
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000436

Length: 1,583

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein isoform 1 [Homo sapiens]. 8710.0O
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein isoform 2 [Homo sapiens]. 8270.0O
Contig/Assembly ProteinHSPA2heat shock-related 70 kDa protein 2 [Homo sapiens]. 7960.0O
Contig/Assembly ProteinHSPA1Bheat shock 70 kDa protein 1A/1B [Homo sapiens]. 7950.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1A/1B [Homo sapiens]. 7950.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Homo sapiens]. 7790.0O
Contig/Assembly ProteinHSPA6heat shock 70 kDa protein 6 [Homo sapiens]. 7480.0O
Contig/Assembly ProteinHSPA578 kDa glucose-regulated protein precursor [Homo sapiens]. 604e-173O
Contig/Assembly ProteinHSPA9stress-70 protein, mitochondrial precursor [Homo sapiens]. 459e-129
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 isoform 1 [Homo sapiens]. 2712e-72O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHspa8heat shock cognate 71 kDa protein [Mus musculus]. 8710.0O
Contig/Assembly ProteinHspa2heat shock-related 70 kDa protein 2 [Mus musculus]. 7940.0O
Contig/Assembly ProteinHspa2heat shock-related 70 kDa protein 2 [Mus musculus]. 7940.0O
Contig/Assembly ProteinHspa1aheat shock 70 kDa protein 1A [Mus musculus]. 7930.0O
Contig/Assembly ProteinHspa1bheat shock 70 kDa protein 1B [Mus musculus]. 7930.0O
Contig/Assembly ProteinHspa1lheat shock 70 kDa protein 1-like [Mus musculus]. 7850.0O
Contig/Assembly ProteinHspa578 kDa glucose-regulated protein precursor [Mus musculus]. 601e-172O
Contig/Assembly ProteinHspa578 kDa glucose-regulated protein precursor [Mus musculus]. 601e-172O
Contig/Assembly ProteinHspa9stress-70 protein, mitochondrial [Mus musculus]. 456e-128
Contig/Assembly ProteinHspa14heat shock 70 kDa protein 14 isoform 1 [Mus musculus]. 2663e-71O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479406PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 1 [Canis familiaris]. 8710.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to heat shock protein 8 isoform 3 [Canis familiaris]. 8710.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to heat shock 70kDa protein 8 isoform 2 isoform 2 [Canis familiaris]. 8270.0O
Contig/Assembly ProteinLOC607182PREDICTED: similar to heat shock 70kDa protein 8 isoform 2 isoform 2 [Canis familiaris]. 8160.0O
Contig/Assembly ProteinLOC479406PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 4 [Canis familiaris]. 7980.0O
Contig/Assembly ProteinLOC480355PREDICTED: similar to heat shock protein 2 isoform 1 [Canis familiaris]. 7940.0O
Contig/Assembly ProteinLOC607182PREDICTED: similar to Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) isoform 1 [Canis familiaris]. 7870.0O
Contig/Assembly ProteinHSP70heat shock 70 kDa protein 1 [Canis lupus familiaris]. 7860.0O
Contig/Assembly ProteinLOC474850PREDICTED: similar to heat shock 70kDa protein 1-like isoform 1 [Canis familiaris]. 7820.0O
Contig/Assembly ProteinLOC480355PREDICTED: similar to heat shock protein 2 isoform 2 [Canis familiaris]. 7510.0O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock cognate 71 kDa protein [Bos taurus]. 8690.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1B [Bos taurus]. 7920.0O
Contig/Assembly ProteinHSPA1Aheat shock 70 kDa protein 1A [Bos taurus]. 7910.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Bos taurus]. 7850.0O
Contig/Assembly ProteinHSPA2heat shock-related 70 kDa protein 2 [Bos taurus]. 7690.0O
Contig/Assembly ProteinHSPA6PREDICTED: heat shock protein 70-like [Bos taurus]. 7440.0O
Contig/Assembly ProteinHSPA6PREDICTED: heat shock protein 70-like [Bos taurus]. 7440.0O
Contig/Assembly ProteinHSPA578 kDa glucose-regulated protein precursor [Bos taurus]. 602e-172O
Contig/Assembly ProteinHSPA9stress-70 protein, mitochondrial precursor [Bos taurus]. 459e-129
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 [Bos taurus]. 2702e-72O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHSPA8heat shock 70kDa protein 8 [Sus scrofa]. 8720.0O
Contig/Assembly ProteinLOC100621324PREDICTED: heat shock-related 70 kDa protein 2-like [Sus scrofa]. 7940.0O
Contig/Assembly ProteinHSP70.2heat shock 70 kDa protein 1B [Sus scrofa]. 7910.0O
Contig/Assembly ProteinHSPA1Lheat shock 70 kDa protein 1-like [Sus scrofa]. 7850.0O
Contig/Assembly ProteinHSP70heat shock 70 kDa protein [Sus scrofa]. 7560.0O
Contig/Assembly ProteinHSPA5PREDICTED: 78 kDa glucose-regulated protein [Sus scrofa]. 602e-172O
Contig/Assembly ProteinLOC100524210PREDICTED: heat shock cognate 71 kDa protein-like [Sus scrofa]. 503e-143O
Contig/Assembly ProteinHSPA9PREDICTED: stress-70 protein, mitochondrial [Sus scrofa]. 456e-128
Contig/Assembly ProteinHSPA14heat shock 70 kDa protein 14 [Sus scrofa]. 2733e-73O
Contig/Assembly ProteinLOC100152073PREDICTED: heat shock 70 kDa protein 13 [Sus scrofa]. 2632e-70O

Assembly Members: 405      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
DCI010078G12DCI01_0078_G12.bDB796531 AK391436
HTMT10021C11HTMT1_0021_C11.bFS665739 AK391768
HTMT10034E07HTMT1_0034_E07.bFS666678 AK391930
HTMT10046C06HTMT1_0046_C06.bFS667412 AK392041
HTMT10070D12HTMT1_0070_D12.bFS669208 AK392393
LVRM10169A12LVRM1_0169_A12.bBW963125 AK233535


SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000436 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0078_G12.b : ncccaaaannaaaaacgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_E08.b :
BFLT1_0056_B02.b :
ADR01_0049_E12.b :
ILNT1_0071_B01.b :
BMWN1_0036_C06.b :
BMWN1_0079_C07.b :
UTR01_0012_G03.b :
HTMT1_0084_H05.b :
HTMT1_0127_E05.b :
ILNT1_0071_B03.b :
CBLT1_0061_G11.b :
BMWN1_0021_G09.b :
BMWN1_0043_D05.b :
ILNT1_0025_F08.b :
ADR01_0040_C03.b :
HTMT1_0070_C12.b :
CBLT1_0092_D08.b :
ITT01_0103_G03.b :
CBLT1_0011_C01.b :
HTMT1_0086_D05.b :
HTMT1_0119_C01.b :
BMWN1_0013_F07.b :
HTMT1_0070_E07.b :
CLNT1_0145_D06.b :
LVR01_0082_E10.b :
HTMT1_0070_D12.b :
ITT01_0102_D07.b :
LVR01_0079_E07.b :
HTMT1_0021_C11.b :
HTMT1_0030_F06.b :
THY01_0065_H08.b :
ILNT1_0016_C07.b :
CBLT1_0052_E12.b :
OVR01_0020_E07.b :
PTG01_0096_D04.b :
HTMT1_0141_B05.b :
OVRM1_0133_C10.b :
PTG01_0063_G05.b :
SPL01_0039_H07.b :
SMG01_0036_F05.b :
BFLT1_0088_D05.b :
PBL01_0105_C09.b :
HTMT1_0004_G01.b :
LNG01_0006_G02.b :
HTMT1_0046_C06.b :
BMWN1_0010_D08.b :
THY01_0203_H03.b :
OVRT1_0049_G01.b :
HTMT1_0125_B12.b :
ADR01_0027_E01.b :
SPL01_0024_F01.b :
ILNT1_0088_E12.b :
CLNT1_0144_F11.b :
BFLT1_0115_A08.b :
HTMT1_0147_D07.b :
BFLT1_0074_C06.b :
AMP01_0011_H07.b : nnnaaacgtatctaaxxxxxx
BFLT1_0066_E10.b :
ITT01_0037_C12.b :
ITT01_0001_D04.b :
ADR01_0079_C04.b :
SPLT1_0097_C12.b :
BMWN1_0029_D12.b :
DCI01_0027_G07.b : nnnaacgatactaaxxxxxxxxx
BMWN1_0040_F04.b :
ILNT1_0060_G12.b :
ILNT1_0012_C10.b :
BMWN1_0026_H01.b :
AMP01_0014_E04.b : nnnttactatctaaxxxxxxxxx
AMP01_0009_B05.b : nnnttgtaatcttxxxxxxxxxx
AMP01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0012_B04.b : nttaaaacttaannnnnnnnctccnnnnnaaggatacntatagggctxxx
BMWN1_0029_H08.b :
AMP01_0007_D04.b : aatataccgtatcttxxxxxxxxxx
DCI01_0013_B08.b : nnnaacatacxxxxxxxxxxxx
AMP01_0070_E03.b : acatcatagggatacttxxxxxxxxx
BMWN1_0029_A07.b :
AMP01_0012_A08.b : ntttaaccttagggctaattttcnaggattccataxxxxxxxxx
HTMT1_0121_G09.b :
AMP01_0020_G06.b : nttttacgatatccttxxxxxxxxxx
AMP01_0060_G08.b : aaacccnnttaagaatcttxxxxxxxxx
AMP01_0012_H02.b : aaataccgatatcttxxxxxxxxxxx
AMP01_0098_A05.b : ggcgaataactccgxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : nnnggaaaanttaagagatactaaxxxxxxxxxx
BMWN1_0081_B10.b :
AMP01_0018_A06.b : nntttacgaatctaaxxxxxxxx
AMP01_0050_G07.b : nnnggttaaatatagggatacttaxxxxxxx
AMP01_0053_C10.b : nnnnccagataannttagggaccttggggctg
SMG01_0016_G03.b :
AMP01_0062_E05.b : nnnnccaatanaataagggacacattxxxxxxxxx
AMP01_0069_G12.b : gagaaactcatagcgatacttaxxxxxxxxx
