[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000449

Length: 1,313

Sequence [FASTA format sequence]
GGATTGGCGC TGGGCTCTCT GCTCCTCCCC GTTCGACAGA CAGCCGTGTG TTCCGTGCAT
TGCCAGCCGC GTCCCTGAGA CACGATGGTG AAGGTCGGAG TGAACGGATT TGGCCGCATC
GGGCGCCTGG TCACCAGGGC TGCTTTTAAC TCTGGCAAAG TGGACATTGT CGCCATCAAT
GACCCCTTCA TTGACCTCCA CTACATGGTC TACATGTTCC AGTATGATTC CACCCACGGC
AAGTTCCACG GCACAGTCAA GGCGGAGAAC GGGAAGCTTG TCATCAATGG AAAGGCCATC
ACCATCTTCC AGGAGCGAGA TCCCGCCAAC ATCAAATGGG GCGATGCTGG TGCTACGTAT
GTTGTGGAGT CCACTGGTGT CTTCACGACC ATGGAGAAGG CCGGGGCTCA CTTGAAGGGT
GGGGCCAAGA GGGTCATCAT CTCTGCCCCT TCTGCCGATG CCCCCATGTT TGTGATGGGC
GTGAACCATG AGAAGTATGA CAACTCCCTC AAGATCGTCA GCAATGCCTC CTGCACCACC
AACTGCTTGG CACCCCTGGC CAAGGTCATC CATGACCACT TCGGCATCGT GGAGGGACTC
ATGACCACGG TCCATGCCAT CACTGCCACC CAGAAGACTG TGGATGGCCC GTCTGGGAAG
CTGTGGCGTG ATGGCCGAGG GGCTGCCCAG AACATCATCC CTGCTTCTAC CGGCGCTGCC
AAGGCTGTGG GCAAGGTCAT CCCTGAGCTC AACGGGAAGC TCACTGGCAT GGCCTTCCGT
GTCCCCACCC CCAACGTGTC GGTTGTGGAT CTGACCTGCC GCCTGGAGAA ACCTGCAAAA
TATGATGACA TCAAGAAGGT GGTGAAGCAG GCGTCCGAGG GCCCCCTCAA GGGCATCCTG
GGCTACACTG AGGACCAGGT TGTGTCCTGT GACTTCAACA GTGACACTCA CTCTTCTACC
TTTGATGCTG GGGCTGGCAT TGCCCTCAAC GACCACTTCG TCAAGCTCAT TTCCTGGTAC
GACAATGAAT TTGGCTACAG CAACAGGGTG GTGGACCTCA TGGTCCACAT GGCCTCCAAG
GAGTAAGAGC CCCTGGACCA CCAACCCCAG CAAGAGCACG CGAGGAGGAA AGAGGCCCTC
AACTGCTGGG GAGTCACACC CCAATTCGAT CCCCCAAACA ACGAAGCATC TCCTGACTTT
AGTTTCATCC CAAACCCCCG AAAAAAGGGA AGGGGCTAGA GGAAACCGGC CCCCTCTGTA
CAATTCAAAA AGTACACTTG TACCCNNNAN AAAAAAAAAA AAAAAAAAAA AAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Homo sapiens]. 6400.0O
Contig/Assembly ProteinGAPDHSglyceraldehyde-3-phosphate dehydrogenase, testis-specific [Homo sapiens]. 467e-131


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100048117PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 1 [Mus musculus]. 6520.0
Contig/Assembly ProteinLOC100042025PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 2 [Mus musculus]. 6380.0O
Contig/Assembly ProteinGapdhglyceraldehyde-3-phosphate dehydrogenase [Mus musculus]. 6380.0O
Contig/Assembly ProteinLOC100505181PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Mus musculus]. 6350.0O
Contig/Assembly ProteinLOC100504897PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Mus musculus]. 627e-180
Contig/Assembly ProteinGapdhsglyceraldehyde-3-phosphate dehydrogenase, testis-specific [Mus musculus]. 467e-131
Contig/Assembly ProteinLOC100046480PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Mus musculus]. 443e-124O
