1_0049_B08.b :
TES01_0111_D12.b :
SKNB1_0021_B11.b :
KDN01_0049_B07.b :
TES01_0062_G10.b :
TES01_0101_E02.b :
TES01_0080_G09.b :
TES01_0111_A03.b :
TES01_0083_F01.b :
TES01_0092_A10.b :
PCT01_0014_A08.b :
SKNB1_0041_C09.b :
TES01_0021_D01.b :
PCT01_0015_A03.b :
PCT01_0035_F03.b :
PST01_0004_D12.b :
PST01_0031_C02.b :
TES01_0057_A01.b :
TES01_0036_A01.b :
TES01_0017_A11.b :
TES01_0032_H09.b :
KDN01_0038_A04.b :
SKNB1_0091_H09.b :
TES01_0007_H03.b :
PST01_0028_D12.b :
PST01_0026_D06.b :
TES01_0004_H05.b :
TES01_0065_G08.b :
PST01_0057_D09.b :
SKNB1_0019_F02.b :
SMG01_0098_F09.b :
TES01_0081_H07.b :
LVRM1_0146_D06.b :
TES01_0079_C09.b :
TES01_0015_F07.b :
ADR01_0096_D11.b :
THY01_0113_A05.b :
OVRM1_0192_C10.b :
TES01_0079_E03.b :
TES01_0077_B03.b :
TES01_0107_D06.b :
TES01_0107_A12.b :
TES01_0031_G02.b :
TES01_0058_B12.b :
TES01_0100_B08.b :
TES01_0032_F01.b :
SKNB1_0069_D07.b :
TES01_0102_H08.b :
TES01_0054_G01.b :
TES01_0019_E09.b :
TES01_0097_B05.b :
PST01_0075_A07.b :
PST01_0046_F11.b :
PST01_0096_A11.b :
PST01_0100_B04.b :
TES01_0021_B11.b :
SKNB1_0030_D07.b :
PST01_0085_B11.b :
PST01_0027_D03.b :
TES01_0098_E05.b :
TES01_0027_D11.b :
TES01_0085_G10.b :
TES01_0047_F04.b :
PCT01_0034_C11.b :
OVRM1_0182_H08.b :
SPL01_0097_G02.b :
OVRM1_0122_G07.b :
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0046_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0040_B10.b :
UTR01_0085_C04.b : nnnnnggctaggactatnacxxxxx
PST01_0043_C02.b :
OVRM1_0218_H11.b : agttt
OVR01_0020_C07.b : ttttggggtgxxxxxxxxxxxxxxxxxx
CLNT1_0082_C07.b : nggttgttnnnnnnaagttcg
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b : cc
OVRM1_0203_G10.b :
OVR01_0091_E09.b :
OVRT1_0002_A01.b :
THY01_0053_H06.b : gct
ITT01_0053_F06.b :
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b : n
CLNT1_0115_F05.b :
OVRT1_0092_G07.b :
MLN01_0087_D07.b :
PBL01_0089_H02.b :
ITT01_0052_D12.b :
LNG01_0080_D10.b :
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b :
SMG01_0101_B05.b :
LNG01_0092_H05.b :
OVRM1_0002_C10.b :
TES01_0084_C12.b :
OVRT1_0120_A10.b :
OVR01_0046_D09.b : ag
CLNT1_0021_C09.b :
TES01_0039_A04.b :
OVRT1_0077_F07.b :
LVR01_0060_G01.b : tt
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b :
OVR01_0100_D01.b :
OVRT1_0066_A01.b :
OVR01_0071_D03.b :
OVRT1_0010_D08.b :
SKNB1_0100_A08.b :
OVRT1_0112_A06.b :
TES01_0005_D07.b :
TES01_0051_F11.b :
TES01_0065_C12.b :
TES01_0082_F11.b :
TES01_0095_F07.b :
TES01_0042_D02.b :
TES01_0011_A07.b :
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b :
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b :
OVR01_0096_C09.b :
SMG01_0092_C04.b :
OVR01_0015_B12.b :
SMG01_0063_H01.b :
OVRT1_0125_H11.b :
OVRT1_0132_C05.b :
OVRT1_0090_B01.b :
OVRT1_0105_H12.b :
OVRT1_0096_B06.b :
OVRT1_0150_H05.b :
OVRT1_0144_E04.b :
OVRT1_0108_F11.b :
SMG01_0018_A04.b :
ITT01_0100_F02.b :
BFLT1_0125_D09.b :
LVR01_0079_A11.b :
OVRT1_0009_A06.b :
OVRT1_0023_E01.b :
CLNT1_0110_G04.b :
CLNT1_0107_D11.b :
OVRT1_0120_G10.b :
OVRT1_0097_E07.b :
PCT01_0036_D05.b :
OVRT1_0098_B12.b :
OVRT1_0113_G05.b :
OVR01_0035_G03.b : tttttttttttt
CLNT1_0072_C04.b :
OVRT1_0086_F02.b :
OVRT1_0095_D04.b :
OVRT1_0084_D06.b :
OVR01_0020_H10.b :
ADR01_0055_D02.b :
OVRT1_0077_G06.b :
OVR01_0070_D03.b :
ITT01_0087_E12.b :
THY01_0022_B02.b :
OVR01_0042_E12.b : gg
OVRT1_0046_F01.b :
OVRT1_0041_F07.b :
OVRT1_0018_F04.b :
ITT01_0078_C07.b :
OVRT1_0052_C03.b :
TES01_0065_G09.b :
TES01_0017_C07.b :
TES01_0028_E07.b :
OVRT1_0023_H04.b :
THY01_0071_F03.b :
UTR01_0068_E12.b : ttt
OVRT1_0013_A03.b :
OVRT1_0093_B03.b :
ITT01_0070_A11.b :
OVRT1_0093_H12.b :
OVRT1_0043_H01.b :
ITT01_0034_G07.b :
ADR01_0052_D12.b :
ADR01_0096_H10.b :
OVR01_0091_B03.b :
ADR01_0057_C08.b :
ITT01_0047_H12.b :
TCH01_0020_H12.b :
OVR01_0088_F01.b :
SPL01_0099_D05.b :
OVRM1_0110_E03.b :
TES01_0034_D07.b :
LVRM1_0049_B08.b :
TES01_0111_D12.b :
SKNB1_0021_B11.b :
KDN01_0049_B07.b :
TES01_0062_G10.b :
TES01_0101_E02.b :
TES01_0080_G09.b :
TES01_0111_A03.b :
TES01_0083_F01.b :
TES01_0092_A10.b :
PCT01_0014_A08.b :
SKNB1_0041_C09.b :
TES01_0021_D01.b :
PCT01_0015_A03.b :
PCT01_0035_F03.b :
PST01_0004_D12.b :
PST01_0031_C02.b :
TES01_0057_A01.b :
TES01_0036_A01.b :
TES01_0017_A11.b :
TES01_0032_H09.b :
KDN01_0038_A04.b :
SKNB1_0091_H09.b :
TES01_0007_H03.b :
PST01_0028_D12.b :
PST01_0026_D06.b :
TES01_0004_H05.b :
TES01_0065_G08.b :
PST01_0057_D09.b :
SKNB1_0019_F02.b :
SMG01_0098_F09.b :
TES01_0081_H07.b :
LVRM1_0146_D06.b :
TES01_0079_C09.b :
TES01_0015_F07.b :
ADR01_0096_D11.b :
THY01_0113_A05.b :
OVRM1_0192_C10.b :
TES01_0079_E03.b :
TES01_0077_B03.b :
TES01_0107_D06.b :
TES01_0107_A12.b :
TES01_0031_G02.b :
TES01_0058_B12.b :
TES01_0100_B08.b :
TES01_0032_F01.b :
SKNB1_0069_D07.b :
TES01_0102_H08.b :
TES01_0054_G01.b :
TES01_0019_E09.b :
TES01_0097_B05.b :
PST01_0075_A07.b :
PST01_0046_F11.b :
PST01_0096_A11.b :
PST01_0100_B04.b :
TES01_0021_B11.b :
SKNB1_0030_D07.b :
PST01_0085_B11.b :
PST01_0027_D03.b :
TES01_0098_E05.b :
TES01_0027_D11.b :
TES01_0085_G10.b :
TES01_0047_F04.b :
PCT01_0034_C11.b :
OVRM1_0182_H08.b :
SPL01_0097_G02.b :
OVRM1_0122_G07.b :
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : ..........................................CCTGGGTTGGGGTATATA
---------+---------+---------+---------+---------+---------+ 18
DCI01_0046_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTGGGTTGGGGTATATA
TES01_0040_B10.b : tcacgtggctatggATATA
UTR01_0085_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATATA
PST01_0043_C02.b : nnnnncctcgcgttggcactggaATATA
OVRM1_0218_H11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATA
OVR01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATA
CLNT1_0082_C07.b : cgtcgagtgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxatcttcaggA
OVRM1_0174_E04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_B10.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0012_H07.b : tttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0203_G10.b : cagtttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_E09.b : ggcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_A01.b : nnaattccgttagctgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0053_H06.b : ttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_F06.b : nnggggtaacaxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_A12.b : gaattgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0215_B06.b : nagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_F03.b : nagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_F05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_C07.b : ngggtttccnnngnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0115_F05.b : nnnnggcgcgttgtgcgnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0092_G07.b : ncccctttnnnnnnnccgttcgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_D07.b : nggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0089_H02.b : nnnaagatgaacaxxxxxxxxxxxxxxxxxxxx
ITT01_0052_D12.b : nttgatgxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_D10.b : nnnnaagctggtatatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0212_A03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_A05.b : tagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0104_H04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0100_H04.b : ctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0101_B05.b : nnngggctttnnnnnggggtaaagcagcxxxxxxxxxxxxxxx
LNG01_0092_H05.b : tttttttgttggaaataaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0002_C10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0084_C12.b : nnnaact
OVRT1_0120_A10.b : nccacgtacgcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0046_D09.b : gatcatagtgncnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_C09.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0039_A04.b :
OVRT1_0077_F07.b : nnncctactatagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_G01.b : tttacagcttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_B02.b : natttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_E04.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_B02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H11.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0208_B12.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxx
OVR01_0100_D01.b : cgctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0066_A01.b : nngggcttnnnggnnnggctcagcgnacgagtgxxxxxxxxxxxxxxxxxxx
OVR01_0071_D03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_D08.b : nnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0100_A08.b :
OVRT1_0112_A06.b : nnncctcgttagctgtagagtgxxxxxxxxxxxxxxxxxxxxxxx
TES01_0005_D07.b :
TES01_0051_F11.b :
TES01_0065_C12.b :
TES01_0082_F11.b :
TES01_0095_F07.b :
TES01_0042_D02.b :
TES01_0011_A07.b :
OVRM1_0175_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0190_F11.b : ctttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0076_A09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0126_G03.b : agtgacaaaaacaxxxxxxxxxxxxxxx
OVRM1_0140_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_G11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0072_E01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_A06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0150_G06.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0200_C07.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_G01.b : xxxxxxxxxxxxxxxxxxxx
OVRM1_0162_B11.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_F06.b : acxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0150_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0211_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_G08.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0165_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0199_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0001_F04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0034_H01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_F03.b : ccttgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_G03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_E11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0207_C12.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_F06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0042_H04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0075_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_E08.b : xxxxxxxxxxxxxxxxxxxx
OVRM1_0089_B02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_A05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_C06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0001_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0109_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0065_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_E08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_A05.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_E03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0116_D08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_F09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_F12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0035_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_B02.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_A11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_B10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0090_A11.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0212_B09.b : gaatttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0070_E05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_B11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_G12.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0030_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_B11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_E11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_B12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0011_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0096_C09.b : ngatagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0092_C04.b : nccatactnnnnnggagtaagcagcxxxxxxxxxxxxxx
OVR01_0015_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
SMG01_0063_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0125_H11.b : nnccccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0132_C05.b : nnngggatccnnnngnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_B01.b : nnncggcttnnnnnnncccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_H12.b : nnnncgttcgcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_B06.b : nnncccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_H05.b : nnnttctctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0144_E04.b : nngggttttnnnnnnnnnccgttagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_F11.b : nnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0018_A04.b : ngggttcaannnnggatacagcagcxxxxxxxxxxxxxx
ITT01_0100_F02.b : nggatgaacaxxxxxxxxxxxxxxxx
BFLT1_0125_D09.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_A11.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_A06.b : nnncccttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0023_E01.b : ncttttttnnnnnnnggtatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0110_G04.b : nnnttcccttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_D11.b : nnnncctttagcggacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0120_G10.b : ncctcgtacgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0097_E07.b : nnnttctttgctgtagagtgxxxxxxxxxxxxxxxxxxxxxx
PCT01_0036_D05.b : nnnttatt
OVRT1_0098_B12.b : nnnnccgtcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_G05.b : nnnttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_G03.b : tttttactacgataggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_C04.b : ngggaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0086_F02.b : nnnttcttnnnngggnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_D04.b : nnnnnggtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_D06.b : nnnaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_H10.b : ttaaggaaacaaggttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_D02.b : gcccnnggatgaacagctggacngcxxxxxxx
OVRT1_0077_G06.b : nnaaatactatctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_D03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_E12.b : nnnggatcaacaxxxxxxxxxxxxxxxxx
THY01_0022_B02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_E12.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_F01.b : nttttccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_F07.b : nccgtttnnnnnnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0018_F04.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_C07.b : nnnnggagtaacaxxxxxxxxxxxxxxxxx
OVRT1_0052_C03.b : nncctcttnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0065_G09.b :
TES01_0017_C07.b :
TES01_0028_E07.b :
OVRT1_0023_H04.b : ncgctttnnnnnnnnggtatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
THY01_0071_F03.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0068_E12.b : tttttaagcatcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0013_A03.b : nnnttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_B03.b : nccgcttnnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0070_A11.b : nnnggatcxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_H12.b : ncggttnnnnnttttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_H01.b : nntttcgatagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0034_G07.b : nnnggataaacaxxxxxxxxxxxxxxxxx
ADR01_0052_D12.b : gannnnaagatacacaxxxxxxxxxxxxxxxxx
ADR01_0096_H10.b : nncctttnaaaaaagagtaagcagcggtaxxxxxxxxx
OVR01_0091_B03.b : nnnnggcatggactatnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_C08.b : nnnnnaatgaacaxxxxxxxxxxxxxxxx
ITT01_0047_H12.b : nnaagataaacaxxxxxxxxxxxxxxxx
TCH01_0020_H12.b : tagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0088_F01.b : nnnnagcttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0099_D05.b : nnnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_E03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0034_D07.b :
LVRM1_0049_B08.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0111_D12.b :
SKNB1_0021_B11.b :
KDN01_0049_B07.b :
TES01_0062_G10.b :
TES01_0101_E02.b :
TES01_0080_G09.b :
TES01_0111_A03.b :
TES01_0083_F01.b :
TES01_0092_A10.b :
PCT01_0014_A08.b : nnng
SKNB1_0041_C09.b :
TES01_0021_D01.b :
PCT01_0015_A03.b : nnnnggg
PCT01_0035_F03.b : nnntt
PST01_0004_D12.b :
PST01_0031_C02.b :
TES01_0057_A01.b :
TES01_0036_A01.b :
TES01_0017_A11.b :
TES01_0032_H09.b :
KDN01_0038_A04.b : ng
SKNB1_0091_H09.b :
TES01_0007_H03.b :
PST01_0028_D12.b :
PST01_0026_D06.b :
TES01_0004_H05.b :
TES01_0065_G08.b :
PST01_0057_D09.b :
SKNB1_0019_F02.b : n
SMG01_0098_F09.b : nncccttaaaatnnnggagtaagcagcxxxxxxxxxxx
TES01_0081_H07.b :
LVRM1_0146_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxx
TES01_0079_C09.b :
TES01_0015_F07.b :
ADR01_0096_D11.b : nnnnnggactaacaxxxxxxxxxxxx
THY01_0113_A05.b : gctgacaaacggcggacgg
OVRM1_0192_C10.b : xxxxxxxxxxxxxxx
TES01_0079_E03.b :
TES01_0077_B03.b :
TES01_0107_D06.b :
TES01_0107_A12.b :
TES01_0031_G02.b :
TES01_0058_B12.b :
TES01_0100_B08.b :
TES01_0032_F01.b :
SKNB1_0069_D07.b :
TES01_0102_H08.b :
TES01_0054_G01.b :
TES01_0019_E09.b :
TES01_0097_B05.b : nggcg
PST01_0075_A07.b :
PST01_0046_F11.b :
PST01_0096_A11.b :
PST01_0100_B04.b :
TES01_0021_B11.b :
SKNB1_0030_D07.b :
PST01_0085_B11.b :
PST01_0027_D03.b :
TES01_0098_E05.b :
TES01_0027_D11.b :
TES01_0085_G10.b :
TES01_0047_F04.b :
PCT01_0034_C11.b : nnnn
OVRM1_0182_H08.b : tagttgtctaacxxxxxxxxxxxxxxxxx
SPL01_0097_G02.b :
OVRM1_0122_G07.b :
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
---------+---------+---------+---------+---------+---------+ 77
DCI01_0046_F12.b : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0040_B10.b : NGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
UTR01_0085_C04.b : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PST01_0043_C02.b : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0218_H11.b : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0020_C07.b : GGATCTCTCGACTCCGCTGCTGCTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0082_C07.b : GGATCTCTCGANTCCGCTGCTGCTCTCAATACTCCTTTAAGAGACTCCTTGGTAG*TCTG
OVRM1_0174_E04.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0043_B10.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SPL01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0203_G10.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0002_A01.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
THY01_0053_H06.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0053_F06.b : xxxxxxxxxxxxxxxxxxxxxxxTCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0098_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0215_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0181_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0018_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0130_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0131_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0115_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0092_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
MLN01_0087_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PBL01_0089_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0052_D12.b : xxxxxxxxxxxxxxxxxxxxxtggCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LNG01_0080_D10.b : xxxxxxxxxxxxxxxxxxxxxxxaCTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0212_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxtGGAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0064_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0104_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0100_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SMG01_0101_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxGGAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LNG01_0092_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0002_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0084_C12.b : gcacatgagtcgccttgttgacactgGAATACTTCTCCCC*AGACTCCTTGGTAG*TCTG
OVRT1_0120_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxcCAATTCTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0046_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxgaGAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0021_C09.b : xxxxxxxxxxxxxxxxxxxxxactgtGAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0039_A04.b : tttctgcgttgctcTGGATCTTCTCCCC*AGACTCCTTGGTAG*TCTG
OVRT1_0077_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVR01_0060_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0133_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0214_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0168_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0196_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0096_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0208_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0114_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0100_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0066_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxtAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0010_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SKNB1_0100_A08.b : nnnncctgactgtggctacggTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0112_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0005_D07.b : ntcacggtggctctGGAACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0051_F11.b : ttttncctagcgttgctatggataTATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0065_C12.b : tttcgctgttgctatggATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0082_F11.b : tcacgctggctatggATACTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0095_F07.b : tttncctactgttgctatgggATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0042_D02.b : cgttggctatggATACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0011_A07.b : ncccgcggtggctctggatcATACTTCTCCCCC*GACTCCTTGGTAG*TCTG
OVRM1_0175_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0190_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0076_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0110_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
THY01_0126_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0140_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0191_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0072_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0066_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0150_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0200_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0014_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0162_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0171_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0150_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0211_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0116_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0165_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0199_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0085_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxgTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0001_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0034_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0059_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0217_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0133_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0207_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0060_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0042_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0075_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0115_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0209_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0049_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0089_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0087_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0034_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0005_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0001_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0109_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0112_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0013_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0065_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTCCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0041_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0118_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0119_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0116_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0049_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0085_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0099_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0035_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0069_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0064_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVRM1_0126_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0090_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0212_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0070_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0083_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0184_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0064_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0030_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0087_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0185_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0069_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0011_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0096_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAGCTCTG
SMG01_0092_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0015_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTAGGTAG*TCAG
SMG01_0063_H01.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0125_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0132_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0090_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0105_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0096_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0150_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0144_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0108_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SMG01_0018_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
BFLT1_0125_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
LVR01_0079_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0009_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0023_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0110_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0107_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0120_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcatTATTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0097_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PCT01_0036_D05.b : ttnnnnnnnnaatacgttgtgcacggncaTACTTCTCCCC*AGACTCCTTGGTAG*TCTG
OVRT1_0098_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0113_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
CLNT1_0072_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0086_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0095_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0084_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0020_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ADR01_0055_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0077_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0070_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0087_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
THY01_0022_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0042_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0046_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0041_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0018_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0078_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0052_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0065_G09.b : tttttcctacgtttgctatggTACTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0017_C07.b : ttccgctgtggctatggtccaTACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0028_E07.b : gttggctctggaAACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
THY01_0071_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
UTR01_0068_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0093_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0070_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0093_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRT1_0043_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0034_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ADR01_0052_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ADR01_0096_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0091_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ADR01_0057_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
ITT01_0047_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TCH01_0020_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVR01_0088_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SPL01_0099_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTCTCCCCCAGACTCCTTGGTAG*TCTG
OVRM1_0110_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxtcACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0034_D07.b : nnnncctacggttgcactggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
LVRM1_0049_B08.b : xxxxxxxxxxxxxxxxxxxxxxcctactggACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0111_D12.b : tttcgctttggcactggaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
SKNB1_0021_B11.b : nntttcctgacagttggctacggaaACTTCTCCC*CAGACTCCTTGGTAG*TCTG
KDN01_0049_B07.b : gtcatatctcagacgtggccacggaaACTTCTCCCC*ATACTCCTTGGTAG*TCTG
TES01_0062_G10.b : ttttactgcgttgcactggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0101_E02.b : nnnncctgcgtggctatgaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0080_G09.b : nttttgcccacgttgctatgaaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0111_A03.b : tttttcctacggtggctactggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0083_F01.b : ttttttcctgcgtttgctatggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0092_A10.b : tttttcctgactgttgctatggaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PCT01_0014_A08.b : gcttttnnnnnnncctacggtggcantggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
SKNB1_0041_C09.b : nnnnnccaactgtggctatggaaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0021_D01.b : nnnnttcgctgtggctactggaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PCT01_0015_A03.b : cttannnnnnnnactacggtgtgcanggnaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
PCT01_0035_F03.b : cgctttaannnnncctacgttgtgcacggnACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PST01_0004_D12.b : ntttactgtggctactggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0031_C02.b : nnccctgcggtggctataaaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0057_A01.b : aaaancctacggtggctactggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0036_A01.b : cgcgttggctctggaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0017_A11.b : tcgctgtggctatggACTTCT*CCCCAGACTCCTTGGTAG*TCTG
TES01_0032_H09.b : tttttccttacgtttgctacggACTTCTCCCCCAGACTCCTTGGTAG*TCTG
KDN01_0038_A04.b : cgtttactnnnnncctgcgggtgctatggaACTTCTCCCCC*GACTCCTTGGTAG*TCTG
SKNB1_0091_H09.b : nnncccacggtggctacggtaaACTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0007_H03.b : tttttgcgcagtggctatggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0028_D12.b : nnnnttcactgtggctatggaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0026_D06.b : ttttcctgctgtggcacggaaACTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0004_H05.b : ntttccgctgtggctatggaACTTCTCC*CCAGACTCCTTGGTAG*TCTG
TES01_0065_G08.b : ttttcctgcggttgctatggccaaACTTCTCCCCCAGACTCCTTGGTAG*TCTG
PST01_0057_D09.b : nnttttgctgcagttggcacggctcaaACTTCT*CCCCAGACTCCTTGGTAG*TCTG
SKNB1_0019_F02.b : nggttttnnnnnnaatgcgttggcacggnaACTTCTCCCCC*GACTCCTTGGTAG*TCTG
SMG01_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0081_H07.b : gaatCTTCTCCCCC*GACTCCTTGGTAG*TCTG
LVRM1_0146_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0079_C09.b : nttttactgctgtggctatggatCTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0015_F07.b : nnnnnttcactgttgctacggggATTCTCCCCCAGACTCCTTGGTAG*TCTG
ADR01_0096_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTCCCCCAGACTCCTTGGTAG*TCTG
THY01_0113_A05.b : tcggaatcctgagcactgtggctactggaataTTCTCCCCCAGACTCCTTGGTA**TCTG
OVRM1_0192_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCCCCCAGACTCCTTGGTAG*TCTG
TES01_0079_E03.b : tttttcctactgttgctatgaataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0077_B03.b : ttccgctgttgctatggataTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0107_D06.b : tttaactagcggtggctacggagtaTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0107_A12.b : nnaacactgctgttgctctggataTTCTCCCC*AGATTCCTTGGTAG*TCTG
TES01_0031_G02.b : ntggcgttggcactggaataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0058_B12.b : nncctgcggtggctctggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0100_B08.b : tttttcccgcgttgctatggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0032_F01.b : ncgactgttgcactggaataTTCTCCCCCAGACTCCTTGGTAG*TCTG
SKNB1_0069_D07.b : nnnnntcaccgttgctatggataTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0102_H08.b : nttttgctactgttgctatggaataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0054_G01.b : ttttcctgcgttggctatggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
TES01_0019_E09.b : ccacgttggcactggataTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0097_B05.b : tttnnnnnttcctacgttggcacggctggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0075_A07.b : nnnncctgagttggctacgataTTCTCCCCCAGACTCCTTGGTAG*TCTG
PST01_0046_F11.b : nnnnncttgcgttggctatgaataTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0096_A11.b : nnnncctgctgtggctctggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0100_B04.b : ttttcctgcggtggctaataTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0021_B11.b : ccgcgttggctatggataTTCTCCCC*AGACTCCTTGGTAG*TCTG
SKNB1_0030_D07.b : nnnnggtcacggtggcantggataTTCTCCCCC*GACTCCTTGGTAG*TCTG
PST01_0085_B11.b : nnncctgaggtggcacggaataTTCTCCCC*AGACTCCTTGGTAG*TCTG
PST01_0027_D03.b : nttttactgctgtggctatggataTTCTCCCCC*GACTCCTTGGTAG*TCTG
TES01_0098_E05.b : nntttactgcgtggctatggactTCCCCCCGACTCCTTGGTAG*TCTG
TES01_0027_D11.b : cgttggctatggtggctctCCCCAGACTCCTTGGTAG*TCTG
TES01_0085_G10.b : ncggcgttggctctggtggctctCCCCGACTCCTTGGTAG*TCTG
TES01_0047_F04.b : gcgttggcgatcttctCCCCGACTCCTTGGTAG*TCTG
PCT01_0034_C11.b : ggcgttttcannnnnnccgcgaggtgtgcacggnttctcccagaactCTTGGTAG*TCTG
OVRM1_0182_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttattgtgtgtgcctccgagtgtgcggc
SPL01_0097_G02.b :
OVRM1_0122_G07.b :
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
---------+---------+---------+---------+---------+---------+ 135
DCI01_0046_F12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0040_B10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
UTR01_0085_C04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0043_C02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0218_H11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0020_C07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0082_C07.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0174_E04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0043_B10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SPL01_0012_H07.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0203_G10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0091_E09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0002_A01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
THY01_0053_H06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0053_F06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0098_A12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0215_B06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0181_D01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0018_F03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0130_F05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0131_C07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0115_F05.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0092_G07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
MLN01_0087_D07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PBL01_0089_H02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0052_D12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LNG01_0080_D10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0212_A03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0064_A05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0104_H04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0100_H04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SMG01_0101_B05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LNG01_0092_H05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0002_C10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0084_C12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCAGAACCCTACA
OVRT1_0120_A10.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0046_D09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0021_C09.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0039_A04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0077_F07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVR01_0060_G01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0133_B02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0214_E04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0168_B02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0196_H11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0096_E06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0208_B12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0114_E11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0100_D01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0066_A01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0071_D03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0010_D08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0100_A08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0112_A06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0005_D07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0051_F11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0065_C12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0082_F11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0095_F07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0042_D02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0011_A07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0175_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0190_F11.b : TCAGTGGGAG*GTCTT*CGTAGCATTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0076_A09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0110_B03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