AMP01_0099_A03.b : gcggtaxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : nnnggagataaantaagggatatcttxxxxxxxxx
MLTL1_0077_A02.b : nnnggactattnnnnnnacgaaaccatxxxxxxxxxx
AMP01_0048_F09.b : ggagaccttatgggatatcttxxxxxxx
AMP01_0022_F02.b : ttatagctgcttatxxxxxxxxxx
SPLT1_0001_D05.b :
OVR01_0052_D09.b :
CLNT1_0141_G06.b :
AMP01_0025_G02.b : nnaatggaatcttxxxxxxxxxx
HTMT1_0119_A08.b :
AMP01_0013_F03.b : nnaatacaattatxxxxxxxx
AMP01_0093_E08.b : cggtxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : naacgaatctatxxxxxxxxxx
DCI01_0075_E02.b : nttatcgtaactatagggct
MLTL1_0053_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0086_C11.b : ctatctgggggtaatnnnanggtattatngggctg
DCI01_0010_D01.b : ctttggggtatcttxxxxxxxxx
OVRT1_0098_H11.b :
SPLT1_0003_E05.b :
BFLT1_0046_B08.b :
DCI01_0066_H05.b : nnnnaaacgtaactaaxxxxxxxxx
AMP01_0025_H03.b : nnttaaggaatcttxxxxxxxxxx
BMWN1_0044_B11.b :
DCI01_0002_G03.b : taaccttatagggatacttaxxxxxxxxx
SPLT1_0064_E07.b :
AMP01_0033_B10.b : nnnccgataaanttataggatacttgggctg
AMP01_0026_F04.b : ttaaaggaatcttxxxxxxxxx
HTMT1_0059_F03.b :
AMP01_0098_H08.b : gggataactccgxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b :
OVRT1_0072_F11.b :
CBLT1_0006_A09.b :
AMP01_0052_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0046_A04.b :
AMP01_0024_E08.b : nngggtttttttatanggacaattxxxxxxxxxxx
HTMT1_0062_E03.b :
AMP01_0033_H04.b : nnggcgatatantttgagatacattxxxxxxxx
DCI01_0112_B07.b : nnncccaatttatnnnnggatactatagggctgc
ITT01_0012_A02.b :
SPLT1_0081_C04.b :
SPLT1_0001_E08.b :
AMP01_0010_G09.b : nnaaacgtaatctaagggctxxx
DCI01_0074_F08.b : nnnnncgatactatagggctxxx
DCI01_0073_A07.b : nnaatactaactaaxxxxxxxxx
CBLT1_0002_B08.b :
AMP01_0017_G08.b : nnnttacttaattatxxxxxxxxxx
OVRM1_0066_F11.b :
THY01_0102_B09.b :
OVRM1_0027_F06.b :
OVRM1_0036_D11.b :
OVRM1_0225_F03.b :
DCI01_0058_C12.b : atgatacactcxxxxxxxxxxxxxx
OVR01_0076_B10.b :
OVRM1_0090_F03.b :
OVRM1_0171_E10.b :
OVRM1_0111_H12.b :
OVRM1_0217_F08.b :
OVRM1_0117_B08.b :
OVRM1_0059_A11.b :
OVRM1_0084_A09.b :
PTG01_0045_H12.b :
OVRM1_0049_D11.b :
OVRM1_0122_H06.b :
SMG01_0051_A01.b :
ILNT1_0011_D03.b :
DCI01_0032_G09.b : nnaaactaactaaxxxxx
DCI01_0037_C02.b : nnnaagatactaaxxxxxxx
BFLT1_0117_C08.b :
SMG01_0052_E04.b :
PTG01_0031_B12.b :
AMP01_0005_H11.b : nnaataagtatcaxxxxxxx
LNG01_0086_B11.b :
DCI01_0038_B10.b : nggtatctaaxxxxxx
DCI01_0012_H07.b : nnnaaactatcttxxxxxxxx
LNG01_0012_B09.b :
DCI01_0027_D04.b : nnnaaagatacaaxxxxxx
AMP01_0028_H06.b : tttaaccgtatctaxxxxxx
MLTL1_0089_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0093_C05.b : gcgctxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : gaaaccttataggatatcttxxxxxx
AMP01_0019_A08.b : ntttacatatttaaxxxxxxx
DCI01_0106_D03.b : aaaaaacgatactaaxxxxxx
DCI01_0041_G08.b : nnnnggatactaaxxxxxxx
AMP01_0034_A05.b : nnnggcgatatattantaagatacttxxxxx
MLTL1_0031_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0067_B02.b : nnnnnccgaaccatxxxxxxxx
DCI01_0009_G06.b : actctatgggatacttxxxxxxx
PTG01_0069_G02.b :
SMG01_0062_F07.b :
AMP01_0093_G05.b : gcggtaacttngxxxxxxxxxxxxx
AMP01_0016_E01.b : nntttggaatctaaxxxx
AMP01_0028_G07.b : nnnnttcgactcttxxxxxx
SMG01_0063_B10.b :
OVR01_0035_D11.b :
SMG01_0023_E02.b :
BFLT1_0128_F02.b :
LNG01_0031_H03.b :
OVR01_0060_D01.b :
OVRT1_0004_G11.b :
MLN01_0006_G11.b :
THY01_0032_F12.b :
DCI01_0066_G01.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0136_F08.b :
AMP01_0032_A06.b : nnnccgatatnntntatagatacttxxxxx
OVR01_0044_H06.b :
THY01_0008_H10.b :
AMP01_0017_D03.b : nnggtatannnnntttggaatctaaxxxxx
BFLT1_0033_D02.b :
MLN01_0022_D07.b :
ITT01_0026_B03.b :
PBL01_0052_C08.b :
ITT01_0076_A08.b :
LNG01_0091_E09.b :
ITT01_0094_G10.b :
DCI01_0005_A03.b : nnnccgaaccatxxxxx
PBL01_0057_E10.b :
LNG01_0018_E03.b :
DCI01_0114_B12.b : nnnnggtaaaataanaccgatactaaxxxxxx
AMP01_0085_G08.b : nnnnccgtatcatxxxxxxxx
OVRT1_0100_B05.b :
AMP01_0049_C11.b : nnnggtgataatatagggatatcttxxxxxx
SMG01_0035_A07.b :
DCI01_0100_H10.b : nttaaaacatacatxxxxxx
LNG01_0108_F03.b :
AMP01_0033_C09.b : nnggagatatatattaggatatcttxxxxx
MLN01_0061_H09.b :
DCI01_0096_A08.b : nnnnccgatactaaxxxxx
OVRT1_0073_B06.b :
PBL01_0025_H11.b :
AMP01_0017_C12.b : nttttactatccaxxxxxxxx
AMP01_0077_F10.b : nncctgtatatatagggatactaaxxxx
AMP01_0052_A11.b : nnnncagaaannataagagaatcattaggg
KDN01_0059_B10.b :
AMP01_0025_G01.b : nnnaaatgaatcatxxxxxx
ITT01_0098_H05.b :
DCI01_0114_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0098_G09.b : nnnnccgatactatagggct
LNG01_0066_D11.b :
DCI01_0072_H01.b : nttttttattaatggaacctatagggc
DCI01_0094_C07.b : nnccaatannnnnnnnggatactatagggc
PBL01_0090_H12.b :
ADR01_0084_G03.b :
OVR01_0042_E03.b :
AMP01_0097_B09.b : gggcataaatccaxxxxxxxxxxxx
MLN01_0017_E06.b :
BKFL1_0012_F02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0016_G06.b : nngggtatttnnnttggaatctaaxxxxx
ILNT1_0054_C09.b :
DCI01_0080_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0006_D01.b :
ILNT1_0015_C04.b :
BMWN1_0017_B06.b :
LVR01_0026_E03.b :
BFLT1_0137_E12.b :
PTG01_0070_F06.b :
BMWN1_0035_F06.b :
BMWN1_0069_B08.b :
HTMT1_0034_E07.b :
HTMT1_0103_E02.b :
BMWN1_0095_H12.b :
LNG01_0035_H06.b :
HTMT1_0053_G01.b :
ILNT1_0004_E12.b :
ILNT1_0001_D11.b :
OVRM1_0164_D02.b :
OVRM1_0051_B03.b :
AMP01_0002_F08.b : atatgtatxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : gatatcttngggggatatcttgg
BFLT1_0120_F08.b :
DCI01_0021_A09.b : nnaaaagtaacaa
AMP01_0017_C08.b : nntttacgaatcttxxx
AMP01_0068_E11.b : nnggagataantatagggacacatt
DCI01_0022_D04.b : tttaacgtaacaax
SPLT1_0017_G01.b :
BFLT1_0092_G06.b :
AMP01_0009_C09.b : naaaaacgtatctatxxxx
LNG01_0013_D09.b :
OVRT1_0090_F09.b :
CBLT1_0008_C05.b :
MLTL1_0045_C08.b : nnnnccgaatttnnnnntagatactaax
KDN01_0053_A05.b :
BFLT1_0074_F02.b :
AMP01_0093_C04.b : gggatxxxxxxxxxxxxxx
OVRT1_0025_G02.b :
BFLT1_0070_D08.b :
ADR01_0063_H09.b :
KDN01_0023_A05.b :
ITT01_0038_E04.b :
SKNB1_0074_A02.b :
KDN01_0068_G05.b :
AMP01_0088_E11.b : naaaggaatcttx
OVRT1_0091_E06.b :
PBL01_0061_G02.b :
PBL01_0093_E02.b :
MLN01_0094_H09.b :
DCI01_0082_D11.b : nggcgtaannnnaaacgatatctax
AMP01_0053_C01.b : nnnggcgataaanntaagggatatcttxx
LVRM1_0169_A12.b :
THY01_0111_G02.b :
OVRM1_0113_B01.b :
OVRM1_0058_A03.b :
OVRM1_0175_D12.b :
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnn
OVRM1_0202_B09.b :
OVR01_0078_A12.b :
OVRM1_0010_G09.b :
OVRM1_0079_H09.b :
PTG01_0050_B05.b :
OVR01_0072_G07.b :
PTG01_0049_F01.b :
ADR01_0045_F03.b :
PBL01_0028_C12.b :
OVRT1_0109_B07.b :
OVRT1_0077_A07.b :
OVRT1_0128_F06.b :
LNG01_0104_C11.b :
PST01_0069_C03.b :
BFLT1_0026_G12.b :
BFLT1_0119_B09.b :
OVRT1_0141_B02.b :
PBL01_0087_H08.b :
SKNB1_0034_G06.b :
THY01_0099_D01.b :
PBL01_0105_H03.b :
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b :
KDN01_0055_B04.b :
THY01_0088_G11.b :
LVR01_0055_D02.b :
BFLT1_0100_F09.b :
PBL01_0106_B09.b :
OVR01_0039_B12.b :
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b :
LNG01_0069_G11.b :
OVR01_0050_D08.b :
PBL01_0100_D09.b :
UTR01_0095_F11.b :
KDN01_0012_B11.b :
SKNB1_0015_H05.b :
BFLT1_0002_C12.b :
OVR01_0049_D04.b :
PST01_0055_C12.b :
PBL01_0090_E04.b :
AMP01_0099_B02.b : gcgcaxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b :
KDN01_0013_E12.b :
OVRM1_0223_D07.b :
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b :
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b :
KDN01_0001_E05.b :
MLN01_0092_G11.b :
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b :
PTG01_0101_H11.b :
BMWN1_0081_A10.b :
PTG01_0074_A03.b :
PTG01_0073_B07.b :
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b :
DCI01_0029_D02.b : nnnggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b :
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
DCI01_0078_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_E08.b : agcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0056_B02.b : gattccgtcagcgnacgnatgxx
ADR01_0049_E12.b :
ILNT1_0071_B01.b :
BMWN1_0036_C06.b :
BMWN1_0079_C07.b :