Contig/Assembly ProteinGm4802PREDICTED: hypothetical protein LOC216818 [Mus musculus]. 87.82e-17O
Contig/Assembly ProteinGm4802PREDICTED: hypothetical protein LOC216818 [Mus musculus]. 87.82e-17O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Canis lupus familiaris]. 6580.0O
Contig/Assembly ProteinLOC610683PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 628e-180O
Contig/Assembly ProteinLOC477441PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 625e-179O
Contig/Assembly ProteinLOC487478PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 605e-173O
Contig/Assembly ProteinLOC491880PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) [Canis familiaris]. 567e-162O
Contig/Assembly ProteinLOC610259PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase, liver (GAPDH) [Canis familiaris]. 560e-159O
Contig/Assembly ProteinLOC488411PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 556e-158O
Contig/Assembly ProteinLOC612118PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 548e-156O
Contig/Assembly ProteinLOC488591PREDICTED: similar to Glyceraldehyde-3-phosphate dehydrogenase, liver (GAPDH) [Canis familiaris]. 540e-153O
Contig/Assembly ProteinLOC492077PREDICTED: similar to glyceraldehyde-3-phosphate dehydrogenase [Canis familiaris]. 536e-152O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Bos taurus]. 6620.0O
Contig/Assembly ProteinGAPDHPREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like isoform 2 [Bos taurus]. 6620.0O
Contig/Assembly ProteinGAPDHPREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Bos taurus]. 6620.0O
Contig/Assembly ProteinGAPDHSglyceraldehyde-3-phosphate dehydrogenase, testis-specific [Bos taurus]. 471e-133
Contig/Assembly ProteinLOC616200PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Bos taurus]. 2502e-66O
Contig/Assembly ProteinLOC616200PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like [Bos taurus]. 2502e-66O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGAPDHglyceraldehyde-3-phosphate dehydrogenase [Sus scrofa]. 6720.0O
Contig/Assembly ProteinLOC100517097PREDICTED: glyceraldehyde-3-phosphate dehydrogenase, testis-specific-like [Sus scrofa]. 404e-113
Contig/Assembly ProteinLOC100627835PREDICTED: glyceraldehyde-3-phosphate dehydrogenase-like, partial [Sus scrofa]. 2379e-63O
Contig/Assembly ProteinLOC100622051PREDICTED: glyceraldehyde-3-phosphate dehydrogenase, testis-specific-like [Sus scrofa]. 1885e-48O