THY01_0126_G03.b : TCAGTGGGAG*GTCTT*CGTAGCATTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0140_G10.b : TCAGTGGGAGGGTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAAACCTACA
LVRM1_0191_G11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0072_E01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0066_A06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTTCTCCAGCCTCGCGGAACCCTACA
OVRM1_0150_G06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0200_C07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCCCCAGCCTCGCGGAACCCTACA
LVRM1_0014_G01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0162_B11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0171_F06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0150_B09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0211_H02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0116_G08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0165_B09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0199_B07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0085_G02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0001_F04.b : TCAGTGGGGG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0034_H01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0059_F03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0217_G03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0133_E11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0207_C12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0060_F06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0042_H04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0075_C08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0115_E01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0035_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0209_H07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0049_E08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0089_B02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0087_A05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0034_C06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0005_B03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0001_D06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0109_E02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0112_H12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0013_G05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0065_D04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0041_E08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0118_A05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0119_E03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0116_D08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0049_F09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0085_F12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0099_H11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0035_G11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0069_B02.b : TCAGT*GGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0064_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0126_B10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0090_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0212_B09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0070_E05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0083_G07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0184_B11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0064_G12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0030_E04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0087_B11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0185_E11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0069_B12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0011_H04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0096_C09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SMG01_0092_C04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0015_B12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SMG01_0063_H01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0125_H11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0132_C05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0090_B01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0105_H12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0096_B06.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0150_H05.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0144_E04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0108_F11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SMG01_0018_A04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0100_F02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
BFLT1_0125_D09.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVR01_0079_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0009_A06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0023_E01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0110_G04.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0107_D11.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0120_G10.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0097_E07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PCT01_0036_D05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0098_B12.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0113_G05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0035_G03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
CLNT1_0072_C04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0086_F02.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0095_D04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0084_D06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0020_H10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ADR01_0055_D02.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0077_G06.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0070_D03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0087_E12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
THY01_0022_B02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0042_E12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0046_F01.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0041_F07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCT****CCTCGCGGAACCCTACA
OVRT1_0018_F04.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0078_C07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0052_C03.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0065_G09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0017_C07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0028_E07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0023_H04.b : TCACTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
THY01_0071_F03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
UTR01_0068_E12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0013_A03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0093_B03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0070_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0093_H12.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRT1_0043_H01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0034_G07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ADR01_0052_D12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ADR01_0096_H10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0091_B03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ADR01_0057_C08.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ITT01_0047_H12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TCH01_0020_H12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVR01_0088_F01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SPL01_0099_D05.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0110_E03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0034_D07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0049_B08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0111_D12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0021_B11.b : TCAGTGGGAG*GTCTT*CCTTTAAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACC
KDN01_0049_B07.b : TCAGTGGGAG*GTCTTCCCCTTTAATCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0062_G10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0101_E02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0080_G09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0111_A03.b : TCAGTGGGAG*GTCCT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0083_F01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0092_A10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PCT01_0014_A08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCTCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0041_C09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0021_D01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCTTCGCGGAACCCTACA
PCT01_0015_A03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PCT01_0035_F03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0004_D12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0031_C02.b : TCAGTGGGAG*GTCTT*CGAGCCATTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0057_A01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0036_A01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0017_A11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0032_H09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
KDN01_0038_A04.b : TCAGTGGGAG*GTCTT*CGAGCCATTCACTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0091_H09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0007_H03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0028_D12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0026_D06.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0004_H05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0065_G08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0057_D09.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0019_F02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SMG01_0098_F09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0081_H07.b : TCAGTGGGAG*GTCTT*CGTACCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
LVRM1_0146_D06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0079_C09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0015_F07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
ADR01_0096_D11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
THY01_0113_A05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0192_C10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0079_E03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0077_B03.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0107_D06.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0107_A12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0031_G02.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0058_B12.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0100_B08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0032_F01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0069_D07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0102_H08.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0054_G01.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0019_E09.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0097_B05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0075_A07.b : TCAGTGGGAG*GTCTT*CGTACCATTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0046_F11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0096_A11.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0100_B04.b : TCAGTGGGAG*GTCTT*CGAGGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0021_B11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
SKNB1_0030_D07.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0085_B11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PST01_0027_D03.b : TCAGTGGGAG*GTCTT*CGACGCTGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0098_E05.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0027_D11.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0085_G10.b : TCAGTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
TES01_0047_F04.b : TCAGTGGGAG*GTCTT*CGTAGCACTCCCTTTGCTTCCTCCAGCCTCGCGGAACCCTACA
PCT01_0034_C11.b : TCANTGGGAG*GTCTT*CGTAGCAGTCCCTTCGCTTCCTCCAGCCTCGCGGAACCCTACA
OVRM1_0182_H08.b : gctccactacttggtggggaggggGTCCCTTCNCTTCCTCCANCCTCGCGGAACCCTACA
SPL01_0097_G02.b : nn
OVRM1_0122_G07.b :
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
---------+---------+---------+---------+---------+---------+ 194
DCI01_0046_F12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0040_B10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
UTR01_0085_C04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0043_C02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0218_H11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0020_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0082_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0174_E04.b : GGTTTCAGTCATGCGTGAGCGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0043_B10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SPL01_0012_H07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0203_G10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0091_E09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0002_A01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
THY01_0053_H06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0053_F06.b : GGTTCCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0098_A12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0215_B06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0181_D01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0018_F03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0130_F05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0131_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0115_F05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0092_G07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
MLN01_0087_D07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PBL01_0089_H02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0052_D12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LNG01_0080_D10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0212_A03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0064_A05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0104_H04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0100_H04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACATTGGCCAAGCTGGTGTCCAGATCG
SMG01_0101_B05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LNG01_0092_H05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0002_C10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0084_C12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0120_A10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0046_D09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0021_C09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTAGCCAAGCTGGTGTCCAGATCG
TES01_0039_A04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCGAGATCG
OVRT1_0077_F07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVR01_0060_G01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0133_B02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0214_E04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0168_B02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0196_H11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0096_E06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0208_B12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0114_E11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0100_D01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0066_A01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0071_D03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0010_D08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0100_A08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0112_A06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0005_D07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0051_F11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0065_C12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0082_F11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0095_F07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0042_D02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0011_A07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0175_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0190_F11.b : GGTTTCAGTCATGCGTGAGTGCATCATCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0076_A09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0110_B03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
THY01_0126_G03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0140_G10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0191_G11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0072_E01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0066_A06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0150_G06.b : GGTTTCAGTCACGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0200_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0014_G01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0162_B11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0171_F06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0150_B09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0211_H02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0116_G08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0165_B09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCATGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0199_B07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0085_G02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0001_F04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0034_H01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0059_F03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0217_G03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0133_E11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0207_C12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0060_F06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0042_H04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0075_C08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0115_E01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0035_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0209_H07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0049_E08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0089_B02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0087_A05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0034_C06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0005_B03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0001_D06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0109_E02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0112_H12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0013_G05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0065_D04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0041_E08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0118_A05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0119_E03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0116_D08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0049_F09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCNTCCACGTTGGCCAAGTTGGTGTCCAGATCG
OVRM1_0085_F12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0099_H11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0035_G11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0069_B02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0064_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCNTCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0126_B10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0090_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0212_B09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0070_E05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0083_G07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0184_B11.b : GGTTCCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0064_G12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCCTCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0030_E04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0087_B11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0185_E11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0069_B12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0011_H04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0096_C09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SMG01_0092_C04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0015_B12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SMG01_0063_H01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0125_H11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0132_C05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0090_B01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0105_H12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0096_B06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0150_H05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0144_E04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0108_F11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SMG01_0018_A04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0100_F02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
BFLT1_0125_D09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVR01_0079_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0009_A06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0023_E01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0110_G04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0107_D11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0120_G10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0097_E07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PCT01_0036_D05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0098_B12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0113_G05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0035_G03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
CLNT1_0072_C04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0086_F02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0095_D04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0084_D06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0020_H10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ADR01_0055_D02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0077_G06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0070_D03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0087_E12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
THY01_0022_B02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0042_E12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0046_F01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0041_F07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0018_F04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0078_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0052_C03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0065_G09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0017_C07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0028_E07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0023_H04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
THY01_0071_F03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
UTR01_0068_E12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0013_A03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0093_B03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0070_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0093_H12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRT1_0043_H01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0034_G07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ADR01_0052_D12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ADR01_0096_H10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0091_B03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ADR01_0057_C08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ITT01_0047_H12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TCH01_0020_H12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVR01_0088_F01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SPL01_0099_D05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0110_E03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0034_D07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0049_B08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0111_D12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0021_B11.b : TGTTTCAGTCATGCGTGGGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
KDN01_0049_B07.b : CGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0062_G10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0101_E02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0080_G09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0111_A03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0083_F01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0092_A10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PCT01_0014_A08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0041_C09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0021_D01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PCT01_0015_A03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PCT01_0035_F03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0004_D12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0031_C02.b : GGTCTCTGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0057_A01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0036_A01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0017_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCGGATCG
TES01_0032_H09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
KDN01_0038_A04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0091_H09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0007_H03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0028_D12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0026_D06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0004_H05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0065_G08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0057_D09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0019_F02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SMG01_0098_F09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0081_H07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
LVRM1_0146_D06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0079_C09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0015_F07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
ADR01_0096_D11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
THY01_0113_A05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0192_C10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0079_E03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0077_B03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0107_D06.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0107_A12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0031_G02.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0058_B12.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0100_B08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0032_F01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0069_D07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0102_H08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0054_G01.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCGTCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0019_E09.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0097_B05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0075_A07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0046_F11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0096_A11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0100_B04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0021_B11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SKNB1_0030_D07.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0085_B11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PST01_0027_D03.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0098_E05.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0027_D11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0085_G10.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
TES01_0047_F04.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
PCT01_0034_C11.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
OVRM1_0182_H08.b : GGTTTCAGTCATGCGTGAGTGCATC*TCCATCCACGTTGGCCAAGCTGGTGTCCAGATCG
SPL01_0097_G02.b : nttggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_G07.b : nagttgtcxxxxxx
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
---------+---------+---------+---------+---------+---------+ 254
DCI01_0046_F12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0040_B10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
UTR01_0085_C04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0043_C02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0218_H11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0020_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0082_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0174_E04.b : GCGATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0043_B10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SPL01_0012_H07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0203_G10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0091_E09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0002_A01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
THY01_0053_H06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0053_F06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0098_A12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0215_B06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0181_D01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0018_F03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0130_F05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0131_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTAGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0115_F05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0092_G07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
MLN01_0087_D07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PBL01_0089_H02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0052_D12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LNG01_0080_D10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0212_A03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0064_A05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0104_H04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0100_H04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SMG01_0101_B05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LNG01_0092_H05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0002_C10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGACGC
TES01_0084_C12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0120_A10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0046_D09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0021_C09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0039_A04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0077_F07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVR01_0060_G01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0133_B02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0214_E04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0168_B02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0196_H11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0096_E06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0208_B12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0114_E11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0100_D01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0066_A01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0071_D03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0010_D08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0100_A08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0112_A06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0005_D07.b : GCAATGCCTGCTAGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0051_F11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0065_C12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGGTGGCCAGATGC
TES01_0082_F11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0095_F07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0042_D02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0011_A07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0175_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0190_F11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0076_A09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0110_B03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
THY01_0126_G03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0140_G10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0191_G11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0072_E01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0066_A06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0150_G06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0200_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0014_G01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0162_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0171_F06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0150_B09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0211_H02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0116_G08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0165_B09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGACGC
OVRM1_0199_B07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0085_G02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0001_F04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGACGGCCAGATGC
OVRM1_0034_H01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0059_F03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0217_G03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0133_E11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0207_C12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0060_F06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0042_H04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0075_C08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0115_E01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0035_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0209_H07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0049_E08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0089_B02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0087_A05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0034_C06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0005_B03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0001_D06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0109_E02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0112_H12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0013_G05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0065_D04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0041_E08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0118_A05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0119_E03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0116_D08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0049_F09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0085_F12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0099_H11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0035_G11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0069_B02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0064_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0126_B10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0090_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0212_B09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0070_E05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0083_G07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0184_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0064_G12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0030_E04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0087_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0185_E11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0069_B12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0011_H04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0096_C09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGT
SMG01_0092_C04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0015_B12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SMG01_0063_H01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0125_H11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0132_C05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0090_B01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0105_H12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0096_B06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0150_H05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0144_E04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0108_F11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SMG01_0018_A04.b : GCAATACCTGCTGGGAGCTCTACTGCCTGGAACACAGCATCCAGCCCGATGGCCAGATGC
ITT01_0100_F02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
BFLT1_0125_D09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVR01_0079_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0009_A06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0023_E01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0110_G04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0107_D11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0120_G10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0097_E07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PCT01_0036_D05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0098_B12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0113_G05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0035_G03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
CLNT1_0072_C04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0086_F02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0095_D04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0084_D06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0020_H10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ADR01_0055_D02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0077_G06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0070_D03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0087_E12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