UTR01_0012_G03.b : tgg
HTMT1_0084_H05.b :
HTMT1_0127_E05.b :
ILNT1_0071_B03.b :
CBLT1_0061_G11.b :
BMWN1_0021_G09.b :
BMWN1_0043_D05.b :
ILNT1_0025_F08.b :
ADR01_0040_C03.b :
HTMT1_0070_C12.b :
CBLT1_0092_D08.b :
ITT01_0103_G03.b :
CBLT1_0011_C01.b :
HTMT1_0086_D05.b :
HTMT1_0119_C01.b :
BMWN1_0013_F07.b :
HTMT1_0070_E07.b :
CLNT1_0145_D06.b :
LVR01_0082_E10.b : gacxxxxxxxx
HTMT1_0070_D12.b :
ITT01_0102_D07.b :
LVR01_0079_E07.b : gcatttggg
HTMT1_0021_C11.b :
HTMT1_0030_F06.b :
THY01_0065_H08.b : ccttt
ILNT1_0016_C07.b :
CBLT1_0052_E12.b :
OVR01_0020_E07.b : gggggggca
PTG01_0096_D04.b :
HTMT1_0141_B05.b :
OVRM1_0133_C10.b :
PTG01_0063_G05.b :
SPL01_0039_H07.b : gaggacatt
SMG01_0036_F05.b :
BFLT1_0088_D05.b :
PBL01_0105_C09.b :
HTMT1_0004_G01.b :
LNG01_0006_G02.b : ggtttaactggctt
HTMT1_0046_C06.b :
BMWN1_0010_D08.b :
THY01_0203_H03.b : cctttacg
OVRT1_0049_G01.b : nngggtt
HTMT1_0125_B12.b :
ADR01_0027_E01.b :
SPL01_0024_F01.b :
ILNT1_0088_E12.b :
CLNT1_0144_F11.b :
BFLT1_0115_A08.b :
HTMT1_0147_D07.b :
BFLT1_0074_C06.b :
AMP01_0011_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_E10.b :
ITT01_0037_C12.b :
ITT01_0001_D04.b :
ADR01_0079_C04.b :
SPLT1_0097_C12.b :
BMWN1_0029_D12.b :
DCI01_0027_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F04.b :
ILNT1_0060_G12.b :
ILNT1_0012_C10.b :
BMWN1_0026_H01.b :
AMP01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A08.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_H08.b :
AMP01_0007_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_A07.b :
AMP01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_G09.b :
AMP01_0020_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_B10.b :
AMP01_0018_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C10.b : ctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_G03.b :
AMP01_0062_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_D05.b :
OVR01_0052_D09.b : n
CLNT1_0141_G06.b :
AMP01_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_A08.b :
AMP01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_G02.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_C11.b : ctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_H11.b :
SPLT1_0003_E05.b :
BFLT1_0046_B08.b :
DCI01_0066_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B11.b :
DCI01_0002_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0064_E07.b :
AMP01_0033_B10.b : ctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_F03.b :
AMP01_0098_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b :
OVRT1_0072_F11.b :
CBLT1_0006_A09.b :
AMP01_0052_B09.b : nnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A04.b :
AMP01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E03.b :
AMP01_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_B07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_A02.b :
SPLT1_0081_C04.b :
SPLT1_0001_E08.b :
AMP01_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_B08.b :
AMP01_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_F11.b :
THY01_0102_B09.b :
OVRM1_0027_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0036_D11.b :
OVRM1_0225_F03.b :
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_B10.b : gc
OVRM1_0090_F03.b :
OVRM1_0171_E10.b :
OVRM1_0111_H12.b :
OVRM1_0217_F08.b :
OVRM1_0117_B08.b :
OVRM1_0059_A11.b :
OVRM1_0084_A09.b :
PTG01_0045_H12.b :
OVRM1_0049_D11.b :
OVRM1_0122_H06.b :
SMG01_0051_A01.b :
ILNT1_0011_D03.b :
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_C08.b :
SMG01_0052_E04.b :
PTG01_0031_B12.b :
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_B11.b :
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_B09.b : xxxxxx
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_H10.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_D09.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0069_G02.b :
SMG01_0062_F07.b :
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0063_B10.b :
OVR01_0035_D11.b : aaggctxxx
SMG01_0023_E02.b :
BFLT1_0128_F02.b :
LNG01_0031_H03.b : tgttttagatt
OVR01_0060_D01.b : nn
OVRT1_0004_G11.b :
MLN01_0006_G11.b :
THY01_0032_F12.b : attt
DCI01_0066_G01.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_F08.b : nnnccaa
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_H06.b : gaggatxx
THY01_0008_H10.b : xxxx
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0033_D02.b :
MLN01_0022_D07.b :
ITT01_0026_B03.b :
PBL01_0052_C08.b :
ITT01_0076_A08.b :
LNG01_0091_E09.b :
ITT01_0094_G10.b :
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0057_E10.b :
LNG01_0018_E03.b : gcat
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_B05.b :
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_A07.b :
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_F03.b :
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_H09.b :
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_B06.b : nt
PBL01_0025_H11.b :
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_A11.b : ctgctcgcgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0059_B10.b :
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_H05.b :
DCI01_0114_E12.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_D11.b :
DCI01_0072_H01.b : tgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0090_H12.b :
ADR01_0084_G03.b :
OVR01_0042_E03.b : ggggca
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0017_E06.b :
BKFL1_0012_F02.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0054_C09.b :
DCI01_0080_G03.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_D01.b :
ILNT1_0015_C04.b :
BMWN1_0017_B06.b :
LVR01_0026_E03.b :
BFLT1_0137_E12.b :
PTG01_0070_F06.b :
BMWN1_0035_F06.b :
BMWN1_0069_B08.b :
HTMT1_0034_E07.b :
HTMT1_0103_E02.b :
BMWN1_0095_H12.b :
LNG01_0035_H06.b :
HTMT1_0053_G01.b :
ILNT1_0004_E12.b :
ILNT1_0001_D11.b :
OVRM1_0164_D02.b :
OVRM1_0051_B03.b :
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : cgnctgtcctccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_F08.b :
DCI01_0021_A09.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_G01.b :
BFLT1_0092_G06.b :
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D09.b :
OVRT1_0090_F09.b :
CBLT1_0008_C05.b : nnnccgcaggagaggccg
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_A05.b :
BFLT1_0074_F02.b :
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_G02.b :
BFLT1_0070_D08.b :
ADR01_0063_H09.b :
KDN01_0023_A05.b :
ITT01_0038_E04.b :
SKNB1_0074_A02.b :
KDN01_0068_G05.b :
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_E06.b :
PBL01_0061_G02.b :
PBL01_0093_E02.b :
MLN01_0094_H09.b :
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_A12.b :
THY01_0111_G02.b :
OVRM1_0113_B01.b :
OVRM1_0058_A03.b :
OVRM1_0175_D12.b :
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0202_B09.b :
OVR01_0078_A12.b :
OVRM1_0010_G09.b :
OVRM1_0079_H09.b :
PTG01_0050_B05.b :
OVR01_0072_G07.b :
PTG01_0049_F01.b :
ADR01_0045_F03.b :
PBL01_0028_C12.b :
OVRT1_0109_B07.b :
OVRT1_0077_A07.b :
OVRT1_0128_F06.b :
LNG01_0104_C11.b :
PST01_0069_C03.b :
BFLT1_0026_G12.b :
BFLT1_0119_B09.b :
OVRT1_0141_B02.b : n
PBL01_0087_H08.b :
SKNB1_0034_G06.b :
THY01_0099_D01.b : g
PBL01_0105_H03.b :
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b :
KDN01_0055_B04.b :
THY01_0088_G11.b :
LVR01_0055_D02.b : c
BFLT1_0100_F09.b :
PBL01_0106_B09.b :
OVR01_0039_B12.b : aaag
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b :
LNG01_0069_G11.b :
OVR01_0050_D08.b :
PBL01_0100_D09.b :
UTR01_0095_F11.b :
KDN01_0012_B11.b :
SKNB1_0015_H05.b :
BFLT1_0002_C12.b :
OVR01_0049_D04.b :
PST01_0055_C12.b :
PBL01_0090_E04.b :
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b :
KDN01_0013_E12.b :
OVRM1_0223_D07.b :
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b :
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b :
KDN01_0001_E05.b :
MLN01_0092_G11.b :
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b :
