[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000436

Length: 1,583

Sequence [FASTA format sequence]
ATAAGAGATA GGGCGACGGG CGGAAACGGG TCTCATTGAA CCGTCGGGAG CGCTTCGGGT
TGCGGCTTTT TTTCTCTAGC TAAACCAGGC CTACGTTTCA GCAACCATGT CTAAGGGACC
TGCAGTTGGC ATTGATCTTG GCACCACCTA TTCTTGTGTG GGTGTCTTCC AGCACGGAAA
AGTGGAAATA ATTGCTAATG ATCAGGGGAA CCGAACCACC CCAAGCTATG TTGCCTTTAC
TGATACTGAA CGATTGATTG GTGATGCTGC GAAGAACCAA GTTGCGATGA ATCCCACCAA
CACGGTTTTT GATGCCAAAC GCCTCATTGG ACGAAGATTT GATGATGCTG TTGTCCAGTC
TGATATGAAG CATTGGCCCT TCGTGGTGGT GAATGATGCA GGCAGGCCTA AGGTCCAAGT
AGAATACAAG GGAGAGACAA AAAGTTTCTA TCCAGAGGAG GTGTCATCCA TGGTTTTGAC
AAAGATGAAG GAAATTGCAG AAGCCTACCT TGGGAAGACT GTTACCAATG CTGTTGTCAC
AGTACCAGCA TACTTTAACG ACTCTCAGCG TCAGGCTACC AAAGATGCTG GAACTATTGC
TGGTCTCAAT GTACTTAGAA TCATCAATGA GCCAACTGCT GCTGCTATTG CTTATGGCTT
AGACAAAAAG GTTGGAGCTG AAAGAAACGT GCTGATCTTC GACTTGGGTG GTGGCACTTT
TGATGTGTCA ATCCTCACTA TTGAGGATGG TATCTTCGAG GTCAAATCTA CAGCTGGAGA
TACCCACTTG GGTGGAGAGG ACTTTGACAA TAGAATGGTC AACCATTTTA TTGCAGAGTT
CAAGCGCAAG CACAAGAAGG ACATCAGCGA GAACAAGAGG GCTGTCCGTC GCCTCCGTAC
TGCTTGTGAG CGTGCTAAGC GCACTCTCTC TTCCAGCACT CAGGCCAGTA TTGAGATTGA
TTCCCTCTAT GAAGGAATCG ACTTCTATAC CTCTATTACT CGTGCCCGAT TTGAAGAATT
GAATGCTGAC CTGTTCCGTG GCACCCTGGA TCCTGTGGAG AAAGCCCTTC GGGATGCCAA
GCTAGACAAG TCTCAGATCC ATGACATTGT CCTGGTGGGT GGCTCAACCC GTATCCCCAA
GATCCAGAAG CTTCTGCAGG ACTTCTTCAA CGGGAAAGAA CTGAATAAGA GCATCAACCC
CGATGAGGCT GTTGCTTATG GTGCAGCTGT GCAGGCAGCC ATTTTATCTG GAGACAAATC
TGAAAATGTT CAAGATTTGC TGCTACTGGA TGTCACTCCT CTTTCCCTTG GCATTGAAAC
TGCTGGTGGA GTCATGACTG TCCTCATCAA GCGCAATACT ACCATTCCTA CTAAGCAGAC
GCAGACGTTC ACCACCTACT CTGACAACCA GCCTGGTGTG CTCATTCAGG TTTATGAAGG
TGAGCGTGCC ATGACCAAGG ATAACAACCT GCTTTGGCAG TTTGAACTCA CAGGCATACC
TCCGGCCCCA CGAAGCGTTC CTCAGAATGA AGTTACTTTT GATATTGATG CCAATGGCAT
CCCTCATGTC TCTGCTGTGG ATA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein isoform 1 [Homo sapiens]. 8710.0O
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein isoform 2 [Homo sapiens]. 8270.0O
Contig/Assembly ProteinHSPA2heat shock-related 70 kDa protein 2 [Homo sapiens]. 7960.0O
Contig/Assembly ProteinHSPA1Bheat shock 70 kDa protein 1A/1B [Homo sapiens]. 7950.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1A/1B [Homo sapiens]. 7950.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Homo sapiens]. 7790.0O
Contig/Assembly ProteinHSPA6heat shock 70 kDa protein 6 [Homo sapiens]. 7480.0O
Contig/Assembly ProteinHSPA578 kDa glucose-regulated protein precursor [Homo sapiens]. 604e-173O
Contig/Assembly ProteinHSPA9stress-70 protein, mitochondrial precursor [Homo sapiens]. 459e-129
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 isoform 1 [Homo sapiens]. 2712e-72O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHspa8heat shock cognate 71 kDa protein [Mus musculus]. 8710.0O
Contig/Assembly ProteinHspa2heat shock-related 70 kDa protein 2 [Mus musculus]. 7940.0O
Contig/Assembly ProteinHspa2heat shock-related 70 kDa protein 2 [Mus musculus]. 7940.0O
Contig/Assembly ProteinHspa1aheat shock 70 kDa protein 1A [Mus musculus]. 7930.0O
Contig/Assembly ProteinHspa1bheat shock 70 kDa protein 1B [Mus musculus]. 7930.0O
Contig/Assembly ProteinHspa1lheat shock 70 kDa protein 1-like [Mus musculus]. 7850.0O
Contig/Assembly ProteinHspa578 kDa glucose-regulated protein precursor [Mus musculus]. 601e-172O
Contig/Assembly ProteinHspa578 kDa glucose-regulated protein precursor [Mus musculus]. 601e-172O
Contig/Assembly ProteinHspa9stress-70 protein, mitochondrial [Mus musculus]. 456e-128
Contig/Assembly ProteinHspa14heat shock 70 kDa protein 14 isoform 1 [Mus musculus]. 2663e-71O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479406PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 1 [Canis familiaris]. 8710.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to heat shock protein 8 isoform 3 [Canis familiaris]. 8710.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to heat shock 70kDa protein 8 isoform 2 isoform 2 [Canis familiaris]. 8270.0O
Contig/Assembly ProteinLOC607182PREDICTED: similar to heat shock 70kDa protein 8 isoform 2 isoform 2 [Canis familiaris]. 8160.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 4 [Canis familiaris]. 7980.0O
Contig/Assembly ProteinLOC480355PREDICTED: similar to heat shock protein 2 isoform 1 [Canis familiaris]. 7940.0O
Contig/Assembly ProteinLOC607182PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 1 [Canis familiaris]. 7870.0O
Contig/Assembly ProteinHSP70heat shock 70 kDa protein 1 [Canis lupus familiaris]. 7860.0O
Contig/Assembly ProteinLOC474850PREDICTED: similar to heat shock 70kDa protein 1-like isoform 1 [Canis familiaris]. 7820.0O
Contig/Assembly ProteinLOC480355PREDICTED: similar to heat shock protein 2 isoform 2 [Canis familiaris]. 7510.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein [Bos taurus]. 8690.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1B [Bos taurus]. 7920.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1A [Bos taurus]. 7910.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Bos taurus]. 7850.0O
Contig/Assembly ProteinHSPA2heat shock-related 70 kDa protein 2 [Bos taurus]. 7690.0O
Contig/Assembly ProteinHSPA6PREDICTED: heat shock protein 70-like [Bos taurus]. 7440.0O
Contig/Assembly ProteinHSPA6PREDICTED: heat shock protein 70-like [Bos taurus]. 7440.0O
Contig/Assembly ProteinHSPA578 kDa glucose-regulated protein precursor [Bos taurus]. 602e-172O
Contig/Assembly ProteinHSPA9stress-70 protein, mitochondrial precursor [Bos taurus]. 459e-129
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 [Bos taurus]. 2702e-72O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock 70kDa protein 8 [Sus scrofa]. 8720.0O
Contig/Assembly ProteinLOC100621324PREDICTED: heat shock-related 70 kDa protein 2-like [Sus scrofa]. 7940.0O
Contig/Assembly ProteinHSP70.2heat shock 70 kDa protein 1B [Sus scrofa]. 7910.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Sus scrofa]. 7850.0O
Contig/Assembly ProteinHSP70heat shock 70 kDa protein [Sus scrofa]. 7560.0O
Contig/Assembly ProteinHSPA5PREDICTED: 78 kDa glucose-regulated protein [Sus scrofa]. 602e-172O
Contig/Assembly ProteinLOC100524210PREDICTED: heat shock cognate 71 kDa protein-like [Sus scrofa]. 503e-143O
Contig/Assembly ProteinHSPA9PREDICTED: stress-70 protein, mitochondrial [Sus scrofa]. 456e-128
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 [Sus scrofa]. 2733e-73O
Contig/Assembly ProteinLOC100152073PREDICTED: heat shock 70 kDa protein 13 [Sus scrofa]. 2632e-70O


Assembly Members: 405      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010018C11ADR01_0018_C11.bDB783086 
ADR010027E01ADR01_0027_E01.bDB783879 
ADR010028H07ADR01_0028_H07.bDB784004 
ADR010040C03ADR01_0040_C03.bDB785034 
ADR010045F03ADR01_0045_F03.bDB785514 
ADR010049E12ADR01_0049_E12.bDB785875 
ADR010058G02ADR01_0058_G02.bDB786690 
ADR010063H09ADR01_0063_H09.bDB787160 
ADR010079C04ADR01_0079_C04.bDB788512 
ADR010084G03ADR01_0084_G03.bDB788995 
AMP010002F08AMP01_0002_F08.bBW955103 
AMP010002H01AMP01_0002_H01.bBW955114 
AMP010005H01AMP01_0005_H01.bBW955346 
AMP010005H11AMP01_0005_H11.bBW955355 
AMP010007D04AMP01_0007_D04.bBW955469 
AMP010009B05AMP01_0009_B05.bBW955588 
AMP010009C09AMP01_0009_C09.bBW955602 
AMP010010C01AMP01_0010_C01.bBW955685 
AMP010010G09AMP01_0010_G09.bBW955732 
AMP010011H07AMP01_0011_H07.bBW955827 
AMP010012A08AMP01_0012_A08.bBW955838 
AMP010012B04AMP01_0012_B04.bBW955845 
AMP010012H02AMP01_0012_H02.bBW955900 
AMP010013F03AMP01_0013_F03.bBW955956 
AMP010014E04AMP01_0014_E04.bBW956023 
AMP010016E01AMP01_0016_E01.bBW956172 
AMP010016G06AMP01_0016_G06.bBW956199 
AMP010017C08AMP01_0017_C08.bBW956239 
AMP010017C12AMP01_0017_C12.bBW956243 
AMP010017D03AMP01_0017_D03.bBW956244 
AMP010017G08AMP01_0017_G08.bBW956281 
AMP010018A06AMP01_0018_A06.bBW956299 
AMP010019A08AMP01_0019_A08.bBW956389 
AMP010020G06AMP01_0020_G06.bBW956526 
AMP010022F02AMP01_0022_F02.bBW956666 
AMP010024E08AMP01_0024_E08.bBW956801 
AMP010025G01AMP01_0025_G01.bBW956891 
AMP010025G02AMP01_0025_G02.bBW956892 
AMP010025H03AMP01_0025_H03.bBW956904 
AMP010026F04AMP01_0026_F04.bBW956963 
AMP010028G07AMP01_0028_G07.bBW957142 
AMP010028H06AMP01_0028_H06.bBW957153 
AMP010032A06AMP01_0032_A06.bBW957247 
AMP010033B10AMP01_0033_B10.bBW957337 
AMP010033C09AMP01_0033_C09.bBW957348 
AMP010033H04AMP01_0033_H04.bBW957397 
AMP010034A05AMP01_0034_A05.bBW957408 
AMP010034A08AMP01_0034_A08.bBW957411 
AMP010039G04AMP01_0039_G04.b  
AMP010041D06AMP01_0041_D06.bBW957918 
AMP010044D05AMP01_0044_D05.bBW958101 
AMP010046F10AMP01_0046_F10.bBW958269 
AMP010048A06AMP01_0048_A06.bBW958364 
AMP010048F09AMP01_0048_F09.bBW958411 
AMP010049C11AMP01_0049_C11.bBW958452 
AMP010050G07AMP01_0050_G07.bBW958569 
AMP010052A11AMP01_0052_A11.bBW958661 
AMP010052B09AMP01_0052_B09.bBW958670 
AMP010052C07AMP01_0052_C07.bBW958680 
AMP010053C01AMP01_0053_C01.bBW958752 
AMP010053C10AMP01_0053_C10.bBW958761 
AMP010055E06AMP01_0055_E06.b  
AMP010060G08AMP01_0060_G08.bBW959381 
AMP010062E05AMP01_0062_E05.bBW959498 
AMP010067E06AMP01_0067_E06.bBW959850 
AMP010068E11AMP01_0068_E11.bBW959939 
AMP010069G12AMP01_0069_G12.bBW960047 
AMP010070B08AMP01_0070_B08.bBW960073 
AMP010070E03AMP01_0070_E03.bBW960101 
AMP010075F04AMP01_0075_F04.bBW960407 
AMP010077F10AMP01_0077_F10.bBW960571 
AMP010085G08AMP01_0085_G08.bBW961208 
AMP010086C11AMP01_0086_C11.bBW961255 
AMP010088E11AMP01_0088_E11.bBW961444 
AMP010093C04AMP01_0093_C04.bBW961842 
AMP010093C05AMP01_0093_C05.bBW961843 
AMP010093E08AMP01_0093_E08.bBW961864 
AMP010093G05AMP01_0093_G05.bBW961885 
AMP010097B09AMP01_0097_B09.bBW962192 
AMP010098A05AMP01_0098_A05.bBW962265 
AMP010098H08AMP01_0098_H08.bBW962347 
AMP010099A03AMP01_0099_A03.bBW962353 
AMP010099B02AMP01_0099_B02.bBW962362 
BFLT10002C12BFLT1_0002_C12.bFS640115 
BFLT10003F02BFLT1_0003_F02.bFS640214 
BFLT10026G12BFLT1_0026_G12.bFS642148 
BFLT10033D02BFLT1_0033_D02.bFS642698 
BFLT10046B08BFLT1_0046_B08.bFS643579 
BFLT10056B02BFLT1_0056_B02.bFS644408 
BFLT10066E10BFLT1_0066_E10.bFS645262 
BFLT10070D08BFLT1_0070_D08.bFS645561 
BFLT10074C06BFLT1_0074_C06.bFS645859 
BFLT10074F02BFLT1_0074_F02.bFS645881 
BFLT10088D05BFLT1_0088_D05.bFS646974 
BFLT10092G06BFLT1_0092_G06.bFS647328 
BFLT10100F09BFLT1_0100_F09.bFS648002 
BFLT10115A08BFLT1_0115_A08.bHX202950 
BFLT10117C08BFLT1_0117_C08.bHX203132 
BFLT10119B09BFLT1_0119_B09.bHX203295 
BFLT10120F08BFLT1_0120_F08.bHX203418 
BFLT10128F02BFLT1_0128_F02.bHX204052 
BFLT10137E12BFLT1_0137_E12.bHX204676 
BKFL10012F02BKFL1_0012_F02.bFS648777 
BMWN10005A09BMWN1_0005_A09.bHX205880 
BMWN10010D08BMWN1_0010_D08.bHX206217 
BMWN10013F07BMWN1_0013_F07.b  
BMWN10017B06BMWN1_0017_B06.bHX206575 
BMWN10021G09BMWN1_0021_G09.b  
BMWN10026H01BMWN1_0026_H01.bHX207179 
BMWN10028B07BMWN1_0028_B07.b  
BMWN10029A07BMWN1_0029_A07.bHX207329 
BMWN10029D12BMWN1_0029_D12.b  
BMWN10029H08BMWN1_0029_H08.bHX207388 
BMWN10035F06BMWN1_0035_F06.bHX207758 
BMWN10036C06BMWN1_0036_C06.bHX207797 
BMWN10040F04BMWN1_0040_F04.bHX208020 
BMWN10043D05BMWN1_0043_D05.b  
BMWN10044B11BMWN1_0044_B11.bHX208162 
BMWN10069B08BMWN1_0069_B08.bHX209773 
BMWN10079C07BMWN1_0079_C07.bHX210417 
BMWN10081A10BMWN1_0081_A10.b  
BMWN10081B10BMWN1_0081_B10.bHX210536 
BMWN10095H12BMWN1_0095_H12.bHX211476 
CBLT10002B08CBLT1_0002_B08.bHX211850 
CBLT10006A09CBLT1_0006_A09.bHX212158 
CBLT10008C05CBLT1_0008_C05.bHX212337 
CBLT10011C01CBLT1_0011_C01.bHX212563 
CBLT10052E12CBLT1_0052_E12.bHX215310 
CBLT10061G11CBLT1_0061_G11.bHX216015 
CBLT10092D08CBLT1_0092_D08.bHX218475 
CLNT10141G06CLNT1_0141_G06.bHX222332 
CLNT10144F11CLNT1_0144_F11.bHX222559 
CLNT10145D06CLNT1_0145_D06.bHX222614 
DCI010002G03DCI01_0002_G03.bDB790730 
DCI010005A03DCI01_0005_A03.bDB790890 
DCI010009G06DCI01_0009_G06.bDB791147 
DCI010010D01DCI01_0010_D01.bDB791191 
DCI010012H07DCI01_0012_H07.bDB791413 
DCI010013B08DCI01_0013_B08.bDB791436 
DCI010021A09DCI01_0021_A09.bDB792135 
DCI010022D04DCI01_0022_D04.bDB792255 
DCI010027D04DCI01_0027_D04.bDB792705 
DCI010027G07DCI01_0027_G07.bDB792742 
DCI010029D02DCI01_0029_D02.bDB792865 
DCI010030D02DCI01_0030_D02.bDB792953 
DCI010032G09DCI01_0032_G09.bDB793175 
DCI010033D05DCI01_0033_D05.bDB793227 
DCI010033H03DCI01_0033_H03.bDB793272 
DCI010037C02DCI01_0037_C02.bDB793579 
DCI010038B10DCI01_0038_B10.bDB793662 
DCI010041G08DCI01_0041_G08.bDB793874 
DCI010058C12DCI01_0058_C12.bDB794718 
DCI010066G01DCI01_0066_G01.bDB795476 
DCI010066H05DCI01_0066_H05.bDB795490 
DCI010067B02DCI01_0067_B02.bDB795511 
DCI010072H01DCI01_0072_H01.bDB796007 
DCI010073A07DCI01_0073_A07.bDB796024 
DCI010074F08DCI01_0074_F08.bDB796169 
DCI010075E02DCI01_0075_E02.bDB796239 
DCI010078G12DCI01_0078_G12.bDB796531 AK391436
DCI010080G03DCI01_0080_G03.bDB796695 
DCI010082D11DCI01_0082_D11.bDB796847 
DCI010094C07DCI01_0094_C07.bDB797902 
DCI010095F06DCI01_0095_F06.bDB798021 
DCI010096A08DCI01_0096_A08.bDB798056 
DCI010098G09DCI01_0098_G09.bDB798298 
DCI010100H10DCI01_0100_H10.bDB798495 
DCI010106D03DCI01_0106_D03.bDB798970 
DCI010112B07DCI01_0112_B07.bDB799466 
DCI010114B12DCI01_0114_B12.bDB799649 
DCI010114E12DCI01_0114_E12.bDB799685 
HTMT10004G01HTMT1_0004_G01.bFS664590 
HTMT10021C11HTMT1_0021_C11.bFS665739 AK391768
HTMT10030F06HTMT1_0030_F06.bFS666437 
HTMT10034E07HTMT1_0034_E07.bFS666678 AK391930
HTMT10046A04HTMT1_0046_A04.bFS667394 
HTMT10046C06HTMT1_0046_C06.bFS667412 AK392041
HTMT10053G01HTMT1_0053_G01.bFS667987 
HTMT10059F03HTMT1_0059_F03.bFS668418 
HTMT10062E03HTMT1_0062_E03.bFS668627 
HTMT10070C12HTMT1_0070_C12.bFS669199 
HTMT10070D12HTMT1_0070_D12.bFS669208 AK392393
HTMT10070E07HTMT1_0070_E07.b  
HTMT10084H05HTMT1_0084_H05.b  
HTMT10086D05HTMT1_0086_D05.bFS670256 
HTMT10103E02HTMT1_0103_E02.bHX223415 
HTMT10117F01HTMT1_0117_F01.b  
HTMT10119A08HTMT1_0119_A08.bHX224477 
HTMT10119C01HTMT1_0119_C01.bHX224487 
HTMT10121G09HTMT1_0121_G09.bHX224652 
HTMT10125B12HTMT1_0125_B12.b  
HTMT10127E05HTMT1_0127_E05.bHX224985 
HTMT10141B05HTMT1_0141_B05.bHX225896 
HTMT10147D07HTMT1_0147_D07.bHX226365 
ILNT10001D11ILNT1_0001_D11.bHX226776 
ILNT10004E12ILNT1_0004_E12.bHX227039 
ILNT10011D03ILNT1_0011_D03.bHX227563 
ILNT10012C10ILNT1_0012_C10.bHX227635 
ILNT10015C04ILNT1_0015_C04.bHX227861 
ILNT10016C07ILNT1_0016_C07.bHX227925 
ILNT10025F08ILNT1_0025_F08.bHX228662 
ILNT10054C09ILNT1_0054_C09.bHX230991 
ILNT10060G12ILNT1_0060_G12.bHX231532 
ILNT10071B01ILNT1_0071_B01.bHX232385 
ILNT10071B03ILNT1_0071_B03.bHX232387 
ILNT10088E12ILNT1_0088_E12.bHX233804 
ITT010001D04ITT01_0001_D04.bBW976073 
ITT010006D01ITT01_0006_D01.bBW976527 
ITT010012A02ITT01_0012_A02.bBW977048 
ITT010026B03ITT01_0026_B03.bBW978322 
ITT010037C12ITT01_0037_C12.bBW979326 
ITT010038E04ITT01_0038_E04.bBW979433 
ITT010076A08ITT01_0076_A08.bBW982728 
ITT010094G10ITT01_0094_G10.bBW984384 
ITT010098H05ITT01_0098_H05.bBW984757 
ITT010102D07ITT01_0102_D07.bBW985079 
ITT010103G03ITT01_0103_G03.bBW985199 
KDN010001E05KDN01_0001_E05.b  
KDN010012B11KDN01_0012_B11.bFS672078 
KDN010013E12KDN01_0013_E12.bFS672186 
KDN010014E12KDN01_0014_E12.bFS672265 
KDN010015A08KDN01_0015_A08.bFS672302 
KDN010023A05KDN01_0023_A05.bFS672892 
KDN010030B12KDN01_0030_B12.bFS673459 
KDN010049F04KDN01_0049_F04.bFS674473 
KDN010052D06KDN01_0052_D06.b  
KDN010053A05KDN01_0053_A05.bFS674626 
KDN010055B04KDN01_0055_B04.b  
KDN010059B10KDN01_0059_B10.bFS675112 
KDN010064D04KDN01_0064_D04.bFS675536 
KDN010064G01KDN01_0064_G01.bFS675564 
KDN010065D02KDN01_0065_D02.bFS675613 
KDN010068G05KDN01_0068_G05.bFS675871 
KDN010085E03KDN01_0085_E03.bFS677191 
LNG010005G07LNG01_0005_G07.bBP439454 
LNG010006G02LNG01_0006_G02.bBP439040 
LNG010012B09LNG01_0012_B09.bBP434638 
LNG010013D09LNG01_0013_D09.bBP436597 
LNG010018E03LNG01_0018_E03.bBP437105 
LNG010031H03LNG01_0031_H03.bBP440143 
LNG010035A12LNG01_0035_A12.bBP433924 
LNG010035H06LNG01_0035_H06.bBP440397 
LNG010066D11LNG01_0066_D11.bBP436794 
LNG010069G11LNG01_0069_G11.bBP439828 
LNG010080D03LNG01_0080_D03.bBP436164 
LNG010086B11LNG01_0086_B11.bBP434858 
LNG010091E09LNG01_0091_E09.bBP437660 
LNG010104C11LNG01_0104_C11.bBP435856 
LNG010108F03LNG01_0108_F03.bBP438198 
LVR010026E03LVR01_0026_E03.bBP444738 
LVR010055D02LVR01_0055_D02.bBP443797 
LVR010079E07LVR01_0079_E07.bBP445046 
LVR010082E10LVR01_0082_E10.bBP445258 
LVRM10169A12LVRM1_0169_A12.bBW963125 AK233535
MLN010006G11MLN01_0006_G11.bCJ008180 
MLN010017E06MLN01_0017_E06.bCJ008946 
MLN010022D07MLN01_0022_D07.b  
MLN010041H04MLN01_0041_H04.bCJ010913 
MLN010061H09MLN01_0061_H09.bCJ012470 
MLN010092G11MLN01_0092_G11.bCJ015056 
MLN010094H09MLN01_0094_H09.bCJ015246 
MLTL10008H10MLTL1_0008_H10.bFS679145 
MLTL10031D09MLTL1_0031_D09.bFS681107 
MLTL10045C08MLTL1_0045_C08.bFS682318 
MLTL10049C05MLTL1_0049_C05.bFS682667 
MLTL10053G02MLTL1_0053_G02.bFS683059 
MLTL10077A02MLTL1_0077_A02.bFS684246 
MLTL10082A07MLTL1_0082_A07.bFS684689 
MLTL10084H06MLTL1_0084_H06.bFS684948 
MLTL10089H10MLTL1_0089_H10.bFS685407 
OVR010020E07OVR01_0020_E07.bBP143274 
OVR010035D11OVR01_0035_D11.bBP142979 
OVR010039B12OVR01_0039_B12.bBP142112 
OVR010042E03OVR01_0042_E03.bBP143141 
OVR010044H06OVR01_0044_H06.bBP144613 
OVR010049D04OVR01_0049_D04.bBW963969 
OVR010050D08OVR01_0050_D08.bBW964063 
OVR010052D09OVR01_0052_D09.bBW964250 
OVR010060D01OVR01_0060_D01.bBW964961 
OVR010072G07OVR01_0072_G07.bBW966070 
OVR010073E08OVR01_0073_E08.bBW966122 
OVR010074F08OVR01_0074_F08.bBW966224 
OVR010076B10OVR01_0076_B10.bBW966359 
OVR010078A12OVR01_0078_A12.b  
OVRM10010G09OVRM1_0010_G09.bBP153215 
OVRM10027F06OVRM1_0027_F06.bBP151674 
OVRM10036D11OVRM1_0036_D11.bBP149729 
OVRM10049D11OVRM1_0049_D11.bBP149732 
OVRM10051B03OVRM1_0051_B03.bBP146366 
OVRM10058A03OVRM1_0058_A03.bBP145072 
OVRM10059A11OVRM1_0059_A11.bBP145949 
OVRM10066F11OVRM1_0066_F11.bBP152218 
OVRM10071D05OVRM1_0071_D05.bBP149110 
OVRM10079H09OVRM1_0079_H09.bBP154609 
OVRM10084A09OVRM1_0084_A09.bBP145746 
OVRM10085G07OVRM1_0085_G07.bBP153046 
OVRM10090F03OVRM1_0090_F03.bBP151401 
OVRM10111H12OVRM1_0111_H12.bBP154970 
OVRM10113B01OVRM1_0113_B01.bBP146213 
OVRM10113E05OVRM1_0113_E05.bBP150386 
OVRM10117B08OVRM1_0117_B08.bBP146954 
OVRM10122H06OVRM1_0122_H06.bBP154310 
OVRM10133C10OVRM1_0133_C10.bBP148422 
OVRM10164D02OVRM1_0164_D02.bBP457594 
OVRM10171E10OVRM1_0171_E10.bBP459192 
OVRM10175D12OVRM1_0175_D12.bBP458406 
OVRM10202B09OVRM1_0202_B09.bBP456271 
OVRM10217F08OVRM1_0217_F08.bBP460058 
OVRM10223D07OVRM1_0223_D07.bBP458038 
OVRM10225F03OVRM1_0225_F03.bBP459642 
OVRT10004G11OVRT1_0004_G11.bFS686739 
OVRT10025G02OVRT1_0025_G02.bFS688475 
OVRT10029G08OVRT1_0029_G08.b  
OVRT10049G01OVRT1_0049_G01.bFS690431 
OVRT10072F11OVRT1_0072_F11.bFS692294 
OVRT10073B06OVRT1_0073_B06.bFS692329 
OVRT10077A07OVRT1_0077_A07.bFS692646 
OVRT10081B04OVRT1_0081_B04.bFS692982 
OVRT10090F09OVRT1_0090_F09.bFS693759 
OVRT10091E06OVRT1_0091_E06.bFS693828 
OVRT10098H11OVRT1_0098_H11.bFS694449 
OVRT10100B05OVRT1_0100_B05.bFS694551 
OVRT10109B07OVRT1_0109_B07.bHX235499 
OVRT10128F06OVRT1_0128_F06.bHX237077 
OVRT10136F08OVRT1_0136_F08.bHX237725 
OVRT10141B02OVRT1_0141_B02.bHX238079 
OVRT10142H12OVRT1_0142_H12.bHX238234 
PBL010025H11PBL01_0025_H11.bBP156637 
PBL010028C12PBL01_0028_C12.bBW970013 
PBL010052C08PBL01_0052_C08.bBW971137 
PBL010057E10PBL01_0057_E10.bBW971468 
PBL010061G02PBL01_0061_G02.bBW971712 
PBL010074G10PBL01_0074_G10.bBW972777 
PBL010087H08PBL01_0087_H08.bBW973942 
PBL010090E04PBL01_0090_E04.bBW974172 
PBL010090H12PBL01_0090_H12.bBW974208 
PBL010093E02PBL01_0093_E02.bBW974385 
PBL010100D09PBL01_0100_D09.bBW974966 
PBL010105C09PBL01_0105_C09.bBW975411 
PBL010105H03PBL01_0105_H03.bBW975464 
PBL010106B09PBL01_0106_B09.bBW975493 
PCT010007H04PCT01_0007_H04.bFS695121 
PST010021B05PST01_0021_B05.b  
PST010028C05PST01_0028_C05.bFS699180 
PST010049E06PST01_0049_E06.bFS700705 
PST010055C12PST01_0055_C12.bFS701181 
PST010058B04PST01_0058_B04.bFS701396 
PST010069C03PST01_0069_C03.bFS702273 
PST010077B03PST01_0077_B03.bFS702888 
PST010082A08PST01_0082_A08.bFS703291 
PST010091A07PST01_0091_A07.bFS704011 
PST010095F12PST01_0095_F12.bFS704370 
PST010099B02PST01_0099_B02.bFS704597 
PTG010031B12PTG01_0031_B12.bFS707116 
PTG010045H12PTG01_0045_H12.bFS708434 
PTG010049F01PTG01_0049_F01.bFS708753 
PTG010050B05PTG01_0050_B05.bFS708801 
PTG010058H02PTG01_0058_H02.bFS709539 
PTG010063G05PTG01_0063_G05.b  
PTG010069G02PTG01_0069_G02.bFS710349 
PTG010070F06PTG01_0070_F06.bFS710418 
PTG010073B07PTG01_0073_B07.bFS710613 
PTG010074A03PTG01_0074_A03.b  
PTG010078G06PTG01_0078_G06.bFS711052 
PTG010092E06PTG01_0092_E06.b  
PTG010096D04PTG01_0096_D04.bFS712249 
PTG010101H11PTG01_0101_H11.b  
PTG010106B09PTG01_0106_B09.b  
SKNB10015H05SKNB1_0015_H05.bDB800836 
SKNB10034G06SKNB1_0034_G06.bDB801855 
SKNB10074A02SKNB1_0074_A02.bDB804495 
SMG010016G03SMG01_0016_G03.bFS714673 
SMG010023E02SMG01_0023_E02.bFS715279 
SMG010035A07SMG01_0035_A07.bFS716312 
SMG010036F05SMG01_0036_F05.bFS716452 
SMG010051A01SMG01_0051_A01.bFS717678 
SMG010052E04SMG01_0052_E04.bFS717803 
SMG010062F07SMG01_0062_F07.bFS718645 
SMG010063B10SMG01_0063_B10.bFS718687 
SPL010024F01SPL01_0024_F01.bBP158381 
SPL010039H07SPL01_0039_H07.bBP159232 
SPLT10001D05SPLT1_0001_D05.bHX239305 
SPLT10001E08SPLT1_0001_E08.bHX239315 
SPLT10003E05SPLT1_0003_E05.bHX239459 
SPLT10017G01SPLT1_0017_G01.bHX240531 
SPLT10064E07SPLT1_0064_E07.bHX244170 
SPLT10081C04SPLT1_0081_C04.bHX245502 
SPLT10097C12SPLT1_0097_C12.bHX246762 
TCH010056B04TCH01_0056_B04.bCJ026381 
TCH010058F12TCH01_0058_F12.bCJ026583 
TCH010060C01TCH01_0060_C01.bCJ026693 
TCH010065C04TCH01_0065_C04.bCJ027075 
TCH010094A01TCH01_0094_A01.bCJ029268 
THY010007E06THY01_0007_E06.bBP164859 
THY010008H10THY01_0008_H10.bBP169068 
THY010032F12THY01_0032_F12.bBP166743 
THY010065H08THY01_0065_H08.bBP168904 
THY010088G11THY01_0088_G11.bBP167950 
THY010099D01THY01_0099_D01.bBP163158 
THY010102B09THY01_0102_B09.bBP161486 
THY010111G02THY01_0111_G02.bBP167015 
THY010203H03THY01_0203_H03.bBP168414 
UTR010012G03UTR01_0012_G03.bBP172657 
UTR010084C01UTR01_0084_C01.bCJ037731 
UTR010095F11UTR01_0095_F11.bCJ038789 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
166C325140.936OSGTC/V
T12110.064GTT/V
730A23660.945OSTCA/S
C1310.055TCC/S


Alignment:      TOP

20110601C-000436 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0078_G12.b : ncccaaaannaaaaacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_E08.b :
BFLT1_0056_B02.b :
ADR01_0049_E12.b :
ILNT1_0071_B01.b :
BMWN1_0036_C06.b :
BMWN1_0079_C07.b :
UTR01_0012_G03.b :
HTMT1_0084_H05.b :
HTMT1_0127_E05.b :
ILNT1_0071_B03.b :
CBLT1_0061_G11.b :
BMWN1_0021_G09.b :
BMWN1_0043_D05.b :
ILNT1_0025_F08.b :
ADR01_0040_C03.b :
HTMT1_0070_C12.b :
CBLT1_0092_D08.b :
ITT01_0103_G03.b :
CBLT1_0011_C01.b :
HTMT1_0086_D05.b :
HTMT1_0119_C01.b :
BMWN1_0013_F07.b :
HTMT1_0070_E07.b :
CLNT1_0145_D06.b :
LVR01_0082_E10.b :
HTMT1_0070_D12.b :
ITT01_0102_D07.b :
LVR01_0079_E07.b :
HTMT1_0021_C11.b :
HTMT1_0030_F06.b :
THY01_0065_H08.b :
ILNT1_0016_C07.b :
CBLT1_0052_E12.b :
OVR01_0020_E07.b :
PTG01_0096_D04.b :
HTMT1_0141_B05.b :
OVRM1_0133_C10.b :
PTG01_0063_G05.b :
SPL01_0039_H07.b :
SMG01_0036_F05.b :
BFLT1_0088_D05.b :
PBL01_0105_C09.b :
HTMT1_0004_G01.b :
LNG01_0006_G02.b :
HTMT1_0046_C06.b :
BMWN1_0010_D08.b :
THY01_0203_H03.b :
OVRT1_0049_G01.b :
HTMT1_0125_B12.b :
ADR01_0027_E01.b :
SPL01_0024_F01.b :
ILNT1_0088_E12.b :
CLNT1_0144_F11.b :
BFLT1_0115_A08.b :
HTMT1_0147_D07.b :
BFLT1_0074_C06.b :
AMP01_0011_H07.b : nnnaaacgtatctaaxxxxxx
BFLT1_0066_E10.b :
ITT01_0037_C12.b :
ITT01_0001_D04.b :
ADR01_0079_C04.b :
SPLT1_0097_C12.b :
BMWN1_0029_D12.b :
DCI01_0027_G07.b : nnnaacgatactaaxxxxxxxxx
BMWN1_0040_F04.b :
ILNT1_0060_G12.b :
ILNT1_0012_C10.b :
BMWN1_0026_H01.b :
AMP01_0014_E04.b : nnnttactatctaaxxxxxxxxx
AMP01_0009_B05.b : nnnttgtaatcttxxxxxxxxxx
AMP01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0012_B04.b : nttaaaacttaannnnnnnnctccnnnnnaaggatacntatagggctxxx
BMWN1_0029_H08.b :
AMP01_0007_D04.b : aatataccgtatcttxxxxxxxxxx
DCI01_0013_B08.b : nnnaacatacxxxxxxxxxxxx
AMP01_0070_E03.b : acatcatagggatacttxxxxxxxxx
BMWN1_0029_A07.b :
AMP01_0012_A08.b : ntttaaccttagggctaattttcnaggattccataxxxxxxxxx
HTMT1_0121_G09.b :
AMP01_0020_G06.b : nttttacgatatccttxxxxxxxxxx
AMP01_0060_G08.b : aaacccnnttaagaatcttxxxxxxxxx
AMP01_0012_H02.b : aaataccgatatcttxxxxxxxxxxx
AMP01_0098_A05.b : ggcgaataactccgxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : nnnggaaaanttaagagatactaaxxxxxxxxxx
BMWN1_0081_B10.b :
AMP01_0018_A06.b : nntttacgaatctaaxxxxxxxx
AMP01_0050_G07.b : nnnggttaaatatagggatacttaxxxxxxx
AMP01_0053_C10.b : nnnnccagataannttagggaccttggggctg
SMG01_0016_G03.b :
AMP01_0062_E05.b : nnnnccaatanaataagggacacattxxxxxxxxx
AMP01_0069_G12.b : gagaaactcatagcgatacttaxxxxxxxxx
AMP01_0099_A03.b : gcggtaxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : nnnggagataaantaagggatatcttxxxxxxxxx
MLTL1_0077_A02.b : nnnggactattnnnnnnacgaaaccatxxxxxxxxxx
AMP01_0048_F09.b : ggagaccttatgggatatcttxxxxxxx
AMP01_0022_F02.b : ttatagctgcttatxxxxxxxxxx
SPLT1_0001_D05.b :
OVR01_0052_D09.b :
CLNT1_0141_G06.b :
AMP01_0025_G02.b : nnaatggaatcttxxxxxxxxxx
HTMT1_0119_A08.b :
AMP01_0013_F03.b : nnaatacaattatxxxxxxxx
AMP01_0093_E08.b : cggtxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : naacgaatctatxxxxxxxxxx
DCI01_0075_E02.b : nttatcgtaactatagggct
MLTL1_0053_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0086_C11.b : ctatctgggggtaatnnnanggtattatngggctg
DCI01_0010_D01.b : ctttggggtatcttxxxxxxxxx
OVRT1_0098_H11.b :
SPLT1_0003_E05.b :
BFLT1_0046_B08.b :
DCI01_0066_H05.b : nnnnaaacgtaactaaxxxxxxxxx
AMP01_0025_H03.b : nnttaaggaatcttxxxxxxxxxx
BMWN1_0044_B11.b :
DCI01_0002_G03.b : taaccttatagggatacttaxxxxxxxxx
SPLT1_0064_E07.b :
AMP01_0033_B10.b : nnnccgataaanttataggatacttgggctg
AMP01_0026_F04.b : ttaaaggaatcttxxxxxxxxx
HTMT1_0059_F03.b :
AMP01_0098_H08.b : gggataactccgxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b :
OVRT1_0072_F11.b :
CBLT1_0006_A09.b :
AMP01_0052_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0046_A04.b :
AMP01_0024_E08.b : nngggtttttttatanggacaattxxxxxxxxxxx
HTMT1_0062_E03.b :
AMP01_0033_H04.b : nnggcgatatantttgagatacattxxxxxxxx
DCI01_0112_B07.b : nnncccaatttatnnnnggatactatagggctgc
ITT01_0012_A02.b :
SPLT1_0081_C04.b :
SPLT1_0001_E08.b :
AMP01_0010_G09.b : nnaaacgtaatctaagggctxxx
DCI01_0074_F08.b : nnnnncgatactatagggctxxx
DCI01_0073_A07.b : nnaatactaactaaxxxxxxxxx
CBLT1_0002_B08.b :
AMP01_0017_G08.b : nnnttacttaattatxxxxxxxxxx
OVRM1_0066_F11.b :
THY01_0102_B09.b :
OVRM1_0027_F06.b :
OVRM1_0036_D11.b :
OVRM1_0225_F03.b :
DCI01_0058_C12.b : atgatacactcxxxxxxxxxxxxxx
OVR01_0076_B10.b :
OVRM1_0090_F03.b :
OVRM1_0171_E10.b :
OVRM1_0111_H12.b :
OVRM1_0217_F08.b :
OVRM1_0117_B08.b :
OVRM1_0059_A11.b :
OVRM1_0084_A09.b :
PTG01_0045_H12.b :
OVRM1_0049_D11.b :
OVRM1_0122_H06.b :
SMG01_0051_A01.b :
ILNT1_0011_D03.b :
DCI01_0032_G09.b : nnaaactaactaaxxxxx
DCI01_0037_C02.b : nnnaagatactaaxxxxxxx
BFLT1_0117_C08.b :
SMG01_0052_E04.b :
PTG01_0031_B12.b :
AMP01_0005_H11.b : nnaataagtatcaxxxxxxx
LNG01_0086_B11.b :
DCI01_0038_B10.b : nggtatctaaxxxxxx
DCI01_0012_H07.b : nnnaaactatcttxxxxxxxx
LNG01_0012_B09.b :
DCI01_0027_D04.b : nnnaaagatacaaxxxxxx
AMP01_0028_H06.b : tttaaccgtatctaxxxxxx
MLTL1_0089_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0093_C05.b : gcgctxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : gaaaccttataggatatcttxxxxxx
AMP01_0019_A08.b : ntttacatatttaaxxxxxxx
DCI01_0106_D03.b : aaaaaacgatactaaxxxxxx
DCI01_0041_G08.b : nnnnggatactaaxxxxxxx
AMP01_0034_A05.b : nnnggcgatatattantaagatacttxxxxx
MLTL1_0031_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0067_B02.b : nnnnnccgaaccatxxxxxxxx
DCI01_0009_G06.b : actctatgggatacttxxxxxxx
PTG01_0069_G02.b :
SMG01_0062_F07.b :
AMP01_0093_G05.b : gcggtaacttngxxxxxxxxxxxxx
AMP01_0016_E01.b : nntttggaatctaaxxxx
AMP01_0028_G07.b : nnnnttcgactcttxxxxxx
SMG01_0063_B10.b :
OVR01_0035_D11.b :
SMG01_0023_E02.b :
BFLT1_0128_F02.b :
LNG01_0031_H03.b :
OVR01_0060_D01.b :
OVRT1_0004_G11.b :
MLN01_0006_G11.b :
THY01_0032_F12.b :
DCI01_0066_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0136_F08.b :
AMP01_0032_A06.b : nnnccgatatnntntatagatacttxxxxx
OVR01_0044_H06.b :
THY01_0008_H10.b :
AMP01_0017_D03.b : nnggtatannnnntttggaatctaaxxxxx
BFLT1_0033_D02.b :
MLN01_0022_D07.b :
ITT01_0026_B03.b :
PBL01_0052_C08.b :
ITT01_0076_A08.b :
LNG01_0091_E09.b :
ITT01_0094_G10.b :
DCI01_0005_A03.b : nnnccgaaccatxxxxx
PBL01_0057_E10.b :
LNG01_0018_E03.b :
DCI01_0114_B12.b : nnnnggtaaaataanaccgatactaaxxxxxx
AMP01_0085_G08.b : nnnnccgtatcatxxxxxxxx
OVRT1_0100_B05.b :
AMP01_0049_C11.b : nnnggtgataatatagggatatcttxxxxxx
SMG01_0035_A07.b :
DCI01_0100_H10.b : nttaaaacatacatxxxxxx
LNG01_0108_F03.b :
AMP01_0033_C09.b : nnggagatatatattaggatatcttxxxxx
MLN01_0061_H09.b :
DCI01_0096_A08.b : nnnnccgatactaaxxxxx
OVRT1_0073_B06.b :
PBL01_0025_H11.b :
AMP01_0017_C12.b : nttttactatccaxxxxxxxx
AMP01_0077_F10.b : nncctgtatatatagggatactaaxxxx
AMP01_0052_A11.b : nnnncagaaannataagagaatcattaggg
KDN01_0059_B10.b :
AMP01_0025_G01.b : nnnaaatgaatcatxxxxxx
ITT01_0098_H05.b :
DCI01_0114_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0098_G09.b : nnnnccgatactatagggct
LNG01_0066_D11.b :
DCI01_0072_H01.b : nttttttattaatggaacctatagggc
DCI01_0094_C07.b : nnccaatannnnnnnnggatactatagggc
PBL01_0090_H12.b :
ADR01_0084_G03.b :
OVR01_0042_E03.b :
AMP01_0097_B09.b : gggcataaatccaxxxxxxxxxxxx
MLN01_0017_E06.b :
BKFL1_0012_F02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0016_G06.b : nngggtatttnnnttggaatctaaxxxxx
ILNT1_0054_C09.b :
DCI01_0080_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0006_D01.b :
ILNT1_0015_C04.b :
BMWN1_0017_B06.b :
LVR01_0026_E03.b :
BFLT1_0137_E12.b :
PTG01_0070_F06.b :
BMWN1_0035_F06.b :
BMWN1_0069_B08.b :
HTMT1_0034_E07.b :
HTMT1_0103_E02.b :
BMWN1_0095_H12.b :
LNG01_0035_H06.b :
HTMT1_0053_G01.b :
ILNT1_0004_E12.b :
ILNT1_0001_D11.b :
OVRM1_0164_D02.b :
OVRM1_0051_B03.b :
AMP01_0002_F08.b : atatgtatxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : gatatcttngggggatatcttgg
BFLT1_0120_F08.b :
DCI01_0021_A09.b : nnaaaagtaacaa
AMP01_0017_C08.b : nntttacgaatcttxxx
AMP01_0068_E11.b : nnggagataantatagggacacatt
DCI01_0022_D04.b : tttaacgtaacaax
SPLT1_0017_G01.b :
BFLT1_0092_G06.b :
AMP01_0009_C09.b : naaaaacgtatctatxxxx
LNG01_0013_D09.b :
OVRT1_0090_F09.b :
CBLT1_0008_C05.b :
MLTL1_0045_C08.b : nnnnccgaatttnnnnntagatactaax
KDN01_0053_A05.b :
BFLT1_0074_F02.b :
AMP01_0093_C04.b : gggatxxxxxxxxxxxxxx
OVRT1_0025_G02.b :
BFLT1_0070_D08.b :
ADR01_0063_H09.b :
KDN01_0023_A05.b :
ITT01_0038_E04.b :
SKNB1_0074_A02.b :
KDN01_0068_G05.b :
AMP01_0088_E11.b : naaaggaatcttx
OVRT1_0091_E06.b :
PBL01_0061_G02.b :
PBL01_0093_E02.b :
MLN01_0094_H09.b :
DCI01_0082_D11.b : nggcgtaannnnaaacgatatctax
AMP01_0053_C01.b : nnnggcgataaanntaagggatatcttxx
LVRM1_0169_A12.b :
THY01_0111_G02.b :
OVRM1_0113_B01.b :
OVRM1_0058_A03.b :
OVRM1_0175_D12.b :
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnn
OVRM1_0202_B09.b :
OVR01_0078_A12.b :
OVRM1_0010_G09.b :
OVRM1_0079_H09.b :
PTG01_0050_B05.b :
OVR01_0072_G07.b :
PTG01_0049_F01.b :
ADR01_0045_F03.b :
PBL01_0028_C12.b :
OVRT1_0109_B07.b :
OVRT1_0077_A07.b :
OVRT1_0128_F06.b :
LNG01_0104_C11.b :
PST01_0069_C03.b :
BFLT1_0026_G12.b :
BFLT1_0119_B09.b :
OVRT1_0141_B02.b :
PBL01_0087_H08.b :
SKNB1_0034_G06.b :
THY01_0099_D01.b :
PBL01_0105_H03.b :
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b :
KDN01_0055_B04.b :
THY01_0088_G11.b :
LVR01_0055_D02.b :
BFLT1_0100_F09.b :
PBL01_0106_B09.b :
OVR01_0039_B12.b :
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b :
LNG01_0069_G11.b :
OVR01_0050_D08.b :
PBL01_0100_D09.b :
UTR01_0095_F11.b :
KDN01_0012_B11.b :
SKNB1_0015_H05.b :
BFLT1_0002_C12.b :
OVR01_0049_D04.b :
PST01_0055_C12.b :
PBL01_0090_E04.b :
AMP01_0099_B02.b : gcgcaxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b :
KDN01_0013_E12.b :
OVRM1_0223_D07.b :
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b :
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b :
KDN01_0001_E05.b :
MLN01_0092_G11.b :
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b :
PTG01_0101_H11.b :
BMWN1_0081_A10.b :
PTG01_0074_A03.b :
PTG01_0073_B07.b :
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b :
DCI01_0029_D02.b : nnnggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b :
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0078_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_E08.b : agcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0056_B02.b : gattccgtcagcgnacgnatgxx
ADR01_0049_E12.b :
ILNT1_0071_B01.b :
BMWN1_0036_C06.b :
BMWN1_0079_C07.b :
UTR01_0012_G03.b : tgg
HTMT1_0084_H05.b :
HTMT1_0127_E05.b :
ILNT1_0071_B03.b :
CBLT1_0061_G11.b :
BMWN1_0021_G09.b :
BMWN1_0043_D05.b :
ILNT1_0025_F08.b :
ADR01_0040_C03.b :
HTMT1_0070_C12.b :
CBLT1_0092_D08.b :
ITT01_0103_G03.b :
CBLT1_0011_C01.b :
HTMT1_0086_D05.b :
HTMT1_0119_C01.b :
BMWN1_0013_F07.b :
HTMT1_0070_E07.b :
CLNT1_0145_D06.b :
LVR01_0082_E10.b : gacxxxxxxxx
HTMT1_0070_D12.b :
ITT01_0102_D07.b :
LVR01_0079_E07.b : gcatttggg
HTMT1_0021_C11.b :
HTMT1_0030_F06.b :
THY01_0065_H08.b : ccttt
ILNT1_0016_C07.b :
CBLT1_0052_E12.b :
OVR01_0020_E07.b : gggggggca
PTG01_0096_D04.b :
HTMT1_0141_B05.b :
OVRM1_0133_C10.b :
PTG01_0063_G05.b :
SPL01_0039_H07.b : gaggacatt
SMG01_0036_F05.b :
BFLT1_0088_D05.b :
PBL01_0105_C09.b :
HTMT1_0004_G01.b :
LNG01_0006_G02.b : ggtttaactggctt
HTMT1_0046_C06.b :
BMWN1_0010_D08.b :
THY01_0203_H03.b : cctttacg
OVRT1_0049_G01.b : nngggtt
HTMT1_0125_B12.b :
ADR01_0027_E01.b :
SPL01_0024_F01.b :
ILNT1_0088_E12.b :
CLNT1_0144_F11.b :
BFLT1_0115_A08.b :
HTMT1_0147_D07.b :
BFLT1_0074_C06.b :
AMP01_0011_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_E10.b :
ITT01_0037_C12.b :
ITT01_0001_D04.b :
ADR01_0079_C04.b :
SPLT1_0097_C12.b :
BMWN1_0029_D12.b :
DCI01_0027_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F04.b :
ILNT1_0060_G12.b :
ILNT1_0012_C10.b :
BMWN1_0026_H01.b :
AMP01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A08.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_H08.b :
AMP01_0007_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_A07.b :
AMP01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_G09.b :
AMP01_0020_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_B10.b :
AMP01_0018_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C10.b : ctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_G03.b :
AMP01_0062_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_D05.b :
OVR01_0052_D09.b : n
CLNT1_0141_G06.b :
AMP01_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_A08.b :
AMP01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_G02.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_C11.b : ctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_H11.b :
SPLT1_0003_E05.b :
BFLT1_0046_B08.b :
DCI01_0066_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B11.b :
DCI01_0002_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0064_E07.b :
AMP01_0033_B10.b : ctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_F03.b :
AMP01_0098_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b :
OVRT1_0072_F11.b :
CBLT1_0006_A09.b :
AMP01_0052_B09.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A04.b :
AMP01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E03.b :
AMP01_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_B07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_A02.b :
SPLT1_0081_C04.b :
SPLT1_0001_E08.b :
AMP01_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_B08.b :
AMP01_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_F11.b :
THY01_0102_B09.b :
OVRM1_0027_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0036_D11.b :
OVRM1_0225_F03.b :
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_B10.b : gc
OVRM1_0090_F03.b :
OVRM1_0171_E10.b :
OVRM1_0111_H12.b :
OVRM1_0217_F08.b :
OVRM1_0117_B08.b :
OVRM1_0059_A11.b :
OVRM1_0084_A09.b :
PTG01_0045_H12.b :
OVRM1_0049_D11.b :
OVRM1_0122_H06.b :
SMG01_0051_A01.b :
ILNT1_0011_D03.b :
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_C08.b :
SMG01_0052_E04.b :
PTG01_0031_B12.b :
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_B11.b :
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_B09.b : xxxxxx
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_H10.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_D09.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0069_G02.b :
SMG01_0062_F07.b :
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0063_B10.b :
OVR01_0035_D11.b : aaggctxxx
SMG01_0023_E02.b :
BFLT1_0128_F02.b :
LNG01_0031_H03.b : tgttttagatt
OVR01_0060_D01.b : nn
OVRT1_0004_G11.b :
MLN01_0006_G11.b :
THY01_0032_F12.b : attt
DCI01_0066_G01.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_F08.b : nnnccaa
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_H06.b : gaggatxx
THY01_0008_H10.b : xxxx
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0033_D02.b :
MLN01_0022_D07.b :
ITT01_0026_B03.b :
PBL01_0052_C08.b :
ITT01_0076_A08.b :
LNG01_0091_E09.b :
ITT01_0094_G10.b :
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0057_E10.b :
LNG01_0018_E03.b : gcat
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_B05.b :
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_A07.b :
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_F03.b :
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_H09.b :
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_B06.b : nt
PBL01_0025_H11.b :
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_A11.b : ctgctcgcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0059_B10.b :
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_H05.b :
DCI01_0114_E12.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_D11.b :
DCI01_0072_H01.b : tgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0090_H12.b :
ADR01_0084_G03.b :
OVR01_0042_E03.b : ggggca
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0017_E06.b :
BKFL1_0012_F02.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0054_C09.b :
DCI01_0080_G03.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_D01.b :
ILNT1_0015_C04.b :
BMWN1_0017_B06.b :
LVR01_0026_E03.b :
BFLT1_0137_E12.b :
PTG01_0070_F06.b :
BMWN1_0035_F06.b :
BMWN1_0069_B08.b :
HTMT1_0034_E07.b :
HTMT1_0103_E02.b :
BMWN1_0095_H12.b :
LNG01_0035_H06.b :
HTMT1_0053_G01.b :
ILNT1_0004_E12.b :
ILNT1_0001_D11.b :
OVRM1_0164_D02.b :
OVRM1_0051_B03.b :
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : cgnctgtcctccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_F08.b :
DCI01_0021_A09.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_G01.b :
BFLT1_0092_G06.b :
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D09.b :
OVRT1_0090_F09.b :
CBLT1_0008_C05.b : nnnccgcaggagaggccg
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_A05.b :
BFLT1_0074_F02.b :
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_G02.b :
BFLT1_0070_D08.b :
ADR01_0063_H09.b :
KDN01_0023_A05.b :
ITT01_0038_E04.b :
SKNB1_0074_A02.b :
KDN01_0068_G05.b :
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_E06.b :
PBL01_0061_G02.b :
PBL01_0093_E02.b :
MLN01_0094_H09.b :
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_A12.b :
THY01_0111_G02.b :
OVRM1_0113_B01.b :
OVRM1_0058_A03.b :
OVRM1_0175_D12.b :
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0202_B09.b :
OVR01_0078_A12.b :
OVRM1_0010_G09.b :
OVRM1_0079_H09.b :
PTG01_0050_B05.b :
OVR01_0072_G07.b :
PTG01_0049_F01.b :
ADR01_0045_F03.b :
PBL01_0028_C12.b :
OVRT1_0109_B07.b :
OVRT1_0077_A07.b :
OVRT1_0128_F06.b :
LNG01_0104_C11.b :
PST01_0069_C03.b :
BFLT1_0026_G12.b :
BFLT1_0119_B09.b :
OVRT1_0141_B02.b : n
PBL01_0087_H08.b :
SKNB1_0034_G06.b :
THY01_0099_D01.b : g
PBL01_0105_H03.b :
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b :
KDN01_0055_B04.b :
THY01_0088_G11.b :
LVR01_0055_D02.b : c
BFLT1_0100_F09.b :
PBL01_0106_B09.b :
OVR01_0039_B12.b : aaag
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b :
LNG01_0069_G11.b :
OVR01_0050_D08.b :
PBL01_0100_D09.b :
UTR01_0095_F11.b :
KDN01_0012_B11.b :
SKNB1_0015_H05.b :
BFLT1_0002_C12.b :
OVR01_0049_D04.b :
PST01_0055_C12.b :
PBL01_0090_E04.b :
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b :
KDN01_0013_E12.b :
OVRM1_0223_D07.b :
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b :
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b :
KDN01_0001_E05.b :
MLN01_0092_G11.b :
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b :
PTG01_0101_H11.b :
BMWN1_0081_A10.b :
PTG01_0074_A03.b :
PTG01_0073_B07.b :
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b :
DCI01_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b :
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : .................................................ATAAGAGATAG
---------+---------+---------+---------+---------+---------+ 11
DCI01_0078_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATAAGAGATAG
OVR01_0073_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGATAG
BFLT1_0056_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaGAGATAG
ADR01_0049_E12.b : tttttaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
ILNT1_0071_B01.b : nnccgaagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0036_C06.b : tcccaaatgtaagacgccxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0079_C07.b : ttttggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_G03.b : gggcacctattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_H05.b : tttttagatagtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_E05.b : ttttggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0071_B03.b : nnnncgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_G11.b : ntttttgcaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G09.b : tgactatgaagacgxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0043_D05.b : ttcgagattacacgcagtagtattaaxxxxxxxxxxxxx
ILNT1_0025_F08.b : ttttcgcaggagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0040_C03.b : nttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0070_C12.b : ttcgcaagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0092_D08.b : tggtaatgacacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0103_G03.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0011_C01.b : ttttccacagtacacgcagtagtaxxxxxxxxxxxxxxxxxxx
HTMT1_0086_D05.b : tttnacgacagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_C01.b : nnnnggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0013_F07.b : tttaggcaagtacacgccgtagtaxxxxxxxxxxxxxxxxxx
HTMT1_0070_E07.b : ttggcaagaagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0145_D06.b : nnnnnacgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0070_D12.b : ttttccgacagaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_D07.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_E07.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_C11.b : ttttggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0030_F06.b : tttccgagagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0065_H08.b : tggatgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0016_C07.b : gagtgtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0052_E12.b : nnttggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_E07.b : cctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0096_D04.b : nnnccactttttntnnngggtcaagcagcggtaxxxxxxxxxxxxxxx
HTMT1_0141_B05.b : tttaaggatgataagacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_C10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0063_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_H07.b : atgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0036_F05.b : nggcatatttnnnnnggagtaagcagcggnacggntccggattctcg
BFLT1_0088_D05.b : nggaatcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_C09.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0004_G01.b : tcccgcat
LNG01_0006_G02.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_C06.b : tttttggacagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_D08.b : nnnnnggatgagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0203_H03.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_G01.b : ttnnnnnnctccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0125_B12.b : tttggacagtacgacgcagtagtaxxxxxxxxxxxxxxxxxx
ADR01_0027_E01.b : ttatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_F01.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0088_E12.b : ntttacctagtacacgccgtagtattaaxxxxxxxxxxxxx
CLNT1_0144_F11.b : nnnnnccgacagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0115_A08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0147_D07.b : tttttaccaagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0074_C06.b : nggactcgttagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_E10.b : ggtttcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_C12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_D04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0079_C04.b : nnnaaatagactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0097_C12.b : nnnggcgcgagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_D12.b : tttttagcaagtacacgxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F04.b : nggaaagaagacgccgtaxxxxxxxxxxxxxxxxxx