THY01_0022_B02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0042_E12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0046_F01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0041_F07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0018_F04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0078_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0052_C03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0065_G09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0017_C07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0028_E07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0023_H04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
THY01_0071_F03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
UTR01_0068_E12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0013_A03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0093_B03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0070_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0093_H12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRT1_0043_H01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0034_G07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ADR01_0052_D12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ADR01_0096_H10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0091_B03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ADR01_0057_C08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ITT01_0047_H12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TCH01_0020_H12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVR01_0088_F01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SPL01_0099_D05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0110_E03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0034_D07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0049_B08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0111_D12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0021_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
KDN01_0049_B07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0062_G10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGACCAGATGC
TES01_0101_E02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0080_G09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0111_A03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0083_F01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0092_A10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCGGCCCGATGGCCAGATGC
PCT01_0014_A08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0041_C09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0021_D01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PCT01_0015_A03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PCT01_0035_F03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0004_D12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0031_C02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGG
TES01_0057_A01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0036_A01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0017_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0032_H09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
KDN01_0038_A04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGG
SKNB1_0091_H09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0007_H03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0028_D12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0026_D06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0004_H05.b : GCAATGTCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0065_G08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0057_D09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0019_F02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SMG01_0098_F09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0081_H07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
LVRM1_0146_D06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0079_C09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0015_F07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
ADR01_0096_D11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
THY01_0113_A05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0192_C10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0079_E03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0077_B03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0107_D06.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0107_A12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0031_G02.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0058_B12.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0100_B08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0032_F01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0069_D07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0102_H08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0054_G01.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0019_E09.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0097_B05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0075_A07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0046_F11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0096_A11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0100_B04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0021_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SKNB1_0030_D07.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0085_B11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PST01_0027_D03.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0098_E05.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0027_D11.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0085_G10.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
TES01_0047_F04.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
PCT01_0034_C11.b : GCAATGCCTACTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0182_H08.b : GCAATGCCTGCTGGGAGCTCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
SPL01_0097_G02.b : xxxxxxxxxxxxxxxxxxxCTACTGCCTGGAACACGGCATCCAGCCCGATGGCCAGATGC
OVRM1_0122_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGATGGCCAGATGC
TES01_0057_H08.b :
OVRM1_0204_A07.b :
ITT01_0053_E04.b :
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
---------+---------+---------+---------+---------+---------+ 313
DCI01_0046_F12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0040_B10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
UTR01_0085_C04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0043_C02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0218_H11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTTCTTCAACACCTTCTTCAGTGAGACA
OVR01_0020_C07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0082_C07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0174_E04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0043_B10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SPL01_0012_H07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0203_G10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0091_E09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0002_A01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
THY01_0053_H06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0053_F06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0098_A12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0215_B06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0181_D01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0018_F03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0130_F05.b : CGAGTGACAAGACCATTGGNGGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0131_C07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0115_F05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0092_G07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
MLN01_0087_D07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PBL01_0089_H02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0052_D12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LNG01_0080_D10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0212_A03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0064_A05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0104_H04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0100_H04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SMG01_0101_B05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LNG01_0092_H05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0002_C10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0084_C12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0120_A10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0046_D09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0021_C09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0039_A04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0077_F07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVR01_0060_G01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0133_B02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0214_E04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0168_B02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0196_H11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0096_E06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0208_B12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0114_E11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0100_D01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0066_A01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0071_D03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0010_D08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0100_A08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0112_A06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0005_D07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0051_F11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0065_C12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0082_F11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0095_F07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0042_D02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0011_A07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0175_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0190_F11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAAGACCTTCTTCAATGAGACA
OVRM1_0076_A09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0110_B03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
THY01_0126_G03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACG
OVRM1_0140_G10.b : CGAG*GACAAAACAATTGG*TGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGATACA
LVRM1_0191_G11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0072_E01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0066_A06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0150_G06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0200_C07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0014_G01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0162_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0171_F06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0150_B09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0211_H02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0116_G08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0165_B09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0199_B07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0085_G02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0001_F04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0034_H01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0059_F03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0217_G03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0133_E11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0207_C12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0060_F06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0042_H04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0075_C08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0115_E01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0035_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0209_H07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0049_E08.b : CGAGTGACAAGACCAAGGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0089_B02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0087_A05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0034_C06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0005_B03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0001_D06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0109_E02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0112_H12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0013_G05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0065_D04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0041_E08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0118_A05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0119_E03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0116_D08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0049_F09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0085_F12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0099_H11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0035_G11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0069_B02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGGCA
OVRM1_0064_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0126_B10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0090_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0212_B09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0070_E05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0083_G07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0184_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0064_G12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0030_E04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0087_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0185_E11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0069_B12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0011_H04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0096_C09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SMG01_0092_C04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0015_B12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SMG01_0063_H01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCCTCTTCAGTGAGACA
OVRT1_0125_H11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0132_C05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0090_B01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0105_H12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0096_B06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0150_H05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0144_E04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0108_F11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SMG01_0018_A04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0100_F02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
BFLT1_0125_D09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVR01_0079_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0009_A06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0023_E01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0110_G04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0107_D11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0120_G10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0097_E07.b : CGAGTGACAAAACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PCT01_0036_D05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0098_B12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0113_G05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0035_G03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
CLNT1_0072_C04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0086_F02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0095_D04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0084_D06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0020_H10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ADR01_0055_D02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0077_G06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0070_D03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0087_E12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
THY01_0022_B02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0042_E12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0046_F01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0041_F07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0018_F04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0078_C07.b : CGAGTGACAAGACCATTGG*GGGGGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0052_C03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0065_G09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0017_C07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0028_E07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0023_H04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
THY01_0071_F03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
UTR01_0068_E12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0013_A03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0093_B03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0070_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0093_H12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRT1_0043_H01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0034_G07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ADR01_0052_D12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ADR01_0096_H10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0091_B03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ADR01_0057_C08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ITT01_0047_H12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TCH01_0020_H12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVR01_0088_F01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SPL01_0099_D05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0110_E03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0034_D07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0049_B08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0111_D12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0021_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
KDN01_0049_B07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0062_G10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0101_E02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0080_G09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0111_A03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0083_F01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0092_A10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PCT01_0014_A08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0041_C09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0021_D01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PCT01_0015_A03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PCT01_0035_F03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0004_D12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0031_C02.b : GGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0057_A01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0036_A01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0017_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0032_H09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
KDN01_0038_A04.b : GGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0091_H09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0007_H03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0028_D12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0026_D06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0004_H05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0065_G08.b : CGAGTGGCAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0057_D09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0019_F02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SMG01_0098_F09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0081_H07.b : CTAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
LVRM1_0146_D06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0079_C09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0015_F07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
ADR01_0096_D11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
THY01_0113_A05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0192_C10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0079_E03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0077_B03.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0107_D06.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0107_A12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0031_G02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0058_B12.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0100_B08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0032_F01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0069_D07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0102_H08.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0054_G01.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0019_E09.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0097_B05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0075_A07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0046_F11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0096_A11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0100_B04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0021_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SKNB1_0030_D07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0085_B11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PST01_0027_D03.b : CGAGTGACAAGACCACTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0098_E05.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0027_D11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0085_G10.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0047_F04.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
PCT01_0034_C11.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0182_H08.b : CGAGTGACAAGACCATTAG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
SPL01_0097_G02.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
OVRM1_0122_G07.b : CGAGTGACAAGACCATTGG*GGGAGGAGATGACTCCTTCAACACCTTCTTCAGTGAGACA
TES01_0057_H08.b : ttctgctgtggctatggcccttcttcGTGAGACA
OVRM1_0204_A07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_E04.b : nngggttaacax
ITT01_0028_E04.b :
PBL01_0095_G02.b :
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
---------+---------+---------+---------+---------+---------+ 373
DCI01_0046_F12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0040_B10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
UTR01_0085_C04.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0043_C02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0218_H11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0020_C07.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0082_C07.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0174_E04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0043_B10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SPL01_0012_H07.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0203_G10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0091_E09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0002_A01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
THY01_0053_H06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0053_F06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0098_A12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAAACCTGGAACCCACAGTCAATGAT
OVRM1_0215_B06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0181_D01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0018_F03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0130_F05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0131_C07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0115_F05.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0092_G07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
MLN01_0087_D07.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PBL01_0089_H02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0052_D12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LNG01_0080_D10.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0212_A03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0064_A05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0104_H04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0100_H04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SMG01_0101_B05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LNG01_0092_H05.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0002_C10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0084_C12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0120_A10.b : GGAGCTGACAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0046_D09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0021_C09.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0039_A04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0077_F07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVR01_0060_G01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0133_B02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0214_E04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0168_B02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0196_H11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0096_E06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0208_B12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0114_E11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0100_D01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0066_A01.b : GGCGCTGGCAAGCATGTGCCCGGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0071_D03.b : GGAGCTGGCAAGCACGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0010_D08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SKNB1_0100_A08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0112_A06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0005_D07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0051_F11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0065_C12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0082_F11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0095_F07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0042_D02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0011_A07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0175_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0190_F11.b : GGCGCTAGCAAGCATGTGCCCAGGGCAGTGTTTGTACACCTGAAAACCACAGTCATTGAT
OVRM1_0076_A09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0110_B03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGCCATTGAT
THY01_0126_G03.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0140_G10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGCCATTGAT
LVRM1_0191_G11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0072_E01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0066_A06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0150_G06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0200_C07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0014_G01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0162_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0171_F06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0150_B09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0211_H02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0116_G08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0165_B09.b : GGCGCTGGCAAGCAAGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0199_B07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0085_G02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0001_F04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0034_H01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0059_F03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0217_G03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0133_E11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0207_C12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0060_F06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0042_H04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0075_C08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0115_E01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0035_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0209_H07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0049_E08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0089_B02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0087_A05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0034_C06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0005_B03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0001_D06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0109_E02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0112_H12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACTCACAGTCATTGAT
OVRM1_0013_G05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0065_D04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0041_E08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0118_A05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0119_E03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0116_D08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0049_F09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0085_F12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0099_H11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0035_G11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0069_B02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0064_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0126_B10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0090_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0212_B09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0070_E05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0083_G07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0184_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0064_G12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0030_E04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0087_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0185_E11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTTGACCTGGAACCCACAGTCATTGAT
OVRM1_0069_B12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0011_H04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0096_C09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SMG01_0092_C04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0015_B12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SMG01_0063_H01.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0125_H11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTCTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0132_C05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0090_B01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0105_H12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCACTGAT
OVRT1_0096_B06.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0150_H05.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0144_E04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0108_F11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SMG01_0018_A04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0100_F02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
BFLT1_0125_D09.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVR01_0079_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0009_A06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0023_E01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0110_G04.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0107_D11.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0120_G10.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0097_E07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PCT01_0036_D05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0098_B12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0113_G05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0035_G03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
CLNT1_0072_C04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0086_F02.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0095_D04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0084_D06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0020_H10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ADR01_0055_D02.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0077_G06.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0070_D03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0087_E12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
THY01_0022_B02.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0042_E12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0046_F01.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0041_F07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0018_F04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0078_C07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0052_C03.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0065_G09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0017_C07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0028_E07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0023_H04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
THY01_0071_F03.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
UTR01_0068_E12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0013_A03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0093_B03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0070_A11.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0093_H12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRT1_0043_H01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0034_G07.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ADR01_0052_D12.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ADR01_0096_H10.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0091_B03.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCGCAGTCATTGAT
ADR01_0057_C08.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ITT01_0047_H12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TCH01_0020_H12.b : GGAGCTGGCAAGCACGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVR01_0088_F01.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SPL01_0099_D05.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0110_E03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0034_D07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0049_B08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0111_D12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SKNB1_0021_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
KDN01_0049_B07.b : GGAGCTGGCAAGCTTGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0062_G10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0101_E02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0080_G09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0111_A03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0083_F01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0092_A10.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PCT01_0014_A08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGCAGACCTGGAACCCACAGTCATTGAT
SKNB1_0041_C09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0021_D01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PCT01_0015_A03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PCT01_0035_F03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0004_D12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0031_C02.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0057_A01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0036_A01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0017_A11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0032_H09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
KDN01_0038_A04.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SKNB1_0091_H09.b : GGCGCTGGTAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0007_H03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0028_D12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0026_D06.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0004_H05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0065_G08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0057_D09.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SKNB1_0019_F02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SMG01_0098_F09.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0081_H07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
LVRM1_0146_D06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0079_C09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0015_F07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
ADR01_0096_D11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
THY01_0113_A05.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0192_C10.b : GGCGCTGGCAAGCATGTGCC*AGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0079_E03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0077_B03.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0107_D06.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0107_A12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTCTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0031_G02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0058_B12.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0100_B08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0032_F01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SKNB1_0069_D07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0102_H08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0054_G01.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0019_E09.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0097_B05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0075_A07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0046_F11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0096_A11.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0100_B04.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0021_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAGCCCACAGTCATTGAT
SKNB1_0030_D07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0085_B11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PST01_0027_D03.b : GGAGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0098_E05.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0027_D11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0085_G10.b : GGCGCTGGCAAGCATGTGCCCAGGACAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0047_F04.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
PCT01_0034_C11.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0182_H08.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
SPL01_0097_G02.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0122_G07.b : GGCGCTGGCAAGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
TES01_0057_H08.b : GGCGCTGGC*AGCATGTGCCCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATTGAT
OVRM1_0204_A07.b : xxxxxxxxxxxxxxxxxxxxCAGGGCAGTGTTTGTAGACCTGGAACCCACAGTCATCGAT
ITT01_0053_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACCCACAGTCATTGAT
ITT01_0028_E04.b : nnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAT
PBL01_0095_G02.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0109_G08.b :
ADR01_0008_C05.b :
SPL01_0072_E09.b :
20110601C-000430 : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
---------+---------+---------+---------+---------+---------+ 433
DCI01_0046_F12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0040_B10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
UTR01_0085_C04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0043_C02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0218_H11.b : GAAGTCCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0020_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0082_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0174_E04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0043_B10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SPL01_0012_H07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0203_G10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0091_E09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0002_A01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
THY01_0053_H06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0053_F06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0098_A12.b : GAAGTTCGCAATGGCACCTACCGCCAGCTCTTCCACaatggacaacttatcagtaggaag
OVRM1_0215_B06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0181_D01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAAGCAAG
OVRM1_0018_F03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0130_F05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0131_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0115_F05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0092_G07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
MLN01_0087_D07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PBL01_0089_H02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0052_D12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LNG01_0080_D10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0212_A03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0064_A05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCNAG
OVRM1_0104_H04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0100_H04.b : GAAGTTCGCACTGGCACCTACGGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SMG01_0101_B05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LNG01_0092_H05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0002_C10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0084_C12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0120_A10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0046_D09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0021_C09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0039_A04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0077_F07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVR01_0060_G01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0133_B02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0214_E04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0168_B02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0196_H11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0096_E06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0208_B12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0114_E11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0100_D01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0066_A01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0071_D03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0010_D08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0100_A08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0112_A06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCGCCCTGAGCAGCTCATCACAGGCAAG
TES01_0005_D07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0051_F11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0065_C12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACATGCAAG
TES01_0082_F11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0095_F07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0042_D02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0011_A07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0175_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAAGCAAG
OVRM1_0190_F11.b : GAAATTCGCACTGGCACATACCGCCAGCTCTTCCACCCTGAACAGCTCATCACAGGCAAG
OVRM1_0076_A09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0110_B03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
THY01_0126_G03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0140_G10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0191_G11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0072_E01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0066_A06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0150_G06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0200_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0014_G01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0162_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0171_F06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0150_B09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0211_H02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0116_G08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0165_B09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0199_B07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0085_G02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0001_F04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0034_H01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0059_F03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0217_G03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0133_E11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0207_C12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0060_F06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0042_H04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0075_C08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0115_E01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0035_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0209_H07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0049_E08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0089_B02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0087_A05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0034_C06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0005_B03.b : GAAGTTCGCACTGGCACCTACCGCCAGCCCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0001_D06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0109_E02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0112_H12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0013_G05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0065_D04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0041_E08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0118_A05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0119_E03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0116_D08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0049_F09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCNAG
OVRM1_0085_F12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0099_H11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0035_G11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0069_B02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0064_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCNAG
LVRM1_0126_B10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0090_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0212_B09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0070_E05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0083_G07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0184_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0064_G12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0030_E04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0087_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0185_E11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0069_B12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0011_H04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0096_C09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SMG01_0092_C04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0015_B12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SMG01_0063_H01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0125_H11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0132_C05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0090_B01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0105_H12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0096_B06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0150_H05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0144_E04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0108_F11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SMG01_0018_A04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0100_F02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
BFLT1_0125_D09.b : GAACTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVR01_0079_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0009_A06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0023_E01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0110_G04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0107_D11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0120_G10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0097_E07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PCT01_0036_D05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0098_B12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0113_G05.b : GAAGTTCGCACTGGCACCTACCGCCAGCCCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0035_G03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
CLNT1_0072_C04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0086_F02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0095_D04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0084_D06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0020_H10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ADR01_0055_D02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0077_G06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0070_D03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0087_E12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
THY01_0022_B02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0042_E12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0046_F01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0041_F07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0018_F04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0078_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0052_C03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0065_G09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0017_C07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0028_E07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0023_H04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
THY01_0071_F03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
UTR01_0068_E12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0013_A03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0093_B03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0070_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0093_H12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRT1_0043_H01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0034_G07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ADR01_0052_D12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ADR01_0096_H10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0091_B03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ADR01_0057_C08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0047_H12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TCH01_0020_H12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVR01_0088_F01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SPL01_0099_D05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0110_E03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGTAAG
TES01_0034_D07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0049_B08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0111_D12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0021_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGTAAT
KDN01_0049_B07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0062_G10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0101_E02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0080_G09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0111_A03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0083_F01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0092_A10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PCT01_0014_A08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCTACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0041_C09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0021_D01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PCT01_0015_A03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PCT01_0035_F03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCGCAGGCAAG
PST01_0004_D12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0031_C02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0057_A01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCCGAGCAGCTCATCACAGGCAAG
TES01_0036_A01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0017_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0032_H09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
KDN01_0038_A04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0091_H09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0007_H03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0028_D12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0026_D06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0004_H05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0065_G08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0057_D09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0019_F02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SMG01_0098_F09.b : GAAGTTCGCACTGGCACCCTACGCCAGCTCTTTCCACCTGAGCAGCTCATCACAGGGCAG
TES01_0081_H07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
LVRM1_0146_D06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0079_C09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0015_F07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTTATCACAGGCAAG
ADR01_0096_D11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
THY01_0113_A05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0192_C10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0079_E03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0077_B03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0107_D06.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0107_A12.b : GAAGTTCGCACTGGCATCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0031_G02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0058_B12.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0100_B08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0032_F01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0069_D07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0102_H08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0054_G01.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0019_E09.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0097_B05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0075_A07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0046_F11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0096_A11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0100_B04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0021_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SKNB1_0030_D07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0085_B11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PST01_0027_D03.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0098_E05.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0027_D11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0085_G10.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0047_F04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PCT01_0034_C11.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0182_H08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
SPL01_0097_G02.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0122_G07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0057_H08.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
OVRM1_0204_A07.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0053_E04.b : GAAGTTCGCGCTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
ITT01_0028_E04.b : GAAGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
PBL01_0095_G02.b : xxxGTTCGCACTGGCACCTACCGCCAGCTCTTCCACCCTGAGCAGCTCATCACAGGCAAG
TES01_0109_G08.b : cgcgttggctctggtggGCTGAGCAGCTCATC*CAGGCAAG
ADR01_0008_C05.b : nnnttatgaacaxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0072_E09.b : ttttggtctgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000430 : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
---------+---------+---------+---------+---------+---------+ 492
DCI01_0046_F12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCACTGGCAAGGAGATCATT*GA
TES01_0040_B10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
UTR01_0085_C04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0043_C02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0218_H11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0020_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0082_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0174_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0043_B10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SPL01_0012_H07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0203_G10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0091_E09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0002_A01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
THY01_0053_H06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0053_F06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0098_A12.b : gaccacacaaggtaaaaagaggcccgaggtcactacacaattagcaagtgccacccgtgg
OVRM1_0215_B06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0181_D01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0018_F03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0130_F05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0131_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0115_F05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0092_G07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
MLN01_0087_D07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PBL01_0089_H02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0052_D12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LNG01_0080_D10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0212_A03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0064_A05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0104_H04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0100_H04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SMG01_0101_B05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LNG01_0092_H05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0002_C10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0084_C12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0120_A10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0046_D09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0021_C09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0039_A04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0077_F07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVR01_0060_G01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0133_B02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0214_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0168_B02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0196_H11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0096_E06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0208_B12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0114_E11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0100_D01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0066_A01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0071_D03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0010_D08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0100_A08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0112_A06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0005_D07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0051_F11.b : GAAGATGCTGCCAATAACTATGCCCGAGATCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0065_C12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0082_F11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0095_F07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0042_D02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0011_A07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0175_A11.b : GAACATGCTGCCAATAACTATGCCCGACGTCACTAAACCAGTGGCAAGGAGATCATgaac
OVRM1_0190_F11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0076_A09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0110_B03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGCGCAGGAGATCATT*GA
THY01_0126_G03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0140_G10.b : GAAGATGCTGCCAATAACTATGCCCGAAGTCACTACACCATGTGCAAGGAGATCATT*GG
LVRM1_0191_G11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0072_E01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0066_A06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0150_G06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0200_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0014_G01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0162_B11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0171_F06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0150_B09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0211_H02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0116_G08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATCGGCAAGGAGATCATT*GA
OVRM1_0165_B09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0199_B07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0085_G02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0001_F04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0034_H01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0059_F03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0217_G03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0133_E11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0207_C12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0060_F06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0042_H04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0075_C08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0115_E01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0035_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0209_H07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0049_E08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0089_B02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0087_A05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0034_C06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0005_B03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0001_D06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0109_E02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGGGATCATT*GA
OVRM1_0112_H12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0013_G05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCTCTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0065_D04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0041_E08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0118_A05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0119_E03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0116_D08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0049_F09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0085_F12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0099_H11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0035_G11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0069_B02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0064_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0126_B10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0090_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0212_B09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0070_E05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0083_G07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0184_B11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0064_G12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0030_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0087_B11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0185_E11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0069_B12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0011_H04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0096_C09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SMG01_0092_C04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0015_B12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SMG01_0063_H01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0125_H11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0132_C05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0090_B01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0105_H12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0096_B06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0150_H05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0144_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0108_F11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGACCATT*GA
SMG01_0018_A04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0100_F02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
BFLT1_0125_D09.b : GAAGATGCTGTCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVR01_0079_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0009_A06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0023_E01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0110_G04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0107_D11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GT
OVRT1_0120_G10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0097_E07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PCT01_0036_D05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0098_B12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0113_G05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0035_G03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
CLNT1_0072_C04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0086_F02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0095_D04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0084_D06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0020_H10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ADR01_0055_D02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0077_G06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0070_D03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0087_E12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
THY01_0022_B02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0042_E12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0046_F01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0041_F07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0018_F04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0078_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0052_C03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0065_G09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAGGGAGATCATT*GA
TES01_0017_C07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0028_E07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0023_H04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
THY01_0071_F03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
UTR01_0068_E12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0013_A03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0093_B03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0070_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0093_H12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRT1_0043_H01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0034_G07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ADR01_0052_D12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ADR01_0096_H10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0091_B03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ADR01_0057_C08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0047_H12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TCH01_0020_H12.b : GAAGATGCCGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVR01_0088_F01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SPL01_0099_D05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0110_E03.b : GAAGATGCTGCCAATCACTATGCCCGAGGCCACTACACCACTGGCAAGGAGATCATT*GA
TES01_0034_D07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
LVRM1_0049_B08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0111_D12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0021_B11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
KDN01_0049_B07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0062_G10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0101_E02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0080_G09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0111_A03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0083_F01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0092_A10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PCT01_0014_A08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0041_C09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0021_D01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PCT01_0015_A03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PCT01_0035_F03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0004_D12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0031_C02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0057_A01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0036_A01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0017_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GG
TES01_0032_H09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
KDN01_0038_A04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0091_H09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0007_H03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0028_D12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0026_D06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0004_H05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0065_G08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0057_D09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0019_F02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SMG01_0098_F09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGGCAGGgagatcaatgg
TES01_0081_H07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCTCTACACCATTGGCAAGGAGATCATTTGA
LVRM1_0146_D06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0079_C09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0015_F07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ADR01_0096_D11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
THY01_0113_A05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0192_C10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0079_E03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0077_B03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0107_D06.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0107_A12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0031_G02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0058_B12.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0100_B08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0032_F01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0069_D07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0102_H08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0054_G01.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0019_E09.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0097_B05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0075_A07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0046_F11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0096_A11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0100_B04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0021_B11.b : GAAGATACTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SKNB1_0030_D07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGAAGATCATT*GA
PST01_0085_B11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PST01_0027_D03.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0098_E05.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0027_D11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0085_G10.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0047_F04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PCT01_0034_C11.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0182_H08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SPL01_0097_G02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0122_G07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0057_H08.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
OVRM1_0204_A07.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0053_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
ITT01_0028_E04.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
PBL01_0095_G02.b : GAAGATGCTGCCAATAACTATGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
TES01_0109_G08.b : GAAGATGCTGCCA*TAACTATGCCCGAGGTCACTACACCATTGGTAAGGAGATCATT*GA
ADR01_0008_C05.b : xxxxxxxxxxxxxxxxxxxxTGCCCGAGGTCACTACACCATTGGCAAGGAGATCATT*GA
SPL01_0072_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCATTGGCAAGGAGATCATT*GA
20110601C-000430 : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
---------+---------+---------+---------+---------+---------+ 551
DCI01_0046_F12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0040_B10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
UTR01_0085_C04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0043_C02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACGGGTCTTCAGGGCTTCT
OVRM1_0218_H11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0020_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0082_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0174_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0043_B10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SPL01_0012_H07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0203_G10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCGGGGCTTCT
OVR01_0091_E09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0002_A01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
THY01_0053_H06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0053_F06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0098_A12.b : agacaggaaagagactagaccatatatcgagtaaccgagggctgtccgattaaacccccg
OVRM1_0215_B06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0181_D01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0018_F03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0130_F05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0131_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0115_F05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0092_G07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
MLN01_0087_D07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PBL01_0089_H02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0052_D12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LNG01_0080_D10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0212_A03.b : CCTCGGCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0064_A05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0104_H04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0100_H04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SMG01_0101_B05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LNG01_0092_H05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0002_C10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0084_C12.b : CCTCGTCTTGGACCGAATTCTGAAACTGGCTGACC*AGTGCACAGGTCTTCAAGGCTTCT
OVRT1_0120_A10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0046_D09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0021_C09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0039_A04.b : CCTCGTCTTGGACCGAAT*CGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0077_F07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVR01_0060_G01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0133_B02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0214_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0168_B02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0196_H11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0096_E06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0208_B12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0114_E11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0100_D01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0066_A01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0071_D03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0010_D08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0100_A08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0112_A06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0005_D07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0051_F11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0065_C12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0082_F11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0095_F07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0042_D02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0011_A07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0175_A11.b : acatccgggaccgaattcggagaccggatgaactgagcacaggtcctatcgagttcctgg
OVRM1_0190_F11.b : CCTCGTCTTGGACAGAATTCGGAAACTGGCTGACC*AATGCACAGGTCTTCAAGGCTTCT
OVRM1_0076_A09.b : CCTCGTCTTGGACCGAATTCAGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGACTTCT
OVRM1_0110_B03.b : CCTCGTCTTGTGACGAATTCGGAAACTGGCTGTAC*AGTGCACAGGTCTCCAGGACTTCT
THY01_0126_G03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCACGGCTTCT
OVRM1_0140_G10.b : ACTCGTCTTGGACCGAATTCTGAAACTGGCTGACC*A*TGCACAGGTCTTCCAGGCTTCT