PTG01_0101_H11.b :
BMWN1_0081_A10.b :
PTG01_0074_A03.b :
PTG01_0073_B07.b :
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b :
DCI01_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b :
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
20110601C-000436 : .................................................ATAAGAGATAG
---------+---------+---------+---------+---------+---------+ 11
DCI01_0078_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATAAGAGATAG
OVR01_0073_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGATAG
BFLT1_0056_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaGAGATAG
ADR01_0049_E12.b : tttttaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
ILNT1_0071_B01.b : nnccgaagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0036_C06.b : tcccaaatgtaagacgccxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0079_C07.b : ttttggacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_G03.b : gggcacctattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0084_H05.b : tttttagatagtaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0127_E05.b : ttttggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0071_B03.b : nnnncgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0061_G11.b : ntttttgcaggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0021_G09.b : tgactatgaagacgxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0043_D05.b : ttcgagattacacgcagtagtattaaxxxxxxxxxxxxx
ILNT1_0025_F08.b : ttttcgcaggagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0040_C03.b : nttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0070_C12.b : ttcgcaagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0092_D08.b : tggtaatgacacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0103_G03.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0011_C01.b : ttttccacagtacacgcagtagtaxxxxxxxxxxxxxxxxxxx
HTMT1_0086_D05.b : tttnacgacagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_C01.b : nnnnggacagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0013_F07.b : tttaggcaagtacacgccgtagtaxxxxxxxxxxxxxxxxxx
HTMT1_0070_E07.b : ttggcaagaagaggccgtaxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0145_D06.b : nnnnnacgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0070_D12.b : ttttccgacagaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_D07.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_E07.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0021_C11.b : ttttggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0030_F06.b : tttccgagagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0065_H08.b : tggatgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0016_C07.b : gagtgtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0052_E12.b : nnttggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_E07.b : cctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0096_D04.b : nnnccactttttntnnngggtcaagcagcggtaxxxxxxxxxxxxxxx
HTMT1_0141_B05.b : tttaaggatgataagacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_C10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0063_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0039_H07.b : atgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0036_F05.b : nggcatatttnnnnnggagtaagcagcggnacggntccggattctcg
BFLT1_0088_D05.b : nggaatcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_C09.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0004_G01.b : tcccgcat
LNG01_0006_G02.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_C06.b : tttttggacagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0010_D08.b : nnnnnggatgagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0203_H03.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_G01.b : ttnnnnnnctccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0125_B12.b : tttggacagtacgacgcagtagtaxxxxxxxxxxxxxxxxxx
ADR01_0027_E01.b : ttatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_F01.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0088_E12.b : ntttacctagtacacgccgtagtattaaxxxxxxxxxxxxx
CLNT1_0144_F11.b : nnnnnccgacagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0115_A08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0147_D07.b : tttttaccaagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0074_C06.b : nggactcgttagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_E10.b : ggtttcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_C12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_D04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0079_C04.b : nnnaaatagactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0097_C12.b : nnnggcgcgagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_D12.b : tttttagcaagtacacgxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0040_F04.b : nggaaagaagacgccgtaxxxxxxxxxxxxxxxxxx
ILNT1_0060_G12.b : nnnngggcggtacgaggxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0012_C10.b : nnnccgcaagtacacgxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0026_H01.b : ttttaccacgtgaagacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_H08.b : ttttaccagagtagaxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0007_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0029_A07.b : ttttagacaggagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_G09.b : nnttacgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0020_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0098_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0081_B10.b : ttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0018_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_G03.b : nnaatatttttnannggataaagcagcxxxxxxxxxxxxxxxxxxxxx
AMP01_0062_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0077_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_D05.b : nnnnccaagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_D09.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0141_G06.b : nnnnccgtcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_A08.b : ntttggatagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0010_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0075_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0053_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0086_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_H11.b : ntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0003_E05.b : nnnnccaagtacacxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0046_B08.b : nggatcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0044_B11.b : ttcgacgttacacgxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0064_E07.b : nnccgcatgagaggxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0059_F03.b : tttttagagagtagaggccgtagtattaaxxxxxxxxxxx
AMP01_0098_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0005_A09.b : nttttggacggtacacgcagtagtattaaxxxxxxxxxx
OVRT1_0072_F11.b : nncctcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_A09.b : nttttcgcaagacacxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0046_A04.b : tttttagacgagagaggccgtaxxxxxxxxxxxxxxxxxxx
AMP01_0024_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0062_E03.b : ttttggacagtagaggxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_A02.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0081_C04.b : nnccgcagtagaggxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_E08.b : nnnngctagtacacgxxxxxxxxxxxxx
AMP01_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0073_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0002_B08.b : tttttccaggtacacgxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_F11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0102_B09.b : cgcgtccggtc