ILNT1_0060_G12.b : nnnngggcggtacgaggxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0012_C10.b : nnnccgcaagtacacgxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0026_H01.b : ttttaccacgtgaagacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_H08.b : ttttaccagagtagaxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0007_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_A07.b : ttttagacaggagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_G09.b : nnttacgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_B10.b : ttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_G03.b : nnaatatttttnannggataaagcagcxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_D05.b : nnnnccaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_D09.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0141_G06.b : nnnnccgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_A08.b : ntttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_H11.b : ntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0003_E05.b : nnnnccaagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0046_B08.b : nggatcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B11.b : ttcgacgttacacgxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0064_E07.b : nnccgcatgagaggxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_F03.b : tttttagagagtagaggccgtagtattaaxxxxxxxxxxx
AMP01_0098_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b : nttttggacggtacacgcagtagtattaaxxxxxxxxxx
OVRT1_0072_F11.b : nncctcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_A09.b : nttttcgcaagacacxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A04.b : tttttagacgagagaggccgtaxxxxxxxxxxxxxxxxxxx
AMP01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E03.b : ttttggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_A02.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0081_C04.b : nnccgcagtagaggxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_E08.b : nnnngctagtacacgxxxxxxxxxxxxx
AMP01_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_B08.b : tttttccaggtacacgxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_F11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0102_B09.b : cgcgtccggtc
OVRM1_0027_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0036_D11.b : aattttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_B10.b : attagggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0090_F03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_H12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_F08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_A11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_A09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0045_H12.b : nnnaaaaaaattntnnggataaagcagcxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_D11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0051_A01.b : nnnaacttttnnnnngggataaagcagcggtacggntccggattctc
ILNT1_0011_D03.b : tttccgcagtagaggccgtagtatttnxxxxxxxxxxx
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_C08.b : ccccttcgcgaacgaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0052_E04.b : nnnttcgttnnnnnaagagtaagcagcxxxxxxxxxxxxxxxxxxxxx
PTG01_0031_B12.b : ttttttggatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_B11.b : tttnttagatggacatgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0069_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0062_F07.b : nngacatttttnnnggataaagcagcggtaxxxxxxxxxxxxxxx
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0063_B10.b : ncgctttttnnnnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_E02.b : nnggagtttcttnnnnggactaagcagcggtaxxxxxxxxxxxxxxxx
BFLT1_0128_F02.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_H03.b : tgattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_D01.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_G11.b : nttttcctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0006_G11.b : nnntttctggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_F12.b : ggtgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_F08.b : ttcaccnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0033_D02.b : ggaatccgtcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0022_D07.b : ntttggtaggatatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0026_B03.b : nnggatgaacaxxxxxxxxxxxxxxxxxx
PBL01_0052_C08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
ITT01_0076_A08.b : nnnnggatcaacaxxxxxxxxxxxxxxxxx
LNG01_0091_E09.b : tttnnggcattggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0094_G10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0057_E10.b : tagatgaacaxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0018_E03.b : tttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_B05.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_A07.b : nnggatattttntnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_F03.b : nnnnnggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_H09.b : ngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_B06.b : agttttnnnnncccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_H11.b : nagataaacaxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0059_B10.b : nntttctacggtgg
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_H05.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_D11.b : nnnnnggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0090_H12.b : nnaaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0084_G03.b : nnnnnnggatcaacagctxxxxxxxxxxxxxxxxxxx
OVR01_0042_E03.b : ttaggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0017_E06.b : nntttagtggacttgnaagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0012_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0054_C09.b : nnnccgcgagtacacgccgtaxxxxxxxxxxxxxxxxx
DCI01_0080_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_D01.b : nnnggatgaacaxxxxxxxxxxxxxxxx
ILNT1_0015_C04.b : agaggccgtaxxxxxxxxxxxxxxx
BMWN1_0017_B06.b : nnnggacacagacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_E03.b : atggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0137_E12.b : nttttccgctagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0070_F06.b : nagaaatttnnnnggatcaagcagcxxxxxxxxxxxxxxxxxx
BMWN1_0035_F06.b : ttttggcagagtagaxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_B08.b : ttttggacagtacgacgcagtagtattaaxxxxxxx
HTMT1_0034_E07.b : nggcaggtacgacgxxxxxxxxxxxxxxxxxxxx
HTMT1_0103_E02.b : ttttggagagtacgaggcagtagtaxxxxxxxxxxx
BMWN1_0095_H12.b : tttttagacggtagacgcagtagtattaaxxxxxxx
LNG01_0035_H06.b : gcattttggcgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_G01.b : ntttatttttttttnggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0004_E12.b : nnnccgcggtacgaggcagtagtattaaxxxxxxx
ILNT1_0001_D11.b : tttcgcatgagaggxxxxxxxxxxxxxxxxxxx
OVRM1_0164_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0051_B03.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_F08.b : nnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_G01.b : nnggttcaagttagacgxxxxxxxxxxxxxxxxxxxx
BFLT1_0092_G06.b : gggaccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D09.b : tttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_F09.b : nttgcttttnnngnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0008_C05.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggaggccgggtatccgattta
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_A05.b :
BFLT1_0074_F02.b : ggatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_G02.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0070_D08.b : gggaccgtcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0063_H09.b : nnnnggagatacacagctgnacccgtccgaa
KDN01_0023_A05.b :
ITT01_0038_E04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxx
SKNB1_0074_A02.b :
KDN01_0068_G05.b : nnnnggct
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_E06.b : nggtatttnnnngnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_G02.b : nnggtgacacaxxxxxxxxxxxxxxxxxxx
PBL01_0093_E02.b : nnggatgaacaxxxxxxxxxxxxxxxxx
MLN01_0094_H09.b : nttgttaggacaagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_A12.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_G02.b : agtgtcaaaacagctggtxxxxxxxxxx
OVRM1_0113_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_A03.b : agttgatcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0175_D12.b : xxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_B09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_A12.b : nnggggcttggactataacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0010_G09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_H09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0050_B05.b : attttnggagtxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_G07.b : nnggattggacttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_F01.b : nggagtttttttttgatcxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0045_F03.b : nggtgaaacaxxxxxxxxxxxxxxxxxxxx
PBL01_0028_C12.b : nnttagtgaaacaxxxxxxxxxxxxxxxxxx
OVRT1_0109_B07.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_A07.b : nnnntttctattgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_F06.b : nncccttcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0104_C11.b : ttttttagatggacttgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0069_C03.b :
BFLT1_0026_G12.b : gacttcctatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0119_B09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_B02.b : nnccaatttnnnnnnnnccgttagcgttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0087_H08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
SKNB1_0034_G06.b : nnnncccttt
THY01_0099_D01.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_H03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b : nnnnccgttagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0055_B04.b :
THY01_0088_G11.b : ccttttggctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D02.b : ctttatggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_F09.b : ggatcccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_B09.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxx
OVR01_0039_B12.b : gaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b : nntttgctagtactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0069_G11.b : tggggggctggacaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_D08.b : nnnnnagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0100_D09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
UTR01_0095_F11.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0012_B11.b : naaa
SKNB1_0015_H05.b : nnnnggat
BFLT1_0002_C12.b : gattccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_D04.b : ttttnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0055_C12.b :
PBL01_0090_E04.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxx
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b : t
KDN01_0013_E12.b : tt
OVRM1_0223_D07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b : naac
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b : ctcttcgctgacgatgttxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0001_E05.b : ngcatattnnn
MLN01_0092_G11.b : nncctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b : ttggagagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0101_H11.b : ncccgctttttnnnntttggagtaaagcaggcgtgntacggntcggaaattcctcn
BMWN1_0081_A10.b : tttccgatagtacgacgxxxxxxxxxxxxxxxxxxxxxx
PTG01_0074_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0073_B07.b : n
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b : nnaaccagtagaggccagtgtatttaacgact
DCI01_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtt
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b : nnnnaa
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : GGCGACGGGCGGAAACGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
---------+---------+---------+---------+---------+---------+ 66
DCI01_0078_G12.b : GGCGACGGGCGGAAACCGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0073_E08.b : GGCGACGGGCGGAAACCGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0056_B02.b : GGCGACGGGCGGAAACCGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0049_E12.b : GGCGACGGGCGGAAACCGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0071_B01.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0036_C06.b : xxxxxxxxxxxxxxxxGGGTCT*CACTTAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0079_C07.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
UTR01_0012_G03.b : xxxxxxxxxxxxxxxgGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0084_H05.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCAGG**TTGCGAG
HTMT1_0127_E05.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0071_B03.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0061_G11.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0021_G09.b : xxxxxxxxxxxxxxxxGGGTCT*CCCTTTTCCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0043_D05.b : xxxxxxxxxxxxxxxxGGGTCT*CACCCTTTTG*TCGGG*AGCGCTTCAGG**TTGCGGC
ILNT1_0025_F08.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0040_C03.b : xxxxxxxxxxxxxxxcGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0070_C12.b : xxxxxxxxxxxxxxxtGGGTCT*CCTTTAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0092_D08.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0103_G03.b : xxxxxxxxxxxacctgGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0011_C01.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0086_D05.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0119_C01.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0013_F07.b : xxxxxxxxxxxxxxxxGGGTCT*CATCGTTTCA*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0070_E07.b : xxxxxxxxxxxxxxxxGGGTCT*CCCTTTAACG*TCGGG*AGCGCTTCGGG**TTGCGGC
CLNT1_0145_D06.b : xxxxxxxxxxxxxxxcGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0082_E10.b : xxxxxxxxxxxxxxxxCTGGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0070_D12.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0102_D07.b : xxxxxxxxxxxxxxxxCTGGCT*CATTGAACCC*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0079_E07.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0021_C11.b : xxxxxxxxxxxxxxxaGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0030_F06.b : xxxxxxxxxxxxxxxaGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0065_H08.b : xxxxxxxxxxxxxxxgGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0016_C07.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0052_E12.b : xxxxxxxxxxxxxxxxGGGTCT*CATTGAACTT*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0020_E07.b : xxxxxxxxxxxxxxtaCTGGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0096_D04.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0141_B05.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0133_C10.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0063_G05.b : nnnnnnnnnnnnnnnnnGGTCT*CATTGAACCGNTCGGG*AGCGCTTCGGGN*TTGCGGN
SPL01_0039_H07.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*TGCGCTTCGGG**TTGCGGC
SMG01_0036_F05.b : agcacggttggcctctgGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0088_D05.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0105_C09.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0004_G01.b : actaaggattaatgattGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0006_G02.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0046_C06.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0010_D08.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0203_H03.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0049_G01.b : xxxxxxxxxxxxxxxxxGGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0125_B12.b : xxxxxxxxxxxxxxxxxGGTCT*CATTCAATTA*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0027_E01.b : xxxxxxxxxxxxxxxxxxGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPL01_0024_F01.b : xxxxxxxxxxxxxxxxxxGGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0088_E12.b : xxxxxxxxxxxxxxxxxgCTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CLNT1_0144_F11.b : xxxxxxxxxxxxxxxxxxCTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0115_A08.b : xxxxxxxxxxxxxxxxxxGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0147_D07.b : xxxxxxxxxxxxxxxxxgCTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0074_C06.b : xxxxxxxxxxxxxxxxxtGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0011_H07.b : xxxxxxxxxxxxxxxxxxCTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0066_E10.b : xxxxxxxxxxxxxxxxxxGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0037_C12.b : xxxxxxxxxxxxxxxxxxGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0001_D04.b : xxxxxxxxxxxxxxxxxxGTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0079_C04.b : xxxxxxxxxxxxxxxxxtCTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0097_C12.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0029_D12.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGCCCTT*ATAGG*AGCGCTTCGGG**TTGCGGC
DCI01_0027_G07.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0040_F04.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGACCCT*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0060_G12.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0012_C10.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0026_H01.b : xxxxxxxxxxxxxcatttaTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0014_E04.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCTAGGAGCGCTTCGGG**TTGCGGC
AMP01_0009_B05.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0034_A08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0012_B04.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0029_H08.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGCCCTT*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0007_D04.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0013_B08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0070_E03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0029_A07.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0012_A08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCTGG**TTGCGGC
HTMT1_0121_G09.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0020_G06.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0060_G08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0012_H02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0098_A05.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0041_D06.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0081_B10.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0018_A06.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0050_G07.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0053_C10.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0016_G03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGN
AMP01_0062_E05.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0069_G12.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0099_A03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0055_E06.b : xxxxxxxxxxxxxxxxxxxACT*CATTGAACCG*TCCGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0077_A02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0048_F09.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0022_F02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0001_D05.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0052_D09.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CLNT1_0141_G06.b : xxxxxxxxxxxxxxxxxxxACT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0025_G02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0119_A08.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0013_F03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_E08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0010_C01.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0075_E02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0053_G02.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCCTCGGG**TTGCGGC
AMP01_0086_C11.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0010_D01.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0098_H11.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0003_E05.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0046_B08.b : xxxxxxxxxxxxxxxxxxtTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0066_H05.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0025_H03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0044_B11.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGACCCT*TTAGG*AGCGCTTCGGG**TTGCGGC
DCI01_0002_G03.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0064_E07.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0033_B10.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0026_F04.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0059_F03.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0098_H08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0005_A09.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0072_F11.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0006_A09.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0052_B09.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0046_A04.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0024_E08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0062_E03.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0033_H04.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0112_B07.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0012_A02.b : xxxxxxxxxxxxxxxxxxxACT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0081_C04.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0001_E08.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0010_G09.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0074_F08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TCGCGGC
DCI01_0073_A07.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0002_B08.b : xxxxxxxxxxxxxxxxxxxGCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_G08.b : xxxxxxxxxxxxxxxxxxxTCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0066_F11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0102_B09.b : ggaatcccaacccggttggcTG*GATTGAAGGG**CGGG*AGCGCTTCGGG**TTG**GG
OVRM1_0027_F06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0036_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0225_F03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0090_F03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0171_E10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0111_H12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0217_F08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0117_B08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0059_A11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0084_A09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0045_H12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0049_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0122_H06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0051_A01.b : gagcacgnttggcctactggCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGN
ILNT1_0011_D03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0117_C08.b : xxxxxxxxxxxxxxxxxxxxCT*CTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0052_E04.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0031_B12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0086_B11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0012_B09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0089_H10.b : xxxxxxxxxxxxxxxxxxxxCT*CATCGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGT
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0069_G02.b : nnnnnnnnnnnnxxxxxxxxCT*CATTGAACCG*TCGGGAAGCGCTTCGGG**TTGCGGC
SMG01_0062_F07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0063_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0035_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0023_E02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0031_H03.b : xxxxxxxxxxxxxxxxxxxxCT*CATCGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0060_D01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGT
OVRT1_0004_G11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0006_G11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0032_F12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0066_G01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0136_F08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0008_H10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0033_D02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0022_D07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0026_B03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0052_C08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0076_A08.b : xxxxxxxxxxxxxxxxxxxxCTGGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0094_G10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACAG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0057_E10.b : xxxxxxxxxxxxxxxxxxxxCTGGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0018_E03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0100_B05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0035_A07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGN
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0108_F03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0061_H09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0073_B06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0025_H11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0052_A11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0059_B10.b : ctactggaaaaaaaaaaaaaCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0098_H05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0114_E12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0066_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0094_C07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0090_H12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0084_G03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0017_E06.b : xxxxxxxxxxxxxxxxxxxxgTGGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BKFL1_0012_F02.b : xxxxxxxxxxxxxxxxxxxatT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0054_C09.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCC*TCTGG*AGCGCTTCGGG**TTGCGGC
DCI01_0080_G03.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0006_D01.b : xxxxxxxxxxxxxxxxxxxxxG*GATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0015_C04.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCCGG*ATCGCTTCGGG**TTGCGGC
BMWN1_0017_B06.b : xxxxxxxxxxxxxxxxxxxxgcaCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0026_E03.b : xxxxxxxxxxxxxxxxxxxxxxxCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0137_E12.b : xxxxxxxxxxxxxxxxxxxxxxcGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0070_F06.b : xxxxxxxxxxxxxxxxxxxxxxxCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0035_F06.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCTGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0069_B08.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0034_E07.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0103_E02.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0035_H06.b : xxxxxxxxxxxxxxxxxxxactaGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0053_G01.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0004_E12.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0001_D11.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0164_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0051_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0067_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxcgtTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0017_G01.b : xxxxxxxxxxxxxxxxxxxxxxgaTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0092_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0013_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0090_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0008_C05.b : gggcgacgggcggaaaccggtctcATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0053_A05.b : ntcacgttggctatgGATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0074_F02.b : xxxxxxxxxxxxxxxxxxxxxxxtATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0070_D08.b : xxxxxxxxxxxxxxxxxxxxxcggTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0063_H09.b : ttctccacactgttggcctactggATTGAACCC*TCCGG*AGCGCTTCCGG**TTGCGGC
KDN01_0023_A05.b : tggcgttggctctgGATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0038_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0074_A02.b : nnnnnttaactgttgctatgGATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0068_G05.b : gcgttggctatgggttggcactggTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0091_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0061_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0093_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVRM1_0169_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0111_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG**CGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0113_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0058_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0175_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0007_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0202_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0078_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCAGC
OVRM1_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0079_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0050_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCCGG*AGCGCTTCCGG**TTGCGGC
PTG01_0049_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0045_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0028_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0109_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0077_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0128_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0104_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0069_C03.b : tcgcgttggctatggATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0026_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0119_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0141_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0087_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0034_G06.b : nnnnntnccaacgttggctctggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0099_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0105_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0099_B02.b : nnnaactgcgtttgctctggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0085_E03.b : nnnnnncctacggtggctatggctcATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0028_C05.b : ttttaacggcgttggctatggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0081_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0055_B04.b : nnnccttactgtggctatggggtctCTTGAACG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0088_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0055_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0100_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0106_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0039_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0058_B04.b : nnnnncctgctgtggctaggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0030_B12.b : nnggtcgctgtggctctgctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
TCH01_0094_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0069_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0050_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0100_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
UTR01_0095_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0012_B11.b : ttttnnnnncctgcgggtgcacggcATTAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0015_H05.b : nnnnnnaaacaacgttggctcggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0002_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0049_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0055_C12.b : tttttgctgcagttggctatggATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0049_E06.b : tcacgttggctctggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0021_B05.b : agttggctactggaTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0014_E12.b : tttttttcctgctgttgctctggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0013_E12.b : ttatnttcctacggttgctatggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0223_D07.b : xxxxxxxxxxxxxxxxxxxxxxxtgggGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0091_A07.b : nnnccaactgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0064_G01.b : nnnncctgctgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0064_D04.b : nnncctgctgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0015_A08.b : ttttnnnnnncccgcgttggctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0065_D02.b : nnnnttcgctgtggctctggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0095_F12.b : nnnnncctgctgttgctctggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0082_A08.b : nncctgcgttggctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0029_G08.b : xxxxxxxxxxxxxxxxxxxxxxxctcttAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0001_E05.b : nnnnncctgcagggtgcactgggctcttAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0092_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0052_D06.b : ggctctggattgaCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0077_B03.b : nnncctgcagttgctatggattgaCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0117_F01.b : xxxxxxxxxxxxxxxxxxxgggtctctcgtttcaTCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0101_H11.b : agcactggnttggcctactggnattgaaccgnntcgGGA*AGCGCTTCGGGNNTTGCGGC
BMWN1_0081_A10.b : xxxxxxxxxxxxxxxxxxxxxgctcanacatttaaaGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0074_A03.b : nnnnnnnnnnnnnnnnnntctcattgaccctntcgnnGG*AGCGCTTCGGGN*TTGCGGN
PTG01_0073_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0028_H07.b : ntgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0049_F04.b :
BMWN1_0028_B07.b : cctacacggaatttaatgaattgggtctcatcgtttaagagggaggggtatgggttgagg
DCI01_0029_D02.b : cttcctttaaaacaagtaacagagaagaacggggctcggtcgggtggaggaggggctgag
OVRM1_0113_E05.b : nagttgtcxxxxxxxxxxxxxx
UTR01_0084_C01.b : nnnnggcattgtactaanacxxxxxx
ADR01_0018_C11.b :
DCI01_0033_D05.b : catactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0058_G02.b :
AMP01_0070_B08.b : acatctatagggatacttaxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
---------+---------+---------+---------+---------+---------+ 124
DCI01_0078_G12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0073_E08.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0056_B02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0049_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0071_B01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0036_C06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0079_C07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
UTR01_0012_G03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0084_H05.b : CTTTTTTTCTCTAGCTAAACCAAGCCTACG*TTTCATCAACCATGTCTAATGAACCTGCA
HTMT1_0127_E05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0071_B03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0061_G11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0021_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0043_D05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0025_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0040_C03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0070_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0092_D08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0103_G03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0011_C01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0086_D05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0119_C01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0013_F07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0070_E07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CLNT1_0145_D06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LVR01_0082_E10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0070_D12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0102_D07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LVR01_0079_E07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0021_C11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0030_F06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0065_H08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0016_C07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0052_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0020_E07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0096_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0141_B05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0133_C10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0063_G05.b : CTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPL01_0039_H07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0036_F05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0088_D05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0105_C09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0004_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0006_G02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0046_C06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0010_D08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0203_H03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0049_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0125_B12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0027_E01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPL01_0024_F01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0088_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CLNT1_0144_F11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0115_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0147_D07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0074_C06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0011_H07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0066_E10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0037_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0001_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAATCATGTCTAAGGGACCTGCA
ADR01_0079_C04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0097_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0029_D12.b : TT*TTTTTCTCTAGCTCTACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0027_G07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0040_F04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0060_G12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0012_C10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0026_H01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0014_E04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCATCAACCATGTCTAAGGGACCTGCA
AMP01_0009_B05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0034_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0012_B04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0029_H08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0007_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0013_B08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCGGCAACCATGTCTAAGGGACCTGCA
AMP01_0070_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0029_A07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0012_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAAGGACCTGCA
HTMT1_0121_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0020_G06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0060_G08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGAGACCTGCA
AMP01_0012_H02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0098_A05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0041_D06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0081_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0018_A06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0050_G07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACTTGCA
AMP01_0053_C10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0016_G03.b : CTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0062_E05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0069_G12.b : T**TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0099_A03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0055_E06.b : TT*TTTTTCTCTAGCTAAGCCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLTL1_0077_A02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0048_F09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0022_F02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0001_D05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0052_D09.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CLNT1_0141_G06.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0025_G02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0119_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0013_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0093_E08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0010_C01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0075_E02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLTL1_0053_G02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0086_C11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0010_D01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0098_H11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTATG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0003_E05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0046_B08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0066_H05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0025_H03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0044_B11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0002_G03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0064_E07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0033_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0026_F04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0059_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0098_H08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0005_A09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0072_F11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0006_A09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0052_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0046_A04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0024_E08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0062_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0033_H04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCG
DCI01_0112_B07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0012_A02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0081_C04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0001_E08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0010_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCGGCAACCATGTCTAAGGGACCTGCA
DCI01_0074_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCCACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0073_A07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0002_B08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0017_G08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0066_F11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAATCATGTCTAAGGGACCTGCA
THY01_0102_B09.b : TTTTTTTCCTCTACCTAAACCAGGCCTACT*TTTCAGCAACCATGTTTAAGGGACCTGCA