LVRM1_0191_G11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0072_E01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0066_A06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0150_G06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0200_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0014_G01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0162_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0171_F06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0150_B09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0211_H02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0116_G08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0165_B09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0199_B07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0085_G02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0001_F04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0034_H01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0059_F03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0217_G03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0133_E11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0207_C12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0060_F06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0042_H04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0075_C08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0115_E01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0035_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0209_H07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0049_E08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0089_B02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0087_A05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0034_C06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0005_B03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0001_D06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0109_E02.b : CCTCGTCTTGGACCGAATTAGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0112_H12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0013_G05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0065_D04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0041_E08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0118_A05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0119_E03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0116_D08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0049_F09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0085_F12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0099_H11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0035_G11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0069_B02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0064_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0126_B10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0090_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0212_B09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0070_E05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0083_G07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0184_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0064_G12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0030_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACCAGTTGCACAGGTTTTCAGGGCTTCT
OVRM1_0087_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0185_E11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0069_B12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0011_H04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0096_C09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SMG01_0092_C04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0015_B12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SMG01_0063_H01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0125_H11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0132_C05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0090_B01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0105_H12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0096_B06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0150_H05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0144_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0108_F11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SMG01_0018_A04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0100_F02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
BFLT1_0125_D09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVR01_0079_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0009_A06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0023_E01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0110_G04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0107_D11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0120_G10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0097_E07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PCT01_0036_D05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0098_B12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0113_G05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0035_G03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
CLNT1_0072_C04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0086_F02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0095_D04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0084_D06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0020_H10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0055_D02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0077_G06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0070_D03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0087_E12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
THY01_0022_B02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0042_E12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0046_F01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0041_F07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0018_F04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0078_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0052_C03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0065_G09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCCTCAGGGCTTCT
TES01_0017_C07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0028_E07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0023_H04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
THY01_0071_F03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
UTR01_0068_E12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0013_A03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0093_B03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0070_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0093_H12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRT1_0043_H01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0034_G07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0052_D12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0096_H10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0091_B03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0057_C08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0047_H12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TCH01_0020_H12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVR01_0088_F01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SPL01_0099_D05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0110_E03.b : CCTCTTCTTGGACCTAATTCTGAAACTGGCTGACCTAGTGCACAGGACTTCACGGCTTCT
TES01_0034_D07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
LVRM1_0049_B08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0111_D12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0021_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
KDN01_0049_B07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0062_G10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0101_E02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0080_G09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0111_A03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0083_F01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0092_A10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PCT01_0014_A08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0041_C09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0021_D01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PCT01_0015_A03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PCT01_0035_F03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0004_D12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0031_C02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0057_A01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0036_A01.b : CCTCGTCTTGGACCGAAT*CGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0017_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0032_H09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
KDN01_0038_A04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0091_H09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0007_H03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0028_D12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0026_D06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0004_H05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0065_G08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0057_D09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0019_F02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SMG01_0098_F09.b : actcgtcctggaacgaattcgggaacttggctgaccattggaacaggttttcagggcttc
TES01_0081_H07.b : CCTCGTCTTGGACCTAATTCAGAAACTGGCTGTAC*ATTGCACATGTCTTCTAGGCTTCT
LVRM1_0146_D06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0079_C09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0015_F07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0096_D11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTTT
THY01_0113_A05.b : CCTCGTCTTGGACCGAATTCGGGAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0192_C10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0079_E03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0077_B03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0107_D06.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0107_A12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0031_G02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0058_B12.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0100_B08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0032_F01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0069_D07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0102_H08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0054_G01.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0019_E09.b : CCTCGTCTTGGACCGAATTCGGAAACCGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0097_B05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0075_A07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0046_F11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0096_A11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0100_B04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0021_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SKNB1_0030_D07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0085_B11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PST01_0027_D03.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0098_E05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0027_D11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0085_G10.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0047_F04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PCT01_0034_C11.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0182_H08.b : CCTCGTCATGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SPL01_0097_G02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCCGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0122_G07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0057_H08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
OVRM1_0204_A07.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0053_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ITT01_0028_E04.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
PBL01_0095_G02.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
TES01_0109_G08.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
ADR01_0008_C05.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCAGGGCTTCT
SPL01_0072_E09.b : CCTCGTCTTGGACCGAATTCGGAAACTGGCTGACC*AGTGCACAGGTCTTCGGGGCTTCT
20110601C-000430 : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
---------+---------+---------+---------+---------+---------+ 609
DCI01_0046_F12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0040_B10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
UTR01_0085_C04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0043_C02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0218_H11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0020_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0082_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0174_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0043_B10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SPL01_0012_H07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0203_G10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0091_E09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0002_A01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
THY01_0053_H06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0053_F06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0098_A12.b : agcatacttaacccaaacgcccaaaagataagataggaagataaggacggaaaaccncaa
OVRM1_0215_B06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0181_D01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0018_F03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0130_F05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0131_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0115_F05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0092_G07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
MLN01_0087_D07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PBL01_0089_H02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0052_D12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LNG01_0080_D10.b : TGATTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0212_A03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0064_A05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0104_H04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0100_H04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SMG01_0101_B05.b : TGGTTTTCCACAGCTTTGGCGGGGGAGC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LNG01_0092_H05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0002_C10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0084_C12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0120_A10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0046_D09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0021_C09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0039_A04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0077_F07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVR01_0060_G01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0133_B02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGCTCTGGT*TTCACCTCCCTGCTGATGGA
OVRM1_0214_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0168_B02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0196_H11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0096_E06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0208_B12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0114_E11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0100_D01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0066_A01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0071_D03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0010_D08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0100_A08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0112_A06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0005_D07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0051_F11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0065_C12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0082_F11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0095_F07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0042_D02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0011_A07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0175_A11.b : tattacaccgcgttgaccgggggaaggggatccgtaatatacatcatatcccgccaccag
OVRM1_0190_F11.b : TGGTTTTCCACAGCTCTGACAGGGGAAC*GGGCTATGGA*TACACCTCCCGGCAGATGGA
OVRM1_0076_A09.b : TGGTTTTTCACAGCTTTTTGAGAGAAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATAGA
OVRM1_0110_B03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGTTTCTGGG*CTCACCTCCCTGCTTGAGGA
THY01_0126_G03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0140_G10.b : TGGGTTTCCACAGCTTTGGCGGGGGAACAGGGTTCTGGGGTTCACTCCCCTGCCGATGGA
LVRM1_0191_G11.b : TGGTTTTCCACAGCTTTGGCGGGGGGAA*CGGGTTCTGG*TTCACCTCCCTGCTGATGGA
OVRM1_0072_E01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTTCCTGCTGATGGA
OVRM1_0066_A06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0150_G06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0200_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0014_G01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0162_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCAGCTGATGGA
OVRM1_0171_F06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0150_B09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0211_H02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0116_G08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0165_B09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0199_B07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0085_G02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0001_F04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0034_H01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGCTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0059_F03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0217_G03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0133_E11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0207_C12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0060_F06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0042_H04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0075_C08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0115_E01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0035_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0209_H07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0049_E08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0089_B02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0087_A05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0034_C06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0005_B03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0001_D06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TCCACCTCCCTGCTGATGGA
OVRM1_0109_E02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0112_H12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0013_G05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0065_D04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0041_E08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0118_A05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0119_E03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0116_D08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0049_F09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0085_F12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0099_H11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0035_G11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0069_B02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0064_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0126_B10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0090_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0212_B09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0070_E05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0083_G07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0184_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0064_G12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0030_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*CGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0087_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0185_E11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0069_B12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0011_H04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0096_C09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SMG01_0092_C04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0015_B12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SMG01_0063_H01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0125_H11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0132_C05.b : TGGTTTTCCACAGCCTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0090_B01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0105_H12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0096_B06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0150_H05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAT*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0144_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGCTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0108_F11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SMG01_0018_A04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0100_F02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
BFLT1_0125_D09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVR01_0079_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0009_A06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0023_E01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0110_G04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0107_D11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0120_G10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGAG*TTCACCTCCCTGCTGATGGA
OVRT1_0097_E07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PCT01_0036_D05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0098_B12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0113_G05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0035_G03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
CLNT1_0072_C04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATAGA
OVRT1_0086_F02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0095_D04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0084_D06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0020_H10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0055_D02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0077_G06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0070_D03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0087_E12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
THY01_0022_B02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0042_E12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0046_F01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0041_F07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0018_F04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0078_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0052_C03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0065_G09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0017_C07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0028_E07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0023_H04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
THY01_0071_F03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
UTR01_0068_E12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0013_A03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0093_B03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0070_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0093_H12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRT1_0043_H01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0034_G07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0052_D12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0096_H10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0091_B03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0057_C08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0047_H12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TCH01_0020_H12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVR01_0088_F01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SPL01_0099_D05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0110_E03.b : TGGTTTTCCACAGCTTTCGCGGGCGAAC*GGGTTCTGGG*TACACTTCCCTGtcgttgga
TES01_0034_D07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
LVRM1_0049_B08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0111_D12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0021_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
KDN01_0049_B07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0062_G10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0101_E02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0080_G09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0111_A03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0083_F01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0092_A10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PCT01_0014_A08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0041_C09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0021_D01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PCT01_0015_A03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PCT01_0035_F03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0004_D12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0031_C02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0057_A01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0036_A01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0017_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0032_H09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
KDN01_0038_A04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0091_H09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0007_H03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0028_D12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0026_D06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0004_H05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0065_G08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0057_D09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0019_F02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SMG01_0098_F09.b : ttggtttttcccagactttggcggggggaacggttttcggggtccacttccctgctaatg
TES01_0081_H07.b : TGGTTTTCCACAGCTTTGGCGGGTGAAC*GGGTTCTGGG*TTTCACTCCCTGCTGATGGA
LVRM1_0146_D06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGG
TES01_0079_C09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0015_F07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0096_D11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
THY01_0113_A05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGT*CTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0192_C10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0079_E03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0077_B03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0107_D06.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0107_A12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0031_G02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0058_B12.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGATTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0100_B08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0032_F01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0069_D07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0102_H08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0054_G01.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGATTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0019_E09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0097_B05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0075_A07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0046_F11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0096_A11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0100_B04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0021_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SKNB1_0030_D07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0085_B11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PST01_0027_D03.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0098_E05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0027_D11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0085_G10.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0047_F04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PCT01_0034_C11.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0182_H08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SPL01_0097_G02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0122_G07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0057_H08.b : TGGTTTTCCACAGCTTTGGCGGAGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
OVRM1_0204_A07.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0053_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ITT01_0028_E04.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
PBL01_0095_G02.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
TES01_0109_G08.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
ADR01_0008_C05.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
SPL01_0072_E09.b : TGGTTTTCCACAGCTTTGGCGGGGGAAC*GGGTTCTGGG*TTCACCTCCCTGCTGATGGA
20110601C-000430 : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
---------+---------+---------+---------+---------+---------+ 666
DCI01_0046_F12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0040_B10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
UTR01_0085_C04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0043_C02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0218_H11.b : ACGTCTCTCTGTCGATTATGG*CNAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0020_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
CLNT1_0082_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0174_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0043_B10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SPL01_0012_H07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0203_G10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0091_E09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0002_A01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
THY01_0053_H06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0053_F06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0098_A12.b : aataaggaatacaaattaagggggacgtatagaaaaagatagcggcaaaaacggagatag
OVRM1_0215_B06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTA*CCAGC
LVRM1_0181_D01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0018_F03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0130_F05.b : ACGTCTCTCTGTCGATTATG**CAAGAA*TCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0131_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTANCCAGC
CLNT1_0115_F05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0092_G07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
MLN01_0087_D07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PBL01_0089_H02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0052_D12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LNG01_0080_D10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0212_A03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0064_A05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0104_H04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTAC*CAGC
OVR01_0100_H04.b : ACGTCTCTCTGTCGATTAAGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SMG01_0101_B05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LNG01_0092_H05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0002_C10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0084_C12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0120_A10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0046_D09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
CLNT1_0021_C09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0039_A04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CACTTACCCAGC
OVRT1_0077_F07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVR01_0060_G01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0133_B02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATATACACAGC
OVRM1_0214_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0168_B02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0196_H11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0096_E06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0208_B12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0114_E11.b : ACGCCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0100_D01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0066_A01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0071_D03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0010_D08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0100_A08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0112_A06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0005_D07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0051_F11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0065_C12.b : ACGTCTCTCTCTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAAC
TES01_0082_F11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCAGCC
TES01_0095_F07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0042_D02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0011_A07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0175_A11.b : gactccttataattggcgacggaagaaccaatgttgtcttagtaggcaaccacccgaatg
OVRM1_0190_F11.b : Agacatacctgccgattatggctccaaataccagctcccaatatcaaatatcgacaacac
OVRM1_0076_A09.b : ACGTCgttctaaaaaataaagcaagaagaccgagctggtgttttccatatatccattccc
OVRM1_0110_B03.b : ACGTCTCTCTGCCTATTATGG*CACTACGTCCAAGCTGG*Aagccctctttcatcctgct
THY01_0126_G03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCT**CATTTAC
OVRM1_0140_G10.b : ACGTCTCTCTGTCGATTATTGTCAAGAAATCTAAACTGGGAGTTCTCCCATTTACCCAGC
LVRM1_0191_G11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*GAGTCTC*CATTTCACCAGC
OVRM1_0072_E01.b : ACGTCTTTCTGTCCATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTT*CATTNACCTCAC
OVRM1_0066_A06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTCCCATTTACCCAGC
OVRM1_0150_G06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0200_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0014_G01.b : ACGTCTCTCTGTCGATTATGG*CAAGGAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0162_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0171_F06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0150_B09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0211_H02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0116_G08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0165_B09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0199_B07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTCCNATTTACCCAGC
OVRM1_0085_G02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0001_F04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0034_H01.b : ACGTATCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0059_F03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0217_G03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0133_E11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0207_C12.b : CCGTCTCTCTGTCGATTATGG*CAAGAAAGTCCAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0060_F06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0042_H04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0075_C08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0115_E01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0035_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0209_H07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0049_E08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0089_B02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0087_A05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0034_C06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0005_B03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0001_D06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0109_E02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0112_H12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0013_G05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0065_D04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0041_E08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0118_A05.b : ACGTCTCTCTGTCGATTATGG*GCAGAAGTCCAAGCTGG*AGTTCTC*CATTTACGCAG*
OVRM1_0119_E03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0116_D08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0049_F09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTATCCCAG
OVRM1_0085_F12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0099_H11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0035_G11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0069_B02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTTTC*CATTTACCCAGC
OVRM1_0064_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVRM1_0126_B10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0090_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0212_B09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0070_E05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0083_G07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0184_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0064_G12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0030_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTAACCCAGC
OVRM1_0087_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0185_E11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0069_B12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0011_H04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0096_C09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTTACCAGC
SMG01_0092_C04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0015_B12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SMG01_0063_H01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0125_H11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0132_C05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0090_B01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0105_H12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0096_B06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0150_H05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0144_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0108_F11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SMG01_0018_A04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0100_F02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
BFLT1_0125_D09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
LVR01_0079_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0009_A06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0023_E01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