Assembly Members: 420      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010010C09ADR01_0010_C09.bDB782393 
ADR010013D03ADR01_0013_D03.bDB782676 
ADR010015A12ADR01_0015_A12.bDB782829 
ADR010019G07ADR01_0019_G07.bDB783194 
ADR010021G06ADR01_0021_G06.bDB783368 
ADR010022C06ADR01_0022_C06.bDB783413 
ADR010024F11ADR01_0024_F11.bDB783634 
ADR010029B12ADR01_0029_B12.bDB784031 
ADR010029G01ADR01_0029_G01.bDB784078 
ADR010043C02ADR01_0043_C02.bDB785300 
ADR010044E07ADR01_0044_E07.bDB785419 
ADR010049G02ADR01_0049_G02.bDB785887 
ADR010054F10ADR01_0054_F10.bDB786331 
ADR010057G06ADR01_0057_G06.bDB786603 
ADR010061A09ADR01_0061_A09.bDB786907 
ADR010061C12ADR01_0061_C12.bDB786934 
ADR010068G08ADR01_0068_G08.bDB787578 
ADR010070C09ADR01_0070_C09.bDB787709 
ADR010074E03ADR01_0074_E03.bDB788073 
ADR010078A07ADR01_0078_A07.bDB788401 
ADR010080F08ADR01_0080_F08.bDB788643 
ADR010083A10ADR01_0083_A10.bDB788845 
ADR010087H06ADR01_0087_H06.bDB789265 
ADR010093H12ADR01_0093_H12.bDB789812 
ADR010099E12ADR01_0099_E12.bDB790308 
ADR010101G12ADR01_0101_G12.bDB790511 
ADR010102E10ADR01_0102_E10.bDB790577 
BFLT10060B08BFLT1_0060_B08.bFS644736 
BKFL10011B03BKFL1_0011_B03.bFS648649 
BKFL10011B07BKFL1_0011_B07.bFS648652 
BMWN10002C02BMWN1_0002_C02.bHX205738 
BMWN10004F11BMWN1_0004_F11.bHX205857 
BMWN10011B08BMWN1_0011_B08.bHX206269 
BMWN10025A12BMWN1_0025_A12.bHX207063 
BMWN10047G04BMWN1_0047_G04.bHX208392 
BMWN10050D06BMWN1_0050_D06.bHX208600 
BMWN10081B04BMWN1_0081_B04.bHX210532 
BMWN10094C06BMWN1_0094_C06.bHX211364 
BMWN10094E01BMWN1_0094_E01.bHX211378 
CBLT10001B02CBLT1_0001_B02.bHX211762 
CBLT10001E12CBLT1_0001_E12.bHX211800 
CBLT10003B05CBLT1_0003_B05.bHX211926 
CBLT10007B09CBLT1_0007_B09.bHX212253 
CBLT10007E08CBLT1_0007_E08.bHX212283 
CBLT10013A08CBLT1_0013_A08.bHX212699 
CBLT10016C02CBLT1_0016_C02.bHX212922 
CBLT10018B01CBLT1_0018_B01.bHX213056 
CBLT10023D04CBLT1_0023_D04.bHX213440 
CBLT10023F12CBLT1_0023_F12.bHX213465 
CBLT10025H02CBLT1_0025_H02.bHX213635 
CBLT10028D12CBLT1_0028_D12.bHX213810 
CBLT10030F09CBLT1_0030_F09.bHX213938 
CBLT10031B10CBLT1_0031_B10.bHX213970 
CBLT10034C05CBLT1_0034_C05.bHX214177 
CBLT10035D12CBLT1_0035_D12.bHX214258 
CBLT10036B11CBLT1_0036_B11.bHX214307 
CBLT10036C08CBLT1_0036_C08.bHX214314 
CBLT10037D07CBLT1_0037_D07.bHX214379 
CBLT10037G03CBLT1_0037_G03.bHX214402 
CBLT10038H08CBLT1_0038_H08.bHX214483 
CBLT10039A08CBLT1_0039_A08.b  
CBLT10041B09CBLT1_0041_B09.bHX214588 
CBLT10042A08CBLT1_0042_A08.bHX214640 
CBLT10045F01CBLT1_0045_F01.bHX214860 