OVRM1_0027_F06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0036_D11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0225_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0058_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0076_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0090_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0171_E10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0111_H12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0217_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0117_B08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0059_A11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0084_A09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0045_H12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0049_D11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0122_H06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0051_A01.b : CTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0011_D03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0032_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0037_C02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0117_C08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0052_E04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0031_B12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0005_H11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0086_B11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0038_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0012_H07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0012_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0027_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0028_H06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLTL1_0089_H10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0093_C05.b : TT*TTTTTCTCTAGCTAAACCGGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0048_A06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0019_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0106_D03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0041_G08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0034_A05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLTL1_0031_D09.b : TT*TTTTCCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0067_B02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0009_G06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0069_G02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0062_F07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0093_G05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTACAGCAACCATGTCTAAGGGACCTGCA
AMP01_0016_E01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0028_G07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0063_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0035_D11.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0023_E02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0128_F02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0031_H03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*CTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0060_D01.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0004_G11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0006_G11.b : TT*TTTTTCTCTAGCTAAACCAGACCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0032_F12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0066_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0136_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0032_A06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0044_H06.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0008_H10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0017_D03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0033_D02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0022_D07.b : TT*TTTTTCTCTAGCTAAACCAAGACTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0026_B03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0052_C08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0076_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0091_E09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0094_G10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0005_A03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0057_E10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0018_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0114_B12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0085_G08.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0100_B05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0049_C11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SMG01_0035_A07.b : CTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0100_H10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0108_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0033_C09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0061_H09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0096_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0073_B06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0025_H11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0017_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0077_F10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0052_A11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0059_B10.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0025_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0098_H05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0114_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0098_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0066_D11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0072_H01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0094_C07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0090_H12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0084_G03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0042_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0097_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0017_E06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BKFL1_0012_F02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0016_G06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0054_C09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0080_G03.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0006_D01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0015_C04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0017_B06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LVR01_0026_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0137_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGGCCTGCA
PTG01_0070_F06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0035_F06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0069_B08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0034_E07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0103_E02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0095_H12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0035_H06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0053_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0004_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ILNT1_0001_D11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0164_D02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0051_B03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0002_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0067_E06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0120_F08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0021_A09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0017_C08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0068_E11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
DCI01_0022_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SPLT1_0017_G01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0092_G06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0009_C09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0013_D09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0090_F09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
CBLT1_0008_C05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLTL1_0045_C08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0053_A05.b : TT*TTTTTCTCTAGCTAACCCATGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0074_F02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0093_C04.b : TT*TTTTTCTCTAGCTAA*CCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0025_G02.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0070_D08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0063_H09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0023_A05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ITT01_0038_E04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SKNB1_0074_A02.b : TT*TTTTTCTCTAGCTA*ACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0068_G05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0088_E11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0091_E06.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0061_G02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0093_E02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0094_H09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCCGCA
DCI01_0082_D11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0053_C01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LVRM1_0169_A12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0111_G02.b : TT**TTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0113_B01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0058_A03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0175_D12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0007_E06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0202_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0078_A12.b : AT*ATTTTCTCTAGCTAAACCAGGCCTACGCTTTCAACAACCATGTCTAAAGGACCTGCA
OVRM1_0010_G09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0079_H09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0050_B05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0072_G07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0049_F01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0045_F03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0028_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0109_B07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0077_A07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0128_F06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCT
LNG01_0104_C11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0069_C03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0026_G12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0119_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0141_B02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0087_H08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SKNB1_0034_G06.b : TT*TTTTTCTCTAGCTAA*CCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0099_D01.b : TT**TTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0105_H03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCG
PST01_0099_B02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0085_E03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0028_C05.b : TT*TTTTTCTCTAGCTA*ACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0081_B04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0055_B04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
THY01_0088_G11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LVR01_0055_D02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0100_F09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0106_B09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0039_B12.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0058_B04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0030_B12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
TCH01_0094_A01.b : CT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
LNG01_0069_G11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0050_D08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0100_D09.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
UTR01_0095_F11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0012_B11.b : TT*TTTTTCTCTAGCTAA*CCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
SKNB1_0015_H05.b : TT*TTTTTCTCTAGCTA*ACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BFLT1_0002_C12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVR01_0049_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0055_C12.b : TT*TTTTTCTCTAGCTA*ACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PBL01_0090_E04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
AMP01_0099_B02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0049_E06.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0021_B05.b : TT*TTTTTCTCTAGCTCC*CCTGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0014_E12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0013_E12.b : TT*TTTTTCTCTAGCTA*ACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0223_D07.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0091_A07.b : TT*TTTTTCTCTAGCTAA*CCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0064_G01.b : TT*TTTTTCTCTAGCTAA*CCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0064_D04.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0015_A08.b : TTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0065_D02.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0095_F12.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0082_A08.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
OVRT1_0029_G08.b : TT*TTTTTCTCCATCAAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0001_E05.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
MLN01_0092_G11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0052_D06.b : TT*TTTTTCTCTAGCTCC*CTAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PST01_0077_B03.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
HTMT1_0117_F01.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0101_H11.b : TT*TTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
BMWN1_0081_A10.b : TT*TTTTTCTCTACCTATACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0074_A03.b : CTTTTTTTCTCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
PTG01_0073_B07.b : nnnnnnTTCTCTAGCTAAACCAGGCCTACN*TTTCAGCAACCATGTCTAAGGGACCTGCA
ADR01_0028_H07.b : xxxxxxxxggCTAGCTAAACCAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCA
KDN01_0049_F04.b : accctttaAGGCCTACG*TTTCAGCAACCATGTCTAAGGGACCTGCT
BMWN1_0028_B07.b : atttttttttgtagttaaaaaAGGCCTACG*TTTCATCAACCATGTCTAAGGGACCTGCA
DCI01_0029_D02.b : aaaagaagccgaatctattctccgcgggataccggAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0113_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGTCTAAGGGACCTGCA
UTR01_0084_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCA
ADR01_0018_C11.b : gctaaacaxxxxxxxxxxxxxx
DCI01_0033_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0058_G02.b :
AMP01_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b :
AMP01_0002_H01.b : tatgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_G04.b : nngggatatttataacgatatcttxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
---------+---------+---------+---------+---------+---------+ 181
DCI01_0078_G12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0073_E08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0056_B02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0049_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0071_B01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0036_C06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0079_C07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
UTR01_0012_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0084_H05.b : GATGGCATTGATCTTGGCACCAC*CTATTCTTGTGTGTGGTGTCTTCC*AGCACGGAAAA
HTMT1_0127_E05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0071_B03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0061_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCCTCC*AACACGGAAAA
BMWN1_0021_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0043_D05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0025_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0040_C03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0070_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0092_D08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0103_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0011_C01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0086_D05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0119_C01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0013_F07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0070_E07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CLNT1_0145_D06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LVR01_0082_E10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0070_D12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0102_D07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LVR01_0079_E07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0021_C11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0030_F06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0065_H08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
ILNT1_0016_C07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0052_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0020_E07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0096_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGGAAA
HTMT1_0141_B05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0133_C10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0063_G05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPL01_0039_H07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0036_F05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0088_D05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0105_C09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0004_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0006_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
HTMT1_0046_C06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0010_D08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0203_H03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0049_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0125_B12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0027_E01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCCTCC*AGCACGGAAAA
SPL01_0024_F01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0088_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CLNT1_0144_F11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0115_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0147_D07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0074_C06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0011_H07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0066_E10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0037_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0001_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0079_C04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0097_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0029_D12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0027_G07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0040_F04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0060_G12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0012_C10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0026_H01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0014_E04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGACAA
AMP01_0009_B05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0034_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0012_B04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0029_H08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0007_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0013_B08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0070_E03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0029_A07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0012_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0121_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0020_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0060_G08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0012_H02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0098_A05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0041_D06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0081_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0018_A06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0050_G07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0053_C10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0016_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0062_E05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0069_G12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0099_A03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0055_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLTL1_0077_A02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0048_F09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0022_F02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0001_D05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0052_D09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CLNT1_0141_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0025_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0119_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0013_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0093_E08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0010_C01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0075_E02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLTL1_0053_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0086_C11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0010_D01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*CGCACGGAAAA
OVRT1_0098_H11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0003_E05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0046_B08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0066_H05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCGCGGAAAA
AMP01_0025_H03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0044_B11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0002_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0064_E07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0033_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0026_F04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0059_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0098_H08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0005_A09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0072_F11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0006_A09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0052_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0046_A04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0024_E08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0062_E03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0033_H04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0112_B07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0012_A02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0081_C04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0001_E08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0010_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0074_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0073_A07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0002_B08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0017_G08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0066_F11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
THY01_0102_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTTTG*GGTGTTTCCC*AGCACGGAAAA
OVRM1_0027_F06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0036_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0225_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0058_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0076_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0090_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0171_E10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0111_H12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0217_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0117_B08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0059_A11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0084_A09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
PTG01_0045_H12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0049_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0122_H06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
SMG01_0051_A01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0011_D03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0032_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0037_C02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0117_C08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0052_E04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0031_B12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0005_H11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0086_B11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0038_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0012_H07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTCCC*AGCACGGAAAA
LNG01_0012_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0027_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0028_H06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLTL1_0089_H10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0093_C05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0048_A06.b : GTTGGCATTGATCTTGGCACTAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0019_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0106_D03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0041_G08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCT*CC*AGCACGGAAAA
AMP01_0034_A05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLTL1_0031_D09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0067_B02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0009_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0069_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0062_F07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0093_G05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0016_E01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGGCTTCC*AGCACGGAAAA
AMP01_0028_G07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0063_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0035_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0023_E02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0128_F02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0031_H03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVR01_0060_D01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0004_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0006_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0032_F12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0066_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0136_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0032_A06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0044_H06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0008_H10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0017_D03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0033_D02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0022_D07.b : CTTGGAATTGATCTTGGCACCACACTATTCTTGTGTG*GGTGTCTTCCAAGCACGGAAAA
ITT01_0026_B03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0052_C08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0076_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0091_E09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0094_G10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0005_A03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0057_E10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0018_E03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0114_B12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0085_G08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0100_B05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0049_C11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SMG01_0035_A07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0100_H10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0108_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0033_C09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGCG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0061_H09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0096_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0073_B06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0025_H11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0017_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0077_F10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0052_A11.b : GTTGGCATTGATCTTGGTACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0059_B10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
AMP01_0025_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0098_H05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0114_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0098_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0066_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0072_H01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0094_C07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0090_H12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0084_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0042_E03.b : GATGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0097_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0017_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BKFL1_0012_F02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0016_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0054_C09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0080_G03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ITT01_0006_D01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0015_C04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0017_B06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LVR01_0026_E03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0137_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0070_F06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0035_F06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0069_B08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0034_E07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0103_E02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0095_H12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0035_H06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
HTMT1_0053_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0004_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ILNT1_0001_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0164_D02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0051_B03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0002_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0067_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0120_F08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0021_A09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0017_C08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0068_E11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0022_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SPLT1_0017_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0092_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0009_C09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0013_D09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0090_F09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
CBLT1_0008_C05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLTL1_0045_C08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0053_A05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
BFLT1_0074_F02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0093_C04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0025_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0070_D08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0063_H09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0023_A05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*AGTGTCTTCC*AGCACGGAAAA
ITT01_0038_E04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SKNB1_0074_A02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0068_G05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0088_E11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0091_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0061_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0093_E02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0094_H09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0082_D11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0053_C01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LVRM1_0169_A12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
THY01_0111_G02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0113_B01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0058_A03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0175_D12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0007_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVRM1_0202_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
OVR01_0078_A12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*GGCCCGGAAAA
OVRM1_0010_G09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0079_H09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0050_B05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0072_G07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0049_F01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0045_F03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0028_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0109_B07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0077_A07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0128_F06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0104_C11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0069_C03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0026_G12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0119_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0141_B02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTCGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0087_H08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
SKNB1_0034_G06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0099_D01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
PBL01_0105_H03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0099_B02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0085_E03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0028_C05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0081_B04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0055_B04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
THY01_0088_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LVR01_0055_D02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0100_F09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0106_B09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0039_B12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0058_B04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0030_B12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
TCH01_0094_A01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
LNG01_0069_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0050_D08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0100_D09.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
UTR01_0095_F11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0012_B11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
SKNB1_0015_H05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BFLT1_0002_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVR01_0049_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0055_C12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PBL01_0090_E04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
AMP01_0099_B02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0049_E06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0021_B05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0014_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0013_E12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0223_D07.b : GTTGGCGTTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0091_A07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0064_G01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
KDN01_0064_D04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
KDN01_0015_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0065_D02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
PST01_0095_F12.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PST01_0082_A08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRT1_0029_G08.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0001_E05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
MLN01_0092_G11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0052_D06.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
PST01_0077_B03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
HTMT1_0117_F01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0101_H11.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
BMWN1_0081_A10.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0074_A03.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
PTG01_0073_B07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0028_H07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
KDN01_0049_F04.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTTTTCC*AGCACGGAAAA
BMWN1_0028_B07.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0029_D02.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
OVRM1_0113_E05.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
UTR01_0084_C01.b : GTTGGCATTGATCTTGGCACCAC*CTATTCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
ADR01_0018_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0033_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTG*GGTGTCTTCC*AGTACGGAAAA
ADR01_0058_G02.b : nnnnngctacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b : cxxxxxxxxxxxxxx
AMP01_0002_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
---------+---------+---------+---------+---------+---------+ 241
DCI01_0078_G12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0073_E08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0056_B02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0049_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0071_B01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0036_C06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0079_C07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
UTR01_0012_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0084_H05.b : GTGGAAATAATTGCTAATGATCAGGAGAACCGAACCACCCCAAGCTATGTTGACTTTACT
HTMT1_0127_E05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0071_B03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0061_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0021_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0043_D05.b : GTGGAAATAATTGGGGAGGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0025_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0040_C03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0070_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0092_D08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0103_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0011_C01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0086_D05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0119_C01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0013_F07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0070_E07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CLNT1_0145_D06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LVR01_0082_E10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0070_D12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0102_D07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LVR01_0079_E07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0021_C11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0030_F06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0065_H08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0016_C07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0052_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0020_E07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0096_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCC*AGCTATGTTGCCTTNACT
HTMT1_0141_B05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0133_C10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0063_G05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPL01_0039_H07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0036_F05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0088_D05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0105_C09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0004_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0006_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0046_C06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0010_D08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0203_H03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0049_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0125_B12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0027_E01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPL01_0024_F01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0088_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CLNT1_0144_F11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0115_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0147_D07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0074_C06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0011_H07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0066_E10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0037_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0001_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0079_C04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0097_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0029_D12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0027_G07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0040_F04.b : GTGGAAATAATTGCTAGGGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0060_G12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0012_C10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0026_H01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0014_E04.b : GTGGATATAATTGCTAATGATCAGGGGAACCCAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0009_B05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0034_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0012_B04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0029_H08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0007_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0013_B08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0070_E03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0029_A07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0012_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0121_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0020_G06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0060_G08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0012_H02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0098_A05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0041_D06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0081_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0018_A06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0050_G07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0053_C10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0016_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0062_E05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0069_G12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0099_A03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCGCCCCAAGCTATGCTGCCTTTACT
AMP01_0055_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLTL1_0077_A02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGTTATGTTGCCTTTACT
AMP01_0048_F09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0022_F02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0001_D05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0052_D09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CLNT1_0141_G06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0025_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0119_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0013_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0093_E08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0010_C01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0075_E02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLTL1_0053_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0086_C11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0010_D01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0098_H11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0003_E05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0046_B08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0066_H05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0025_H03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0044_B11.b : GTGGAAATAATTGCTAAGGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0002_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0064_E07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0033_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0026_F04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0059_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0098_H08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0005_A09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0072_F11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0006_A09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0052_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAATCACCCCAAGCCATGTTGCCTTTACT
HTMT1_0046_A04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0024_E08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0062_E03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0033_H04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0112_B07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0012_A02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0081_C04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0001_E08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0010_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0074_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0073_A07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0002_B08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0017_G08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0066_F11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0102_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0027_F06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0036_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0225_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0058_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0076_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0090_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCCCCCCAAGCTATGTTGCCTTTACT
OVRM1_0171_E10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0111_H12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0217_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0117_B08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0059_A11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0084_A09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0045_H12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0049_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0122_H06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0051_A01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0011_D03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0032_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0037_C02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0117_C08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0052_E04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0031_B12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0005_H11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0086_B11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0038_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0012_H07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0012_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0027_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0028_H06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLTL1_0089_H10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0093_C05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0048_A06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0019_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0106_D03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0041_G08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0034_A05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTCACT
MLTL1_0031_D09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0067_B02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCTAAGCTATGTTGCCTTTACT
DCI01_0009_G06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0069_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0062_F07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0093_G05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0016_E01.b : GTGGAAATGATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGCTGCCTTTACT
AMP01_0028_G07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0063_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0035_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SMG01_0023_E02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0128_F02.b : GTGGAAATAATTGCTAATGATCGGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0031_H03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0060_D01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0004_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0006_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0032_F12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0066_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0136_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0032_A06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0044_H06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0008_H10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0017_D03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0033_D02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0022_D07.b : GTGGAAATAATTGCTAATGATCATGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0026_B03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0052_C08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0076_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0091_E09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0094_G10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0005_A03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0057_E10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0018_E03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0114_B12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0085_G08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0100_B05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0049_C11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACC
SMG01_0035_A07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0100_H10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0108_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0033_C09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0061_H09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0096_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0073_B06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0025_H11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0017_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0077_F10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0052_A11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGCTGCCTTTACT
KDN01_0059_B10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0025_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0098_H05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0114_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0098_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0066_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0072_H01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0094_C07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0090_H12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0084_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0042_E03.b : GTGTAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0097_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0017_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BKFL1_0012_F02.b : GTGGAAATAATTGCTAGTGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0016_G06.b : GCGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0054_C09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0080_G03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0006_D01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0015_C04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0017_B06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LVR01_0026_E03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0137_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0070_F06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0035_F06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0069_B08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0034_E07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0103_E02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0095_H12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0035_H06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0053_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0004_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ILNT1_0001_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0164_D02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0051_B03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCNAGCTATGTTGCCTTTACT
AMP01_0002_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0067_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0120_F08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0021_A09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0017_C08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0068_E11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0022_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SPLT1_0017_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0092_G06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0009_C09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0013_D09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0090_F09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
CBLT1_0008_C05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLTL1_0045_C08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0053_A05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0074_F02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0093_C04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0025_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0070_D08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0063_H09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0023_A05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ITT01_0038_E04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SKNB1_0074_A02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0068_G05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0088_E11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0091_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0061_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0093_E02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0094_H09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0082_D11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0053_C01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LVRM1_0169_A12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0111_G02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0113_B01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0058_A03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0175_D12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0007_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0202_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0078_A12.b : GTGGAAAAAATTGCTAATGATCATGGGAACCAAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0010_G09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0079_H09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0050_B05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0072_G07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0049_F01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0045_F03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0028_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0109_B07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0077_A07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0128_F06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0104_C11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0069_C03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0026_G12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0119_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0141_B02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0087_H08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SKNB1_0034_G06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0099_D01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0105_H03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0099_B02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0085_E03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0028_C05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0081_B04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0055_B04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
THY01_0088_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LVR01_0055_D02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0100_F09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0106_B09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0039_B12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0058_B04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0030_B12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
TCH01_0094_A01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
LNG01_0069_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0050_D08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0100_D09.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
UTR01_0095_F11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0012_B11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
SKNB1_0015_H05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BFLT1_0002_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVR01_0049_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0055_C12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PBL01_0090_E04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0099_B02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0049_E06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0021_B05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0014_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0013_E12.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0223_D07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0091_A07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0064_G01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0064_D04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0015_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0065_D02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0095_F12.b : GTGGAAATGATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0082_A08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRT1_0029_G08.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0001_E05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
MLN01_0092_G11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0052_D06.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PST01_0077_B03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
HTMT1_0117_F01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0101_H11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGCACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0081_A10.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0074_A03.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
PTG01_0073_B07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0028_H07.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
KDN01_0049_F04.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
BMWN1_0028_B07.b : ATGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0029_D02.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0113_E05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
UTR01_0084_C01.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0018_C11.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
DCI01_0033_D05.b : GTGGAAATAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
ADR01_0058_G02.b : xxxxxxxTAATTGCTAATGATCAGGGGAACCGAACCACCCCAAGCTATGTTGCCTTTACT
AMP01_0070_B08.b : xxxxxxxxAATTGCTAATGATCAGGGGAACCAAACCACCCCAAGCTATGTTGCCTTTACT
OVRM1_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCCTTTACT
AMP01_0002_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACT
AMP01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
---------+---------+---------+---------+---------+---------+ 299
DCI01_0078_G12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0073_E08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0056_B02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0049_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0071_B01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0036_C06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0079_C07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
UTR01_0012_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0084_H05.b : GATACTGAACGATTGATTGATGATGCTGCGAAGA*ACCTACTTGCG*ATGAATCCCACCA
HTMT1_0127_E05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0071_B03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0061_G11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0021_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0043_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0025_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0040_C03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0070_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0092_D08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0103_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0011_C01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0086_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0119_C01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0013_F07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0070_E07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CLNT1_0145_D06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LVR01_0082_E10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0070_D12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0102_D07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LVR01_0079_E07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0021_C11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0030_F06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0065_H08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0016_C07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0052_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0020_E07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0096_D04.b : GATACTGAACGATTGATTGGTGATGCTGCNAAGA*AACCAGTTGCG*AAGNATCCCACCC
HTMT1_0141_B05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0133_C10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0063_G05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPL01_0039_H07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0036_F05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0088_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0105_C09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0004_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0006_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0046_C06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0010_D08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0203_H03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0049_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0125_B12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0027_E01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPL01_0024_F01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0088_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CLNT1_0144_F11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0115_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0147_D07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0074_C06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0011_H07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0066_E10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0037_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0001_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0079_C04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0097_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*AC*AAGTTGCG*ATGAANTCCCACC
BMWN1_0029_D12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0027_G07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0040_F04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0060_G12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0012_C10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0026_H01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0014_E04.b : GATACTGAACGATTGATTGGTGATGCTGCTAAGA*ACCAATTTGCG*ATGAATCCCACCA
AMP01_0009_B05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0034_A08.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0012_B04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0029_H08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0007_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0013_B08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0070_E03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0029_A07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0012_A08.b : GATACTGAACGATTGATTGGTGATGCTGCCAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0121_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0020_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0060_G08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0012_H02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0098_A05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0041_D06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0081_B10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0018_A06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0050_G07.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0053_C10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0016_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0062_E05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0069_G12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0099_A03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0055_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAACA*ACCCACTTGCG*ATGAATCCCAACA
MLTL1_0077_A02.b : GATACTGAACGATTGATTGGTGGTGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0048_F09.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0022_F02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0001_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0052_D09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CLNT1_0141_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0025_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0119_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0013_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0093_E08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0010_C01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0075_E02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLTL1_0053_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0086_C11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0010_D01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0098_H11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0003_E05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0046_B08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0066_H05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0025_H03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0044_B11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0002_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0064_E07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0033_B10.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0026_F04.b : GATACAGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0059_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0098_H08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0005_A09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0072_F11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0006_A09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0052_B09.b : GATACTGAGCGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0046_A04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0024_E08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0062_E03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0033_H04.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0112_B07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0012_A02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0081_C04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0001_E08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0010_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0074_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0073_A07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0002_B08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0017_G08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0066_F11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0102_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0027_F06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0036_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0225_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0058_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0076_B10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0090_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0171_E10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0111_H12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0217_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0117_B08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0059_A11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0084_A09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0045_H12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0049_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0122_H06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0051_A01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0011_D03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0032_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0037_C02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0117_C08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0052_E04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0031_B12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0005_H11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0086_B11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0038_B10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0012_H07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0012_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0027_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0028_H06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLTL1_0089_H10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0093_C05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0048_A06.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0019_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0106_D03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0041_G08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0034_A05.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLTL1_0031_D09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0067_B02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0009_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0069_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0062_F07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0093_G05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0016_E01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0028_G07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0063_B10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0035_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0023_E02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0128_F02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0031_H03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0060_D01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0004_G11.b : GATACTGAATGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0006_G11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0032_F12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0066_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0136_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0032_A06.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0044_H06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0008_H10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0017_D03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0033_D02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0022_D07.b : GATACTGAACAATTGATTGGTGATGCTGCGAAGAGACCAAGTTGCTCATGAATCCCACCA
ITT01_0026_B03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0052_C08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0076_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0091_E09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0094_G10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0005_A03.b : GATACTTAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0057_E10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0018_E03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0114_B12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0085_G08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0100_B05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCC*ACCA
AMP01_0049_C11.b : GATACTGAACGATTGATTGGTGATGCTGCNAAAA*ACCAAGTTGCG*ATGAATCCCACCA
SMG01_0035_A07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0100_H10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0108_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0033_C09.b : GATACTGAACGATTGATTGGTGATGCTGCAAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0061_H09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0096_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0073_B06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0025_H11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0017_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0077_F10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0052_A11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0059_B10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0025_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0098_H05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0114_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0098_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0066_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0072_H01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0094_C07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0090_H12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0084_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0042_E03.b : GATACTGAACGATTGATAGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCG
AMP01_0097_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0017_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BKFL1_0012_F02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0016_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0054_C09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0080_G03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0006_D01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0015_C04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCT*ATGAATCCCACCA
BMWN1_0017_B06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LVR01_0026_E03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0137_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0070_F06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0035_F06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0069_B08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0034_E07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0103_E02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0095_H12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0035_H06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0053_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0004_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ILNT1_0001_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0164_D02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0051_B03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0002_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0067_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0120_F08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0021_A09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0017_C08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0068_E11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0022_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SPLT1_0017_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0092_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0009_C09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0013_D09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0090_F09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
CBLT1_0008_C05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLTL1_0045_C08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0053_A05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0074_F02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0093_C04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0025_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0070_D08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0063_H09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0023_A05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ITT01_0038_E04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SKNB1_0074_A02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0068_G05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0088_E11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0091_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0061_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0093_E02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0094_H09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0082_D11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0053_C01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LVRM1_0169_A12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0111_G02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0113_B01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0058_A03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0175_D12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ACGAATCCCACCA
THY01_0007_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0202_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0078_A12.b : GATACTGAACGATTGATTGGTGATGCTGCCAATA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0010_G09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0079_H09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0050_B05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0072_G07.b : GATACTGAACGATTGATTGGTGATGCTGCCAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0049_F01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0045_F03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0028_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0109_B07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0077_A07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0128_F06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0104_C11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0069_C03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0026_G12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0119_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGCTGCG*ATGAATCCCACCA
OVRT1_0141_B02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAATTTGCG*ATGAATCCCACCA
PBL01_0087_H08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SKNB1_0034_G06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0099_D01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0105_H03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0099_B02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0085_E03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0028_C05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0081_B04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0055_B04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
THY01_0088_G11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LVR01_0055_D02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0100_F09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0106_B09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0039_B12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0058_B04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0030_B12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
TCH01_0094_A01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
LNG01_0069_G11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0050_D08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0100_D09.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
UTR01_0095_F11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0012_B11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
SKNB1_0015_H05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BFLT1_0002_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVR01_0049_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0055_C12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PBL01_0090_E04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0099_B02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0049_E06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0021_B05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0014_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0013_E12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0223_D07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0091_A07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0064_G01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0064_D04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0015_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0065_D02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCTCACCA
PST01_0095_F12.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0082_A08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRT1_0029_G08.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0001_E05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
MLN01_0092_G11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0052_D06.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PST01_0077_B03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
HTMT1_0117_F01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0101_H11.b : GATACTGAACGATTGATTGGTGATACTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0081_A10.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0074_A03.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
PTG01_0073_B07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0028_H07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
KDN01_0049_F04.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
BMWN1_0028_B07.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0029_D02.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
OVRM1_0113_E05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
UTR01_0084_C01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0018_C11.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
DCI01_0033_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
ADR01_0058_G02.b : GATACTGAACGATTGATTGGTAATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0070_B08.b : GATACTGAACGATTGATTGGGGATGCTGCAAACA*ACCAAGTTGAG*ATGAATCCCACCA
OVRM1_0071_D05.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCA
AMP01_0002_H01.b : GATACTGAACGATTGATTGGTGATGCTGCGAAGA*ACCAAGTTGCG*ATGAATCCCACCG
AMP01_0039_G04.b : xxxxxxxxxCGATTGATTGGTGATGCTGCCAAAA*ACCAAGTTGCG*ATGAATCCCCCCC
TCH01_0060_C01.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_F08.b : gcttttagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0058_F12.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
TCH01_0056_B04.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_G07.b : cagttgtcxxxxxxxxxxx
BFLT1_0003_F02.b : gggattcgttagctgtcgxxxx
PTG01_0106_B09.b :
DCI01_0033_H03.b : nnttaacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0078_G06.b :
AMP01_0075_F04.b : ngggatatantataggatacttxxxxxxxxxx
LNG01_0005_G07.b :
DCI01_0030_D02.b : nn
MLTL1_0008_H10.b : nnnnnnnnnnnnnnnn
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
---------+---------+---------+---------+---------+---------+ 359
DCI01_0078_G12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0073_E08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0056_B02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0049_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTATTGTCCAGT
ILNT1_0071_B01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0036_C06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0079_C07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
UTR01_0012_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0084_H05.b : ACACGGTTTTTGATGCCGAACGCCTCATTGAACAAATATTTGATGATGCTGTTGTCCATT
HTMT1_0127_E05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0071_B03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0061_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0021_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0043_D05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0025_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0040_C03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0070_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0092_D08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0103_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0011_C01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0086_D05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0119_C01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0013_F07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0070_E07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CLNT1_0145_D06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LVR01_0082_E10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0070_D12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0102_D07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LVR01_0079_E07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0021_C11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0030_F06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0065_H08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0016_C07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0052_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0020_E07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0096_D04.b : ACCCGTTTTTTGATGGCAAcccccccatggacaaaaatttaggatgcggtggcccaaccg
HTMT1_0141_B05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0133_C10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0063_G05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPL01_0039_H07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCGGT
SMG01_0036_F05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0088_D05.b : ACACGGTTTTTGATGCCGAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0105_C09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0004_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0006_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0046_C06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0010_D08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0203_H03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0049_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0125_B12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0027_E01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPL01_0024_F01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0088_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CLNT1_0144_F11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0115_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0147_D07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0074_C06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0011_H07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0066_E10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0037_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0001_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0079_C04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0097_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0029_D12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0027_G07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0040_F04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0060_G12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0012_C10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0026_H01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0014_E04.b : ACACCGTTTTTGATGCCAAACGCCTCATTGGACGAACATTTGATGATGCTGTTGTCCAGT