CLNT1_0110_G04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
CLNT1_0107_D11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0120_G10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0097_E07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PCT01_0036_D05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0098_B12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0113_G05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0035_G03.b : ACGTCTCTATGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
CLNT1_0072_C04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0086_F02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0095_D04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0084_D06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0020_H10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ADR01_0055_D02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0077_G06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0070_D03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0087_E12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
THY01_0022_B02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0042_E12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0046_F01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0041_F07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0018_F04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0078_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0052_C03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0065_G09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0017_C07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0028_E07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0023_H04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
THY01_0071_F03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
UTR01_0068_E12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAGGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0013_A03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0093_B03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0070_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0093_H12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRT1_0043_H01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0034_G07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCGGC
ADR01_0052_D12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ADR01_0096_H10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0091_B03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ADR01_0057_C08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0047_H12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TCH01_0020_H12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVR01_0088_F01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SPL01_0099_D05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0110_E03.b : cagtcttctcgttgattatggcacgagtcctaccttggcttctctatttaccctgctcct
TES01_0034_D07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAAGTCCAGCTGG*GAGTCTC*CATTTACCCANC
LVRM1_0049_B08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0111_D12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0021_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
KDN01_0049_B07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0062_G10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0101_E02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0080_G09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0111_A03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0083_F01.b : ACGTCTCCCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0092_A10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PCT01_0014_A08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0041_C09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0021_D01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PCT01_0015_A03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PCT01_0035_F03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0004_D12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0031_C02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0057_A01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0036_A01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0017_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0032_H09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
KDN01_0038_A04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0091_H09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0007_H03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0028_D12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0026_D06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0004_H05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0065_G08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0057_D09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0019_F02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SMG01_0098_F09.b : gaacctcctcccggtcaataagggaaaaaatccaagctggaatttccctttttcccagcc
TES01_0081_H07.b : ACTTCTCCCTttccaataatggcaatgaatcccatctggagtttccccttttacccaccc
LVRM1_0146_D06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0079_C09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0015_F07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ADR01_0096_D11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
THY01_0113_A05.b : AGTCTCTntgttcattatggaagaagtcagccgggtttcccatttacccccccccgggtt
OVRM1_0192_C10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0079_E03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTTACCAGC
TES01_0077_B03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0107_D06.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0107_A12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0031_G02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0058_B12.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0100_B08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0032_F01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0069_D07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0102_H08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0054_G01.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0019_E09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0097_B05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0075_A07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTGCCCAGC
PST01_0046_F11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0096_A11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0100_B04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0021_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SKNB1_0030_D07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0085_B11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PST01_0027_D03.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0098_E05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0027_D11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0085_G10.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0047_F04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTCCTC*CATTTACCCAGC
PCT01_0034_C11.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0182_H08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SPL01_0097_G02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0122_G07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0057_H08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
OVRM1_0204_A07.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0053_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ITT01_0028_E04.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
PBL01_0095_G02.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
TES01_0109_G08.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
ADR01_0008_C05.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
SPL01_0072_E09.b : ACGTCTCTCTGTCGATTATGG*CAAGAAGTCCAAGCTGG*AGTTCTC*CATTTACCCAGC
20110601C-000430 : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
---------+---------+---------+---------+---------+---------+ 723
DCI01_0046_F12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCCTCAC*ACC*ACAC
TES01_0040_B10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCATTCCTCACC*ACCCACAC
UTR01_0085_C04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCTT*CCTCACC*ACCCACAC
PST01_0043_C02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0218_H11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTA*AACTCCAT*CCTCACC*ANCCACAC
OVR01_0020_C07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0082_C07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0174_E04.b : CCCACAAGTTCCCACAGCTGTGAGTGGAGGCCTACTAATCCATCCTCAACA*CCCAAACG
OVRM1_0043_B10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SPL01_0012_H07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0203_G10.b : CCCCCAGGATTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0091_E09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0002_A01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
THY01_0053_H06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0053_F06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0098_A12.b : atactaagaaacccaataaaatatagaagagagtatggagagtgacgagcatagtggcat
OVRM1_0215_B06.b : CACACAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCAGAC
LVRM1_0181_D01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0018_F03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACGACTCCAT*CCTCACC*ACCCACAC
OVRM1_0130_F05.b : CCCCCAGGTTTC*ACAGCTGT*AGTTGAGCCCTA*AACTCCAT*CCTCAC**ACCCAAAC
OVRT1_0131_C07.b : CCCCCANGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0115_F05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0092_G07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
MLN01_0087_D07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PBL01_0089_H02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0052_D12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LNG01_0080_D10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0212_A03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0064_A05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCCT*CCTCACC*ACCCACAC
OVRM1_0104_H04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTA*TACTCCATCCCTCAC**ACCCACAC
OVR01_0100_H04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SMG01_0101_B05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCATCCTCANNC*ACCCACA*
LNG01_0092_H05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0002_C10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0084_C12.b : CCCCCAGGTTTCCACAGCTGT*ATTTGAGCCCTACAACTCCAT*CCTCACC*ACACACAC
OVRT1_0120_A10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0046_D09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0021_C09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0039_A04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0077_F07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVR01_0060_G01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0133_B02.b : CCCCCATGGTTTCACAGCTGC*AGTTGAGCCCTATA*CTCTATCCTtactatcctaccta
OVRM1_0214_E04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0168_B02.b : CNCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0196_H11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0096_E06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCATAC
OVRM1_0208_B12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACCCCAT*CCTCACC*ACCCACAC
OVRM1_0114_E11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0100_D01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0066_A01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAGCTCCAT*CCTCACC*ACCCACAC
OVR01_0071_D03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0010_D08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0100_A08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0112_A06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0005_D07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0051_F11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0065_C12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCTT*CCTCACC*ACCCACAC
TES01_0082_F11.b : CCCCCATGTTTTCACAGCTGT*AGTTGAGCCCTAAAACTTCCT*CCTCACC*ACCCACAC
TES01_0095_F07.b : CCCCCANGTTTTCACAGCTGT*AGTTGAAGCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0042_D02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0011_A07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0175_A11.b : catgaaacgttcgccaatcgccagattgtagtaaatatcacgacgccccctgtgaaatag
OVRM1_0190_F11.b : cacacaagtttcacaaaaataagtttaacataaaaaacaccatttatacaacacacccat
OVRM1_0076_A09.b : tcccgtattcgcaggtgtggttgaaccactacgcttaaatcggacacaccattcgtatct
OVRM1_0110_B03.b : tcccccgttctcacatttggctgctgagccctacatctcacttctcacctatcatactac
THY01_0126_G03.b :
OVRM1_0140_G10.b : CCCCcaagttttcaacacctggtatttgagccctacaacttcgatcctcaacaccgaaac
LVRM1_0191_G11.b : CCCC*AGGTTTTCACAACTGT*ATTTGAGCCCTACAACT*CAT*CCTCACaccaaaacac
OVRM1_0072_E01.b : CCCGCAGGTTTCCACAGCTGT*ACTTGCCCCCTTCAACTCCAT*CCTTtccacgatacna
OVRM1_0066_A06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTAAAACTCCAT*CCTCCAC*ACCCACAC
OVRM1_0150_G06.b : CCCCCCAGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0200_C07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0014_G01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*AGCCACAC
OVRM1_0162_B11.b : CCC*CAAGTTTCCACAGCTGT*AATTGAGCCCTACAACTCCAT*CCTCAAC*AGCCA*AC
OVRM1_0171_F06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0150_B09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0211_H02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0116_G08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCAT*CCTCACC*ACCCACAC
OVRM1_0165_B09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0199_B07.b : CCCC*AGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0085_G02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0001_F04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0034_H01.b : CCCCCAAGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0059_F03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAAGCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0217_G03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAAGCCTACAACTCCAT*CCTCACC*ACCCA*AC
OVRM1_0133_E11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTANAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0207_C12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0060_F06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCAT*CCTCACC*ACCCACAC
OVRM1_0042_H04.b : CCCTCAGGTTTCCACAGCTGT*AGTTGAACCCTACAACTCCAT*CCTCACT*ACCCAAAT
OVRM1_0075_C08.b : CCCCCAGGTTTTCACAGCTGT*AGTTGAGCCCTACAACTGCAT*CCTCACC*ACCCACAC
OVRM1_0115_E01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0035_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0209_H07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0049_E08.b : CTCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCNT*CCTCACC*ACCCACAC
OVRM1_0089_B02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0087_A05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVRM1_0034_C06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACT*ACCCACAC
OVRM1_0005_B03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0001_D06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0109_E02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACCNACCCACAC
OVRM1_0112_H12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0013_G05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*TCTCACC*ACCCACAC
OVRM1_0065_D04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0041_E08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTAAAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0118_A05.b : CCCCCAGGTTTCCACAGCTGTTAGTTGAGCCCTACAACTCCAT*CCTCAGC*ACCCGAAC
OVRM1_0119_E03.b : CCCCCAGGTTTCCACAGCTGT*AGTTTGAGCCCTAAACTCCAT*CCTCACC*ACCNACAC
OVRM1_0116_D08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0049_F09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCNT*CCTCACCCACCCACAC
OVRM1_0085_F12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0099_H11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0035_G11.b : CCCCCAGGTTTTCACAGCTGT*AGTTGAGCCCTACAACTTCAT*CCTNACC*ACCCACAC
OVRM1_0069_B02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0064_A11.b : CCCCCCGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCNT*CCTCACC*ACCCACAC
LVRM1_0126_B10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNACTCCAT*CCTCACN*ACCCACAC
OVRM1_0090_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0212_B09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0070_E05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0083_G07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0184_B11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0064_G12.b : CCCGCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCTT*CCTCACC*ACCCACAC
OVRM1_0030_E04.b : CCCCCAGGTTTACACAGCTGA*AGTTGAGTCCTACAACTCCAT*CCTAACC*ACCCGCAC
OVRM1_0087_B11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0185_E11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0069_B12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*TCTCACC*ACCCAAAC
OVRM1_0011_H04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0096_C09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACCACCCCACAC
SMG01_0092_C04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCCATCCTCACA**CCNACAC
OVR01_0015_B12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SMG01_0063_H01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACNAACTCAT*CCNTCAC*ACCCACAA
OVRT1_0125_H11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0132_C05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCATCCCTCA*C*ACCCACAT
OVRT1_0090_B01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0105_H12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCNAC*ACCCACAC
OVRT1_0096_B06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0150_H05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0144_E04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCNAC*ACCCACAC
OVRT1_0108_F11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SMG01_0018_A04.b : CACCCAGGTTTCTACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0100_F02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
BFLT1_0125_D09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
LVR01_0079_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0009_A06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0023_E01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0110_G04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0107_D11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0120_G10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0097_E07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PCT01_0036_D05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0098_B12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0113_G05.b : CCCC*AGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0035_G03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
CLNT1_0072_C04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0086_F02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0095_D04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0084_D06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0020_H10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0055_D02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0077_G06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0070_D03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTANAACTCCAT*CCTCACC*ACCCACAC
ITT01_0087_E12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
THY01_0022_B02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0042_E12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0046_F01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0041_F07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0018_F04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0078_C07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0052_C03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAACCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0065_G09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0017_C07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0028_E07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0023_H04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
THY01_0071_F03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
UTR01_0068_E12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0013_A03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0093_B03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0070_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0093_H12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRT1_0043_H01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0034_G07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0052_D12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0096_H10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0091_B03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0057_C08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0047_H12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TCH01_0020_H12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVR01_0088_F01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SPL01_0099_D05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0110_E03.b : cagcgcttcctctctgtaagttgagttccatatcttcatcctcaccccgttaccacccct
TES01_0034_D07.b : CCCCCAGGTTTC*ACAGCTGT*AGGTGAAGCCTAAAAANTCAT*CCTCACC*ACCCACAA
LVRM1_0049_B08.b : CCCCCAAGTTTTCACAGCTGT*AGTTGAGCCCTA*AACTCCAT*CCTCACC*ACCCACAC
TES01_0111_D12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0021_B11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
KDN01_0049_B07.b : CCCCCATGTTTCCACAGCTGT*AGTTGAGCCCTAAAACTCCAT*CCTCAAC*ACCCACAC
TES01_0062_G10.b : CCCCCANGTTTCCACAGCTGT*AGTTGAGCCCCTACACTCCAT*CCTCNAC*ACCCACAC
TES01_0101_E02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0080_G09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0111_A03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0083_F01.b : CCCCCANGTTTCCACAGCTGT*AGTTGAGCCCTAAAACTCCAT*CCTCACA*A*CCACAC
TES01_0092_A10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PCT01_0014_A08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0041_C09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0021_D01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PCT01_0015_A03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PCT01_0035_F03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0004_D12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0031_C02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0057_A01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0036_A01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0017_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACT*ACCCACAC
TES01_0032_H09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
KDN01_0038_A04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0091_H09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0007_H03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0028_D12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0026_D06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0004_H05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0065_G08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0057_D09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0019_F02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SMG01_0098_F09.b : ccccggttttcccagcgtgaaatgggccctaaattctcttccccccccccaacacccctg
TES01_0081_H07.b : cccccatgtttttccccaccttgtatttgaaccctataacttccttcctttactaaccaa
LVRM1_0146_D06.b : CCCCCACGTTTCCACAGCTGT*AGTTGAGCCCTACAATTCCAT*CCTCACC*ACCCACAC
TES01_0079_C09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0015_F07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0096_D11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
THY01_0113_A05.b : cccaggctggtttaaccctaaccccc
OVRM1_0192_C10.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAAGCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0079_E03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCNTCAC*ACCCACAC
TES01_0077_B03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTTCAT*CCTCACC*ACCCACAC
TES01_0107_D06.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAAGCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0107_A12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0031_G02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0058_B12.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0100_B08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0032_F01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0069_D07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0102_H08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCCTACACTCCAT*CCCTCAC*AACCACAC
TES01_0054_G01.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0019_E09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0097_B05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0075_A07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0046_F11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0096_A11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0100_B04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0021_B11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SKNB1_0030_D07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0085_B11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PST01_0027_D03.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0098_E05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0027_D11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTAACACTCCAT*CCTCACC*ACCCACAC
TES01_0085_G10.b : CCCCCAG*TTTCCACAGCTGT*AGTTGAGCCCTAAAATCCAT**CCTCACC*ACCCACAC
TES01_0047_F04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PCT01_0034_C11.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0182_H08.b : CCCCCAGGAGTCCACAGCTGGTAGTTGAGCCCTACAATTCCGT*CCTCAAT*CACCACAT
SPL01_0097_G02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0122_G07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACNCACAC
TES01_0057_H08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
OVRM1_0204_A07.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0053_E04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ITT01_0028_E04.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
PBL01_0095_G02.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
TES01_0109_G08.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
ADR01_0008_C05.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
SPL01_0072_E09.b : CCCCCAGGTTTCCACAGCTGT*AGTTGAGCCCTACAACTCCAT*CCTCACC*ACCCACAC
20110601C-000430 : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
---------+---------+---------+---------+---------+---------+ 779
DCI01_0046_F12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACCATGAGGCCATCTACGACA
TES01_0040_B10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
UTR01_0085_C04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0043_C02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0218_H11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0020_C07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
CLNT1_0082_C07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0174_E04.b : CACCCT*GGAAGCACCT*GATTGTGCCTTC**ATGGTAGACgacggggcctattaagaaa
OVRM1_0043_B10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTATGACA
SPL01_0012_H07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0203_G10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAAACAATGAGGCCATCTACGACA
OVR01_0091_E09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0002_A01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
THY01_0053_H06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0053_F06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LVRM1_0098_A12.b : agagaccaacgacaaacctnttaccgcgacgattgcagcgagtcgacagctgtggntgta
OVRM1_0215_B06.b : CAACCT*GGAGCAATCTGGATTGTGCCTTcatgggtaaacaatgagggccatctatgaca
LVRM1_0181_D01.b : CACCCT*GGAGCACTCT*GATTGTGCCCTC**ATGGTAGACAn
OVRM1_0018_F03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0130_F05.b : CACCCT*GGAGCACTCT*GATTGTGGCTTC**ATGGTAGACAATGAAGGCATCTACGACA
OVRT1_0131_C07.b : CACCCT*GGAGCACTCT*GATTGTGCCCTC**ATGGTAGACAATGAGGCCATCTATGACA
CLNT1_0115_F05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0092_G07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
MLN01_0087_D07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PBL01_0089_H02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCTATCTATGACA
ITT01_0052_D12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LNG01_0080_D10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0212_A03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0064_A05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0104_H04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACNATGACGCCATCTACGACA
OVR01_0100_H04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SMG01_0101_B05.b : CACCCT*GGAGCACTCT*GAATGTGCCTTC**ATGGTAGAACATGANGCCATCTACGACA
LNG01_0092_H05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0002_C10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0084_C12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCTTCTACGACA
OVRT1_0120_A10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0046_D09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
CLNT1_0021_C09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0039_A04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0077_F07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
LVR01_0060_G01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
LVRM1_0133_B02.b : cctgtaggcatttgaatgtgctttcagggagaccatgatgccatctaccacatctggcct
OVRM1_0214_E04.b : CAACCT*GGAGCACTCT*GATTGTGCCTTC**ATGTTAGACAATGAGGCCATCTACGACA
OVRM1_0168_B02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0196_H11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0096_E06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0208_B12.b : CACCCT*GGAGCACTCT*GATTGTTGCCTC**ATGGTAGACCATGAGGCCATCTATGACA
OVRM1_0114_E11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTACACAATGAGGCCATCTACGACA
OVR01_0100_D01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0066_A01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVR01_0071_D03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
OVRT1_0010_D08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
SKNB1_0100_A08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0112_A06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0005_D07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0051_F11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
TES01_0065_C12.b : CACCCT*GTAGCCCTCTGATTTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACTACA
TES01_0082_F11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACT
TES01_0095_F07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACATGGAG*CCATCTACGACA
TES01_0042_D02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0011_A07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0175_A11.b : gtttctttagtgatatagcccacacgcgcgacgttcaagtaatacaccgcgaacgtatag
OVRM1_0190_F11.b : aaatggaactacctacggagtgaattaccggatatagagtgcgtcttctatacctaatgc
OVRM1_0076_A09.b : catcaatataataaagcctatagatataaaaaattgacatttacaacatttgccgcataa
OVRM1_0110_B03.b : catggtacactctgtatcgtttcccttttgccattacctcatggcctctacntaaacctg
THY01_0126_G03.b :
OVRM1_0140_G10.b : caacctggaggaatcttgattgtggc
LVRM1_0191_G11.b : cctggaagatctgattgtgcttcctggtaaacatgagccatctacgaatctgtcgan
OVRM1_0072_E01.b : cctatgagcaatctgattgtgtctgattgcataaaatgaagccacctaccacatttgtcg
OVRM1_0066_A06.b : AACCCT*GGAGCACTCT*GAATGTGCCTTC**ATGGTAGACAATGAGGCCATtaagaaat
OVRM1_0150_G06.b : CACCCT*GGAGCACTCT*GATTGTGGCTTC**ATGTTAGACCATGAAGCCATCTATGACA
OVRM1_0200_C07.b : CACCCTGGGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LVRM1_0014_G01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAAACAATGAGGCCATCTACGACA
OVRM1_0162_B11.b : CAACCT*GGAGGAATCT*GATTGTGGCTTC**ATGGTAAAACATGAGGCCATCTATGACA
OVRM1_0171_F06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTAAGACA
OVRM1_0150_B09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGANCATGAGGCCATCTACGACA
OVRM1_0211_H02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LVRM1_0116_G08.b : CAACCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0165_B09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0199_B07.b : CACCCTGGGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0085_G02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0001_F04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0034_H01.b : CAACCT*GGAGCACTAT*GATTGTGCCTTC**ATTGTAGACAATGAGGCCATCTATGACA
OVRM1_0059_F03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACCATGAGGTCATCTACGACA
OVRM1_0217_G03.b : CAACCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACTATGAGGCCATCTACGACA
OVRM1_0133_E11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0207_C12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0060_F06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0042_H04.b : CACCCT*GGAACACTCC*GATTGTGCCTTC**ATGGTAGACCACGAGGCCATCTACGAAC
OVRM1_0075_C08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGGAGACAATGAGGCCATCTACGACA
OVRM1_0115_E01.b : CACCCT*GGAGCACTCT*GATTGTGCCCTC**ATGGTAGACAATGAGGCCATCTACGACA
LVRM1_0035_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0209_H07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0049_E08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACNATGAGGCCATCTACGACA
OVRM1_0089_B02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0087_A05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LVRM1_0034_C06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGGCCTCTACGACA
OVRM1_0005_B03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0001_D06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0109_E02.b : CAC*CT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0112_H12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0013_G05.b : CCACCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0065_D04.b : CACCCTTGGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0041_E08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0118_A05.b : CACGCT*GGAGCATTCT*GATTGTGCCTTC**ATGGTAGAACATGAGGCCATCTACGGAC
OVRM1_0119_E03.b : CAACCT*GGAGCAATCTTGATTGTGCC*TC**ATGGTAGACAATGAGGCCATCTACAACA
OVRM1_0116_D08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0049_F09.b : CA*CCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0085_F12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0099_H11.b : CACCCT*GGAGNACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0035_G11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0069_B02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAAGCCATCTACGACA
OVRM1_0064_A11.b : CACCCT*GGAGCACTCT*TATTGTGCCTTC**ATGGTAAACNATGAGGCCATCTACGACA
LVRM1_0126_B10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0090_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0212_B09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0070_E05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0083_G07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0184_B11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
OVRM1_0064_G12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0030_E04.b : TACCCT*GGAGCACTCT*GATTGTGCCCTT**ATGGTCAACAATGAGGCCATGTATGACT
OVRM1_0087_B11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0185_E11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0069_B12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0011_H04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0096_C09.b : AACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGAACATGAGGCCATCTACGACA
SMG01_0092_C04.b : AACCNT*GGAGCACTCT*GAATGTGCCTTC**ATGGTAGACAATGAGGGCATCTACGACA
OVR01_0015_B12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SMG01_0063_H01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAAGCCATCTACGACA
OVRT1_0125_H11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0132_C05.b : CACCCT*GGAGCANTCT*GATTGTGCCTTC**ATGGGTAGACATGAGGCCATCTATGACA
OVRT1_0090_B01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0105_H12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0096_B06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0150_H05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0144_E04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0108_F11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
SMG01_0018_A04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACCATGANGCCATCTACGACC
ITT01_0100_F02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
BFLT1_0125_D09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
LVR01_0079_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ACGGTAGACAATGAGGCCATCTACGACA
OVRT1_0009_A06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0023_E01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
CLNT1_0110_G04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
CLNT1_0107_D11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
OVRT1_0120_G10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0097_E07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
PCT01_0036_D05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0098_B12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0113_G05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVR01_0035_G03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
CLNT1_0072_C04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0086_F02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0095_D04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0084_D06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVR01_0020_H10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGGCA
ADR01_0055_D02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0077_G06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0070_D03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ITT01_0087_E12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
THY01_0022_B02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0042_E12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0046_F01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
OVRT1_0041_F07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0018_F04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0078_C07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0052_C03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0065_G09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0017_C07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0028_E07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0023_H04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
THY01_0071_F03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
UTR01_0068_E12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0013_A03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRT1_0093_B03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0070_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0093_H12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRT1_0043_H01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0034_G07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ADR01_0052_D12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ADR01_0096_H10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0091_B03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ADR01_0057_C08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ITT01_0047_H12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TCH01_0020_H12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVR01_0088_F01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SPL01_0099_D05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