OVRM1_0027_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0036_D11.b : aattttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_B10.b : attagggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0090_F03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_H12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_F08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_A11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_A09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0045_H12.b : nnnaaaaaaattntnnggataaagcagcxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_D11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0051_A01.b : nnnaacttttnnnnngggataaagcagcggtacggntccggattctc
ILNT1_0011_D03.b : tttccgcagtagaggccgtagtatttnxxxxxxxxxxx
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0117_C08.b : ccccttcgcgaacgaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0052_E04.b : nnnttcgttnnnnnaagagtaagcagcxxxxxxxxxxxxxxxxxxxxx
PTG01_0031_B12.b : ttttttggatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_B11.b : tttnttagatggacatgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0069_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0062_F07.b : nngacatttttnnnggataaagcagcggtaxxxxxxxxxxxxxxx
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0063_B10.b : ncgctttttnnnnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0035_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_E02.b : nnggagtttcttnnnnggactaagcagcggtaxxxxxxxxxxxxxxxx
BFLT1_0128_F02.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_H03.b : tgattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_D01.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_G11.b : nttttcctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0006_G11.b : nnntttctggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_F12.b : ggtgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0066_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_F08.b : ttcaccnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0033_D02.b : ggaatccgtcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0022_D07.b : ntttggtaggatatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0026_B03.b : nnggatgaacaxxxxxxxxxxxxxxxxxx
PBL01_0052_C08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxx
ITT01_0076_A08.b : nnnnggatcaacaxxxxxxxxxxxxxxxxx
LNG01_0091_E09.b : tttnnggcattggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0094_G10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0057_E10.b : tagatgaacaxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0018_E03.b : tttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_B05.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_A07.b : nnggatattttntnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0108_F03.b : nnnnnggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_H09.b : ngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_B06.b : agttttnnnnncccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_H11.b : nagataaacaxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0059_B10.b : nntttctacggtgg
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0098_H05.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0114_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_D11.b : nnnnnggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0090_H12.b : nnaaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0084_G03.b : nnnnnnggatcaacagctxxxxxxxxxxxxxxxxxxx
OVR01_0042_E03.b : ttaggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0017_E06.b : nntttagtggacttgnaagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0012_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0054_C09.b : nnnccgcgagtacacgccgtaxxxxxxxxxxxxxxxxx
DCI01_0080_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_D01.b : nnnggatgaacaxxxxxxxxxxxxxxxx
ILNT1_0015_C04.b : agaggccgtaxxxxxxxxxxxxxxx
BMWN1_0017_B06.b : nnnggacacagacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_E03.b : atggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0137_E12.b : nttttccgctagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0070_F06.b : nagaaatttnnnnggatcaagcagcxxxxxxxxxxxxxxxxxx
BMWN1_0035_F06.b : ttttggcagagtagaxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0069_B08.b : ttttggacagtacgacgcagtagtattaaxxxxxxx
HTMT1_0034_E07.b : nggcaggtacgacgxxxxxxxxxxxxxxxxxxxx
HTMT1_0103_E02.b : ttttggagagtacgaggcagtagtaxxxxxxxxxxx
BMWN1_0095_H12.b : tttttagacggtagacgcagtagtattaaxxxxxxx
LNG01_0035_H06.b : gcattttggcgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0053_G01.b : ntttatttttttttnggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0004_E12.b : nnnccgcggtacgaggcagtagtattaaxxxxxxx
ILNT1_0001_D11.b : tttcgcatgagaggxxxxxxxxxxxxxxxxxxx
OVRM1_0164_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0051_B03.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0067_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_F08.b : nnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_G01.b : nnggttcaagttagacgxxxxxxxxxxxxxxxxxxxx
BFLT1_0092_G06.b : gggaccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D09.b : tttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_F09.b : nttgcttttnnngnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0008_C05.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggaggccgggtatccgattta
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_A05.b :
BFLT1_0074_F02.b : ggatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_G02.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0070_D08.b : gggaccgtcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0063_H09.b : nnnnggagatacacagctgnacccgtccgaa
KDN01_0023_A05.b :
ITT01_0038_E04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxx
SKNB1_0074_A02.b :
KDN01_0068_G05.b : nnnnggct
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_E06.b : nggtatttnnnngnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_G02.b : nnggtgacacaxxxxxxxxxxxxxxxxxxx
PBL01_0093_E02.b : nnggatgaacaxxxxxxxxxxxxxxxxx
MLN01_0094_H09.b : nttgttaggacaagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_A12.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_G02.b : agtgtcaaaacagctggtxxxxxxxxxx
OVRM1_0113_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_A03.b : agttgatcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0175_D12.b : xxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_B09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_A12.b : nnggggcttggactataacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0010_G09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_H09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0050_B05.b : attttnggagtxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_G07.b : nnggattggacttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_F01.b : nggagtttttttttgatcxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0045_F03.b : nggtgaaacaxxxxxxxxxxxxxxxxxxxx
PBL01_0028_C12.b : nnttagtgaaacaxxxxxxxxxxxxxxxxxx
OVRT1_0109_B07.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_A07.b : nnnntttctattgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_F06.b : nncccttcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0104_C11.b : ttttttagatggacttgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0069_C03.b :
BFLT1_0026_G12.b : gacttcctatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0119_B09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_B02.b : nnccaatttnnnnnnnnccgttagcgttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0087_H08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
SKNB1_0034_G06.b : nnnncccttt
THY01_0099_D01.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_H03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
PST01_0099_B02.b :
KDN01_0085_E03.b :
PST01_0028_C05.b :
OVRT1_0081_B04.b : nnnnccgttagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0055_B04.b :