AMP01_0009_B05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0034_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0012_B04.b : ACACGGTTTTTGATGCCCAACGCCTCAATGGACCAAGATTTGATGATGCTGGTGTCCAGT
BMWN1_0029_H08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0007_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0013_B08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0070_E03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0029_A07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0012_A08.b : ACACGGTTTTTGATGCCCAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0121_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0020_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0060_G08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0012_H02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0098_A05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0041_D06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0081_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0018_A06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCTGT
AMP01_0050_G07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0053_C10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0016_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0062_E05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTCGTCCAGT
AMP01_0069_G12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0099_A03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0055_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAACATTTGATGATGCTGTTGTCCACT
MLTL1_0077_A02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0048_F09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCTGT
AMP01_0022_F02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0001_D05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0052_D09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CLNT1_0141_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0025_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0119_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0013_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0093_E08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0010_C01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0075_E02.b : ACGCGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLTL1_0053_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0086_C11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0010_D01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0098_H11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0003_E05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0046_B08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0066_H05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0025_H03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0044_B11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0002_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0064_E07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0033_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0026_F04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0059_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0098_H08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0005_A09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0072_F11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0006_A09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0052_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0046_A04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0024_E08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0062_E03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0033_H04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0112_B07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0012_A02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0081_C04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0001_E08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0010_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0074_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTCGATGATGCTGTTGTCCAGT
DCI01_0073_A07.b : ACACGGTTTTTGATACCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0002_B08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0017_G08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0066_F11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0102_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0027_F06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0036_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0225_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0058_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0076_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0090_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0171_E10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0111_H12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0217_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0117_B08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0059_A11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0084_A09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGGCGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0045_H12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0049_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0122_H06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0051_A01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0011_D03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0032_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0037_C02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0117_C08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0052_E04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0031_B12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0005_H11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0086_B11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0038_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGCCCAGT
DCI01_0012_H07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0012_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0027_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0028_H06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLTL1_0089_H10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0093_C05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0048_A06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0019_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0106_D03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0041_G08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0034_A05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLTL1_0031_D09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0067_B02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0009_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0069_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0062_F07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0093_G05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0016_E01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0028_G07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0063_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0035_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0023_E02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0128_F02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0031_H03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0060_D01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0004_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0006_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0032_F12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0066_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0136_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0032_A06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0044_H06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0008_H10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0017_D03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0033_D02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0022_D07.b : GCACGGTTTTTGATGACAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAAT
ITT01_0026_B03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0052_C08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0076_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGGTTTGATGATGCTGTTGTCCAGT
LNG01_0091_E09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0094_G10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0005_A03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0057_E10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0018_E03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0114_B12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0085_G08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0100_B05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0049_C11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SMG01_0035_A07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0100_H10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0108_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0033_C09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0061_H09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0096_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0073_B06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0025_H11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0017_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0077_F10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0052_A11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0059_B10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0025_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0098_H05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0114_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0098_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0066_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0072_H01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0094_C07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0090_H12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0084_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0042_E03.b : ACACGGCTTTTGATGCCAAACGCCTCATTGGACGAACATTTGATGATGCTGATGTCCACT
AMP01_0097_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0017_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BKFL1_0012_F02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0016_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0054_C09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0080_G03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0006_D01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0015_C04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0017_B06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LVR01_0026_E03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0137_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0070_F06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0035_F06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0069_B08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0034_E07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0103_E02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0095_H12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0035_H06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0053_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0004_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ILNT1_0001_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0164_D02.b : ACACGGTTTTTGATGCCAAACGCCCCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0051_B03.b : ACACGGTTTTTGATGCCNAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0002_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0067_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0120_F08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0021_A09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0017_C08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0068_E11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0022_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SPLT1_0017_G01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0092_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0009_C09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0013_D09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0090_F09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
CBLT1_0008_C05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLTL1_0045_C08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0053_A05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0074_F02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0093_C04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0025_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0070_D08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0063_H09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0023_A05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ITT01_0038_E04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SKNB1_0074_A02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0068_G05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0088_E11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0091_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0061_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0093_E02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0094_H09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0082_D11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0053_C01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LVRM1_0169_A12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACAAAAATTTGATGATGCTGTTGTCCAGT
THY01_0111_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0113_B01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0058_A03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0175_D12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGAT*TGATGATGCTGTTGTCCAGT
THY01_0007_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGCACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0202_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0078_A12.b : ACACCGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0010_G09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0079_H09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0050_B05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0072_G07.b : ACACGGTTTTTGATGCCCAACCCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0049_F01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0045_F03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0028_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0109_B07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0077_A07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0128_F06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0104_C11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0069_C03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0026_G12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0119_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0141_B02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0087_H08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SKNB1_0034_G06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0099_D01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0105_H03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0099_B02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0085_E03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0028_C05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0081_B04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0055_B04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
THY01_0088_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LVR01_0055_D02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0100_F09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0106_B09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0039_B12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0058_B04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0030_B12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
TCH01_0094_A01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
LNG01_0069_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0050_D08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0100_D09.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
UTR01_0095_F11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0012_B11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
SKNB1_0015_H05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BFLT1_0002_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0049_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0055_C12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PBL01_0090_E04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0099_B02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0049_E06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0021_B05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0014_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0013_E12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0223_D07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0091_A07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0064_G01.b : ACACGGTTTTTGATGCCAAACGCCTCGTTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0064_D04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0015_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGGTTTGATGATGCTGTTGTCCAGT
KDN01_0065_D02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0095_F12.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0082_A08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRT1_0029_G08.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0001_E05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
MLN01_0092_G11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0052_D06.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PST01_0077_B03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
HTMT1_0117_F01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0101_H11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0081_A10.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0074_A03.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
PTG01_0073_B07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0028_H07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
KDN01_0049_F04.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
BMWN1_0028_B07.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0029_D02.b : ACACGGTTTTTGATACCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVRM1_0113_E05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
UTR01_0084_C01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0018_C11.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
DCI01_0033_D05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
ADR01_0058_G02.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0070_B08.b : ACACGGTTTTTGATGCCAAACCCCTCATTGGACAAAAATTTGATGATGCTGTTGTCCAGT
OVRM1_0071_D05.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0002_H01.b : ACACGGTTTTTGATGCCAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
AMP01_0039_G04.b : GCACGGTTTTTGATGCCAAACCCCTCATTGGACAAAAATTTGATGATGCTGTTGTCCAGT
TCH01_0060_C01.b : xxxxxxxxxxxxxxactAAACGCCTCATTGGACGAAGATTTGATGATGCTGTTGTCCAGT
OVR01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTTGATGATGCTGTTGTCCAGT
TCH01_0058_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGATGATGCTGTTGTCCAGT
TCH01_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGATGATGCTGTTGTCCAGT
OVRM1_0085_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATGATGCTGTTGTCCAGT
BFLT1_0003_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGTCCAGT
PTG01_0106_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0033_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0078_G06.b : nn
AMP01_0075_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_G07.b :
DCI01_0030_D02.b : ggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H01.b : nnttttcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F10.b : atatttagcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
OVRT1_0142_H12.b :
AMP01_0044_D05.b : atcccctttaggatact
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
---------+---------+---------+---------+---------+---------+ 419
DCI01_0078_G12.b : CTGATATGAAGCATTGGCTCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0073_E08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0056_B02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0049_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0071_B01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0036_C06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0079_C07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
UTR01_0012_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0084_H05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAAGCAGGCATAACGTCCAAG
HTMT1_0127_E05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0071_B03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0061_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0021_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0043_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0025_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0040_C03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0070_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0092_D08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0103_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0011_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0086_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0119_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0013_F07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0070_E07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CLNT1_0145_D06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LVR01_0082_E10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0070_D12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0102_D07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LVR01_0079_E07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0021_C11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0030_F06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0065_H08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0016_C07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0052_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0020_E07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0096_D04.b : aaaagaacacatggcccttcccgggggggaaaaaaacccagcccgccctaaggtcccatt
HTMT1_0141_B05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0133_C10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0063_G05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPL01_0039_H07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0036_F05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0088_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0105_C09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0004_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0006_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0046_C06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0010_D08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0203_H03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0049_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0125_B12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0027_E01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPL01_0024_F01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCTGGCAGGCCTAAGGTCCAAG
ILNT1_0088_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CLNT1_0144_F11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0115_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0147_D07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0074_C06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0011_H07.b : CTGATATGAAGTATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0066_E10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0037_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0001_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0079_C04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0097_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCANGCAGGCCTAAGGTCCAAG
BMWN1_0029_D12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0027_G07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0040_F04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0060_G12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0012_C10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0026_H01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0014_E04.b : CTGATATGAAGCATTGGCCCTTCATGGTGGTGAATGATGCACGCAGGCCTAAGGTCCAAG
AMP01_0009_B05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0034_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0012_B04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAAGCCTAAAGTCCAAG
BMWN1_0029_H08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0007_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0013_B08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0070_E03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0029_A07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0012_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCANGCAGGCCTAAGGTCCAAG
HTMT1_0121_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0020_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0060_G08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCANGCAGGCCTAAGGTCCAAG
AMP01_0012_H02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0098_A05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0041_D06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0081_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0018_A06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0050_G07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0053_C10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0016_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0062_E05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCNAG
AMP01_0069_G12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0099_A03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0055_E06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCCCG
MLTL1_0077_A02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0048_F09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0022_F02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0001_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0052_D09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CLNT1_0141_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0025_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0119_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0013_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0093_E08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0010_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0075_E02.b : CTGATATGAAGCATTGACCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLTL1_0053_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0086_C11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0010_D01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0098_H11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0003_E05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0046_B08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0066_H05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0025_H03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0044_B11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0002_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0064_E07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0033_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0026_F04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCGGGCCTAAGGTCCAAG
HTMT1_0059_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0098_H08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0005_A09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0072_F11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0006_A09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0052_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCGGGCCTAAGGTCCAAG
HTMT1_0046_A04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0024_E08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0062_E03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0033_H04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0112_B07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0012_A02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0081_C04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0001_E08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0010_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0074_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0073_A07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0002_B08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0017_G08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0066_F11.b : CTGATATGAAGCATTGGCCCTTCCTGGTGGTGAATGATGCAAGCAGGCCTAATGTCCAAG
THY01_0102_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0027_F06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCATGCAGGCCTAAGGTCCAAG
OVRM1_0036_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0225_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0058_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATACAGGCAGGCCTAAGGTCCAAG
OVR01_0076_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0090_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0171_E10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0111_H12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0217_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0117_B08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0059_A11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0084_A09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0045_H12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0049_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0122_H06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0051_A01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0011_D03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0032_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0037_C02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0117_C08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0052_E04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0031_B12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0005_H11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0086_B11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0038_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0012_H07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCATGCAGGCCTAAGGTCCAAG
LNG01_0012_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0027_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0028_H06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLTL1_0089_H10.b : CTGATATGAAGCATTGGCCCTTCGTGGTG*TGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0093_C05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0048_A06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0019_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0106_D03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0041_G08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0034_A05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTTCAAG
MLTL1_0031_D09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0067_B02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0009_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0069_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0062_F07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0093_G05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0016_E01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0028_G07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0063_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0035_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SMG01_0023_E02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0128_F02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0031_H03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0060_D01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0004_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0006_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0032_F12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0066_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0136_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0032_A06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0044_H06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0008_H10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0017_D03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0033_D02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0022_D07.b : CTGATATGAAGCATTGGCCCTTCCTGGTGGTGAATGATGCATGCAGGCCTAAAGTCCAAG
ITT01_0026_B03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0052_C08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0076_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0091_E09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0094_G10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0005_A03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0057_E10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0018_E03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0114_B12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0085_G08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0100_B05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0049_C11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGGTCCAG
SMG01_0035_A07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0100_H10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCGAG
LNG01_0108_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0033_C09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0061_H09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0096_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0073_B06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0025_H11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0017_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0077_F10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0052_A11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0059_B10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0025_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0098_H05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0114_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0098_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0066_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0072_H01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATACAGGCAGGCCTAAGGTCCAAG
DCI01_0094_C07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0090_H12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0084_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0042_E03.b : CTGATATGAAGCATTGGGCCTTCTGGGTGGTGAATGATGCAAGCAGGCCTAAGGTCCAAG
AMP01_0097_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0017_E06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BKFL1_0012_F02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0016_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0054_C09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0080_G03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0006_D01.b : CTGCTATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0015_C04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0017_B06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LVR01_0026_E03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0137_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0070_F06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0035_F06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0069_B08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0034_E07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0103_E02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0095_H12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0035_H06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0053_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0004_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ILNT1_0001_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0164_D02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0051_B03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0002_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0067_E06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0120_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0021_A09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0017_C08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0068_E11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0022_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SPLT1_0017_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0092_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0009_C09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0013_D09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0090_F09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
CBLT1_0008_C05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLTL1_0045_C08.b : CTGATATGAAGCATCGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0053_A05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0074_F02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCCAAGGTCCAAG
AMP01_0093_C04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0025_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0070_D08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0063_H09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0023_A05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ITT01_0038_E04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SKNB1_0074_A02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0068_G05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0088_E11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0091_E06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0061_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0093_E02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0094_H09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0082_D11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0053_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LVRM1_0169_A12.b : CCGATATGAAACATTGGCCCTTCGTGGTGGTGAATGATGCAAGCAAGCCCAAAGTCCAAG
THY01_0111_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0113_B01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0058_A03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0175_D12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0007_E06.b : CTGATATGAAGCATTGGCCCTTCGCGGTGGTGAATGATGCACGCAGGCCTAAGGTCTCAG
OVRM1_0202_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0078_A12.b : CTGATATGAAACATTGGCCCCTCGGGGTGGTGAATGATGCAGGCACGCCTAAGGTCCTAG
OVRM1_0010_G09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0079_H09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0050_B05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0072_G07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCCAG
PTG01_0049_F01.b : CTGATGTGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0045_F03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0028_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0109_B07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0077_A07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0128_F06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0104_C11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0069_C03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0026_G12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0119_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0141_B02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0087_H08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SKNB1_0034_G06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0099_D01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0105_H03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0099_B02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0085_E03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0028_C05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0081_B04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0055_B04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
THY01_0088_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LVR01_0055_D02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0100_F09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0106_B09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0039_B12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0058_B04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0030_B12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
TCH01_0094_A01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
LNG01_0069_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0050_D08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0100_D09.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
UTR01_0095_F11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0012_B11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
SKNB1_0015_H05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0002_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0049_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0055_C12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PBL01_0090_E04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0099_B02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0049_E06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0021_B05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0014_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0013_E12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0223_D07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0091_A07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0064_G01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0064_D04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0015_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0065_D02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0095_F12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0082_A08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRT1_0029_G08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0001_E05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
MLN01_0092_G11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0052_D06.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PST01_0077_B03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
HTMT1_0117_F01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0101_H11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BMWN1_0081_A10.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0074_A03.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0073_B07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0028_H07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
KDN01_0049_F04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCATGCAGGCCTAAGGTCCAAG
BMWN1_0028_B07.b : CTGATATGAAGCATTGGCCCTTCGAGGTGGTGAATGATGCAGGCAAGCCTAAGGTCCAAG
DCI01_0029_D02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0113_E05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
UTR01_0084_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0018_C11.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
DCI01_0033_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