OVRM1_0110_E03.b : ggaactacacgtttttcgccttcactgtaaactttgatgccttccccgagntcgcgcgca
TES01_0034_D07.b : CAACCTGGGAGAACTCG*GATTGTGGCTTCcggtaaaaaaagagggcatctacgaaatct
LVRM1_0049_B08.b : CAC*CT*GGAACACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0111_D12.b : CACCTT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SKNB1_0021_B11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAAACAATGAAGCCATCTATGACA
KDN01_0049_B07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0062_G10.b : CACCCT*GAAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0101_E02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
TES01_0080_G09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTANACAATGANGCCATCTACGACA
TES01_0111_A03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0083_F01.b : CACCCT*GGAGCACTCT*GATTGTGCCCTC**ATGGTAGAACATGAAGCCATCTACGACA
TES01_0092_A10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PCT01_0014_A08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
SKNB1_0041_C09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0021_D01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PCT01_0015_A03.b : CACCCT*GGAGCACTCT*GATTATGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
PCT01_0035_F03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
PST01_0004_D12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0031_C02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0057_A01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0036_A01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0017_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0032_H09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
KDN01_0038_A04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SKNB1_0091_H09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0007_H03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0028_D12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0026_D06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0004_H05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0065_G08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0057_D09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SKNB1_0019_F02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SMG01_0098_F09.b : gaaaaccttgtatggggcccttttgggaaaaaaaagggggccttaaaaaaccttgggaaa
TES01_0081_H07.b : aacatccatgatacacttcgattgcgcccttcttggataaaaaaattatgccctcttcca
LVRM1_0146_D06.b : CACCCT*GGAGCACTCT*GATTGTGCGTTC**ATGATAGACA*TGAGGCCATCTACGACA
TES01_0079_C09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGGGGCCATCTACGACA
TES01_0015_F07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
ADR01_0096_D11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
THY01_0113_A05.b :
OVRM1_0192_C10.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0079_E03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAAGGCATCTACGACA
TES01_0077_B03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAAACAATGAGGCCATCTACGACA
TES01_0107_D06.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0107_A12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0031_G02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0058_B12.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0100_B08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0032_F01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SKNB1_0069_D07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0102_H08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTANACAATGANGCCATCTACGACA
TES01_0054_G01.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGANGCCATCTACGACA
TES01_0019_E09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0097_B05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0075_A07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0046_F11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0096_A11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0100_B04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0021_B11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
SKNB1_0030_D07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0085_B11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PST01_0027_D03.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0098_E05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0027_D11.b : CACCCT*GGAACACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0085_G10.b : AACCCT*GGAGCACTCTGAATGTGCCCTTC**ATGTAAGACAATGAGGCCCTCTACGACA
TES01_0047_F04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
PCT01_0034_C11.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0182_H08.b : GACCCTGGGAGCACTCT*GAATGTGCCTTC**ATGGgtagacactgaggcct
SPL01_0097_G02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCACCTATGACA
OVRM1_0122_G07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTACGACA
TES01_0057_H08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
OVRM1_0204_A07.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0053_E04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ITT01_0028_E04.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
PBL01_0095_G02.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
TES01_0109_G08.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
ADR01_0008_C05.b : CACCCT*GGAGCACTCT*GATTGTGCCTTC**ATGGTAGACAATGAGGCCATCTATGACA
SPL01_0072_E09.b : CACCCT*GGAGCACTCT*GATTGTGCCTTCGGATGGTAGACAATGAGGCCATCTATGACA
20110601C-000430 : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
---------+---------+---------+---------+---------+---------+ 834
DCI01_0046_F12.b : TCTGTC*GTAAAAACCTTGATA*TTGAACGC*CCANCCTACACT*AATCTGAA*ACGCCT
TES01_0040_B10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
UTR01_0085_C04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCA*CCTACACT*AATCTGAA*ACGCCT
PST01_0043_C02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0218_H11.b : TCTGTC*GGTAAAACCTTGATtatga
OVR01_0020_C07.b : TCTGTC*GTAGTAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
CLNT1_0082_C07.b : TCCGTC*GTAAAAACCTTGATT*TTGAAAGC*CCCAACTACACT*TATCTGAA*CCGGCT
OVRM1_0174_E04.b : tctgtgt
OVRM1_0043_B10.b : TCTGTC*GTAGAAACCTCGATA*TTGAAACG*CCAcct
SPL01_0012_H07.b : TCTGTC*GTAGAAAC
OVRM1_0203_G10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCn
OVR01_0091_E09.b : TCTGTC*GGAAAAACCTTGGAA*TTGATCGCCCCAACCTACACTTAATCTGAA*CCGCCT
OVRT1_0002_A01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
THY01_0053_H06.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0053_F06.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
LVRM1_0098_A12.b : cacactata
OVRM1_0215_B06.b : actgctcgtaaaaacctcgcatatctgacg
LVRM1_0181_D01.b :
OVRM1_0018_F03.b : TCTGTC*GTAGAAACCTCGAn
OVRM1_0130_F05.b : TCTGTC*GTAGAAACTTGGATA*Tggacgccc
OVRT1_0131_C07.b : TCTGTC*GTAGA*ACCTCGATA*TTGAACGC*CC*ACCTACACT*AATCTGAA*ACGCtc
CLNT1_0115_F05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0092_G07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*TATCTGAA*CCGCCT
MLN01_0087_D07.b : TCTGTC*GTAGAAACCTTGATA*TTGAAACG*CCAACCTACACT*AATCTGAA*CCGCCT
PBL01_0089_H02.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0052_D12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
LNG01_0080_D10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0212_A03.b : TCTGTC*GTAGAAACCTCGAT
OVRM1_0064_A05.b : TCTGTC*GTAGAAACCTTGATA*T
OVRM1_0104_H04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*ATTCTG
OVR01_0100_H04.b : TCTGTCCGTAAAAACTTTGATA*TTGAACGCCCCAACCTACACT*AATCTGAAACCGCCT
SMG01_0101_B05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGNCT
LNG01_0092_H05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0002_C10.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCTT
TES01_0084_C12.b : TCTGTC*ATAAAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAAACCGCCT
OVRT1_0120_A10.b : TCTGTC*GTAGAAACCT*GATA*ATGAACGC*CCAACCTAC*CT*AATCGGAA*CCGCCT
OVR01_0046_D09.b : TCTGTC*GAAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
CLNT1_0021_C09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0039_A04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0077_F07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
LVR01_0060_G01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
LVRM1_0133_B02.b : ataaccttgattttgaaccccc
OVRM1_0214_E04.b : TCTGTC*GTAGAGACCTTG
OVRM1_0168_B02.b : TCTGTC*GTATA*ACCTCGATA*TTGAA
OVRM1_0196_H11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACG
OVRM1_0096_E06.b : TCTGTC*GTATAAAC*TTGATA*TTGAACGC*CCAACCT
OVRM1_0208_B12.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAAC*TACACT
OVRM1_0114_E11.b : TCTGTC*GTAGAAACCTTGATA*TTGAAACG*CCAANCTACCCTAAATCTGAA*CCGCCT
OVR01_0100_D01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGCCCCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0066_A01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0071_D03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCCGAA*ACGCCT
OVRT1_0010_D08.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SKNB1_0100_A08.b : TCTGTC*GTAGAAACCTCGATA*TTGGACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0112_A06.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
TES01_0005_D07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0051_F11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCAACTACACT*AATCTGAA*CCGCCT
TES01_0065_C12.b : TCTGTCCTATAAAACCTTAATA*TTGAAAGC*CCA*CCTACACT*AATCTtgaaccgccc
TES01_0082_F11.b : TCTGTCGTAAAAACCCTTGATA*TTGAACGC*CCAACCCTACCT*AATCTGAC*CCGCCT
TES01_0095_F07.b : TCTGTC*GTAAAAACCTTGATA*TTGAACGC*CCAA*CTACACT*AATCTGAC*CCGC*T
TES01_0042_D02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0011_A07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0175_A11.b : cggctacaactagtgtgatgacgcacggggacccacggtgat
OVRM1_0190_F11.b : gtacgataatgtgataatcgaaaacagacacacgcgttaatt
OVRM1_0076_A09.b : cgt
OVRM1_0110_B03.b : tcgctaacatcgtccatttcgaacttacccaactccttn
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b : tccatacctggatatcgaacccccctctacct
OVRM1_0066_A06.b : ctgtactataacctccaaacttgaacccaacccaccg
OVRM1_0150_G06.b : TCTG
OVRM1_0200_C07.b : TCTGT
LVRM1_0014_G01.b : TCTGTC*GTAAAAACCTTGA
OVRM1_0162_B11.b : TCTGTC*CTAan
OVRM1_0171_F06.b : TCTGTC*GTAGAAACTTga
OVRM1_0150_B09.b : TCTGTC*GTA
OVRM1_0211_H02.b : TCTGTC*GTAGAAAC
LVRM1_0116_G08.b : TCTGTC*GTAGAACCTtg
OVRM1_0165_B09.b : TCTGTC*GTAGAAAC
OVRM1_0199_B07.b : TCTGTC*GTAGAAACC
OVRM1_0085_G02.b : TCTGTC*GTAGAAACCTC
OVRM1_0001_F04.b : TCTGTC*GTAGAAACCTC
OVRM1_0034_H01.b : TCTGTC*TTATAAACCT
OVRM1_0059_F03.b : TCTGTC*GTAGAAACCTTGATA
OVRM1_0217_G03.b : TCTGTC*GTAGAAACCTTGATA*Tga
OVRM1_0133_E11.b : TCTGTC*GTAGAAAC*TCGATA*T
OVRM1_0207_C12.b : TCTGTC*GTAGAAACCTTGATA*TTGtacgn
OVRM1_0060_F06.b : TCTGTC*GTAGAAA*CTTGATA*TTGAcgc
OVRM1_0042_H04.b : TCTGTC*GTAAAAACCTGGAAA*TTGAc
OVRM1_0075_C08.b : TCTGTC*GTAGAAACCTTGATA*T
OVRM1_0115_E01.b : TCTGTC*GTAGAAACCTTGATA*TTGA
LVRM1_0035_A11.b : TCTGTC*GTAGAAACCTCGATA*TTGAA
OVRM1_0209_H07.b : TCTGTC*GTAGAAACCTTGATA*TTGAA
OVRM1_0049_E08.b : TCTGTC*GTANAAACCTTGATA*TTGAACGC*CAACCTAC
OVRM1_0089_B02.b : TCTGTC*GTAGAAACCTCGATA*TTGAAC
OVRM1_0087_A05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACG
LVRM1_0034_C06.b : TCTGTC*GTAGAAACCTTGATA*TTGGACGC
OVRM1_0005_B03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*Cn
OVRM1_0001_D06.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCn
OVRM1_0109_E02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CC
OVRM1_0112_H12.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGCCCAC
OVRM1_0013_G05.b : TCTGTC*GTAGAAACCTTGATA*TGGAACGC*CCA
OVRM1_0065_D04.b : TCTGTC*GCATAAACCTCGATT*TTGAACGC*CCAA
OVRM1_0041_E08.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACC
OVRM1_0118_A05.b : TCTGTC*GTAGAAGCCTTGATA*ATTGACGC*CCAACCT
OVRM1_0119_E03.b : TCTGTC*GTAAAAACCCTGATA*TTGAACGC*CCAACCT
OVRM1_0116_D08.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTA
OVRM1_0049_F09.b : TCTGTC*GTAGAAACCTCGATA*TCGAACGC*CCAACCTACct
OVRM1_0085_F12.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACA
OVRM1_0099_H11.b : TCTGTC*GTAGAAACCTTGATA*TTG*ACGC*CCAACCTAC
OVRM1_0035_G11.b : TCTGTC*GTAAAAACCTCAATA*TTGAACGC*CCACCCT
OVRM1_0069_B02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACAC*CCAACCTAact
OVRM1_0064_A11.b : TCTGTC*GTAAAANCCTTGATA*TTGAAACG*CCCACCTACACT
LVRM1_0126_B10.b : TCTGTC*GTAGAAAACTTGATA*TTGAACGC*CCA*CCTACACT*AAT
OVRM1_0090_A11.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCCAACTACACT*AATCTG
OVRM1_0212_B09.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCCACCTACACT*AATCTG
OVRM1_0070_E05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCA*CCTACACT*AAT
OVRM1_0083_G07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTG
OVRM1_0184_B11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGtc
OVRM1_0064_G12.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACTAATTCTGAccgtctca
OVRM1_0030_E04.b : CCTGTC*CTATAAACCTCGATA*TTGGACGC*TCTACCTACACT*AATCTGAA*Tcgc
OVRM1_0087_B11.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCG
OVRM1_0185_E11.b : TCTGTC*GTAGAAACCTTGATA*TTGAAACG*CCCACCTACACT*AATCTGAA*CCGC
OVRM1_0069_B12.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCA*CCTACACT*AATCTGAA*CCG
OVRM1_0011_H04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCA*CCTACACT*AATCTGAA*CCGCCT
OVR01_0096_C09.b : TCTGTT*CGTAAAACCCTTGAA*TTGAACGC*CCCAACTACACT*AATTCGAAACGCCCT
SMG01_0092_C04.b : TCTGTC*GTAGAAACCTTGATA*TTGA*CGG*CCAAACTACCCC*TATCTGAA*CCGCCT
OVR01_0015_B12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SMG01_0063_H01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCAACTACACT*AATCTGAA*CCCGCT
OVRT1_0125_H11.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC*CCCAACTACACT*AATCTGAA*CCGCCT
OVRT1_0132_C05.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC**CCACCTACACT*AATCTGAA*CCGCCT
OVRT1_0090_B01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0105_H12.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC*CCAAACTACACT*AATCTGAAACCGCCT
OVRT1_0096_B06.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0150_H05.b : TCTGTC*GTAAAAACCTTGATA*TTGAACGC*CCCACCTACACT*AATCTGGA*ACGCCT
OVRT1_0144_E04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAAC*TACACT*AATCTGAA*CCGCCT
OVRT1_0108_F11.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SMG01_0018_A04.b : TCTGTC*GTACAAACCTTGATA*TTGAACGC*CCAAACTACACT*AATCTGAA*CCGGCT
ITT01_0100_F02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
BFLT1_0125_D09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
LVR01_0079_A11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0009_A06.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0023_E01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
CLNT1_0110_G04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
CLNT1_0107_D11.b : TCTGTC*GTAAAAACCTTTGAT*ATGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
OVRT1_0120_G10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*TATCTGAA*CCGCCT
OVRT1_0097_E07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PCT01_0036_D05.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0098_B12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
OVRT1_0113_G05.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0035_G03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
CLNT1_0072_C04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0086_F02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0095_D04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0084_D06.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0020_H10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ADR01_0055_D02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0077_G06.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
OVR01_0070_D03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0087_E12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
THY01_0022_B02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0042_E12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0046_F01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0041_F07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0018_F04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
ITT01_0078_C07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0052_C03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCCGCT
TES01_0065_G09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0017_C07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0028_E07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
OVRT1_0023_H04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
THY01_0071_F03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
UTR01_0068_E12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAAACTACACT*AATCTGAA*CCGCCT
OVRT1_0013_A03.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0093_B03.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0070_A11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0093_H12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRT1_0043_H01.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0034_G07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
ADR01_0052_D12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ADR01_0096_H10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0091_B03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
ADR01_0057_C08.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0047_H12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TCH01_0020_H12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVR01_0088_F01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SPL01_0099_D05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0110_E03.b : gcaacctttgatactgtaccccatacctacccttat
TES01_0034_D07.b : gtcgtaaaaacctgtaatttaaaggcccacccaacctaatttaaaacgccccttgaacca
LVRM1_0049_B08.b : TCTGT
TES01_0111_D12.b : TCTGTC*GTAAAACCCTTGATA*TTGAACGCCCCAACCTACACT*AATCTGAACCGCCCT
SKNB1_0021_B11.b : TCTGTC*GTAAAAACCTCGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
KDN01_0049_B07.b : TCTGTC*ATACAAACCTTGATAATTGAACGC*CCAACCTACACA*ATCCTGAA*CCCCCT
TES01_0062_G10.b : TCTGTCGTAAAAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTTGAACGGCTT
TES01_0101_E02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCACCC*ACACT*AATCTGAA*CCGCCT
TES01_0080_G09.b : TCTGTC*GTAGAAACTTTGATA**TGAACGC*CNAA*CTACACT*AATCTGAA*CCGCCT
TES01_0111_A03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0083_F01.b : TCTGTC*GTAGAAACTTTGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*ACGCCT
TES01_0092_A10.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCAACTACACT*AATCTGAA*CCGCCT
PCT01_0014_A08.b : TCTGTC*GTAGAAAACTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*ACGCCT
SKNB1_0041_C09.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0021_D01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PCT01_0015_A03.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAC*CCGCCT
PCT01_0035_F03.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0004_D12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0031_C02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0057_A01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0036_A01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
TES01_0017_A11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0032_H09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
KDN01_0038_A04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SKNB1_0091_H09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0007_H03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0028_D12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0026_D06.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0004_H05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0065_G08.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCCACCTACACT*AATCTGAA*CCGCCT
PST01_0057_D09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SKNB1_0019_F02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SMG01_0098_F09.b : aaaacctttatttttaagccccccctctaaatattttaaacccccccgaagaaaaatagg
TES01_0081_H07.b : atatcagtcatataaaaccctgaatatttaatccctcaactctaatttattctgataacc
LVRM1_0146_D06.b : TCTGTC*GTAGAAACCTGGATA*TTGAACCC*CCACCT
TES01_0079_C09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0015_F07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ADR01_0096_D11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
THY01_0113_A05.b :
OVRM1_0192_C10.b : TCTGTC*GTAGAAACCTA*ATA*TTGAACGC*CCACCTAacactatctgaccgcc
TES01_0079_E03.b : TCTGTC*GTAAAAACCTTGATA*TTGAACGC*CCAACCTACCCT*AATCTGAA*CGGCCC
TES01_0077_B03.b : TCTGTC*GAAAAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCCGCT
TES01_0107_D06.b : TCTGTC*GTAGAAACCTTGATA*TTGAA*GC*CCAACCTACACT*TATCTGAA*CCGCCT
TES01_0107_A12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0031_G02.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0058_B12.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAAACTACACT*AATCTGAAACGCCCT
TES01_0100_B08.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0032_F01.b : TCTGTC*GTATAAACCTTGATA*TTGAACGC*CCAACCTTACCT*AATCTGAA*CCGCCT
SKNB1_0069_D07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0102_H08.b : TCTGTC*GTAGAAACTTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0054_G01.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0019_E09.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0097_B05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0075_A07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0046_F11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0096_A11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0100_B04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0021_B11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SKNB1_0030_D07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0085_B11.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PST01_0027_D03.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0098_E05.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0027_D11.b : TCTGTC*CTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0085_G10.b : TCTGTCGTAAAAAACCTTGATA*TTGAACGC*CCCAACTACccctaatcgaacccccctc
TES01_0047_F04.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PCT01_0034_C11.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCCGCT
OVRM1_0182_H08.b :
SPL01_0097_G02.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0122_G07.b : TCTGTC*GTAGAAACCTTGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0057_H08.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
OVRM1_0204_A07.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0053_E04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ITT01_0028_E04.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
PBL01_0095_G02.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
TES01_0109_G08.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
ADR01_0008_C05.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
SPL01_0072_E09.b : TCTGTC*GTAGAAACCTCGATA*TTGAACGC*CCAACCTACACT*AATCTGAA*CCGCCT
20110601C-000430 : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
---------+---------+---------+---------+---------+---------+ 889
DCI01_0046_F12.b : CATGAGCC*CAGT*TGGGCCTCCATCCCT*GCTTCCCTG**AAGGTTGATGGGGCCC*TG
TES01_0040_B10.b : CATGAACCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGAAGGGGCCCCTG
UTR01_0085_C04.b : CATGAGCC*AATT*GTGTCCCTCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0043_C02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRM1_0218_H11.b :
OVR01_0020_C07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**AGGTTTGATGGGGCCC*TG
CLNT1_0082_C07.b : CATGAGCCAAATT*GTGTCCTCCA*CACT*GCTTTCCTG**AGGTTTGATGGGGCCC*TG
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b :
OVRM1_0203_G10.b :
OVR01_0091_E09.b : CCTGAGCCAAATT*GGGTCCTCCATCACT*GCTTCCCTGGAAGGTTTGATGGGGGCCCTA
OVRT1_0002_A01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**AANGTTGATGGGGCCC*TG
THY01_0053_H06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
ITT01_0053_F06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b : atgaaccaattgggtcctccacactgccttcctgaagtttgaggggccctgaatgttgat
CLNT1_0115_F05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGGCCCTG
OVRT1_0092_G07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTCCCCTG**AAGTTNGATGGGGCCC*TG
MLN01_0087_D07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PBL01_0089_H02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
ITT01_0052_D12.b : CATGAGCCCAATT*GTGTCCCTCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
LNG01_0080_D10.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b : CATGAGCCAAATGggggccctccatcactgctttcccctgaggtttgaagggggccctga
SMG01_0101_B05.b : CATGAGCCAAATG*GTGT*CTCCATCACT*GCTTCCCTG**AAGGTTGATGGGGCTC*TG
LNG01_0092_H05.b : CATGAGCCGAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCCTGN
OVRM1_0002_C10.b : c
TES01_0084_C12.b : CATGAACCATATG*GGGTCCTTCATCAAT*GGCTCCCTGA*AGTTTGAatggggccctga
OVRT1_0120_A10.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTGGAAGGGGCCCTGA
OVR01_0046_D09.b : CATGAGCCAGATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
CLNT1_0021_C09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0039_A04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRT1_0077_F07.b : CATGAGCCAAA*T*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
LVR01_0060_G01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b : C
OVR01_0100_D01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGAAGGGGCCCCTG
OVRT1_0066_A01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVR01_0071_D03.b : CATGAGCCAAATT*GTGTCCTCCCTCACT*GCTTCCCTG**AGGGTTGAAGGGGCCC*CG
OVRT1_0010_D08.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTNGATGGGGCCC*TG
SKNB1_0100_A08.b : CATGAGCCA*GTT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0112_A06.b : CATGAGCCAAATT*GTGTCCTCCGTCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0005_D07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0051_F11.b : CATGAGCCAAAAT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0065_C12.b : cattaaccaaaattgtgtcccccttcctagcttccctgaaagttgattggggcccttaaa
TES01_0082_F11.b : TCTGACCCAAATT*GTGTCTCCCACCCCT*GCTTCCCTGA*AGGTTGTAGGGGGCCCctg
TES01_0095_F07.b : CATGAACCAAATT*GGGTCTTTCAACCCT*GGCTCCCTG**AGGTTTGATGGGGCCC*GG
TES01_0042_D02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**GGGTTTGATGGGGCCC*TG
TES01_0011_A07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b : tg
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b : CATG
OVR01_0096_C09.b : CATGAGCCAAATT*GGGTCCTCCAttactggtttccctgaggttggaaggggccctgaaa
SMG01_0092_C04.b : CATGGACCAAATG*GTGTCCTC*ATCACG*GCTTCCCTG**GAGTTTGATGGGGCCC*TG
OVR01_0015_B12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
SMG01_0063_H01.b : CATGAGCCAAATT*TTGTCCTCCATCAAT*GCTTCCCTG**AAGGTTGATGGGGCCC*TG
OVRT1_0125_H11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGGCC*TG
OVRT1_0132_C05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AANGTTGAGGGGGCC**TG
OVRT1_0090_B01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTGA*NNGTTGATNGGG**CCTTG
OVRT1_0105_H12.b : CATGAGCAAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0096_B06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRT1_0150_H05.b : CATGAGCCAAA*T*GTGTCCCTCAACACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRT1_0144_E04.b : CATGAGCCAAA*T*GTGTCCTCCATCACT*GCTTCCTG***AGGTTTGATGGGGCCCCTG
OVRT1_0108_F11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGTTGGGGGCC*TG
SMG01_0018_A04.b : CATGAGCCAAAAT*GTGTCCTCCATCACTGCTTCCCCTG**AGGTTTGATGGGGCCCTTG
ITT01_0100_F02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGGCCCTG
BFLT1_0125_D09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTNGATGGGGCCC*TG
LVR01_0079_A11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTNCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0009_A06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0023_E01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTNCCTG**ANGGTTGATGGGGCCC*TG
CLNT1_0110_G04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
CLNT1_0107_D11.b : CATGAGCCAAATT*GTGTCCCTCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCN*TG
OVRT1_0120_G10.b : CATGAACCCAAAT*GTGTCCTCCAACACT*GCTTCCCTG**GAGGTTGGATGGGGCCCTG
OVRT1_0097_E07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
PCT01_0036_D05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTNNGATGGGCCC*TG
OVRT1_0098_B12.b : CATGAGCCAA*TT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0113_G05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVR01_0035_G03.b : CATGAACCAAATT*GTGTCCTCCATCACT*GCTCCCCTG***AGGTTTGTGGGGGCCCTG
CLNT1_0072_C04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0086_F02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRT1_0095_D04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
OVRT1_0084_D06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVR01_0020_H10.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGGCC*TG
ADR01_0055_D02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
OVRT1_0077_G06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AANGTTGATGGGGCCC*TG
OVR01_0070_D03.b : CATGAGCCCAAATGTGGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
ITT01_0087_E12.b : CATGAGCCAAATT*GTGGTCTCCATCACT*GCTTCCCTG**AGGTTTGAGGGGGCCC*TG
THY01_0022_B02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVR01_0042_E12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0046_F01.b : CATGAGCCCAA*T*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTNGATGGGGCCC*TG
OVRT1_0041_F07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTNCCTG**AGGTATGATGGGGCCC*TG
OVRT1_0018_F04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTGA*AGNNTTGATGGGCCT**TG
ITT01_0078_C07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
OVRT1_0052_C03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCCT**GAGGTTGATGGGGCCC*TG
TES01_0065_G09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AANGTTGATGGGGCCC*TG
TES01_0017_C07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0028_E07.b : CATGAGCCAAATT*GTGTCCTCCATCACTGCCTTCCCTG**ATGTTTGATGGGGCCC*CG
OVRT1_0023_H04.b : CATGAGCAAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCNTGA
THY01_0071_F03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
UTR01_0068_E12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0013_A03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCCT**GAGGTTGATGGGGCCN*TG
OVRT1_0093_B03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
ITT01_0070_A11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRT1_0093_H12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
OVRT1_0043_H01.b : CATGAGCCCAATT*GTGTCCTCCATCACT*GCTTCCCCN**TGAGTTGATGGGGCCC*TG
ITT01_0034_G07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGGTTGATGGGGCCC*TG
ADR01_0052_D12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**AAGTTTGATGGGGCCC*TG
ADR01_0096_H10.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGGTTGATGGGGCCC*TG
OVR01_0091_B03.b : CATGAGCCAAAAT*GTGTCCTCCATCACTGGCTTCCCTG**AAGTTTGATGGGGGCCCTG
ADR01_0057_C08.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
ITT01_0047_H12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TCH01_0020_H12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTNCCNNT*GAGTTTGATGGGGCCC*TG
OVR01_0088_F01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
SPL01_0099_D05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRM1_0110_E03.b :
TES01_0034_D07.b : aattttggtccccccccccgggttccctcaaagtttaaagggggcccccaaatgttattt
LVRM1_0049_B08.b :
TES01_0111_D12.b : CATGAACCAAAatttgggtcctccatccactgcttccctgaagtttgaaggggcccctga
SKNB1_0021_B11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGAAGGGGGCCCTG
KDN01_0049_B07.b : CATGAGCCAAATTTGTGTCTTCCATCACTTGCTTCCCTG**AAGTTTGATGGGGCCC*CG
TES01_0062_G10.b : CAGGAACCAAATTGTTGTCCTCCCTCCCT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0101_E02.b : CATGAGCCAAATT*GTGTCCTCCAACCCT*GCTTCCCTG**AAGTTTGATGGGGGCCCTG
TES01_0080_G09.b : CATGAGCCAAATT*GTGTTCCTCATCACT*GCTTCCCTTG*AAGTTTGATGGGGCCC*TG
TES01_0111_A03.b : CATGAGCCAA*TT*GTGTCCTCCATCACT*GCTTCCCTGG*AGG*TTGATGGGGCCCCTG
TES01_0083_F01.b : CATGAGCCAAATG*GGGTTCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGGCCTGA
TES01_0092_A10.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PCT01_0014_A08.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**AGGTTTGATGGGGCCC*TG
SKNB1_0041_C09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0021_D01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGCCC**TG
PCT01_0015_A03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTNGATGGGGCCC*TG
PCT01_0035_F03.b : CATGAGCCCAATT*GTGTCCTCCATCACT*GCTTTCCTG**AAGTTTGATGGGGCCC*TG
PST01_0004_D12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**A*GTTTGATGGGGCCC*TG
PST01_0031_C02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0057_A01.b : CATGAGCCNAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0036_A01.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCCCTG
TES01_0017_A11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCCCTG
TES01_0032_H09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
KDN01_0038_A04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
SKNB1_0091_H09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0007_H03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0028_D12.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0026_D06.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0004_H05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0065_G08.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**ANNGTTGATGGGGCCC*TG
PST01_0057_D09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
SKNB1_0019_F02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
SMG01_0098_F09.b : ggtccccacaaaggttttccaaggtttagggggcccccctatttttttttttaaaaaaaa
TES01_0081_H07.b : ctccttgaacccaaattgttattcatcaaatcaagcttccctgtatattttttatgggtc
LVRM1_0146_D06.b :
TES01_0079_C09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGNCCTTG
TES01_0015_F07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**ANGTTTGATGGGGCCC*TG
ADR01_0096_D11.b : CATGAGCCCAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
THY01_0113_A05.b :
OVRM1_0192_C10.b :
TES01_0079_E03.b : TCTGGAGCAAATT*GTGGCCTCCAACACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0077_B03.b : CCTGAACCAAATT*GTGTCCTCCATCACT*GGTTTCCCT**GAGGTTGGATGGGCCCTTG
TES01_0107_D06.b : CATGAGCCAAATT*GTGTCCCTCATCATT*GCTTCCCTG**AAGGTTTGAGGGGCCCCCG
TES01_0107_A12.b : CATGAGCCCAATTTGTGTCCTCCATCACT*GCTTCCCCTG*AAGTTTGATTGGGGCCCTG
TES01_0031_G02.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCCTG*AGGTTTGATGGGGCCCCTG
TES01_0058_B12.b : CATGAGCCAAATTTGTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGAATGGGGCCCTG
TES01_0100_B08.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC**T
TES01_0032_F01.b : CCTGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGGTTGAAGGGGGCC*TG
SKNB1_0069_D07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCCCTG
TES01_0102_H08.b : CATGAGCCAAAAT*GTGTCCCTCATCACT*GCTTCCCTG**AGGGTTGAAGGGGGCC*TG
TES01_0054_G01.b : CATGAGCCCAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0019_E09.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0097_B05.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0075_A07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0046_F11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0096_A11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0100_B04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0021_B11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
SKNB1_0030_D07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
PST01_0085_B11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PST01_0027_D03.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0098_E05.b : CATGAGCCAAATT*GTGTC*TCCATCACT*GCTTCCCTG**AAGTTTGATGGGGGCCTTG
TES01_0027_D11.b : CATGAGCCAAATT*GTGTCCTCC*TCACT*GCTTCCCTG**AAGTTTGATGGGGCCC*TG
TES01_0085_G10.b : atgagcccaattgtggtcctccatcactggctcccctgaggttttgaaggggcccctgaa
TES01_0047_F04.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCCT**GAGTTTGATGGGGCCC*TG
PCT01_0034_C11.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTTCCTG**AAGTTNNGATGGGCCN*TG
OVRM1_0182_H08.b :
SPL01_0097_G02.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRM1_0122_G07.b : CATGAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0057_H08.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
OVRM1_0204_A07.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
ITT01_0053_E04.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
ITT01_0028_E04.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
PBL01_0095_G02.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
TES01_0109_G08.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
ADR01_0008_C05.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*TG
SPL01_0072_E09.b : TATTAGCCAAATT*GTGTCCTCCATCACT*GCTTCCCTG**AGGTTTGATGGGGCCC*CG
20110601C-000430 : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
---------+---------+---------+---------+---------+---------+ 946
DCI01_0046_F12.b : AATGTTGA*TCTGACAGATTT*CCGAACAACCTGGTG*CCCT*ACCCC*GCATCCAT*TT
TES01_0040_B10.b : AAAGTTGA*ACTGACAAAATTCCAGAAAAACCTGGTGGCCTTACCCCA*CCATCCAT*TT
UTR01_0085_C04.b : AATGTTGA*TCTGACAGAATT*CAGACCAACCTGTGC*CCTA*CCCCC*GCATCCAT*TT
PST01_0043_C02.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCAT*TT
OVRM1_0218_H11.b :
OVR01_0020_C07.b : AATGTTGA*TCTGACAGAATTC*AGAACAACCTGGTG*CCCTACCCCC*GCATCCAT*TT
CLNT1_0082_C07.b : AATGGTGA*TCTTGAAG*ATTCCAGAACAACCTGGTGCCtaccccgcatcattttcctct
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b :
OVRM1_0203_G10.b :
OVR01_0091_E09.b : AATGTTGA*TTTGACAGAATTCCAAAACCAACCTGGgggcccctacccccgcattccatt
OVRT1_0002_A01.b : AAATGTGA*TCTGACAGAATTCAGGACNANCTGGTG***CCNTACCCC*GCATCCAT*TT
THY01_0053_H06.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCAT*TT
ITT01_0053_F06.b : AATGTTGA*TCTGACAGAATTCCAGACCCAACTGGTG*CCCTACCCCC*GCATCCATTTT
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b : ctgacaaattcagaccaactggtgccctacccccgcttctttttctttggccaataaccc
CLNT1_0115_F05.b : *ATGTTGA*TCTGACAGA*TTCCAGACAAACTGGTGG**CCTACCCCC*GCATCCATTTC
OVRT1_0092_G07.b : NNATGTGA*TCTGACAGAATTCCAGACCAACTGGTG***CCCTACCCC*GCATTCAT*TT
MLN01_0087_D07.b : AATGTTGA*TCTGACAGA*TTTCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PBL01_0089_H02.b : AAATGTGA*TCTGACAGAATTCCAGAAACAACTGGTG*CCCTACCCCC*GCATCCAT*TC
ITT01_0052_D12.b : AATGTTGA*TCTGACAGAATTTCCAGACCAACCTGGTGCCCTACCCCC*GCATCCATTTC
LNG01_0080_D10.b : AAATGTGA*TCTGACAGAATTCCAGAACAACCTGGTG*CCCTACCCCC*GTATCCATTTC
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b : aatgttgaacttgaccaaaatttcccgaccaaaccttgggggcccctaccccccgaattc
SMG01_0101_B05.b : AATGGTGA*TCTGACAGAAT**CCAAACAAACTGGTG*CCCTACCCCC*GAATCCTT*TC
LNG01_0092_H05.b : AATGT*GA*TCTGACAGAATTC*AGAACCACCTGGTG*CCNTACCCCC*GCATCCATTTC
OVRM1_0002_C10.b :
TES01_0084_C12.b : atgtttaatctgaaggaattccaaaacaaacctggggccctacccccggcattccttttc
OVRT1_0120_A10.b : AATGTTGA*TCTGAAAAAtttcagaacaacctggtggccctaccccgcaatccttttccc
OVR01_0046_D09.b : AATGTTGA*TCTGACAGAATTCCAGAACAACCCTGGTGCCCTACCCCCCGCATCCCTTTT
CLNT1_0021_C09.b : AAATGTGA*TCTGACAGAATCCCAGA*CAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0039_A04.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0077_F07.b : AATGTTGA*TCTGACNGAATTCAGAACCACCTGGTGG**CCTACCCCC*GCATC*ATTTC
LVR01_0060_G01.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b :