THY01_0088_G11.b : ccttttggctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D02.b : ctttatggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_F09.b : ggatcccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_B09.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxx
OVR01_0039_B12.b : gaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0058_B04.b :
KDN01_0030_B12.b :
TCH01_0094_A01.b : nntttgctagtactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0069_G11.b : tggggggctggacaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_D08.b : nnnnnagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0100_D09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxx
UTR01_0095_F11.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0012_B11.b : naaa
SKNB1_0015_H05.b : nnnnggat
BFLT1_0002_C12.b : gattccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_D04.b : ttttnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0055_C12.b :
PBL01_0090_E04.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxx
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0049_E06.b :
PST01_0021_B05.b :
KDN01_0014_E12.b : t
KDN01_0013_E12.b : tt
OVRM1_0223_D07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0091_A07.b :
KDN01_0064_G01.b :
KDN01_0064_D04.b :
KDN01_0015_A08.b : naac
KDN01_0065_D02.b :
PST01_0095_F12.b :
PST01_0082_A08.b :
OVRT1_0029_G08.b : ctcttcgctgacgatgttxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0001_E05.b : ngcatattnnn
MLN01_0092_G11.b : nncctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0052_D06.b :
PST01_0077_B03.b :
HTMT1_0117_F01.b : ttggagagtacgaggxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0101_H11.b : ncccgctttttnnnntttggagtaaagcaggcgtgntacggntcggaaattcctcn
BMWN1_0081_A10.b : tttccgatagtacgacgxxxxxxxxxxxxxxxxxxxxxx
PTG01_0074_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0073_B07.b : n
ADR01_0028_H07.b :
KDN01_0049_F04.b :
BMWN1_0028_B07.b : nnaaccagtagaggccagtgtatttaacgact
DCI01_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtt
OVRM1_0113_E05.b :
UTR01_0084_C01.b :
ADR01_0018_C11.b :
DCI01_0033_D05.b : nnnnaa
ADR01_0058_G02.b :
AMP01_0070_B08.b :
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 66
THY01_0102_B09.b : ggaatcccaacccggttggcTG*GATTGAAGGG**CGGG*AGCGCTTCGGG**TTG**GG
DCI01_0058_C12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0045_H12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0051_A01.b : gagcacgnttggcctactggCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGN
DCI01_0032_G09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0037_C02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0052_E04.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0031_B12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0086_B11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0038_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0012_H07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0012_B09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0027_D04.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_C05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0106_D03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGT
DCI01_0041_G08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0034_A05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0067_B02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0009_G06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0062_F07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0028_G07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0063_B10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0035_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0023_E02.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0031_H03.b : xxxxxxxxxxxxxxxxxxxxCT*CATCGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0060_D01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGT
MLN01_0006_G11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0032_F12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0066_G01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0032_A06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0008_H10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0022_D07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0026_B03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0052_C08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0094_G10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0005_A03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACAG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0018_E03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0114_B12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0085_G08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0049_C11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SMG01_0035_A07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGN
DCI01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0108_F03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0061_H09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0096_A08.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0025_H11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_C12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0077_F10.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0052_A11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0059_B10.b : ctactggaaaaaaaaaaaaaCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0025_G01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0098_H05.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0114_E12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0098_G09.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0066_D11.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0094_C07.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0090_H12.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0084_G03.b : xxxxxxxxxxxxxxxxxxxxCT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0097_B09.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0017_E06.b : xxxxxxxxxxxxxxxxxxxxgTGGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BKFL1_0012_F02.b : xxxxxxxxxxxxxxxxxxxatT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0054_C09.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCC*TCTGG*AGCGCTTCGGG**TTGCGGC
DCI01_0080_G03.b : xxxxxxxxxxxxxxxxxxxxxT*CATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ITT01_0006_D01.b : xxxxxxxxxxxxxxxxxxxxxG*GATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0015_C04.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCCGG*ATCGCTTCGGG**TTGCGGC
BMWN1_0017_B06.b : xxxxxxxxxxxxxxxxxxxxgcaCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0026_E03.b : xxxxxxxxxxxxxxxxxxxxxxxCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0137_E12.b : xxxxxxxxxxxxxxxxxxxxxxcGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0070_F06.b : xxxxxxxxxxxxxxxxxxxxxxxCATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0035_F06.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCTGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0069_B08.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0034_E07.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0103_E02.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BMWN1_0095_H12.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0035_H06.b : xxxxxxxxxxxxxxxxxxxactaGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0053_G01.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0004_E12.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ILNT1_0001_D11.b : xxxxxxxxxxxxxxxxxxxxxxxGATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0164_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0051_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0067_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxcgtTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0068_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0022_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SPLT1_0017_G01.b : xxxxxxxxxxxxxxxxxxxxxxgaTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0092_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0013_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0090_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