ADR01_0058_G02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0070_B08.b : CAGATATGAAGCATTGGCCCTTCGTGATGGTGAATGATGCACGCACGCCTAATGTCCAAT
OVRM1_0071_D05.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0002_H01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
AMP01_0039_G04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCACGCAGGCCTAAAGTCCAAG
TCH01_0060_C01.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVR01_0074_F08.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
TCH01_0058_F12.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
TCH01_0056_B04.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
OVRM1_0085_G07.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
BFLT1_0003_F02.b : CTGATATGAAGCATTGGCCCTTCGTGGTGGTGAATGATGCAGGCAGGCCTAAGGTCCAAG
PTG01_0106_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaatgGATGCAGGCAGGCCTAAGGTCCAAN
DCI01_0033_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGCAGGCCTAAGGTCCAAG
PTG01_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0075_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_G07.b : gcgtttnccgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_H12.b : nnnccttattnnnnnnnnn
AMP01_0044_D05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0065_C04.b :
AMP01_0052_C07.b : nnnnccagataaataagggaatcnattgggct
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
---------+---------+---------+---------+---------+---------+ 475
DCI01_0078_G12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0073_E08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0056_B02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0049_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0071_B01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0036_C06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0079_C07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
UTR01_0012_G03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0084_H05.b : TAG*AATACAAGGG*ATAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0127_E05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0071_B03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0061_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0021_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0043_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0025_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0040_C03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0070_C12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0092_D08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0103_G03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0011_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0086_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0119_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0013_F07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0070_E07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CLNT1_0145_D06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LVR01_0082_E10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0070_D12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0102_D07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LVR01_0079_E07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0021_C11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0030_F06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0065_H08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0016_C07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0052_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0020_E07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0096_D04.b : taaaaaacccgggggaaaaacaaaaatttttctttcccaaaaaaaggtgttcctcccggg
HTMT1_0141_B05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0133_C10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0063_G05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPL01_0039_H07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0036_F05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0088_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0105_C09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0004_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0006_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0046_C06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0010_D08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0203_H03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0049_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0125_B12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0027_E01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPL01_0024_F01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0088_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CLNT1_0144_F11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0115_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGCCATCCAT*GGTT
HTMT1_0147_D07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0074_C06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0011_H07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0066_E10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0037_C12.b : TAG*AATACAAGGG*AGAGACAAAATGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0001_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0079_C04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0097_C12.b : TAG*AATACAAGGG*AAGAGACAAAAGTTTCTATCCAGA*GGAGGTGTCATCCATGGGTT
BMWN1_0029_D12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0027_G07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0040_F04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0060_G12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0012_C10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0026_H01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0014_E04.b : TAGCAATACAAGGG*AGAGACATAAAGTTTCTATCCAGA*GGATGTGTCATCCAT*GGTT
AMP01_0009_B05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0034_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0012_B04.b : TAG*AATACAAAGG*AGAGACAAAA*GTTTCTATCCAGA*AGGAGTGTCATCCAT*GGTT
BMWN1_0029_H08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0007_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0013_B08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0070_E03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0029_A07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0012_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0121_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0020_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0060_G08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0012_H02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0098_A05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0041_D06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0081_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0018_A06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0050_G07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0053_C10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0016_G03.b : TAG*AATACAAGGG*AGAGACGAAAAGTTTCTATCCAGA*GAAGGTGTCATCCAT*GGTT
AMP01_0062_E05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0069_G12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0099_A03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0055_E06.b : TAG*AATGCGAGGG*AGAGACACAAAGTTTCTATCCAGA*GGAGGTGTCGTCTGT*GGTT
MLTL1_0077_A02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0048_F09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0022_F02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0001_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0052_D09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CLNT1_0141_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0025_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0119_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0013_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0093_E08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0010_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0075_E02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0053_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0086_C11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0010_D01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0098_H11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0003_E05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0046_B08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0066_H05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0025_H03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0044_B11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0002_G03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0064_E07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0033_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0026_F04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0059_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0098_H08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0005_A09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0072_F11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0006_A09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0052_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0046_A04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0024_E08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0062_E03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0033_H04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0112_B07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0012_A02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0081_C04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0001_E08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0010_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0074_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0073_A07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0002_B08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0017_G08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0066_F11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCCT*GGTT
THY01_0102_B09.b : TAG*AATACAAGGG*AAAGACAAAAAGTTTCTATCCACA*GGAGGTGTCATCCAT*GGTT
OVRM1_0027_F06.b : TAG*AATACACGGG*ACAGACAAAAAGTTTCTATCCAGA*GGAGGTGCCATACAT*GGTT
OVRM1_0036_D11.b : TAG*AATACATGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0225_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0058_C12.b : TAGAAATACAGGGG*AGAGACA*AAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0076_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0090_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0171_E10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0111_H12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0217_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0117_B08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0059_A11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0084_A09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0045_H12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0049_D11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0122_H06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0051_A01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0011_D03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0032_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0037_C02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0117_C08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0052_E04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0031_B12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0005_H11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0086_B11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0038_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0012_H07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0012_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0027_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0028_H06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0089_H10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0093_C05.b : TAG*AATACAAGGG*AGGGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0048_A06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0019_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0106_D03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0041_G08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0034_A05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0031_D09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0067_B02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0009_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0069_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0062_F07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0093_G05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0016_E01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0028_G07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0063_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0035_D11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0023_E02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0128_F02.b : TAG*AACACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0031_H03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0060_D01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0004_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0006_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0032_F12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0066_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0136_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0032_A06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0044_H06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0008_H10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0017_D03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0033_D02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0022_D07.b : TAG*AATACAACGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGAT
ITT01_0026_B03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0052_C08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0076_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGCGTCATCCAT*GGTT
LNG01_0091_E09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0094_G10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0005_A03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0057_E10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0018_E03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0114_B12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0085_G08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0100_B05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0049_C11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SMG01_0035_A07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0100_H10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0108_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0033_C09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0061_H09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0096_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0073_B06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0025_H11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0017_C12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0077_F10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0052_A11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0059_B10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0025_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0098_H05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0114_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0098_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0066_D11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0072_H01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0094_C07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0090_H12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0084_G03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0042_E03.b : TAT*AATACAACGG*ACAGACAAAAAGTTTCTATCCAGA*GGAAGTGTCATCCAT*GGTT
AMP01_0097_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0017_E06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BKFL1_0012_F02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0016_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0054_C09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0080_G03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0006_D01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0015_C04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0017_B06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LVR01_0026_E03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0137_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0070_F06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTACCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0035_F06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0069_B08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0034_E07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0103_E02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0095_H12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0035_H06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0053_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0004_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ILNT1_0001_D11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0164_D02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0051_B03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCCGA*GGAGGTGTCATCCAT*GGTT
AMP01_0002_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0067_E06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0120_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0021_A09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0017_C08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0068_E11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0022_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SPLT1_0017_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0092_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0009_C09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0013_D09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0090_F09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
CBLT1_0008_C05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0045_C08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGCCATCCAT*GGTT
KDN01_0053_A05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0074_F02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0093_C04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0025_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0070_D08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0063_H09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0023_A05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ITT01_0038_E04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SKNB1_0074_A02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0068_G05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0088_E11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0091_E06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0061_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0093_E02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0094_H09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0082_D11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0053_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LVRM1_0169_A12.b : TAG*AATACAAGGGcagagaaaaacagttgtctaccaagacgacgtgtaatcaatggttt
THY01_0111_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0113_B01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0058_A03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0175_D12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0007_E06.b : TAG*AATACAAGGG*AGAGACAAAAAGCTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0202_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0078_A12.b : TAT*AATGCAAGGG*ACAGACAAAAAGTTTCTATCCCCA*GGACGTGTCATCCAT*GGTT
OVRM1_0010_G09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0079_H09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0050_B05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0072_G07.b : TAG*AATACAAGGG*AGAGACCAAAAGTTTCTATCCCGA*GGAGGTGTCATCCAT*GGTT
PTG01_0049_F01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0045_F03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0028_C12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0109_B07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0077_A07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0128_F06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0104_C11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0069_C03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0026_G12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0119_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0141_B02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0087_H08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SKNB1_0034_G06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0099_D01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0105_H03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0099_B02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0085_E03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGATGTGTCATCCAT*GGTT
PST01_0028_C05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAAA*GGAGGTGTCATCCAT*GGTT
OVRT1_0081_B04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0055_B04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
THY01_0088_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LVR01_0055_D02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0100_F09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0106_B09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0039_B12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0058_B04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0030_B12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
TCH01_0094_A01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0069_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0050_D08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0100_D09.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
UTR01_0095_F11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0012_B11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
SKNB1_0015_H05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0002_C12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0049_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0055_C12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PBL01_0090_E04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0099_B02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0049_E06.b : TAG*AATACAAGGG*AGAGGCAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0021_B05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0014_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0013_E12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0223_D07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0091_A07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0064_G01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0064_D04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0015_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0065_D02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0095_F12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0082_A08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRT1_0029_G08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0001_E05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
MLN01_0092_G11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0052_D06.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PST01_0077_B03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
HTMT1_0117_F01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0101_H11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0081_A10.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0074_A03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0073_B07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0028_H07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
KDN01_0049_F04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BMWN1_0028_B07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0029_D02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0113_E05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
UTR01_0084_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0018_C11.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0033_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
ADR01_0058_G02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0070_B08.b : TAA*AATACAAGGG*AGAGACAAAACGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0071_D05.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0002_H01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
AMP01_0039_G04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
TCH01_0060_C01.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVR01_0074_F08.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
TCH01_0058_F12.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
TCH01_0056_B04.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
OVRM1_0085_G07.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
BFLT1_0003_F02.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0106_B09.b : TAG*AATACAAGGGGAGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCATGGGTT
DCI01_0033_H03.b : TAG*AATACAAGGG*AGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
PTG01_0078_G06.b : nnnnnnncaagGGN*AGAGACAAAAAGTTTCTATCCAGAAGGAGGTGTCATCCATGGNTT
AMP01_0075_F04.b : xxxxxxxxxxxxxxxAGAGACAAAAAGTTTCTATCCAGA*GGAGGTGTCATCCAT*GGTT
LNG01_0005_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxacggTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0030_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*GGAGGTGTCATCCAT*GGTT
AMP01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
OVRT1_0142_H12.b : ccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A12.b : gcatttagctgxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0092_E06.b : nttctt
MLN01_0041_H04.b : nnnttactagtaca
MLTL1_0049_C05.b : nnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0065_C04.b : nnnnaactagga
AMP01_0052_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b : nnnnnggatactatag
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
---------+---------+---------+---------+---------+---------+ 530
DCI01_0078_G12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0073_E08.b : TTGACAAAGATGAA**GGAAATTGCATAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0056_B02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0049_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0071_B01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0036_C06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0079_C07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
UTR01_0012_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0084_H05.b : TTGACAAAGATGAA**GGAAATTGCAAAACCCTACC**TTG*GGAATACTGTTACCGATG
HTMT1_0127_E05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0071_B03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0061_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0021_G09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0043_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0025_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0040_C03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0070_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0092_D08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0103_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0011_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0086_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0119_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0013_F07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0070_E07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CLNT1_0145_D06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LVR01_0082_E10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0070_D12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0102_D07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LVR01_0079_E07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0021_C11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0030_F06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0065_H08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0016_C07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0052_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0020_E07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0096_D04.b : gttttaaaaaaaaaaaaaaaaaaattccaaaaacccccccttgggaaaaaaattttccca
HTMT1_0141_B05.b : TTGACAAAGATGAA**GGAAATTGCAAAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0133_C10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0063_G05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPL01_0039_H07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0036_F05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0088_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0105_C09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0004_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0006_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0046_C06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0010_D08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0203_H03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0049_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0125_B12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0027_E01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPL01_0024_F01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0088_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CLNT1_0144_F11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0115_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*AGAAGACTGTTACCAATG
HTMT1_0147_D07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0074_C06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0011_H07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0066_E10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0037_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0001_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GAAAGACTGTTACCAATG
ADR01_0079_C04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0097_C12.b : TTGACAAAAATGAA**GGAAATTGCAAAACCCTACC**TTG*GGAAAACTGTTACAAATG
BMWN1_0029_D12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0027_G07.b : TTGACAAAGATGAA**GGAGATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0040_F04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0060_G12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0012_C10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0026_H01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0014_E04.b : TTGACGACGATGAA**GGAGATTGCATAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0009_B05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0034_A08.b : TTGAACAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCNATG
AMP01_0012_B04.b : TTTGACAAGATGAA**GGAAATTGCAGAAGCCTACC**CTG*GGGAGACTGGTACCAATG
BMWN1_0029_H08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0007_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0013_B08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0070_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0029_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0012_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0121_G09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0020_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0060_G08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0012_H02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0098_A05.b : TTGACAAAGATGAA**GGAAATTGCAGGAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0041_D06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0081_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0018_A06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0050_G07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0053_C10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0016_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0062_E05.b : TTGANCAAGATGAA**GGGAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0069_G12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0099_A03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0055_E06.b : TCTGACAAGATGAA**CGAGATTGCCTACTCCTACC**TTG*GGAAGACTGTTACCACTG
MLTL1_0077_A02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0048_F09.b : TTGACAAAGATGAA**GGAAATTGCACAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0022_F02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0001_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0052_D09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CLNT1_0141_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0025_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0119_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0013_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0093_E08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0010_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0075_E02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0053_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0086_C11.b : TTGACAAAGATGAA**GGANATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0010_D01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAGGACTGTTACCAATG
OVRT1_0098_H11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0003_E05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0046_B08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0066_H05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0025_H03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0044_B11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0002_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0064_E07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0033_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0026_F04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0059_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0098_H08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0005_A09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0072_F11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0006_A09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0052_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0046_A04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0024_E08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0062_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0033_H04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0112_B07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0012_A02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0081_C04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0001_E08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0010_G09.b : TTGACAAAGATGAA**GGAAATTGCTGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0074_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0073_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0002_B08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0017_G08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0066_F11.b : TTGACTAAGATGAA**AGAAATTGCAAATACCTACC**TTGCGGAAGACTGCTACCAATG
THY01_0102_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0027_F06.b : TTGACACAGATGAAG*GAACATTGCAGAAGCCTACC**TTG*AGAAGACTGCCACCAACG
OVRM1_0036_D11.b : TTGACATAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0225_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0058_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0076_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0090_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0171_E10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0111_H12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0217_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0117_B08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0059_A11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0084_A09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0045_H12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0049_D11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTATC**TTG*GGAAGACTGTTACCAATG
OVRM1_0122_H06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0051_A01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0011_D03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0032_G09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTNNGTACCATG
DCI01_0037_C02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0117_C08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0052_E04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0031_B12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0005_H11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0086_B11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0038_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0012_H07.b : TTGACAAAGATGAA**GGACATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0012_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0027_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0028_H06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0089_H10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0093_C05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0048_A06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0019_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0106_D03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0041_G08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0034_A05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0031_D09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0067_B02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0009_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0069_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0062_F07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0093_G05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0016_E01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0028_G07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0063_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0035_D11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0023_E02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0128_F02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0031_H03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0060_D01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0004_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0006_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0032_F12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0066_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0136_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0032_A06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0044_H06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0008_H10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*G*AAGACTGTTACCAATG
AMP01_0017_D03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0033_D02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0022_D07.b : TTGACAAAAATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0026_B03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0052_C08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0076_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0091_E09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0094_G10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0005_A03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0057_E10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0018_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0114_B12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0085_G08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0100_B05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0049_C11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SMG01_0035_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0100_H10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0108_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0033_C09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0061_H09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0096_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0073_B06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0025_H11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0017_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0077_F10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0052_A11.b : TTGATAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0059_B10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0025_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0098_H05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0114_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0098_G09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0066_D11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0072_H01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0094_C07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0090_H12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0084_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0042_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0097_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0017_E06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BKFL1_0012_F02.b : TTGTCAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0016_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGGCTGTTACCAATG
ILNT1_0054_C09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0080_G03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0006_D01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0015_C04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0017_B06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LVR01_0026_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0137_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0070_F06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0035_F06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0069_B08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0034_E07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0103_E02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0095_H12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0035_H06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0053_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0004_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ILNT1_0001_D11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0164_D02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0051_B03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0002_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0067_E06.b : TTGACAAAGATGAA**AGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCNATG
BFLT1_0120_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGATCGTTACCAATG
DCI01_0021_A09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0017_C08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0068_E11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0022_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SPLT1_0017_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0092_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0009_C09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0013_D09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0090_F09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
CBLT1_0008_C05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0045_C08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0053_A05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0074_F02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0093_C04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0025_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0070_D08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0063_H09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0023_A05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ITT01_0038_E04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SKNB1_0074_A02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0068_G05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0088_E11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0091_E06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0061_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0093_E02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0094_H09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0082_D11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0053_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LVRM1_0169_A12.b : tcacaaaaaaagaaagaaattgcacaacccctaccctagaaaacacaaccacccacaccc