CBLT10045H07CBLT1_0045_H07.bHX214879 
CBLT10046H08CBLT1_0046_H08.bHX214944 
CBLT10049F05CBLT1_0049_F05.bHX215104 
CBLT10057E08CBLT1_0057_E08.bHX215706 
CBLT10058H11CBLT1_0058_H11.bHX215810 
CBLT10061B06CBLT1_0061_B06.bHX215961 
CBLT10062B01CBLT1_0062_B01.bHX216038 
CBLT10062G01CBLT1_0062_G01.bHX216087 
CBLT10063F12CBLT1_0063_F12.bHX216174 
CBLT10064H07CBLT1_0064_H07.bHX216252 
CBLT10065A01CBLT1_0065_A01.bHX216257 
CBLT10065E04CBLT1_0065_E04.bHX216304 
CBLT10069H07CBLT1_0069_H07.bHX216686 
CBLT10070E03CBLT1_0070_E03.bHX216736 
CBLT10072E04CBLT1_0072_E04.bHX216906 
CBLT10074H11CBLT1_0074_H11.bHX217114 
CBLT10075C01CBLT1_0075_C01.bHX217137 
CBLT10076F06CBLT1_0076_F06.bHX217262 
CBLT10079G03CBLT1_0079_G03.bHX217487 
CBLT10080H07CBLT1_0080_H07.bHX217570 
CBLT10082C03CBLT1_0082_C03.b  
CBLT10082D09CBLT1_0082_D09.bHX217670 
CBLT10083F05CBLT1_0083_F05.bHX217763 
CBLT10084A10CBLT1_0084_A10.bHX217791 
CBLT10089B09CBLT1_0089_B09.bHX218210 
CBLT10096E08CBLT1_0096_E08.bHX218821 
CBLT10099A12CBLT1_0099_A12.bHX219026 
CLNT10008C09CLNT1_0008_C09.bFS657667 
CLNT10025H02CLNT1_0025_H02.bFS659061 
CLNT10041F03CLNT1_0041_F03.bFS660293 
CLNT10083E10CLNT1_0083_E10.b  
CLNT10102D09CLNT1_0102_D09.bHX219295 
CLNT10109H09CLNT1_0109_H09.bHX219884 
CLNT10111A10CLNT1_0111_A10.bHX219975 
CLNT10114A01CLNT1_0114_A01.bHX220197 
CLNT10132D04CLNT1_0132_D04.bHX221603 
CLNT10133C12CLNT1_0133_C12.bHX221677 
CLNT10147D04CLNT1_0147_D04.bHX222769 
DCI010001C04DCI01_0001_C04.bDB790635 
DCI010005F02DCI01_0005_F02.bDB790932 
DCI010013E07DCI01_0013_E07.bDB791467 
DCI010016E01DCI01_0016_E01.bDB791723 
DCI010031C10DCI01_0031_C10.bDB793039 
DCI010036C01DCI01_0036_C01.bDB793490 
DCI010043E12DCI01_0043_E12.bDB794034 
DCI010044C04DCI01_0044_C04.bDB794096 
DCI010091D03DCI01_0091_D03.bDB797637 
HTMT10002D09HTMT1_0002_D09.b  
HTMT10002H03HTMT1_0002_H03.bFS664490 
HTMT10007B06HTMT1_0007_B06.bFS664729 AK399837
HTMT10008C08HTMT1_0008_C08.b  
HTMT10008D12HTMT1_0008_D12.bFS664802 
HTMT10013H11HTMT1_0013_H11.bFS665178 
HTMT10017B02HTMT1_0017_B02.bFS665416 AK391706
HTMT10017D04HTMT1_0017_D04.bFS665439 
HTMT10019B08HTMT1_0019_B08.bFS665579 
HTMT10020F06HTMT1_0020_F06.bFS665694 
HTMT10023H04HTMT1_0023_H04.bFS665943 
HTMT10024C01HTMT1_0024_C01.bFS665972 
HTMT10039E07HTMT1_0039_E07.bFS666948 
HTMT10040B08HTMT1_0040_B08.b  
HTMT10041F11HTMT1_0041_F11.bFS667081 
HTMT10044E12HTMT1_0044_E12.b  
HTMT10048A09HTMT1_0048_A09.bFS667554 
HTMT10051G11HTMT1_0051_G11.bFS667838 
HTMT10054A03HTMT1_0054_A03.bFS668007 
HTMT10054E03HTMT1_0054_E03.bFS668044 