CBLT1_0008_C05.b : gggcgacgggcggaaaccggtctcATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLTL1_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0074_F02.b : xxxxxxxxxxxxxxxxxxxxxxxtATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0070_D08.b : xxxxxxxxxxxxxxxxxxxxxcggTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0063_H09.b : ttctccacactgttggcctactggATTGAACCC*TCCGG*AGCGCTTCCGG**TTGCGGC
ITT01_0038_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0074_A02.b : nnnnnttaactgttgctatgGATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0068_G05.b : gcgttggctatgggttggcactggTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0088_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0091_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0061_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0093_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
DCI01_0082_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0053_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxATTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVRM1_0169_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0111_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG**CGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0113_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0058_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0175_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0007_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0202_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0078_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCAGC
OVRM1_0010_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0079_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0050_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCCGG*AGCGCTTCCGG**TTGCGGC
PTG01_0049_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
ADR01_0045_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0028_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0109_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0077_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0128_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0104_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0026_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0119_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0141_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0087_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0034_G06.b : nnnnntnccaacgttggctctggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0099_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0105_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0099_B02.b : nnnaactgcgtttgctctggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0085_E03.b : nnnnnncctacggtggctatggctcATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0028_C05.b : ttttaacggcgttggctatggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0081_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0055_B04.b : nnnccttactgtggctatggggtctCTTGAACG*TCGGG*AGCGCTTCGGG**TTGCGGC
THY01_0088_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LVR01_0055_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0100_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0106_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0039_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0058_B04.b : nnnnncctgctgtggctaggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0030_B12.b : nnggtcgctgtggctctgctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
TCH01_0094_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
LNG01_0069_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0050_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0100_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
UTR01_0095_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0012_B11.b : ttttnnnnncctgcgggtgcacggcATTAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
SKNB1_0015_H05.b : nnnnnnaaacaacgttggctcggctATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
BFLT1_0002_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVR01_0049_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0055_C12.b : tttttgctgcagttggctatggATTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PBL01_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
AMP01_0099_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0049_E06.b : tcacgttggctctggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0014_E12.b : tttttttcctgctgttgctctggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0013_E12.b : ttatnttcctacggttgctatggctcTTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRM1_0223_D07.b : xxxxxxxxxxxxxxxxxxxxxxxtgggGAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0091_A07.b : nnnccaactgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0064_G01.b : nnnncctgctgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0064_D04.b : nnncctgctgttgctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0015_A08.b : ttttnnnnnncccgcgttggctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0065_D02.b : nnnnttcgctgtggctctggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0095_F12.b : nnnnncctgctgttgctctggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0082_A08.b : nncctgcgttggctatggaTGACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
OVRT1_0029_G08.b : xxxxxxxxxxxxxxxxxxxxxxxctcttAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0001_E05.b : nnnnncctgcagggtgcactgggctcttAACCG*TCGGG*AGCGCTTCGGG**TTGCGGC
MLN01_0092_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCG*TCGGG*AGCGCTTCGGG**TTGCGGC
KDN01_0052_D06.b : ggctctggattgaCG*TCGGG*AGCGCTTCGGG**TTGCGGC
PST01_0077_B03.b : nnncctgcagttgctatggattgaCG*TCGGG*AGCGCTTCGGG**TTGCGGC
HTMT1_0117_F01.b : xxxxxxxxxxxxxxxxxxxgggtctctcgtttcaTCGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0101_H11.b : agcactggnttggcctactggnattgaaccgnntcgGGA*AGCGCTTCGGGNNTTGCGGC
BMWN1_0081_A10.b : xxxxxxxxxxxxxxxxxxxxxgctcanacatttaaaGGG*AGCGCTTCGGG**TTGCGGC
PTG01_0074_A03.b : nnnnnnnnnnnnnnnnnntctcattgaccctntcgnnGG*AGCGCTTCGGGN*TTGCGGN
PTG01_0073_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0028_H07.b : ntgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0049_F04.b :
BMWN1_0028_B07.b : cctacacggaatttaatgaattgggtctcatcgtttaagagggaggggtatgggttgagg
DCI01_0029_D02.b : cttcctttaaaacaagtaacagagaagaacggggctcggtcgggtggaggaggggctgag
OVRM1_0113_E05.b : nagttgtcxxxxxxxxxxxxxx
UTR01_0084_C01.b : nnnnggcattgtactaanacxxxxxx
ADR01_0018_C11.b :
DCI01_0033_D05.b : catactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0058_G02.b :
AMP01_0070_B08.b : acatctatagggatacttaxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b :
AMP01_0002_H01.b :
AMP01_0039_G04.b :
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 124
DCI01_0029_D02.b : aaaagaagccgaatctattctccgcgggataccggAGCAACCATGTCTAAGGGACCTGCA
OVRM1_0113_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGTCTAAGGGACCTGCA
UTR01_0084_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCA
ADR01_0018_C11.b : gctaaacaxxxxxxxxxxxxxx
DCI01_0033_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0058_G02.b :
AMP01_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b :
AMP01_0002_H01.b : tatgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_G04.b : nngggatatttataacgatatcttxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 181
ADR01_0018_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGTGTG*GGTGTCTTCC*AGCACGGAAAA