THY01_0111_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0113_B01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0058_A03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0175_D12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0007_E06.b : TTGACAAAGATCGACGGAAATCTGCAGAAGCCTACCCTTTG*GGAAGACTGTTACCAATG
OVRM1_0202_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0078_A12.b : TTGACAAACATGAA**AGAGATTGCAAAAGCCTACC**TTG*GCAAGACTGGTACCAATG
OVRM1_0010_G09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0079_H09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0050_B05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0072_G07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**CTG*GGAAGACTGTTACCCATG
PTG01_0049_F01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0045_F03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0028_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0109_B07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0077_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0128_F06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0104_C11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0069_C03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0026_G12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0119_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0141_B02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0087_H08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SKNB1_0034_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0099_D01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0105_H03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0099_B02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0085_E03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0028_C05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0081_B04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0055_B04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
THY01_0088_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LVR01_0055_D02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0100_F09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0106_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0039_B12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0058_B04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0030_B12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
TCH01_0094_A01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0069_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0050_D08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0100_D09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
UTR01_0095_F11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0012_B11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
SKNB1_0015_H05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0002_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0049_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0055_C12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PBL01_0090_E04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0099_B02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0049_E06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0021_B05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0014_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0013_E12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0223_D07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0091_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0064_G01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0064_D04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0015_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0065_D02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0095_F12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0082_A08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0029_G08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0001_E05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLN01_0092_G11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0052_D06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PST01_0077_B03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
HTMT1_0117_F01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0101_H11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGGCTGTTACCAATG
BMWN1_0081_A10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0074_A03.b : TTGACAAAGATGAA**NGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGNTTACAATG
PTG01_0073_B07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0028_H07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
KDN01_0049_F04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BMWN1_0028_B07.b : TTGACAAAGATGAA**CGAAATTGCAAAAGCCTACC**TTG*CGAAGACTGTTACCAATG
DCI01_0029_D02.b : TTGACAAAGATGAA**AGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAACG
OVRM1_0113_E05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
UTR01_0084_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0018_C11.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0033_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
ADR01_0058_G02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0070_B08.b : TTGACAAAGATGAA**TGAAATTGCATAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0071_D05.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0002_H01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0039_G04.b : TTGACAAAGATGAA**GGAAATTGCACAAGCCTACC**TTG*GGAAGACTGTTACCAATG
TCH01_0060_C01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVR01_0074_F08.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
TCH01_0058_F12.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
TCH01_0056_B04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRM1_0085_G07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
BFLT1_0003_F02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0106_B09.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0033_H03.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
PTG01_0078_G06.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0075_F04.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0005_G07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
DCI01_0030_D02.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0008_H10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0005_H01.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0046_F10.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
MLTL1_0082_A07.b : TTGACAAAGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
OVRT1_0142_H12.b : xxxxxxxxGATGAA**GGAAATTGCAGAAGCCTACC**TTG*GGAAGACTGTTACCAATG
AMP01_0044_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0035_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTACCAATG
PTG01_0092_E06.b : tttttttnntnggactaaagcagcggnacggntccgaaatcctcnagcacgnttggccta
MLN01_0041_H04.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0065_C04.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0074_G10.b : nnaaagatgaacaxxxxxxxxxxxxxxxxx
PTG01_0058_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PCT01_0007_H04.b : nnnc
DCI01_0095_F06.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_D03.b :
MLTL1_0084_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-000436 : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
---------+---------+---------+---------+---------+---------+ 588
DCI01_0078_G12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCACAGAT*GC
OVR01_0073_E08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0056_B02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0049_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0071_B01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0036_C06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0079_C07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
UTR01_0012_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0084_H05.b : CTGTTGT*CACACTACCAGCATACTTTAACAACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0127_E05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0071_B03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0061_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0021_G09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0043_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0025_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0040_C03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0070_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0092_D08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0103_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0011_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0086_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0119_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0013_F07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0070_E07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CLNT1_0145_D06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LVR01_0082_E10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0070_D12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0102_D07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LVR01_0079_E07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0021_C11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0030_F06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0065_H08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0016_C07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0052_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0020_E07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0096_D04.b : aaaggttttgttccccccccccccccaattttttaaacccccccccgcggcggggcccaa
HTMT1_0141_B05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCACGCTACCAAAGAT*GC
OVRM1_0133_C10.b : CTATTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0063_G05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPL01_0039_H07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGATTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0036_F05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0088_D05.b : CTGTTGT*CACAGTACCGGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0105_C09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0004_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0006_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0046_C06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0010_D08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0203_H03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0049_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0125_B12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0027_E01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCANGCTACCAAAGAT*GC
SPL01_0024_F01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0088_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CLNT1_0144_F11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0115_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0147_D07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0074_C06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0011_H07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0066_E10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0037_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0001_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0079_C04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0097_C12.b : CTTTTGT*CACAGTCCCAGCATACTTTAACGACTtctagccgtaggctacaaaaatgctg
BMWN1_0029_D12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0027_G07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCNAAGAT*GC
BMWN1_0040_F04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0060_G12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0012_C10.b : CTGTTGC*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0026_H01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0014_E04.b : CTGTTGT*CACATTACCAGCATACTTTAACGACTCTCAACGTCACGCTACCAGAGAT*GC
AMP01_0009_B05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0034_A08.b : CTNGTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0012_B04.b : CTGGTGT*CACAGTACCAGCATACTTTAACGACTCTCAACGTCCAGCTACCCAAGAT*GC
BMWN1_0029_H08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0007_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0013_B08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0070_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0029_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0012_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0121_G09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0020_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0060_G08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0012_H02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0098_A05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0041_D06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0081_B10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0018_A06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0050_G07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0053_C10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0016_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0062_E05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCNAAGAT*GC
AMP01_0069_G12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0099_A03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0055_E06.b : CTGATGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAAGCTACCAAAGAT*GC
MLTL1_0077_A02.b : CTGTTGT*TACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0048_F09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0022_F02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0001_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0052_D09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CLNT1_0141_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0025_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0119_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0013_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0093_E08.b : CTGTTGT*CACAGTACCAGCATATTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0010_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGGT*GC
DCI01_0075_E02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0053_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0086_C11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0010_D01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0098_H11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0003_E05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0046_B08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0066_H05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0025_H03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0044_B11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0002_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0064_E07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0033_B10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0026_F04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0059_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0098_H08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0005_A09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0072_F11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0006_A09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0052_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0046_A04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0024_E08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0062_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0033_H04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0112_B07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0012_A02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0081_C04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0001_E08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0010_G09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0074_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0073_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCGGGCTACCAAAGAT*GC
CBLT1_0002_B08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0017_G08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0066_F11.b : CTGTTtgtcaccataccagaaatactctaatgacatctcatcttcaagcctaccccacaa
THY01_0102_B09.b : CTGTTGT*CACCGTCACAGCATACTTTAACGACTCTCAGCGTCCGGCTACaaagatgctg
OVRM1_0027_F06.b : CTGTTGT*CACAGTACCAGCATACTCTACTGACTCTCAGCGCCAGGCTACCACAGAT*GC
OVRM1_0036_D11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAAGCTACCAAAGATTGC
OVRM1_0225_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGAATCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0058_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCNAAGAT*GC
OVR01_0076_B10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0090_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0171_E10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0111_H12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0217_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0117_B08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0059_A11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0084_A09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0045_H12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0049_D11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0122_H06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0051_A01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0011_D03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0032_G09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0037_C02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCCAAGAT*GC
BFLT1_0117_C08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0052_E04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0031_B12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0005_H11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0086_B11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0038_B10.b : CTGTTGT*CACAGTACCAGCATACTTTTACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0012_H07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0012_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0027_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGACTACCAAAGAT*GC
AMP01_0028_H06.b : CTGTCGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0089_H10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0093_C05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0048_A06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0019_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACAACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0106_D03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0041_G08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0034_A05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0031_D09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0067_B02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0009_G06.b : CTGTTGT*CACAGTGCCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0069_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0062_F07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0093_G05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCCAAGAT*GC
AMP01_0016_E01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0028_G07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0063_B10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0035_D11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0023_E02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0128_F02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0031_H03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0060_D01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0004_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0006_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0032_F12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0066_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGATACCAAAGAT*GC
OVRT1_0136_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0032_A06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0044_H06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0008_H10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0017_D03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0033_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0022_D07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0026_B03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0052_C08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0076_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0091_E09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0094_G10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0005_A03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0057_E10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0018_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0114_B12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0085_G08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0100_B05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0049_C11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SMG01_0035_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0100_H10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0108_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0033_C09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0061_H09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0096_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0073_B06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0025_H11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0017_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0077_F10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0052_A11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0059_B10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0025_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0098_H05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0114_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0098_G09.b : CTGTTGT*CACAGTACCAGCATACCTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0066_D11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0072_H01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0094_C07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0090_H12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0084_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0042_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0097_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAACGTCAGGCTACCAAAGAT*GC
MLN01_0017_E06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCACAGAT*GC
BKFL1_0012_F02.b : CTGCTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0016_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0054_C09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0080_G03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0006_D01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0015_C04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0017_B06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LVR01_0026_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0137_E12.b : CTGTTGT*CACAGTACCATCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0070_F06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0035_F06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0069_B08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0034_E07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0103_E02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0095_H12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0035_H06.b : CTGTTGT*CACAGTATCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0053_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0004_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ILNT1_0001_D11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0164_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0051_B03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0002_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0067_E06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0120_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0021_A09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0017_C08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGTCTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0068_E11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0022_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SPLT1_0017_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0092_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0009_C09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGTCTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0013_D09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0090_F09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
CBLT1_0008_C05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0045_C08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0053_A05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0074_F02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0093_C04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0025_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0070_D08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0063_H09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0023_A05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ITT01_0038_E04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SKNB1_0074_A02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0068_G05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0088_E11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0091_E06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0061_G02.b : CTATTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0093_E02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0094_H09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0082_D11.b : CTGTTGT*CACAGTACCAGCGTACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0053_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LVRM1_0169_A12.b : tttaaaccccaataacccataaaaagtctgaaaacctcaaagcgtccaagagacgaaaaa
THY01_0111_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0113_B01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0058_A03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0175_D12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0007_E06.b : CTGTCGT*CACAGTACCAGCATACCTTAACGACTCTCCGCGTCAGGCTACCAACGAT*GC
OVRM1_0202_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0078_A12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGTGTCATGCTACCAAAGAT*GC
OVRM1_0010_G09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0079_H09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0050_B05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0072_G07.b : CTGTTGT*CCCAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0049_F01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0045_F03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0028_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0109_B07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0077_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCATCAGGCTACCAAAGAT*GC
OVRT1_0128_F06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0104_C11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0069_C03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0026_G12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0119_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0141_B02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0087_H08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SKNB1_0034_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0099_D01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0105_H03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0099_B02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0085_E03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0028_C05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0081_B04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0055_B04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
THY01_0088_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LVR01_0055_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0100_F09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0106_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0039_B12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0058_B04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0030_B12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
TCH01_0094_A01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0069_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0050_D08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0100_D09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
UTR01_0095_F11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0012_B11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
SKNB1_0015_H05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0002_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0049_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0055_C12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PBL01_0090_E04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0099_B02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0049_E06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0021_B05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0014_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0013_E12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0223_D07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0091_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0064_G01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0064_D04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0015_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0065_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0095_F12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0082_A08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0029_G08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0001_E05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACCCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0092_G11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0052_D06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PST01_0077_B03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
HTMT1_0117_F01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0101_H11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BMWN1_0081_A10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0074_A03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0073_B07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0028_H07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
KDN01_0049_F04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAACGTCAGGCTACCAAAGAT*GC
BMWN1_0028_B07.b : CTGTTGTTCACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTAACAAAGAT*GC
DCI01_0029_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0113_E05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
UTR01_0084_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0018_C11.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0033_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
ADR01_0058_G02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACTAAAGAT*GC
AMP01_0070_B08.b : CTGTTGT*CACAATACCAGCATACTTTAGCGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRM1_0071_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0002_H01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0039_G04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGCCAGGCTACCAAAGAT*GC
TCH01_0060_C01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVR01_0074_F08.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
TCH01_0058_F12.b : CTGTCGT*CACAGTACCAGCATACTTTAACGACTCTCAGTGTCAGGCTACCAAAGAT*GC
TCH01_0056_B04.b : CTGTCGT*CACAGTACCAGCATACTTTAACGACTCTCAGTGTCAGGCTACCAAAGAT*GC
OVRM1_0085_G07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
BFLT1_0003_F02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0106_B09.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0033_H03.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0078_G06.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0075_F04.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0005_G07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
DCI01_0030_D02.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0008_H10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0005_H01.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0046_F10.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0082_A07.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
OVRT1_0142_H12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0044_D05.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
LNG01_0035_A12.b : CTGTTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0092_E06.b : ctgGTGT*CACANTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLN01_0041_H04.b : xxxxTGT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
MLTL1_0049_C05.b : xxxxxxT*CACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
TCH01_0065_C04.b : xxxxxxxxCACAGTACCAGCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
AMP01_0052_C07.b : xxxxxxxxxxxxxxxxxxxCATACTTTAACGACTCTCAGCGTCAGGCTACCAAAGAC*GC
PBL01_0074_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0058_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnAACNACTCTCAGCGTCAGGCTACCAAAGAT*GC
PCT01_0007_H04.b : cattttnnnnnnncctgaggtgccactggtacgactctcgcgtcAGCTACCAAAGAT*GC
DCI01_0095_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_D03.b : nnnnnaagatggacta
MLTL1_0084_H06.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000436 : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
---------+---------+---------+---------+---------+---------+ 646
DCI01_0078_G12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0073_E08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCNATGAGCCAACTGCTGCTGCT
BFLT1_0056_B02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0049_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0071_B01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0036_C06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0079_C07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
UTR01_0012_G03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0084_H05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGATCCAACTGCTGCTGCT
HTMT1_0127_E05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0071_B03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0061_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0021_G09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0043_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0025_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0040_C03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0070_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0092_D08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0103_G03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0011_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0086_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0119_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0013_F07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0070_E07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CLNT1_0145_D06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LVR01_0082_E10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0070_D12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0102_D07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LVR01_0079_E07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0021_C11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0030_F06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0065_H08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0016_C07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0052_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0020_E07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTG**
PTG01_0096_D04.b : aaaaaaagggaaaaaaaatggggggggccccgggtttttaaaaaaccccattaaaaccca
HTMT1_0141_B05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*TAATCATCAATGAACCAACTGCTGCTGCT
OVRM1_0133_C10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0063_G05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPL01_0039_H07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0036_F05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0088_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0105_C09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0004_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0006_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0046_C06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0010_D08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0203_H03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0049_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0125_B12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0027_E01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*AAATCATCAATGAACCAACTGCTGCTGCT
SPL01_0024_F01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0088_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CLNT1_0144_F11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0115_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0147_D07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0074_C06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0011_H07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0066_E10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0037_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0001_D04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0079_C04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0097_C12.b : gaacaattgctggtcccaaggtccttaaatcctcagtgcccaacggcgcgcgcattggtt
BMWN1_0029_D12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0027_G07.b : TGGAAACTAT*GCTGGTCTCAATGTACTTA*GAATCATNCATGAGCCNACTGCTGCTGCT
BMWN1_0040_F04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0060_G12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*AAATCATNCATGAGCCAACTGCTGCTGCT
ILNT1_0012_C10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0026_H01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0014_E04.b : TGGAACTATT*GCTGGTCACAATGTACTTA*CAATCATCTATGAGCCTACTGCTGCTGCT
AMP01_0009_B05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0034_A08.b : TGGAACTAGT*GCTGGTCTCAATGTACTTA*NAATCATCNATGAGCCCACTGCTGCTGCT
AMP01_0012_B04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*NAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0029_H08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0007_D04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0013_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0070_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
BMWN1_0029_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0012_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0121_G09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0020_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*NAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0060_G08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATNCATGAGCCAACTGCTGCTGCT
AMP01_0012_H02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0098_A05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0041_D06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0081_B10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0018_A06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0050_G07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0053_C10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0016_G03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0062_E05.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATNCATGAGCCNACTGCTGCTGCT
AMP01_0069_G12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
AMP01_0099_A03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0055_E06.b : TGGAACTATT*GCTGGTCTACATGTACTTA*GAATCATCAGTGAGCCAACTGCTGCTGCT
MLTL1_0077_A02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0048_F09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0022_F02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0001_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0052_D09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CLNT1_0141_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0025_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*NAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0119_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0013_F03.b : CGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0093_E08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0010_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0075_E02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0053_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0086_C11.b : TGGAACCATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0010_D01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCGTCAATGAGCCAACTGCTGCTGCT
OVRT1_0098_H11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0003_E05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0046_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0066_H05.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0025_H03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0044_B11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0002_G03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0064_E07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0033_B10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0026_F04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0059_F03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0098_H08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0005_A09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0072_F11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0006_A09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0052_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0046_A04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0024_E08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0062_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0033_H04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0112_B07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0012_A02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0081_C04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0001_E08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0010_G09.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0074_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0073_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0002_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0017_G08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0066_F11.b : gcctacaactatctgttggacccattgttcattagtaatcataaaagaacctacagctgc
THY01_0102_B09.b : gactattgctgtttactgttcttgaaacaccaggacccaccggtgctgcattggtatggg
OVRM1_0027_F06.b : TGGAACTATC*GCTCGGCATAATGTACTCA*GAATCATCCATGAGCCAACctgctgctgc
OVRM1_0036_D11.b : TGGAACTATT*GCTGGTCCTAATGTACTTA*GAATTATCATTGAGCCAACTGCTGATGCT
OVRM1_0225_F03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0058_C12.b : TGGAAACTAT*GCTGGTCTCCATGTACTTA*GAAATCATCATGAGCCCACTGCTGCTGCT
OVR01_0076_B10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0090_F03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0171_E10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0111_H12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0217_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*AAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0117_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0059_A11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0084_A09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0045_H12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATNCATGAGCCAACTGCTGCTGCT
OVRM1_0049_D11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0122_H06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0051_A01.b : TGGAACTATT*GCTGGGTCTCATGTACTTA*GAATCATNCATGAGCCAACTGCTGCTGCT
ILNT1_0011_D03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0032_G09.b : TGGAACTATT*GCTGGGTCTCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0037_C02.b : TGGAACTATT*GCTGGGTCTCATGTACTTA*NAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0117_C08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0052_E04.b : TGGGACTATT*GCTGGGTCTCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0031_B12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0005_H11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