HTMT10055C09HTMT1_0055_C09.bFS668092 
HTMT10059E04HTMT1_0059_E04.bFS668410 
HTMT10063B02HTMT1_0063_B02.bFS668670 
HTMT10064E05HTMT1_0064_E05.bFS668775 
HTMT10064G07HTMT1_0064_G07.bFS668792 
HTMT10064H07HTMT1_0064_H07.bFS668802 
HTMT10065D03HTMT1_0065_D03.bFS668840 
HTMT10067A11HTMT1_0067_A11.bFS668969 
HTMT10068B04HTMT1_0068_B04.bFS669048 
HTMT10069G07HTMT1_0069_G07.b  
HTMT10075H04HTMT1_0075_H04.bFS669585 
HTMT10076D08HTMT1_0076_D08.bFS669621 
HTMT10077E02HTMT1_0077_E02.bFS669688 
HTMT10079B01HTMT1_0079_B01.bFS669793 
HTMT10080A10HTMT1_0080_A10.bFS669855 
HTMT10080E02HTMT1_0080_E02.b  
HTMT10084E04HTMT1_0084_E04.b  
HTMT10087H11HTMT1_0087_H11.bFS670373 
HTMT10094F04HTMT1_0094_F04.bFS670872 
HTMT10095D09HTMT1_0095_D09.bFS670935 
HTMT10095E12HTMT1_0095_E12.bFS670949 
HTMT10096H11HTMT1_0096_H11.bFS671037 
HTMT10097E01HTMT1_0097_E01.bFS671072 
HTMT10105F10HTMT1_0105_F10.bHX223582 
HTMT10113B04HTMT1_0113_B04.bHX224125 
HTMT10114G07HTMT1_0114_G07.bHX224244 
HTMT10114G08HTMT1_0114_G08.bHX224245 
HTMT10116D04HTMT1_0116_D04.bHX224335 
HTMT10121H10HTMT1_0121_H10.bHX224662 
HTMT10124A01HTMT1_0124_A01.bHX224754 
HTMT10128H09HTMT1_0128_H09.bHX225071 
HTMT10130E05HTMT1_0130_E05.bHX225159 
HTMT10131B10HTMT1_0131_B10.bHX225189 
HTMT10131F02HTMT1_0131_F02.bHX225212 
HTMT10132G07HTMT1_0132_G07.bHX225266 
HTMT10135D09HTMT1_0135_D09.bHX225465 
HTMT10136D05HTMT1_0136_D05.bHX225531 
HTMT10139A11HTMT1_0139_A11.bHX225737 
HTMT10141C01HTMT1_0141_C01.bHX225902 
HTMT10141C07HTMT1_0141_C07.bHX225907 
HTMT10142H07HTMT1_0142_H07.b  
HTMT10143A06HTMT1_0143_A06.bHX226047 
HTMT10148B08HTMT1_0148_B08.bHX226415 
HTMT10149B12HTMT1_0149_B12.bHX226485 
HTMT10149H07HTMT1_0149_H07.bHX226531 
HTMT10151H09HTMT1_0151_H09.bHX226671 
HTMT10152E02HTMT1_0152_E02.bHX226707 
HTMT10152G10HTMT1_0152_G10.bHX226725 
ILNT10002B07ILNT1_0002_B07.bHX226837 
ILNT10018B02ILNT1_0018_B02.bHX228060 
ILNT10021D06ILNT1_0021_D06.bHX228325 
ILNT10032H02ILNT1_0032_H02.bHX229238 
ILNT10035B02ILNT1_0035_B02.bHX229428 
ILNT10040B02ILNT1_0040_B02.bHX229844 
ILNT10040F05ILNT1_0040_F05.bHX229887 
ILNT10043B12ILNT1_0043_B12.bHX230096 
ILNT10045F09ILNT1_0045_F09.bHX230288 
ILNT10046F12ILNT1_0046_F12.bHX230364 
ILNT10047G01ILNT1_0047_G01.bHX230448 
ILNT10049F05ILNT1_0049_F05.bHX230606 
ILNT10051B05ILNT1_0051_B05.bHX230735 
ILNT10052H09ILNT1_0052_H09.bHX230878 
ILNT10072C02ILNT1_0072_C02.bHX232473 
ILNT10076E12ILNT1_0076_E12.bHX232827 
ILNT10086G12ILNT1_0086_G12.bHX233655 
ILNT10093H08ILNT1_0093_H08.bHX234212 