OVR01_0100_D01.b : AATGTTGA*TCTGACCGAATTTCCGAACAAACCTGGgggccctaacccccgcatccattt
OVRT1_0066_A01.b : AAATGTGA*TCTGACAGAATTCCAGACNANCTGGTG**CCCTACCCCC*GCATC*ATTTC
OVR01_0071_D03.b : AAAGGTGA*TCTGACAGAATTTCCGACCACCTGGTGG**CCTACCCCC*GCATCCATTTT
OVRT1_0010_D08.b : AATGTTGA*TCTGACAGAATTCAAGACNANNCTGGTG*CCCTACCCCC*GCATCAA*TTC
SKNB1_0100_A08.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0112_A06.b : AATGTTGA*TCTGACAGAATTCCAGACCAAACTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0005_D07.b : AATGTTGA*TCTGACAGAATTCCAGA*CAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0051_F11.b : AATGTTGA*TCTGACAGAATTC*AGAACAANCTGGTG*CCCTACCCCC*GCATCCAT*TC
TES01_0065_C12.b : tttttaatctgataaatttccaaaccaaccttggtgccctaacccccctttcttttttcc
TES01_0082_F11.b : atggttatcttgacaaaatttccaaaccaacctggttggcctaccccccgaatcaatttc
TES01_0095_F07.b : AATGTTAA*TCTGAACGAATTCCCGAACAAacttggtggccttacccccgattccatttc
TES01_0042_D02.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0011_A07.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b :
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b :
OVR01_0096_C09.b : tggtgaaccggaaaaaaattccaaaaccaacttgggggccctaccccccgcaacaaattc
SMG01_0092_C04.b : AATGTTGA*TCTGAAAAAATTCAAAACacctggggccttaacccccgatccaattccttt
OVR01_0015_B12.b : AATGGTGA*TCTGACAGAATTC*AGACCCANCTGGTG*CCCTACC
SMG01_0063_H01.b : AATGTTGA*TCTGACAGAATTCAGAACNACCTGTGG***CCCTACCCC*GCATCATTTTC
OVRT1_0125_H11.b : AATGTTGA*TCTGACAAAATTCCGGACCAACCTGGGTGCCCTA*CCCC*GCATCCTTTTC
OVRT1_0132_C05.b : AATGTGGA*TCTGACNGAATTCG*GACCAACCTGGTG**CCCTACCCC*GCATCTAT*Tc
OVRT1_0090_B01.b : AATGGTGA*TCTGACAGAATTCAAAACAACCTGGTTG***CCTACCCC*GCATCCATTTC
OVRT1_0105_H12.b : AATGTTGA*TCTGACAGAATTCAAAACCANC***TGGTGCCCTACCCC*GCATC*ATTTT
OVRT1_0096_B06.b : AATGTTGA*TCTGACTGAATTCCAGACCAACTGGTG***CCCTACCCC*GCATCCATTTC
OVRT1_0150_H05.b : GATGTTGA*TCTGACAGAATTC**AAACCAACTGGTTGCCCTACCCC**GAATCCATTTC
OVRT1_0144_E04.b : A*TGTTGA*TCTGAC*GAATTTCAGACCAACTGGTG***CCCTACCCC*GCATCCATTCC
OVRT1_0108_F11.b : AATGTTGA*TCTGACAGAATTCCAGACCACCTGGTG***CCCTACCCC*GCATCCAT*TT
SMG01_0018_A04.b : A*TGTTGA*TCTGACAAANTTCCAAACAACCTGGTGG**CCTACCCCC*GGATCCATT*C
ITT01_0100_F02.b : A*TGTTGA*TCTGACAGAATTC**AGACCAACTGGTGCCCCTACC*CC*GCATCCATTTC
BFLT1_0125_D09.b : AATGTTGA*TCTGACAAAATTC*AGACCAACCGGTG**CCCTACCCCC*GCATCCTTTT*
LVR01_0079_A11.b : AATGTTGA*TCTGACAGAATTCCAGACAAACCTGGTG*CCCTACCCCC*GCATCCAATTT
OVRT1_0009_A06.b : AATGGTTA*TCTGAAAAAATTTCCAGACAAACCTGGTGCCCTACCCCC*GCATCCTTTTC
OVRT1_0023_E01.b : AATGTTGA*TCTGACAGAATTNCAGACNANCTGGTG**CCCTACCCCC*GCATC**ATTT
CLNT1_0110_G04.b : AATGTTGA*TCTGACAGAATTCAAGACNACCTTGGTG**CCCTACCCC*GCATC*ATTTC
CLNT1_0107_D11.b : AATTGTGA*TCTGACAAATTNCAAGACCAACTGGTG***CCCTACCCC*GCATTCATTTC
OVRT1_0120_G10.b : AATGTTGA*TCTGAACAAATTCAAGACAAACCTGGTG*CCCTACCCCC*GCATTCAT*TT
OVRT1_0097_E07.b : AATGTTGA*TCTGACAAAATTCCAACAAACTGGGTG****CCTACCCC*GCAATCATTTC
PCT01_0036_D05.b : AAATGTGA*TCTGACAGAATTCCAGAACAANCTGNTG**CCCTACCCC*GCATCCATTT*
OVRT1_0098_B12.b : AATGTTGA*TCTGAC*GAATTCCAGAACCAACTGGTG**CCCTACCCC*GCATCCATTCC
OVRT1_0113_G05.b : AATGTTGA*TCTGACCGAATTCCAGACNAACTGGTG***CCCTACCCC*GCATTCAT*TT
OVR01_0035_G03.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCCTGGTGCCCTACCCCC*GCATCCATTTC
CLNT1_0072_C04.b : AATGTTGA*TCTGACAGAATTCCAGACCAACTGGTG***CCCTACCCC*GCATCCAT*TC
OVRT1_0086_F02.b : AATGTTGA*TCTGACAGAATTC**AGACAANCTGGTG*CCCTACCCCC*GCATCCAT*TC
OVRT1_0095_D04.b : AATGTTGA*TCTGACAGAATTTCAGACCCAACTGGTN*GCCTACCCCC*GCATCCATTCC
OVRT1_0084_D06.b : AAATGTGA*TCTGACAGAATTCCAGACCAAACTGGTG**CCCTACCCC*GCATCCATTT*
OVR01_0020_H10.b : AATGTTGA*TCTGACAGAATGCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ADR01_0055_D02.b : AAATGTGA*TCTGACAGAATTCAGAACCAACTGGTG**CCCTACCCCC*GCATC**ATTT
OVRT1_0077_G06.b : AATGTTGA*TCTGACAAAATCCAGAACAANCTGGNTG***CCTACCCC*GCATCCATTTC
OVR01_0070_D03.b : AAATGTGA*TCTGACAGAAATTCCAGACCACCCTGGTGCCCTAACCCC*GCATCCATTTC
ITT01_0087_E12.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTGCCCCTACCCCC*GCATTCATTTT
THY01_0022_B02.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*GCCTACCCCC*GCATCCATTTT
OVR01_0042_E12.b : AATGTTGA*TCTGACAAAATTCCAAACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0046_F01.b : AATGTTGA*TCTGACAGAATCCCAGA*CAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0041_F07.b : AATGGTGA*TCTGACAGAATTCCAGAACAACCTGGTG**CCTACCCCC*GCATCCATTTT
OVRT1_0018_F04.b : AATGTTGA*TCTGACAGAATTNCAGACNANC**TGNTGCCNTACCCCC*GCATCCATTTC
ITT01_0078_C07.b : AATGTTGA*TCTGACAGAA*TCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0052_C03.b : AATGTTGA*TCTGACAGAATTCCAGAACCAACTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0065_G09.b : AAATGTGA*TCTGACAGAATTCCAGACCAANCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0017_C07.b : AATGTTGA*TCTGACAGAATTCCAGACAAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0028_E07.b : AATGTTGA*TCTGACAGAATTCCCGACCCAACCTGGTGCCCTACCCCC*GCAATCATCTC
OVRT1_0023_H04.b : AATGT*GA*TCTGACAGAATTCAAAACCACCTGGTG**CCCTACCCCC*GCATCCATTTC
THY01_0071_F03.b : AATGTTGA*TCTGACAGAAATCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCAT*TT
UTR01_0068_E12.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCAATCAT*TT
OVRT1_0013_A03.b : AATGNTGA*TCTGACAGATTTNCAGACNA*CCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0093_B03.b : AATGTTGA*TCTGACAGAATTCCAGACCAANCTGGTG*CCTTACCCCC*GCATCCATTTC
ITT01_0070_A11.b : AATGTTGA*TCTGACAGAATTCCAGACCAACTGGTG**CCCTACCCCC*GCATCCATTTC
OVRT1_0093_H12.b : AATGTTGA*TCTGACAGATTTCCAGACNANCCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRT1_0043_H01.b : AAATGTGA*TCTGACAGAATTCCAGACNNAACTGGTG*CCCTACCCCC*GCATCCATT*C
ITT01_0034_G07.b : AAATGTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCAT*TC
ADR01_0052_D12.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ADR01_0096_H10.b : AATGTTGA*TCTGACAGAATTCCAGAACAAACTGGTGGCCCTA*CCCC*GCATCAATTTC
OVR01_0091_B03.b : AATGTTGA*TCTGACAGAAATTCCAGACAAACCTGTTGCCCTACCCCC*GCATCCATTTC
ADR01_0057_C08.b : AATGTTGA*TCTGACAGAATTCCAGACCAGCCTGGTG*CCCTACCCCC*GCATCCATTTC
ITT01_0047_H12.b : AATGTTGA*TCTGACAGAATTCCAGAACCAACCTGGTGCCCTACCCCC*GCCATCATTTC
TCH01_0020_H12.b : AATGTTGA*TCTGACAGAATTCAAGACCACCTGGTG***CCCTACCCC*GCATC*ATTTT
OVR01_0088_F01.b : AATGTTGA*TCTGACAGAATTC*AGACCANCCTGGTG**CCCTACCCC*GCATCCATTTT
SPL01_0099_D05.b : AATGTTGA*TCTGACAGAAATCCAGAACGACCTGGTGCCCTAACCCCC*GCATC*ATTTC
OVRM1_0110_E03.b :
TES01_0034_D07.b : tccaaaaaatttcaaaacacccttgggggcaaccccccgtatcctttttccctgggggca
LVRM1_0049_B08.b :
TES01_0111_D12.b : atgttgacttgaccaaattccaaaacaaacctgggggccctaccccccctatcctttttc
SKNB1_0021_B11.b : AAaggttgatcttgaaaaaatttccagaccaaaccgggtggccctaacccccgcaatcca
KDN01_0049_B07.b : AATGTTGA*TCAGACAGAATTCCA*AACAACCTGGTAACCTAACCCCcgtatcattttcc
TES01_0062_G10.b : GATGTTGA*TCTGAACAAAATTCCGGACCAACTTGGGGCCCTTACCCC*GAATCCTTTTC
TES01_0101_E02.b : AATGT*GA*TTTGAAAGAATTCCAAACAAACCTGGG***CCTTACCCC*GCAACCATTTC
TES01_0080_G09.b : GATGTTGA*TCTGACAGAATTC*AGACCCACCTGGTG*CCCTACCCCC*GCATCCATTT*
TES01_0111_A03.b : ATTGTTGA*TCTGACAGAATTCCAAACCAACC**GTGGCCCTACCCCC*GCATCCATTCC
TES01_0083_F01.b : AATGTTGA*TCTGAAAGAAATCCCAAACCAACCTGTTGCCCTACCCCC*GCATCCATTTC
TES01_0092_A10.b : AATGTTGA*TCTGACGGAATCCCGAACTAACTTGTTGCCCTACCCCCC*GCATC*AT*TT
PCT01_0014_A08.b : AATGTTGA*TCTGACAGAATT*CAGAACAACCTGGTG**CCCTACCCC*GCATCCA*TTC
SKNB1_0041_C09.b : AATGTTGA*TCTGACAGAATTCAGACNANNC****TGGTGCCTACCCC*GCATCCAT*TT
TES01_0021_D01.b : AATGTTGA*TCTGACAGAATTCCAGAACAACCTGGTG**CCCTACCCC*GCATCCCATTT
PCT01_0015_A03.b : AATGTTGA*TCTGACAGAATTCCAGACNAACCTGGTG**CCCTACCCC*GCATCCATTTC
PCT01_0035_F03.b : AATGTTGA*TCTGACAGAATTCCAGACCANCTGNT***GCCCTACCCC*GCATC*ATTTT
PST01_0004_D12.b : AATGTTGA*TCTGACAGATTTCAGAACCAACCGGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0031_C02.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0057_A01.b : AATGTTGA*TCTGACAGAATTC*AGAACAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0036_A01.b : *ATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0017_A11.b : A*TGTTGA*TCTGGCAGAATTCCAAACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0032_H09.b : AATGTTGA*TCTGACAAAATTCCAGAACAACCTGGTG*CCCTACCCCC*GCATCCATTTT
KDN01_0038_A04.b : AATGTTGA*TCTGACAGAATTCCAGACCCACCTGGTG*CCCTACCCCC*GCATCCATTTC
SKNB1_0091_H09.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0007_H03.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0028_D12.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0026_D06.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0004_H05.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0065_G08.b : AATGTTGA*TCTGACAGAATTC*AGAACNANCTGGTG*CCCTACCCCC*GCATCCAT*TC
PST01_0057_D09.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
SKNB1_0019_F02.b : AATGTTGA*TCTGACAGAATTCCAGAACCACCTGGTG*CCCTACCCCC*CGCATCATTTC
SMG01_0098_F09.b : tcaaaaacaaggggggtgccccccccccaatttttttttcgtgggaaaaaaaccccccct
TES01_0081_H07.b : ccctttattggttatccttaacaaattttcttaatctacttgtggtgcgcaatccccgtt
LVRM1_0146_D06.b :
TES01_0079_C09.b : ATTGT*GA*TCTGACAGAATTCCAAACCAACTGGTG***CCCTACCCC*GCATCCATTTC
TES01_0015_F07.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ADR01_0096_D11.b : AATGTTGA*TCTGACAGAACTCCAGACAAACCTGGTG*CCCTACCCCC*GCATCCATTTC
THY01_0113_A05.b :
OVRM1_0192_C10.b :
TES01_0079_E03.b : AATGTGatttgacaaattcccaacaaactgtgggccctaccccggatccttttccttggg
TES01_0077_B03.b : AATGTTGA*TCTGAAAAATTTCAAAACCACCTGGTGgccctaaccccgcaatccttttcc
TES01_0107_D06.b : AATGTTAA*TCTAACAAATTTCAAAACAAACCTGGGG*CCCTACCCCC*CCATCCATTTC
TES01_0107_A12.b : AATGTTGAATCTGACAAAATTCCAAACCAACCTTGTGGCCCTACCCCC*GCATCCAT*TT
TES01_0031_G02.b : AATGTTGA*TCTGACAGAATTCCCGAACAACCTGGGTGCCCTACCCCC*GCATCCCTTTC
TES01_0058_B12.b : AATGTTGA*TCTGACAGAAATTCCGAACCAACCTGGTGCCCTACCCCC*GCATCCAATTT
TES01_0100_B08.b : GATGTTGA*TCTGACAAAATTCC*GAACAACCTGGTG*CCCTACCCCC*GCATCCATTTT
TES01_0032_F01.b : AATGTTGA*TCTGAACGAATTCCAAACCAACCTGGTG*CCCTACCCCC*GCATCCCTTTT
SKNB1_0069_D07.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0102_H08.b : AAAGTTGA*TCTGACCGAAT*CCAGAACCACCTGGTG*CCCTACCCCC*GCATCCATTT*
TES01_0054_G01.b : AATGTTGA*TCTGACAGAATTCCAGACCAAACTGGTG*CCTTACCCCC*GCATCAATTTC
TES01_0019_E09.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0097_B05.b : AATGTTGA*TCTGACAGAAATCCAGAACAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0075_A07.b : AATGTTGA*TCTGACAGAATTCCAGAACAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0046_F11.b : AATGTTGA*TCTGACAGAATTCCAGA*CAACCTGNTG*CCCTACCCCC*GCATCCATTTC
PST01_0096_A11.b : AATGTTGA*TCTGACAGAATTCCAGAACAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0100_B04.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0021_B11.b : AATGTTGA*TCTGACAGAAATTCCAGACCAACCGGGTGCCCTAACCCC*CCATCCATTTC
SKNB1_0030_D07.b : AATGTTGA*TCTGACAGAATTCCAGACCCACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0085_B11.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PST01_0027_D03.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0098_E05.b : AATG*TGA*TCTGACAGAATTCC*GACCAACCTGGTG*CCCTACCCCC*GCATC*ATTTT
TES01_0027_D11.b : AAAGGTGA*TCTGA*AGAAATCCCGAACAACCTGGTG*CCCTACCCCC*CGCACCAT*TT
TES01_0085_G10.b : agtttattctgaccaaattccccaaaccaacctgggggcccttacccccccgaacccatt
TES01_0047_F04.b : AATGTTGA*TCTGACCGAATTCCAACCAAACCTGGTG*CCTTACCCCC*GCATCCATTTT
PCT01_0034_C11.b : AAATGTGA*TCTGACAGAATTTCAGAACAACCTGNTG**CCCTACCCC*GCATCCAT*TC
OVRM1_0182_H08.b :
SPL01_0097_G02.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRM1_0122_G07.b : AATGTTGA*TCTGACAGAATTCCAGA*CAACCTGGTG*CCCTACCCCG*GCATCCAATTC
TES01_0057_H08.b : AATGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
OVRM1_0204_A07.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ITT01_0053_E04.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ITT01_0028_E04.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
PBL01_0095_G02.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
TES01_0109_G08.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
ADR01_0008_C05.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
SPL01_0072_E09.b : AACGTTGA*TCTGACAGAATTCCAGACCAACCTGGTG*CCCTACCCCC*GCATCCATTTC
20110601C-000430 : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
---------+---------+---------+---------+---------+---------+ 1002
DCI01_0046_F12.b : CCCTCTGGCCAAATAC*CCCCCCTattctctgctgaaaaagcctaccagaaccgactact
TES01_0040_B10.b : CCCTtttgggcaattaaggcccccgtcttctctgctgaaaaagcctaccatgaaaaactt
UTR01_0085_C04.b : CCTCTGGCCCATAAGC*CCCGTCATCTtgctgagaaagccaccatgaccgctactgtaca
PST01_0043_C02.b : CCCTCTGGNCACATAC*GCCCCCGTCATCT*CTGCTGAGAAAGCCCTACAT*GAACAGCT
OVRM1_0218_H11.b :
OVR01_0020_C07.b : CCCTCTGGCCACATACGCCCCCCGTCATCT*CTGCTGAAAAAAGCctaccatgaacaagc
CLNT1_0082_C07.b : gggcaataagccccgtcatctcggtgggaaagctacctggacggttatggacagaatcat
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b :
OVRM1_0203_G10.b :
OVR01_0091_E09.b : tccctctgggccaaatatcgcccccggtcatttttggctgagaaaggcctaccctgaaaa
OVRT1_0002_A01.b : CCTCTGGNCAATACGCCCCCGTCATtctgctgagaaagctacatgaacgctactgtacaa
THY01_0053_H06.b : CCCTCTGGCCACATAC*GCCCCCGTCATCT*CTGCTGAAAAAGCC*TACAT*GAACAGCT
ITT01_0053_F06.b : CCTCTGGNCACATACNG**CCCCGTCATCT*CTGCTGAGAAAGCTAC*CAT*GAACAGCT
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b : ccgtaattttgcgaaaaacctaccggaacgcttacggaccaaaatcccaatgcttgcttt
CLNT1_0115_F05.b : CCTTGGGCAAATACGCCCCgtcattctgctgagaagcctacatgaacgcttactgtacaa
OVRT1_0092_G07.b : CCTCTGGCAAATA****CCCCCCGTCATCT*C*GCTGAGAAAGCTACATGAacagctact
MLN01_0087_D07.b : CCTCGGGCCAAATA**CGCCCCCGTCATCT*CTGCTGAAAAAGGCTTACAT*GAACAGCT
PBL01_0089_H02.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCCTACAT*GAACAGCT
ITT01_0052_D12.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGC*TACCAT*GAACAGCT
LNG01_0080_D10.b : C*TCTGGCCACATA**CGCCCTCGTCATCT*CTGCTGAGAAAGCTTA*CAT*GAACAGCT
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b : cattttcccctctggggcaacattacgccccccgtttaatttttggttgaaaaaagcccc
SMG01_0101_B05.b : CNTCTGGCAataagccccgtcatcctgctgaaaaacctacatgaacgcttactgtaccaa
LNG01_0092_H05.b : CTCTGGNCGCATA***CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRM1_0002_C10.b :
TES01_0084_C12.b : cctctggggcactaaagcccccgttattctttggtgaaaaaagccttccattgaaaagtt
OVRT1_0120_A10.b : tcgggcaaatacgcccccgtctttcttgcgaaaaagcccaccctgaaacgctttcggaac
OVR01_0046_D09.b : CCCTCTGGGCACATACGCCCCCGTTCATCT*CTGCTGaaaaaagcctaccatgaacaagt
CLNT1_0021_C09.b : CCTCTGGCAAATA***CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACATG*GACAGgct
TES01_0039_A04.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRT1_0077_F07.b : CCTCTGGNCAAATA**CGCCCCCGTCATCT*CTGCTGAGAAAGC*TACCAT*GGACAGCT
LVR01_0060_G01.b : CCTCTGGCCACATA*CGCCCCCCGTCATCT*CTGCTGAGAAAAGCTACCATGGAACAGCT
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b :
OVR01_0100_D01.b : tccctctgggccaaattacgccccccgtccttctctgctgaaaaaaaccctaccattgaa
OVRT1_0066_A01.b : CCTCTGGGCAATACGCCCCCGTCATtctgctgagaaacctacctggacagctactgtacc
OVR01_0071_D03.b : CCTCTGGCCACATAAGCCCCCGTCtttctggtgaaaaagcctacctggaaccctttctgt
OVRT1_0010_D08.b : CCTCTGGCACATA***CGCCCCCGTCATCT*CTGCTGA*AAAGCCTACCAT*GAACgctt
SKNB1_0100_A08.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRT1_0112_A06.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GA*CAGCT
TES01_0005_D07.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAA*GCCTACCAT*GAACAGCT
TES01_0051_F11.b : CCTCTGGCACATA***CGCCCCCGTCATCT*CTGCTGAGAAAGC*TACCAT*GA*CAGCT
TES01_0065_C12.b : ccttgggccaaataactcccccgaaatttcctgcttaaaaaccccacccctaaacatgct
TES01_0082_F11.b : tcctttggccaatatagccccccttttttcttggtgtaaaaaccctaccctgaacacttt
TES01_0095_F07.b : cttttggcccaattacccccccgttattcttgtgttaaaaaacctaccctggaaaccctt
TES01_0042_D02.b : CCTCTGGCACATA***CGCCCCCGTCATCT*CTGCTGAGAAAACCTACCAT*TGACAGCC
TES01_0011_A07.b : CCTCTGGCCACATA**CCCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b :
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b :
OVR01_0096_C09.b : ccttctggcccaattaccccccccgtcattttttgctgaaaaaaagcctaaccattaaac
SMG01_0092_C04.b : ggggcaataacccccctttatctttggtaaaaaacccaacctgaaaagctaactggtaca
OVR01_0015_B12.b :
SMG01_0063_H01.b : CTTTGGCCAataagcccccgtattctgctgaaaacctaactggaaggtttctgttacaaa
OVRT1_0125_H11.b : CTCTGGCCAattagcccccgtcattctgctaaaaaacctacatgaacagcttatggacca
OVRT1_0132_C05.b : ctctgccaaatacgccccgtcattctgctgaaaagctacatgaacgcttactgtagcaaa
OVRT1_0090_B01.b : CTCTGGgcaatacgcccccctcattctgctgagaagcctaccatgaacagctactgtacc
OVRT1_0105_H12.b : CCTCTGGCAAATACGCCCCCgtctctcgctaaaaaacctacctgaacggcttatggacaa
OVRT1_0096_B06.b : CTCTGGCCACATACCCCCCgtctctctgctgagaaagctaccatgacagctaatgtagca
OVRT1_0150_H05.b : CCTTGGGCACATACGCCCCcgtatttttgctgaaaaagctacctggaacgctactgaacc
OVRT1_0144_E04.b : CTCTGGCAattagcccccgtcattttgctgaaaaagctaccatgacagcttatggaaaaa
OVRT1_0108_F11.b : CCTCTGGCCAATA****CGCCCCGTCATCTtgctgaaaagcctacatggacagctactgt
SMG01_0018_A04.b : CTTCTGGCAAATAA***GCCCCCGTCTTCT*CTGCTGAaaaagccacccggaacgcttac
ITT01_0100_F02.b : CCTCTGGCCACATA**CGCCCCCGTCGTCT*CTGCTGAGAA*GCCTACCAT*GAAagctt
BFLT1_0125_D09.b : CCTCTGCCAAATA****CGCCCCGTCATCT*CTGCTGagaaagcaacatgaacagctacg
LVR01_0079_A11.b : CCTCTGGCCACATA**CGCCCCCGTC
OVRT1_0009_A06.b : CCTTGGGCACTTACG***CCCCCGTCATCT*CTGCTGAAAAAAgcctacctgaaacgctt
OVRT1_0023_E01.b : CCTCTGGCACATACGCCCCGTCTCTCTGCTGaaaagctacatgacagctactgtacagaa
CLNT1_0110_G04.b : CCTCTGGCAAATTA***GCCCCCGTCATCT*CTGCTGAAAAacctacctgaacagcttac
CLNT1_0107_D11.b : CTCTGGGCAATA****CGCCCCCGTCATCT*CTGCTGAAAAAcctacctgaaagcttacg
OVRT1_0120_G10.b : CCCTCTGGGCAAATAA*CCCCCCCTTATCT*CTGCTGGAAAAGaccaaccagaaacgctt
OVRT1_0097_E07.b : CCTCTGGCCACATAC**GCCCCCGTCATCT*CTGCTGAAAAAGCTAaccaggaaagcttt
PCT01_0036_D05.b : CCTCTGGCACATAT***GCCCCTGTCATCT*CTGCTGAGAAAGC*TACCAT*GAACAGCT
OVRT1_0098_B12.b : CCTCTGGCACATA****CGCCCCGTCATCT*CTGCTGAGAAGCCTACcagaacggctaat
OVRT1_0113_G05.b : CCTCTGGCAAATAAG****CCCCGTCATCT*CTGCTGAAAAGCCTACATGgaaagcttat
OVR01_0035_G03.b : CCTCTGGGCACATTAC*CCCCCCGTCATCTtttcttaagaaaacctaccatgaacagctt
CLNT1_0072_C04.b : CCTCTGGCACATACGC*CCCGTC****TCT*CTGCTGAGAAAGCTACATGA*CAGCTTac
OVRT1_0086_F02.b : CCTCTGGCACATACGCCCCGTCACTC******TGCTGAGAAAGCTACcatgacagctact
OVRT1_0095_D04.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRT1_0084_D06.b : CCTCTGGCACATA****CGCCCCGTCATCT*CTGCTGAGAAAGC**TACAA*TGACAGCT
OVR01_0020_H10.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAAACAGC
ADR01_0055_D02.b : CCTCTGGCACATA****CGCCCCGTCATCT*CTGCTGAGAAAGCTACATGA*CAGCTACT
OVRT1_0077_G06.b : CCTCTGCCCAATA***CGCCCCCGTCATCT*CTGCTGAGAAAGCCTA*CAT*GAACAGCT
OVR01_0070_D03.b : CCTCTGGGCCAATA**CGCCCCCCGTATCC*CTGGTGAGAAAGCCTACCCT*GAACAGCT
ITT01_0087_E12.b : CCTCTGGCCACATA*CGCCCCCGTTCATTT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
THY01_0022_B02.b : CCCTCTGGCCACATACCGCCCCCGTCATCTTCTGCTGAGAAAGCCTACCAT*GAAAAGCT
OVR01_0042_E12.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAAAAAACCTACCAT*GAAACAcc
OVRT1_0046_F01.b : CCTCTGGTAACTAA***GCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACGGCT
OVRT1_0041_F07.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCTT*ACAT*GAACAGGC
OVRT1_0018_F04.b : CTCTGGCACATA*****CGCCCCGTCATCT*CTGCTGAAAAAGCT**ACCA*TGACAGCT
ITT01_0078_C07.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCCA*TGACAGCT
OVRT1_0052_C03.b : CCTCTGGCAAATA***CGCCCCCGTCATCT*CTGCTGAAAAAGCCTA*CAT*GAACAGCT
TES01_0065_G09.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCCTACAT*GAACAGCT
TES01_0017_C07.b : CTCTGGCCACATA***CGCCCCCGTCATCT*CTGCTGAAAAAGCCTACCAT*GAACAGCT
TES01_0028_E07.b : CCTCTGGCCACATA**CGCCCCCGTCATCC*CTGCTGAAAAAGCCTACCAT*GAACAGCT
OVRT1_0023_H04.b : CTCTGGGCAAATA***CGCCCCCGTCATCT*CTGCTGAGAAAGC*TACCAT*GAACAGCC
THY01_0071_F03.b : CCCTCTGGCCACATACGCCCCCCGTCATCT*CTGGTGAAGAAGCCCACCAT*GAACAGCT
UTR01_0068_E12.b : CCCTCTGGGCACATACGCCCCCCGTCATCT*CTGCTGAAAAAAGCCTACAT*GAACAGCT
OVRT1_0013_A03.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGA*AAAGCCTNACAT*GAACAGCT
OVRT1_0093_B03.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAAAAAAGCCTACAT*GAACAGCT
ITT01_0070_A11.b : CCTCTGGTCAATA***CGCCCCCGTCATCT*CTGCTGAGA*AGCCTACCAT*GAACAGCC
OVRT1_0093_H12.b : CCTCTGGGCCAATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTAACAT*GAACAGCT
OVRT1_0043_H01.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
ITT01_0034_G07.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGGCTACCAT*GAACAGCT
ADR01_0052_D12.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAAAAAAGCTACCAT*GAACAGCT
ADR01_0096_H10.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVR01_0091_B03.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAAAAAGCCCTACAT*GGAAAGCT
ADR01_0057_C08.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAAGAAGCCTACCAT*GAACAGCT
ITT01_0047_H12.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TCH01_0020_H12.b : CCTCTGGCCACATA**CGCCCCCGTCATCTCTGGCTGAGAAAGCCTACCAT*GA*CAGCT
OVR01_0088_F01.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGGCTACCAT*GAACAGCT
SPL01_0099_D05.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRM1_0110_E03.b :
TES01_0034_D07.b : aaataccccccggtattctttggggagaaaaccccccctgaaaaaactttcttggtgcaa
LVRM1_0049_B08.b :
TES01_0111_D12.b : cctctgggcccatatacccccccgtcattttttgctgaaaaaaacccctccctgaaacac
SKNB1_0021_B11.b : atttccctcttgccaccataagccccccgtcaatcttggctgaaaaaaagcccaacccag
KDN01_0049_B07.b : ctctggccaattaccccccccttaattcttgctgagaaacccacctttaaaagctttatg
TES01_0062_G10.b : Ctctggccaaattaccccccgtcttttctgctgaaaaaccccccttgaacattttagtgt
TES01_0101_E02.b : CCTTTGGCCAAATAGCCCCCcgtatttttggctgaaaacccaccctgaacaactttatgg
TES01_0080_G09.b : CCTCTGGCCAATACGCCCCGTCATtctgcggagaaacccacctgaacagcttatgtaaca
TES01_0111_A03.b : CTTCTGCCCAATTCGCCCCCCTCATttttgctaaaaaagcctacctgaccgcttacggtt
TES01_0083_F01.b : CCTCTTGGCCAATA**CGCCCCCGTCATTC*CTGGCGAAAAAGCCTACCtggaaacctta
TES01_0092_A10.b : CCTTCTGGGCAAATAC*GCCCCGGTCATCT*CGGCTGA*AAAGCCTAACAT*GAAacgct
PCT01_0014_A08.b : CCTCTGGCAAATAT***GCCCCTGTCATCT*CTGCTGAAAAAAGCTACCAT*GAcagctt
SKNB1_0041_C09.b : CCTCTGCCACATA****CGCCCCCTCATCT*CTGCTGAGAAAGCT**ACAT*GAACAGCT
TES01_0021_D01.b : CCTCTGGGCACTAAG***CCCCCGTCATCT*CTGCTGAAAAAGCCTAACCT*GAACGCCT
PCT01_0015_A03.b : CCTCTGGCCACATA**TGCCCCTGTCATCT*CTGCTGAAAAAACCTACCAT*GACCAGCT
PCT01_0035_F03.b : CCTCTGNCACATAT***GCCCCTGTCATCT*CTGCTGAGAAAGC*TACCAT*G*ACAGCT
PST01_0004_D12.b : CCTCTGGGCACATA**AGCCCCCGTCATCT*CTGCTGAAAAAGCCTACCAT*GAACAGCT
PST01_0031_C02.b : CCTCTGGCCACATA**CCGCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0057_A01.b : CCTCTGGCACATA***CGCCCCCGTCATCT*CTGCTGAAAAAGCCTACCAT*GAACAGCT
TES01_0036_A01.b : CCTCTGGNCACATA**CGCCCCCCTCATCT*CTGCTGAGAAAGCCTACCAT*TGACAGCC
TES01_0017_A11.b : CCTCTGGCCCCATA**CCCCCCCTTCATCT*CTGCTGAAAAAGCCTACC*T*GAACACCT
TES01_0032_H09.b : CCTCTGGCCACATA**CCCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACA*CT
KDN01_0038_A04.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAAGCTACCAT*GAACAGCT
SKNB1_0091_H09.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCCA*TGACAGCT
TES01_0007_H03.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTA*CAT*GAACAGCT
PST01_0028_D12.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTAACAT*GAACAGCT
PST01_0026_D06.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0004_H05.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0065_G08.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAGGCCCTACAT*GAACAGCC
PST01_0057_D09.b : CCTCTGGCCACATAC*NGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
SKNB1_0019_F02.b : CCTCTGGNCACATA*CGCCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
SMG01_0098_F09.b : tttttttgggggaaaaacccccccgaaaagtttttttgtggaaaaaaaaaaattttgggt
TES01_0081_H07.b : ttattttttctctttagttaactattaccccccttaatcttatgtatttaaaaatcctac
LVRM1_0146_D06.b :
TES01_0079_C09.b : CCTCTGGCACATA****CGCCCCGTCATCT*CTGCTGAAAAAGCTACATGA*ACgcttac
TES01_0015_F07.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
ADR01_0096_D11.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAAGCTACCAT*GAACAGCT
THY01_0113_A05.b :
OVRM1_0192_C10.b :
TES01_0079_E03.b : caaaaaaccccccttattctctgccaaaaaacctacctgaacactttatggaacaaaata
TES01_0077_B03.b : ctctggccaataacccccccgttattcttgctgaaaaaccctcccttaacacctttatgg
TES01_0107_D06.b : CTTTGGGCCAAATACCCCCCCGTttttcttggtgaaaaagccctcccttgaaacgttttg
TES01_0107_A12.b : CCCTCTGGCCCAATAA*CCCCCCGTCATtttctgctgaaaaaagcctaccatgaaacgcc
TES01_0031_G02.b : CCTTTGGGCCAAATAC*GCCCCCGTCATCTCTGgctgaaaaaaccctacctggacaactt
TES01_0058_B12.b : CCTTCTGGCCAACTTACCCCCCCGTCATCT*CTGCTGAAAAAGCCctacattgaaacacc
TES01_0100_B08.b : CCTCTGGGCACATA***GCCCCCGTCATCT*CTGCTGAAAAAGCCTACCTGgaacaccta
TES01_0032_F01.b : CCCTCTGGCCCATA*CGCCCCCCGTCATTT*CTGCTGTAAAACCCTACCCT*GAACAGCT
SKNB1_0069_D07.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCT*ACAT*GAACAGCT
TES01_0102_H08.b : CCTCTGGCCAACTA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTA*CAG*GAACAGCT
TES01_0054_G01.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCCT*GAACAGCT
TES01_0019_E09.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTTACAT*GAACAGCT
TES01_0097_B05.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCCTACAT*GAACAGCT
PST01_0075_A07.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
PST01_0046_F11.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
PST01_0096_A11.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
PST01_0100_B04.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0021_B11.b : CCTCTGGCCACATA**CGCCCCCGTTCTCT*CTGCTGAAAAACCCTACC*T*GGACACCT
SKNB1_0030_D07.b : CCTCTGGNCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
PST01_0085_B11.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTAACATGAAACAGCT
PST01_0027_D03.b : CCTCTGGGCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0098_E05.b : CCTCTGGCAAATACGCCCCCGTCATCTCgctgaaaaacctaccctgacagcttacgtacc
TES01_0027_D11.b : CCCTTTGGCCAATAAC*CCCCCCTTCATCT*CTGCGGAAAAAGCCTACAAT*GAAaaact
TES01_0085_G10.b : ttccctctgggcccaaataagcccccccgtttattttttggttgagaaaaagccctcccc
TES01_0047_F04.b : CCTCTGGC*CACATACGCCCCCCGTCATCT*CTGCTtgaaaaaccctaccatgaacaact
PCT01_0034_C11.b : CCTCTGGCACATAT***GCCCCTGTCATCT*CTGCTGAAAAAGCT**ACAT*GAACAGCT
OVRM1_0182_H08.b :
SPL01_0097_G02.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRM1_0122_G07.b : CCTCTGGCCACATA***GGCCCCGTCATCT*CTGCTGAGAAAGCTT*ACAT*GAACAGCT
TES01_0057_H08.b : CCTCTGGCCACATA**CGCCCCCGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
OVRM1_0204_A07.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
ITT01_0053_E04.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
ITT01_0028_E04.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
PBL01_0095_G02.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
TES01_0109_G08.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
ADR01_0008_C05.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
SPL01_0072_E09.b : CCTCTGGCCACATA**CGCCCCTGTCATCT*CTGCTGAGAAAGCCTACCAT*GAACAGCT
20110601C-000430 : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAACCAGATGGTGAAATGT
---------+---------+---------+---------+---------+---------+ 1060
DCI01_0046_F12.b : gttaccaaaataccaatgcttgccttgacccccccacccgaaggggaaaagggaccttcc
TES01_0040_B10.b : tactggtacaaaaatcactaaggcttgcttttaaccccccatacaaatggtgaaatgttc
UTR01_0085_C04.b : gagatcctaatgctggcttagccaccaacccaaggtgaatgtgaccccccagggaaaatc
PST01_0043_C02.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*Cagccnacagaatggtgaatgtga
OVRM1_0218_H11.b :
OVR01_0020_C07.b : ttactggaaccaaaaatccctaatgctttgcttttgagccaagcccaaccaaatggggga
CLNT1_0082_C07.b : aaggttgcttgggccaccaccgagggggaaggggacctcgcgggaaaaaagggcggcgcc
OVRM1_0174_E04.b :
OVRM1_0043_B10.b :
SPL01_0012_H07.b :
OVRM1_0203_G10.b :
OVR01_0091_E09.b : gctttaatggtagccaaaaatcactaaatgcttggttttgagcccgccccacccaaaggg
OVRT1_0002_A01.b : aatcactatgctgctttgaccaccaacagatggggatgtgacctcgcatggaaatactgg
THY01_0053_H06.b : TACTGTAGCAAAAATTACTAATGGCTtggttttgaccacccaaccaaaaggggaaaaggg
ITT01_0053_F06.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAANCAGATGGNTGAATGT
LVRM1_0098_A12.b :
OVRM1_0215_B06.b :
LVRM1_0181_D01.b :
OVRM1_0018_F03.b :
OVRM1_0130_F05.b :
OVRT1_0131_C07.b : aacaaccaaccaaggggaaagggccccccccggaaaaacaggcccgccgccggtttaccg
CLNT1_0115_F05.b : aaatcactatgctgcttgaccagccaacagatgggaaagggcccccccagggaaaacagg
OVRT1_0092_G07.b : gtacaaaaatcactatgcttgcttgagccagcaacaaatgtgaaatggacctcgcatgta
MLN01_0087_D07.b : TACTGTAACAAAAATCAC*AATGGCTTGCTTgagccagccaaccaaatggtgaaatgggc
PBL01_0089_H02.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCCAACAGATGGTGAAATGT
ITT01_0052_D12.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCANCCAC*CAGATGGTGAAATGT
LNG01_0080_D10.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAA*CAGATGGTGAAATGT
OVRM1_0212_A03.b :
OVRM1_0064_A05.b :
OVRM1_0104_H04.b :
OVR01_0100_H04.b : aaccagggagcaaggctttaatggttagccagaaagattccccaaagggtcttggctttt
SMG01_0101_B05.b : aatcctaaggctgctttgaccacccaacaaaggggaaatggaccccgccaggtaaaaaat
LNG01_0092_H05.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTNNG*AGCAGCCANCAGAT*GTGAAATGT
OVRM1_0002_C10.b :
TES01_0084_C12.b : taattgtgcaaaaaattacttaatgctttgcctttgaaccaccccaaccagaaaggggaa
OVRT1_0120_A10.b : aaaatccaaatggcttgcttgaaccacccaaccaaagggaaatgtggccccccccaggga
OVR01_0046_D09.b : taactgtaagcaaagatccctaaatgcttggcttttgaaccagcccacccgaaaggggga
CLNT1_0021_C09.b : actgtagcaaaaatcctaatgcttgctttggaccagccaaccagatggggaaatgggacc
TES01_0039_A04.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCACCCA**CCAGATGGTGAATGT
OVRT1_0077_F07.b : TACTGTANCAGA*ATTACTAATGCTgctttgagcagcccaccagatgggtgaatgtgacc
LVR01_0060_G01.b : TACTGTAACAGAAATCGCTAAT*GCTTGCTTTTGA*GCAGCCAACCAGATGGTGAAAatg
LVRM1_0133_B02.b :
OVRM1_0214_E04.b :
OVRM1_0168_B02.b :
OVRM1_0196_H11.b :
OVRM1_0096_E06.b :
OVRM1_0208_B12.b :
OVRM1_0114_E11.b :
OVR01_0100_D01.b : cagctttatggtaaccaaaaaaatcccaaatggcttgccttttgagcccgcgccaaccca
OVRT1_0066_A01.b : aaaaatcctatggctgcttgagccgccaacgaatgtgaatgggaccctggcatgtaatac
OVR01_0071_D03.b : aaccaaaataccaaaggctggctttgagccccccaacccaagggggaaaggggccccccc
OVRT1_0010_D08.b : actgtagcaaagatcactatgcttgctttgagccagcaaccaaatgtgaaatggacctcg
SKNB1_0100_A08.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CAGCCcaccgaatgggtgaatgtg
OVRT1_0112_A06.b : TACTGTAacaaagtcactaatggttgctttgagcaagcaaacagatggtaaatgtgacct
TES01_0005_D07.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAA*CCACCCAC*CCGATGGTGAAATGT
TES01_0051_F11.b : TACTGTACCNGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAC*CAGATGGTGAAATGT
TES01_0065_C12.b : taatgttggagaaaatccctatgtcgctggttttaccccacccatccaaatgggaaaatg
TES01_0082_F11.b : ttttgtacccaaaaatcccaatgccttgcttttaccccccccaccaaaaggggaaagtgt
TES01_0095_F07.b : tatgttacccaaatatcccaaggcctgcttttgacccccccaaccaaagggggaaatgga
TES01_0042_D02.b : TTCTGTACCAGAAATCCCAAT**GCTTGCTTTGAG*CCACCCAA*CAAAATGTGGAATGT
TES01_0011_A07.b : TACTGTAGCAAAGATCACTAAT*GCTTGCTTTGAGCCCAGCCAACCAGATGGTGAAATGT
OVRM1_0175_A11.b :
OVRM1_0190_F11.b :
OVRM1_0076_A09.b :
OVRM1_0110_B03.b :
THY01_0126_G03.b :
OVRM1_0140_G10.b :
LVRM1_0191_G11.b :
OVRM1_0072_E01.b :
OVRM1_0066_A06.b :
OVRM1_0150_G06.b :
OVRM1_0200_C07.b :
LVRM1_0014_G01.b :
OVRM1_0162_B11.b :
OVRM1_0171_F06.b :
OVRM1_0150_B09.b :
OVRM1_0211_H02.b :
LVRM1_0116_G08.b :
OVRM1_0165_B09.b :
OVRM1_0199_B07.b :
OVRM1_0085_G02.b :
OVRM1_0001_F04.b :
OVRM1_0034_H01.b :
OVRM1_0059_F03.b :
OVRM1_0217_G03.b :
OVRM1_0133_E11.b :
OVRM1_0207_C12.b :
OVRM1_0060_F06.b :
OVRM1_0042_H04.b :
OVRM1_0075_C08.b :
OVRM1_0115_E01.b :
LVRM1_0035_A11.b :
OVRM1_0209_H07.b :
OVRM1_0049_E08.b :
OVRM1_0089_B02.b :
OVRM1_0087_A05.b :
LVRM1_0034_C06.b :
OVRM1_0005_B03.b :
OVRM1_0001_D06.b :
OVRM1_0109_E02.b :
OVRM1_0112_H12.b :
OVRM1_0013_G05.b :
OVRM1_0065_D04.b :
OVRM1_0041_E08.b :
OVRM1_0118_A05.b :
OVRM1_0119_E03.b :
OVRM1_0116_D08.b :
OVRM1_0049_F09.b :
OVRM1_0085_F12.b :
OVRM1_0099_H11.b :
OVRM1_0035_G11.b :
OVRM1_0069_B02.b :
OVRM1_0064_A11.b :
LVRM1_0126_B10.b :
OVRM1_0090_A11.b :
OVRM1_0212_B09.b :
OVRM1_0070_E05.b :
OVRM1_0083_G07.b :
OVRM1_0184_B11.b :
OVRM1_0064_G12.b :
OVRM1_0030_E04.b :
OVRM1_0087_B11.b :
OVRM1_0185_E11.b :
OVRM1_0069_B12.b :
OVRM1_0011_H04.b :
OVR01_0096_C09.b : aactttaactgggtagcaaaaaaaccacataaggggctttggcttttggaaccccacccc
SMG01_0092_C04.b : aaaaaccaaagggttggttttgaccccccaaccaaagggaaaattgggcccccccccggg
OVR01_0015_B12.b :
SMG01_0063_H01.b : aatccaatgctgctttagacacccaccaaagggaaatgggaccccccccgggaaaaaaag
OVRT1_0125_H11.b : gatatcctaagcttgctttgaccccccaaccaatggggaaggtgcccctccccagggaaa
OVRT1_0132_C05.b : atcctatgcttgtttggccacccaccaaagggaatggtacctccctgggaaaaaatgccc
OVRT1_0090_B01.b : aaaatcataatgctgctttgacccaccaaccgatgggtaaagggacctcgccagggaaaa
OVRT1_0105_H12.b : aaatcctaatgcctgctttgaacccccaaccaatggtaaagtgaccctccccgggaaaaa
OVRT1_0096_B06.b : agatcataatgctgctttgagcagccaacaaaggtgaaagtgacttgccatgtaataatg
OVRT1_0150_H05.b : aaaatcacaaggcttgctttagccaccaaccagaggtgatgtggacccgcccgggaaaac
OVRT1_0144_E04.b : aatcccaaggcttgctgggcccccaaccaatggggaaaggaccccgcagggtaaacaagg
OVRT1_0108_F11.b : acaaaaatactatggctgcttgaccacccacagatgggaaagggacctccccggtaaaac
SMG01_0018_A04.b : tgaagcaaaatccctcaggttgctttgaccacccaccaaaagggaaagggaccccccccg
ITT01_0100_F02.b : actgtagcagagatcactatgcttgcttgagcccgccaccagatgtggaatgggaccctc
BFLT1_0125_D09.b : gtaacaaagatcctatgcttgctttgacccaccaacaaagggtgaagggaccccgcccgg
LVR01_0079_A11.b :
OVRT1_0009_A06.b : tatggaaccaaagatcataaaggttgctttggacccaccaaccaaaggggaaaagtgacc
OVRT1_0023_E01.b : tactatgctgcttgagcaagcacagatgtggatgtgacccgcatggaaatcatggcggct
CLNT1_0110_G04.b : tgtaccaaaatcactaatggttgcttgtacccagcaaccgaaggggaaatgggaccctgc
CLNT1_0107_D11.b : gaaaaaaatccttatgcctgctttaaccagcaaccaaaagggaaatggaccctcccaggg
OVRT1_0120_G10.b : taatggaccaaaaattccctaagcttgctttgaaccccccaaccagagggggaaaggtgg
OVRT1_0097_E07.b : atggaacaaaaatcactatggttggtttggagccagcaaccagatggggaaatgggaccc
PCT01_0036_D05.b : TACTGTAGC*GAGATCACTAtgctgctttgagcagccaccagatgtgaatgtgacctcgc
OVRT1_0098_B12.b : ggacaaaaatcactaatgcttgcttgagccaccaacagaggggaaagggacctcgcatgg
OVRT1_0113_G05.b : gtaacaaaatccctatggctgctttgaccagcaaccaaaggtgaatgtgacctcgcctgg
OVR01_0035_G03.b : aatggtagcaaaaaatccttattgcttggttttgagcccccccaaccaaaatggggaaaa
CLNT1_0072_C04.b : tgtacaggatcactatgcttgcttgagcacccaccaatgtgaaagtgaccctcccatggt
OVRT1_0086_F02.b : gtaccaaagattactatgctgctttgaaccagccaacagagggtgaatgtgacctcgcca
OVRT1_0095_D04.b : actgtaccagagatcctaatgcctgctttgagccagccaccaaatgtggaatgtgaccct
OVRT1_0084_D06.b : Tactgaacagagacactaatgctgcttggaggcagcancagatggggaatggaccctcgc
OVR01_0020_H10.b : Tgactggtaacaaagatcactaatgctttgctttgaaccagcccaaccagaatggtgaaa
ADR01_0055_D02.b : GTAGCGAGATCACTATGCTgcttgagccatcaacagatggtgaatgtgacctcccatgtt
OVRT1_0077_G06.b : TACTGTgcaaagatccctatgcttgctttgaaccaccaaccagaggggaaatgggaccct
OVR01_0070_D03.b : TTacggtaacaaaagatcactaatgcttggcttgaacccgcccaaccaaatggtggaatg
ITT01_0087_E12.b : TACTGTAACAAAAATCCCTAATGCTTGgctttgaccccccccaacaaaatggggaaatgt
THY01_0022_B02.b : TTattgtaacaaaaatcactaatggttggctttgagcccagccaaaccaaatgggggaaa
OVR01_0042_E12.b : ttattgtaacaaaaaattactaatggcttgcttttgaacccacccaacccaaaggggggg
OVRT1_0046_F01.b : TACGGTAGCAGAAATactaaggctggctttgacccccccaaccaaaggggaaagggaacc
OVRT1_0041_F07.b : TACTGTAGCAaaaacactaatgctgctttgagccagccacaaatggtgaatgggacctcc
OVRT1_0018_F04.b : TACTGTAGCAAA*ATCACTAatgctgctttgagcagccaaccgatggtgaatgtcacctc
ITT01_0078_C07.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCACCcaaatntggaatgtg
OVRT1_0052_C03.b : TACTGTAGCAAAAATCACTAtggctgctttgaggcagccnacgaatggtgattgtgacct
TES01_0065_G09.b : TACTGTGGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCAA**CCAGATGTGAAATGT
TES01_0017_C07.b : TACTGTAGCAAAGATCACTAATGCTTGCTTTGTAC*CCAGCCAACCAAATGGTGAAATGT
TES01_0028_E07.b : TACTGTAACAAAGATCACAAT**GCTTGCTTTTAA*CCACCCAACCCAAGGGGAAAAGGG
OVRT1_0023_H04.b : TACTGTAACAGAGATTCATAAT*GCTGGCTTTGAccagccaccaaatgggaaaggtgacc
THY01_0071_F03.b : TACTGTAGCCAAAATTACTAATGGTTGCTTTTaacccagcaa
UTR01_0068_E12.b : TACTGTAGCAAAAATCACTAATGGCTTGCTTTGaacccgcccaaccaaatggggaaaatg
OVRT1_0013_A03.b : TACTGGTACAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAACCAGATGGgaaatggg
OVRT1_0093_B03.b : TACTGGAGCAGAGATCACTAAT*GCCTGCTTTGAG*CCGCCCAACAGATGtggaatggga
ITT01_0070_A11.b : TACTGTAACAGAGATCACTAAT*GCTTGCTTTGAG*CCACCCAA*CCGAATGTGAAATGT
OVRT1_0093_H12.b : TACTGTAGCAAAGATCACTAATGCTTTGCTT*GAA*CCCACCAACCAAATGGTGAAAgga
OVRT1_0043_H01.b : TACTGTACCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCAAA*CAGATGGGGGAATGG
ITT01_0034_G07.b : TACTGTACCAGAGATCACTAAT*GCTTGCTTTGAG*CCACCCAC*CCGATGGGTGAATGT
ADR01_0052_D12.b : TACTGTAGCAAAGATCACTAATGCTTGCTTTTAAC*CCACCCACCCAAATGGTGAAATGT
ADR01_0096_H10.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CAACCAAACCAGAGGGTGAAATGT
OVR01_0091_B03.b : TATTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAACCGAATGGTGAAATGT
ADR01_0057_C08.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCAAA*CAGATGGTGAAATGT
ITT01_0047_H12.b : TACTGTAGCAGAGATCACTAAT*GCCTGGCTTGGG*CCAGCCAACCAGATGTNG*AATGT
TCH01_0020_H12.b : TACTGTAGCAGAAATCACTAATGCCTGGCTTTGAG*CCGCCAAACCAAATGGTGAAATGT
OVR01_0088_F01.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAA*GCCACCCAACAGATGGTGAAATGT
SPL01_0099_D05.b : AACTGTAACAGAGATCACAAAT*GCTTGGCTTGAA*GCAGCCAACCAGATG*TGAAATGT
OVRM1_0110_E03.b :
TES01_0034_D07.b : aaaaactcaaagggttgttttttggccccccccccaccaagggggaaaatgggccccccc
LVRM1_0049_B08.b :
TES01_0111_D12.b : ccttacggtaaccaaaaatcccccaattccctgctttttgagccccccccaacctcaaag
SKNB1_0021_B11.b : aaaaagctttactggtaacccaaaaaatccccaaaggccttggctttttgaaccccgccc
KDN01_0049_B07.b : gaacaaaaatcacttatgcttgctttggacccgcccaccctaaggtgaaatgttaccccc
TES01_0062_G10.b : cccaaatatcctatggttgttttgacccgccccccaaaaggggaaatggccccccccccg
TES01_0101_E02.b : aacaaaatccctagggcttgtttgaacccccaaccaaaggggaaaatgtaccccccccgg
TES01_0080_G09.b : agatcctatgctgcttgaaccagccaccaatgtgaaatggaccctcccgggaaaaatggc
TES01_0111_A03.b : ccaaaattcctaaggcttgctttgacccaccaaccaaaggggaaatggaccctcccatgg
TES01_0083_F01.b : cgggtaccaaaattcctaagggttgctttgacccgcccaaccaaagggtaaaatgtaccc
TES01_0092_A10.b : actgtaccagaaatcactatgcttgccttgaaccacccaacaaatggtgaaatgtgaccc
PCT01_0014_A08.b : actgtancaaaaatcctaatgctggcttgagccagcaaccaaatggggaatgggaccctc
SKNB1_0041_C09.b : *ACTGTAGCGAAgatcctaatgctgctttgagcagccnacaaattgtgaatgtgaccttc
TES01_0021_D01.b : TACTGGAACAGAGATCACCAA*GGCTTGCTTTGAcccaccaaacaaatggggaatgtgac
PCT01_0015_A03.b : TACTGTAACAGAGATCACTAtgcctgctttgacccaaccaccaaatgtgaaatgtaaccc
PCT01_0035_F03.b : ACTGTANCAGGATCACTATGCTTGCTtgacccancaacaaatgtgaaatgtaccctcgca
PST01_0004_D12.b : TACTTGTACAAAGATTCCTAAG*GCTTGCTTTGAA*CCAGCCAACCAaaggtgaaaagtg
PST01_0031_C02.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAACAAATGGTGAAtgtga
TES01_0057_A01.b : TACTGTAACAAAGATCACAAT**GCTTGCTTTGAA*CCACCCA**CCAAATGGTGAATGT
TES01_0036_A01.b : TACTGTAGCAAAGATTACTAATGCCTTGCTT*GAG*CCAGCCAAACCAGATGGGAAATGT
TES01_0017_A11.b : TACTGTATCAAAAATCACAATTGCTTGGCTTTAAG*CCACCCAACCCAATGGTGAAAGGT
TES01_0032_H09.b : TACTGTAGCAAAGATCACTAAT*GCTTGCTTTGAG*CCGCCCAA*CCGATGGTGAAATGT
KDN01_0038_A04.b : TACTGTAGCAGAGATCACTAAT*GCCTGCTTTGAG*CCAACCAA*CCAGATGGTGAATGT
SKNB1_0091_H09.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCNACCAGATGGTGAAATGT
TES01_0007_H03.b : TACTGTACCAGAGATCACTAAT*GCTTGCTTTGA**CCAGCCAACCAGAATGTGAAATGT
PST01_0028_D12.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAC*CAGATGGTGAAATGT
PST01_0026_D06.b : TACTGTAGCAGAGATCACTAAT*GCTTTGCTTGAG*CCAGCCNACCAGATGGTGAAATGT
TES01_0004_H05.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGC*AACCAGATGGGTGAATGT
TES01_0065_G08.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAC*CAGATGGTGAAATGT
PST01_0057_D09.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAANCAGATGGTGAAATGT
SKNB1_0019_F02.b : TACTGTACCAGAGATCACTAAG*GCTTGCTTTGAG*CCA*CCAACCAAATGGTGAAATGT
SMG01_0098_F09.b : tttggggcccccccccaaaaaaagagagagacccccccccccaaagaaaaaaaagcgccc
TES01_0081_H07.b : ctcataattttttaactgtaccaaaagcctcaactccttttgtattttagccacctcccc
LVRM1_0146_D06.b :
TES01_0079_C09.b : tggaccaaaatcctatgctgctttgacccagcaaccaatggggaatgggacctcgccatg
TES01_0015_F07.b : TACTGTAGCAGAGATCACTAAT*GCTTGCTTTGAG*CCAGCCAA*CAGATGGGTGAATGT
ADR01_0096_D11.b : TACTGTAGCAAAAATCACTAT**GCTTGCTTTGAA*CCAGC*AACCCGATGGTGAAATGT
THY01_0113_A05.b :