LNG01_0086_B11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0038_B10.b : TGGGACTATT*GCTGGTCTTCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0012_H07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCGATGAGCCAACTGCTGCTGCT
LNG01_0012_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0027_D04.b : TGGAACTATT*GCTGGGTCTCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0028_H06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0089_H10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0093_C05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0048_A06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0019_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0106_D03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATNCATGAGCCAACTGCTGCTGCT
DCI01_0041_G08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0034_A05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0031_D09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0067_B02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0009_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0069_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0062_F07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0093_G05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0016_E01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0028_G07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0063_B10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0035_D11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0023_E02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0128_F02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0031_H03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0060_D01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0004_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0006_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0032_F12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTACT
DCI01_0066_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATNCATGAGCCAACTGCTGCTGCT
OVRT1_0136_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0032_A06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0044_H06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0008_H10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0017_D03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0033_D02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0022_D07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCAACAATGAGCCAACTGCTGCTGCT
ITT01_0026_B03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0052_C08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0076_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0091_E09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0094_G10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0005_A03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0057_E10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0018_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0114_B12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0085_G08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0100_B05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0049_C11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SMG01_0035_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0100_H10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0108_F03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0033_C09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0061_H09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0096_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0073_B06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0025_H11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0017_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0077_F10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0052_A11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0059_B10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0025_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0098_H05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAGCTGCTGCTGCT
DCI01_0114_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0098_G09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0066_D11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0072_H01.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0094_C07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0090_H12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCGACTGCTGCTGCT
ADR01_0084_G03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0042_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*CAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0097_B09.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0017_E06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BKFL1_0012_F02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0016_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0054_C09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0080_G03.b : TGGAACCATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0006_D01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0015_C04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0017_B06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LVR01_0026_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0137_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0070_F06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0035_F06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0069_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0034_E07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0103_E02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0095_H12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0035_H06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0053_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0004_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ILNT1_0001_D11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0164_D02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0051_B03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0002_F08.b : TGGAACTATT*GCTGGTCTNCATGTACTTANGAATCATCA*TGAGCCCACTGCTGCTGCT
AMP01_0067_E06.b : TGGAACTATT*GCTGGGTCTCATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
BFLT1_0120_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0021_A09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0017_C08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0068_E11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0022_D04.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SPLT1_0017_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0092_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0009_C09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0013_D09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0090_F09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
CBLT1_0008_C05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0045_C08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0053_A05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0074_F02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0093_C04.b : TGGAACTATT*GCTGGTCTNCATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0025_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0070_D08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0063_H09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0023_A05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ITT01_0038_E04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SKNB1_0074_A02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAGCTGCTGCTGCT
KDN01_0068_G05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0088_E11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGTTGCT
OVRT1_0091_E06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0061_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0093_E02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0094_H09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0082_D11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0053_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LVRM1_0169_A12.b : acagccagaaagaaacccatatatcagtagacatttaaacacagccacacagccaactac
THY01_0111_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAAgagccactgctgctgctat
OVRM1_0113_B01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0058_A03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0175_D12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0007_E06.b : TGGAACTATT*GCTGGTCTCCATGTACTCACAATCTTTCAATGAGCCAACTGCTGCTGCT
OVRM1_0202_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0078_A12.b : TGGAACTATT*GCTGGACTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0010_G09.b : TGGAACTATT*GCTGGTCTCAATGCACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0079_H09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0050_B05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0072_G07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
PTG01_0049_F01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0045_F03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0028_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0109_B07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0077_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0128_F06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0104_C11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0069_C03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0026_G12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0119_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0141_B02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0087_H08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SKNB1_0034_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCACCAATGAGCCAACTGCTGCTGCT
THY01_0099_D01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0105_H03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0099_B02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAACCAACTGCTGCTGCT
KDN01_0085_E03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0028_C05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0081_B04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0055_B04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
THY01_0088_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LVR01_0055_D02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0100_F09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0106_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0039_B12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0058_B04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0030_B12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
TCH01_0094_A01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0069_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0050_D08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0100_D09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
UTR01_0095_F11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0012_B11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
SKNB1_0015_H05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0002_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVR01_0049_D04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0055_C12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0090_E04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0099_B02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0049_E06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0021_B05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0014_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0013_E12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0223_D07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0091_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0064_G01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0064_D04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0015_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0065_D02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0095_F12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0082_A08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0029_G08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0001_E05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0092_G11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0052_D06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PST01_0077_B03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
HTMT1_0117_F01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0101_H11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0081_A10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0074_A03.b : TGGAACTATT*GCTGGGTCTCATGTACTAG*AAATCATCAtgagcaactgctgctgctat
PTG01_0073_B07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0028_H07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
KDN01_0049_F04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*TAATCATCAATGAGCCAACTGCTGCTGCT
BMWN1_0028_B07.b : TGGAACTATTTGCTGGGTCTCATGTACTTA*CAATCAACAATGAGCCAACTGCTGCTGCT
DCI01_0029_D02.b : TGGAACTANT*GCTGGTCTCAATGTACTTA*GAATCATTCATGACCCAACTGCTGCTGCT
OVRM1_0113_E05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
UTR01_0084_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0018_C11.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0033_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
ADR01_0058_G02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0070_B08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*TAATCATCAGTGAGCCCACTGCTGCTGCT
OVRM1_0071_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0002_H01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0039_G04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCCACTGCTGCTGCT
TCH01_0060_C01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGGCAACTGCTGCTGCT
OVR01_0074_F08.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
TCH01_0058_F12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
TCH01_0056_B04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRM1_0085_G07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
BFLT1_0003_F02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0106_B09.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0033_H03.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0078_G06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0075_F04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0005_G07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0030_D02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0008_H10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0005_H01.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0046_F10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0082_A07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
OVRT1_0142_H12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0044_D05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0035_A12.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0092_E06.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLN01_0041_H04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
MLTL1_0049_C05.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTACTGCTGCT
TCH01_0065_C04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
AMP01_0052_C07.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PBL01_0074_G10.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PTG01_0058_H02.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
PCT01_0007_H04.b : TGGAACTATT*GCTGGTCTCAATGTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
DCI01_0095_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0080_D03.b : anacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0084_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000436 : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
---------+---------+---------+---------+---------+---------+ 702
DCI01_0078_G12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0073_E08.b : ATTGCTTATGGCTT*ATACCAAAAGGTTGGA*GCTGCAAGAAACGGGCT*GATCTTCG*A
BFLT1_0056_B02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0049_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0071_B01.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCC*A
BMWN1_0036_C06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAAGAACGTGCTTGATCTTCG*A
BMWN1_0079_C07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
UTR01_0012_G03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0084_H05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGATATAAACATGCT*GATCTTCC*A
HTMT1_0127_E05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0071_B03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0061_G11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0021_G09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGNAACGTGCT*GATCTTCG*A
BMWN1_0043_D05.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0025_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0040_C03.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0070_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0092_D08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0103_G03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0011_C01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGANAGAAACGTGCT*GATCTTCG*A
HTMT1_0086_D05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0119_C01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0013_F07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0070_E07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CLNT1_0145_D06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LVR01_0082_E10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0070_D12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0102_D07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LVR01_0079_E07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0021_C11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0030_F06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0065_H08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0016_C07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0052_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0020_E07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0096_D04.b : cacccttcttttttttttttttttggtgtgaaaaaaaaaatggtgggaaaaaaaaaaaaa
HTMT1_0141_B05.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGAACCTCAAAAAAACCTGCT*AATCTTCG*A
OVRM1_0133_C10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0063_G05.b : ATTGCTTATGGCTT*AGACNAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPL01_0039_H07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0036_F05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGCGCT*GATCTTCG*A
BFLT1_0088_D05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0105_C09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0004_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0006_G02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGGAACGTGCT*GATCTTCG*A
HTMT1_0046_C06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0010_D08.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0203_H03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0049_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0125_B12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0027_E01.b : ATTGCTTATGGCTT*NAACAAAAAG*TTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPL01_0024_F01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0088_E12.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CLNT1_0144_F11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0115_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0147_D07.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0074_C06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0011_H07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0066_E10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0037_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0001_D04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0079_C04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0097_C12.b : aggcttaaaaaaaaggttgaactaaaaaaacgtgcctattttacattgggtgggggcctt
BMWN1_0029_D12.b : ATTGCTTATGGCTT*ANACAAAAAAGTTGGA*GCTGAAAAAAACGTGCT*GATCTTCG*A
DCI01_0027_G07.b : ATTGCTTATGGNCT*ANACAAAA*GGTTGGA*GCTGAA*GAAACGTGCT*GATCTTCG*A
BMWN1_0040_F04.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCA*A
ILNT1_0060_G12.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0012_C10.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0026_H01.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCAAC
AMP01_0014_E04.b : ATTGCTTATGGCTA*TATACTCCAGGTTGGA*GCTGACATATACGTGCT*GATCTTCA*A
AMP01_0009_B05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*CCTGAAAGAAACGTGCT*GATCCTCA*A
AMP01_0034_A08.b : ATTGGCTATGGNCT*ANNACAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0012_B04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0029_H08.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0007_D04.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0013_B08.b : ATTGCTTATGGCTT*AGACA*AAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0070_E03.b : ATTTGCTATGGNCT*ANACAAAAA*GTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0029_A07.b : ATTGCTTATGGCTT*AGACAAAANGGT*GGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0012_A08.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0121_G09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0020_G06.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0060_G08.b : ATTGCTTATGGCTT*AAACAAA*AGGTGGNA*GCTGAAAGAAACATGCT*GATCTTCGAA
AMP01_0012_H02.b : ATTGCTTATGGCTT*ANACAAAAACGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0098_A05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0041_D06.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0081_B10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCC*A
AMP01_0018_A06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGTT*GATCTTCG*A
AMP01_0050_G07.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0053_C10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0016_G03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0062_E05.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0069_G12.b : ATTGCTTATGGGCT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCCTCG*A
AMP01_0099_A03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0055_E06.b : ATTGCTTATGGCTG*AGACGAAAAGGTTGGA*GCTGACAGAAACGTGCT*GATCTTCG*A
MLTL1_0077_A02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0048_F09.b : ATTGCTTATGGCTT*AAAC*AAAAGGTTGGA*GCTGAAAGAAACGTGTT*GATCTTCG*A
AMP01_0022_F02.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0001_D05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0052_D09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CLNT1_0141_G06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0025_G02.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0119_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0013_F03.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCN*A
AMP01_0093_E08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0010_C01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GAATCTCG*A
DCI01_0075_E02.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0053_G02.b : ATTGCTTATGGCTT*ANACNAAAAGGTTGGA*GCTGAAAGA*ACGTGCT*GATCTTCG*A
AMP01_0086_C11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0010_D01.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGATACGTGCT*GATCTTCG*A
OVRT1_0098_H11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0003_E05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0046_B08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0066_H05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0025_H03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0044_B11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0002_G03.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0064_E07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0033_B10.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0026_F04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0059_F03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0098_H08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0005_A09.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0072_F11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0006_A09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0052_B09.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0046_A04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0024_E08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0062_E03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0033_H04.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0112_B07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0012_A02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0081_C04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0001_E08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0010_G09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0074_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0073_A07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
CBLT1_0002_B08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0017_G08.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0066_F11.b : acgattgtgctttatgcttaacataaactcgtcgtacgccgacaaaaccaccgacgttct
THY01_0102_B09.b : tttaaaaaa
OVRM1_0027_F06.b : gatcggttaacggcctagacaagaaggccggcgctcgaagaaacatactcgatatccaca
OVRM1_0036_D11.b : ATTGCTTATGCCTT*ACACTAAAAGGTTGGA*GCTGTAAGAAACGTGCTtgatctttaat
OVRM1_0225_F03.b : ATTGCTTATGGCTT*AAACAAAAAGGCTGGA*GCTTGAAGAGACGTGCT*GATCTTCG*A
DCI01_0058_C12.b : ATGGCTTATGGCTT*AAACAn
OVR01_0076_B10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0090_F03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0171_E10.b : ATTGCTTATGGCTT*AGAACAAAAGGTTGGA*GCTGAAAGA*ACGTGCT*GATCTTCA*A
OVRM1_0111_H12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0217_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0117_B08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0059_A11.b : ATTGCTTATGGCTT*AGACNAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GGTCTTCG*A
OVRM1_0084_A09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0045_H12.b : ATTGCTTATGGCTT*AGACAAAAGGGTGGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0049_D11.b : ATTGCTTATGGCTT*AGACAAAAAGGCTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0122_H06.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0051_A01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0011_D03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0032_G09.b : ATTGCTTATGGCTA*GACAAAAAAG**TGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0037_C02.b : NATGCTTATGGGCT*TAGATAAAAAGTTGAA*GCTGAAAAGAACGTGCT*GATCTTCG*A
BFLT1_0117_C08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0052_E04.b : ATTGCTTATGGCTT*ANACAAAAAGGT*GGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0031_B12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0005_H11.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0086_B11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0038_B10.b : ATTGCTTATGGNCT*AAACNAAAAGGTTGGA*GCTGAAAAAAACGTGCT*GATCTTCC*A
DCI01_0012_H07.b : ATTGCTTATGGCTT*AGNACAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0012_B09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0027_D04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0028_H06.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGNAAGAAACGTGCT*GATCTTCG*A
MLTL1_0089_H10.b : ATTGCTTATGGCTT*ANACAAAAAGGGTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0093_C05.b : ATTGCTTATGGCTT*ATACA*AAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTTC*A
AMP01_0048_A06.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0019_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0106_D03.b : ATTGCTTATGGGCT*AGACAAA*AGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0041_G08.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0034_A05.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0031_D09.b : ACTGCTTATGGCTT*ANACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0067_B02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0009_G06.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0069_G02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0062_F07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0093_G05.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0016_E01.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0028_G07.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0063_B10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0035_D11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0023_E02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0128_F02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0031_H03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0060_D01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0004_G11.b : ACTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0006_G11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0032_F12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0066_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0136_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0032_A06.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0044_H06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0008_H10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0017_D03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0033_D02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0022_D07.b : ATTGCTTATGGCTT*ACACGAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0026_B03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0052_C08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0076_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0091_E09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0094_G10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0005_A03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0057_E10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0018_E03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0114_B12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0085_G08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0100_B05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0049_C11.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SMG01_0035_A07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0100_H10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0108_F03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0033_C09.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0061_H09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0096_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0073_B06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0025_H11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0017_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0077_F10.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0052_A11.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0059_B10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0025_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0098_H05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0114_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0098_G09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0066_D11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0072_H01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0094_C07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0090_H12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0084_G03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGACAGAAACGTGCT*GATCTTCG*A
OVR01_0042_E03.b : ATTGCTTATGGCTT*ATACTAAAAGGCTGGA*GCTGACAGAAACTCGCT*GATCTTCC*A
AMP01_0097_B09.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0017_E06.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BKFL1_0012_F02.b : ATTGCTTATGGCTT*AGACAAAAAGGTGGNA*GCTNNGAAGAACGTGCT*GATCTTCG*A
AMP01_0016_G06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0054_C09.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0080_G03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0006_D01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0015_C04.b : ACTGCTTATGGCTT*ATACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCC*A
BMWN1_0017_B06.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGAA*GCTGAAAGAAAACTGCT*GATCTCCG*A
LVR01_0026_E03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0137_E12.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0070_F06.b : ATTGCTTACGGCTT*AAACAAAAAGGTTGGA*GCTGGAAGAAACGTGCT*GATCTTCG*A
BMWN1_0035_F06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0069_B08.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0034_E07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0103_E02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0095_H12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0035_H06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0053_G01.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0004_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ILNT1_0001_D11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0164_D02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT
OVRM1_0051_B03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGACACGTGCT*GATCTTCG*A
AMP01_0002_F08.b : ATTGCTTATGGCTT*AGACNNAAAGGTTGGA*GCTGNAAGAAACGTGCT*GATCTTCG*A
AMP01_0067_E06.b : ATTTGCTATGGGCT*ANACA*AAAGGGTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0120_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0021_A09.b : ATTGCTTATGGCTTTAAACAAAAGGTTTGGA*GCTGAAAGAAACGTGCT*GATCTTCC*A
AMP01_0017_C08.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0068_E11.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0022_D04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SPLT1_0017_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0092_G06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0009_C09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0013_D09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0090_F09.b : ATTGCTTATGGCTT*ACACAAAAAGGTTGGA*GCTGAGAGAAACGTGCT*GATCTTCG*A
CBLT1_0008_C05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0045_C08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0053_A05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0074_F02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0093_C04.b : ATTGCTTATGGCTT*AGACAAAAAAGTTGGA*GCTGATAGAAACGTGCT*GATCTTCG*A
OVRT1_0025_G02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0070_D08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0063_H09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0023_A05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ITT01_0038_E04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SKNB1_0074_A02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0068_G05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0088_E11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0091_E06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0061_G02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0093_E02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0094_H09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0082_D11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0053_C01.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LVRM1_0169_A12.b : atcaacagaatactaaacagtgtaaacgtcaaacgaaccagcgaaaaaaagataaagtga
THY01_0111_G02.b : gcttatggttagacaaa
OVRM1_0113_B01.b : ATTGCTTATGGCTT*NAGACAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0058_A03.b : ATTGCTTATGGCTT*AGACNAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0175_D12.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0007_E06.b : ATTGCTTATGGCTC*ACACCACACGTTGGCA*GCTGACAGAAACGTGCT*GATCTTCG*A
OVRM1_0202_B09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0078_A12.b : ATTGCTTATGGCTT*AGACAAGAAGGTTGGA*GCTGACAGAAACGTGCT*GATCTTCG*A
OVRM1_0010_G09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0079_H09.b : ATTGCTTATGGCTT*AGACA*AAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0050_B05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0072_G07.b : ATTGCTTATGGCTT*AGACCAAAAGGGTGGA*ACTGAAAGAAACCTGCT*GATCCTCG*A
PTG01_0049_F01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0045_F03.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0028_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0109_B07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0077_A07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0128_F06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAGAGAAATGTGCT*GATCTTCG*A
LNG01_0104_C11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCN*A
PST01_0069_C03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0026_G12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0119_B09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0141_B02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0087_H08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SKNB1_0034_G06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0099_D01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTAGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0105_H03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0099_B02.b : ATTGCTTATGGCTT*ACACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0085_E03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0028_C05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0081_B04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0055_B04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
THY01_0088_G11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LVR01_0055_D02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0100_F09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0106_B09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0039_B12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0058_B04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0030_B12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
TCH01_0094_A01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0069_G11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0050_D08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0100_D09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
UTR01_0095_F11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0012_B11.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
SKNB1_0015_H05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0002_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0049_D04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0055_C12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0090_E04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0099_B02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAGGAAACGTGCT*GATCTTCG*A
PST01_0049_E06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0021_B05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0014_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0013_E12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0223_D07.b : ATTGCTTATGGCTT*AGACAAAAAGGCTGGA*GCTGAAAGAAACGCGCT*GATCTTCG*A
PST01_0091_A07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0064_G01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0064_D04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0015_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0065_D02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0095_F12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0082_A08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0029_G08.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0001_E05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0092_G11.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0052_D06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PST01_0077_B03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
HTMT1_0117_F01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0101_H11.b : ATTGCTTATGGCTTAAACAAAAAGGGTTGGA*GCTGAAAGAAACGTGCT*GATCCTCG*A
BMWN1_0081_A10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0074_A03.b : ggctaatgcctaaacaaaaagttggacctgaagaaacttggtgatctccaactggttggg
PTG01_0073_B07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0028_H07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
KDN01_0049_F04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BMWN1_0028_B07.b : ATTGCTTATGGCTT*AAACAAAAAGGGTGGA*AACTAAAAAAACGTGCC*GATCTTCG*A
DCI01_0029_D02.b : AATGCCTATGGCTT*NACNAAAAAGGTTGaactgaaaaaacgtgctgatctccgactggg
OVRM1_0113_E05.b : ATTGCTTATGGCTT*AGACAA*AAGGTTGGA*GCTGATAG*AACGTGCT*GATCTTCG*A
UTR01_0084_C01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0018_C11.b : ATTGCTTATGGCTT*ACACAAAAAGGGTGGA*GCTGAAAAAAACGTGCT*GATCTTCA*A
DCI01_0033_D05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
ADR01_0058_G02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0070_B08.b : ATTGCTTATGGCTT*ACACAAAAAGGTTGGA*GCTGAGAGAAACGTGCT*GATCTTCG*A
OVRM1_0071_D05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0002_H01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0039_G04.b : ATTGCTTATGGCTT*ANACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
TCH01_0060_C01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVR01_0074_F08.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
TCH01_0058_F12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
TCH01_0056_B04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRM1_0085_G07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
BFLT1_0003_F02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0106_B09.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0033_H03.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0078_G06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0075_F04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0005_G07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0030_D02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAGAGAAACGTGCT*GATCTTCG*A
MLTL1_0008_H10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0005_H01.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0046_F10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0082_A07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
OVRT1_0142_H12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0044_D05.b : ATTGCTTATGGCTT*AAACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0035_A12.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0092_E06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLN01_0041_H04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0049_C05.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
TCH01_0065_C04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
AMP01_0052_C07.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PBL01_0074_G10.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PTG01_0058_H02.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
PCT01_0007_H04.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
DCI01_0095_F06.b : ATTGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
LNG01_0080_D03.b : xxaGCTTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
MLTL1_0084_H06.b : xxxxxxTATGGCTT*AGACAAAAAGGTTGGA*GCTGAAAGAAACGTGCT*GATCTTCG*A
20110601C-000436 : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
---------+---------+---------+---------+---------+---------+ 758
DCI01_0078_G12.b : CTTGGGTGGTGG*CACTTTTGATG*TGTNCAT*CCTCACTATTGANG*ATGGTATCTTCG
OVR01_0073_E08.b : CTTGGGTGGTG
BFLT1_0056_B02.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
ADR01_0049_E12.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
ILNT1_0071_B01.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
BMWN1_0036_C06.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
BMWN1_0079_C07.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
UTR01_0012_G03.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
HTMT1_0084_H05.b : CTTGTGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
HTMT1_0127_E05.b : CTTGNGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
ILNT1_0071_B03.b : CTTGNGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGANG*ATGGTATCTTCG
CBLT1_0061_G11.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
BMWN1_0021_G09.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
BMWN1_0043_D05.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAAG*ATGGTATCTTCG
ILNT1_0025_F08.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
ADR01_0040_C03.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
HTMT1_0070_C12.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
CBLT1_0092_D08.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
ITT01_0103_G03.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCAAT*CCTCACTATTGAGG*ATGGTATCTTCG
CBLT1_0011_C01.b : CTTGGGTGGTGG*CACTTTTGATG*TGTCA