DCI01_0033_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTG*GGTGTCTTCC*AGTACGGAAAA
ADR01_0058_G02.b : nnnnngctacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_D05.b : cxxxxxxxxxxxxxx
AMP01_0002_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 241
OVRM1_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCCTTTACT
AMP01_0002_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACT
AMP01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_C01.b :
OVR01_0074_F08.b :
TCH01_0058_F12.b :
TCH01_0056_B04.b :
OVRM1_0085_G07.b :
BFLT1_0003_F02.b :
PTG01_0106_B09.b :
DCI01_0033_H03.b :
PTG01_0078_G06.b :
AMP01_0075_F04.b :
LNG01_0005_G07.b :
DCI01_0030_D02.b :
MLTL1_0008_H10.b :
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 299
TCH01_0060_C01.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_F08.b : gcttttagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0058_F12.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
TCH01_0056_B04.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_G07.b : cagttgtcxxxxxxxxxxx
BFLT1_0003_F02.b : gggattcgttagctgtcgxxxx
PTG01_0106_B09.b :
DCI01_0033_H03.b : nnttaacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0078_G06.b :
AMP01_0075_F04.b : ngggatatantataggatacttxxxxxxxxxx
LNG01_0005_G07.b :
DCI01_0030_D02.b : nn
MLTL1_0008_H10.b : nnnnnnnnnnnnnnnn
AMP01_0005_H01.b :
AMP01_0046_F10.b :
MLTL1_0082_A07.b :
OVRT1_0142_H12.b :
AMP01_0044_D05.b :
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 359
PTG01_0096_D04.b : ACCCGTTTTTTGATGGCAAcccccccatggacaaaaatttaggatgcggtggcccaaccg
OVR01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTTGATGATGCTGTTGTCCAGT
TCH01_0058_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGATGATGCTGTTGTCCAGT
TCH01_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGATGATGCTGTTGTCCAGT
OVRM1_0085_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATGATGCTGTTGTCCAGT
BFLT1_0003_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGTCCAGT
PTG01_0106_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0033_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0078_G06.b : nn
AMP01_0075_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_G07.b :
DCI01_0030_D02.b : ggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H01.b : nnttttcgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F10.b : atatttagcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_A07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
OVRT1_0142_H12.b :
AMP01_0044_D05.b : atcccctttaggatact
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b :
TCH01_0065_C04.b :
AMP01_0052_C07.b :
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 419
PTG01_0096_D04.b : aaaagaacacatggcccttcccgggggggaaaaaaacccagcccgccctaaggtcccatt
PTG01_0106_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnntgaatgGATGCAGGCAGGCCTAAGGTCCAAN
DCI01_0033_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGCAGGCCTAAGGTCCAAG
PTG01_0078_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0075_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_G07.b : gcgtttnccgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_H12.b : nnnccttattnnnnnnnnn
AMP01_0044_D05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A12.b :
PTG01_0092_E06.b :
MLN01_0041_H04.b :
MLTL1_0049_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0065_C04.b :
AMP01_0052_C07.b : nnnnccagataaataagggaatcnattgggct
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b :
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 475
PTG01_0096_D04.b : taaaaaacccgggggaaaaacaaaaatttttctttcccaaaaaaaggtgttcctcccggg
LVRM1_0169_A12.b : TAG*AATACAAGGGcagagaaaaacagttgtctaccaagacgacgtgtaatcaatggttt
LNG01_0005_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxacggTATCCAGA*GGAGGTGTCATCCAT*GGTT
DCI01_0030_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCAGA*GGAGGTGTCATCCAT*GGTT
MLTL1_0008_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxA*GGAGGTGTCATCCAT*GGTT
AMP01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
AMP01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
MLTL1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
OVRT1_0142_H12.b : ccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0044_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A12.b : gcatttagctgxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0092_E06.b : nttctt
MLN01_0041_H04.b : nnnttactagtaca
MLTL1_0049_C05.b : nnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0065_C04.b : nnnnaactagga
AMP01_0052_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0074_G10.b :
PTG01_0058_H02.b :
PCT01_0007_H04.b :
DCI01_0095_F06.b : nnnnnggatactatag
LNG01_0080_D03.b :
MLTL1_0084_H06.b :
---------+---------+---------+---------+---------+---------+ 530
PTG01_0096_D04.b : gttttaaaaaaaaaaaaaaaaaaattccaaaaacccccccttgggaaaaaaattttccca
LVRM1_0169_A12.b : tcacaaaaaaagaaagaaattgcacaacccctaccctagaaaacacaaccacccacaccc
AMP01_0044_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAAGCCTACC**TTG*GGAAGACTGTTACCAATG
LNG01_0035_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTACCAATG
PTG01_0092_E06.b : tttttttnntnggactaaagcagcggnacggntccgaaatcctcnagcacgnttggccta
MLN01_0041_H04.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0049_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0065_C04.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0074_G10.b : nnaaagatgaacaxxxxxxxxxxxxxxxxx
PTG01_0058_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PCT01_0007_H04.b : nnnc
DCI01_0095_F06.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_D03.b :
MLTL1_0084_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
---------+---------+---------+---------+---------+---------+ 588
PTG01_0096_D04.b : aaaggttttgttccccccccccccccaattttttaaacccccccccgcggcggggcccaa
SPLT1_0097_C12.b : CTTTTGT*CACAGTCCCAGCATACTTTAACGACTtctagccgtaggctacaaaaatgctg
OVRM1_0066_F11.b : CTGTTtgtcaccataccagaaatactctaatgacatctcatcttcaagcctaccccacaa
LVRM1_0169_A12.b : tttaaaccccaataacccataaaaagtctgaaaacctcaaagcgtccaagagacgaaaaa
PBL01_0074_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTAACGACTCTCAGCGTCAGGCTACCAAAGAT*GC
PTG01_0058_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnAACNACTCTCAGCGTCAGGCTACCAAAGAT*GC
PCT01_0007_H04.b : cattttnnnnnnncctgaggtgccactggtacgactctcgcgtcAGCTACCAAAGAT*GC
DCI01_0095_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_D03.b : nnnnnaagatggacta
MLTL1_0084_H06.b : nnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 646
PTG01_0096_D04.b : aaaaaaagggaaaaaaaatggggggggccccgggtttttaaaaaaccccattaaaaccca
SPLT1_0097_C12.b : gaacaattgctggtcccaaggtccttaaatcctcagtgcccaacggcgcgcgcattggtt
OVRM1_0066_F11.b : gcctacaactatctgttggacccattgttcattagtaatcataaaagaacctacagctgc
THY01_0102_B09.b : gactattgctgtttactgttcttgaaacaccaggacccaccggtgctgcattggtatggg
LVRM1_0169_A12.b : acagccagaaagaaacccatatatcagtagacatttaaacacagccacacagccaactac
DCI01_0095_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxTACTTA*GAATCATCAATGAGCCAACTGCTGCTGCT
LNG01_0080_D03.b : anacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0084_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 702
PTG01_0096_D04.b : cacccttcttttttttttttttttggtgtgaaaaaaaaaatggtgggaaaaaaaaaaaaa
SPLT1_0097_C12.b : aggcttaaaaaaaaggttgaactaaaaaaacgtgcctattttacattgggtgggggcctt
OVRM1_0066_F11.b : acgattgtgctttatgcttaacataaactcgtcgtacgccgacaaaaccaccgacgttct
THY01_0102_B09.b : tttaaaaaa
OVRM1_0027_F06.b : gatcggttaacggcctagacaagaaggccggcgctcgaagaaacatactcgatatccaca
LVRM1_0169_A12.b : atcaacagaatactaaacagtgtaaacgtcaaacgaaccagcgaaaaaaagataaagtga
THY01_0111_G02.b : gcttatggttagacaaa
PTG01_0074_A03.b : ggctaatgcctaaacaaaaagttggacctgaagaaacttggtgatctccaactggttggg
DCI01_0029_D02.b : AATGCCTATGGCTT*NACNAAAAAGGTTGaactgaaaaaacgtgctgatctccgactggg
---------+---------+---------+---------+---------+---------+ 758
OVR01_0073_E08.b : CTTGGGTGGTG