ITT010006B04ITT01_0006_B04.bBW976506 
ITT010008D07ITT01_0008_D07.bBW976716 
ITT010055D03ITT01_0055_D03.bBW980881 
ITT010078F01ITT01_0078_F01.bBW982946 
KDN010026H03KDN01_0026_H03.b  
LNG010016C06LNG01_0016_C06.bBP435373 
LNG010070G01LNG01_0070_G01.bBP439004 
LVR010065F09LVR01_0065_F09.bBP446060 
LVR010067D02LVR01_0067_D02.bBP443807 
LVR010082A11LVR01_0082_A11.bBP441775 
LVRM10034A02LVRM1_0034_A02.bCJ001293 
LVRM10063G06LVRM1_0063_G06.bBP140487 
LVRM10093C02LVRM1_0093_C02.bCJ003442 
MLN010013G03MLN01_0013_G03.bCJ008743 
MLN010035H10MLN01_0035_H10.bCJ010421 
MLN010048F05MLN01_0048_F05.bCJ011378 
MLN010084A01MLN01_0084_A01.bCJ014313 
MLN010084B03MLN01_0084_B03.bCJ014326 
MLN010094D03MLN01_0094_D03.bCJ015195 
MLTL10018A02MLTL1_0018_A02.bFS679915 
MLTL10022C04MLTL1_0022_C04.bFS680294 
MLTL10025B05MLTL1_0025_B05.bFS680550 
MLTL10029A10MLTL1_0029_A10.bFS680906 
MLTL10031G05MLTL1_0031_G05.b  
MLTL10032B01MLTL1_0032_B01.bFS681158 
MLTL10032D08MLTL1_0032_D08.bFS681186 
MLTL10033C06MLTL1_0033_C06.bFS681255 
MLTL10037A03MLTL1_0037_A03.bFS681578 
MLTL10040H09MLTL1_0040_H09.bFS681934 
MLTL10041D08MLTL1_0041_D08.bFS681978 
MLTL10045D04MLTL1_0045_D04.bFS682326 
MLTL10058H03MLTL1_0058_H03.bFS683512 
MLTL10071F06MLTL1_0071_F06.bFS683766 
MLTL10073E12MLTL1_0073_E12.bFS683942 
MLTL10082D08MLTL1_0082_D08.bFS684724 
MLTL10086E06MLTL1_0086_E06.bFS685096 
MLTL10088G08MLTL1_0088_G08.bFS685300 
MLTL10089A01MLTL1_0089_A01.bFS685317 
MLTL10090B12MLTL1_0090_B12.bFS685433 
MLTL10093D02MLTL1_0093_D02.bFS685715 
MLTL10093H09MLTL1_0093_H09.bFS685763 
OVR010007G07OVR01_0007_G07.bBP144173 
OVR010008B10OVR01_0008_B10.bBP142020 
OVR010019F02OVR01_0019_F02.bBP143525 
OVR010029F09OVR01_0029_F09.b  
OVR010036E04OVR01_0036_E04.bBP143173 
OVR010041H10OVR01_0041_H10.bBP144762 
OVR010045E11OVR01_0045_E11.bBP143432 
OVR010046H02OVR01_0046_H02.bBP144466 
OVR010051D06OVR01_0051_D06.bBW964154 
OVR010051D07OVR01_0051_D07.bBW964155 
OVR010052B06OVR01_0052_B06.bBW964225 
OVR010057E11OVR01_0057_E11.bBW964711 
OVR010064B08OVR01_0064_B08.bBW965296 
OVR010073B04OVR01_0073_B04.bBW966101 
OVR010076C04OVR01_0076_C04.bBW966365 
OVR010080H01OVR01_0080_H01.bBW966713 
OVR010084H01OVR01_0084_H01.bBW966951 
OVR010090E07OVR01_0090_E07.bBW967387 
OVR010097E07OVR01_0097_E07.bBW967915 
OVR010099G12OVR01_0099_G12.bBW968101 
OVRM10021E07OVRM1_0021_E07.bBP150514 AK234838
OVRM10037B07OVRM1_0037_B07.bBP456057 
OVRM10049B04OVRM1_0049_B04.bBP146472 
OVRM10055A08OVRM1_0055_A08.bBP145612 
OVRM10060D11OVRM1_0060_D11.bBP149743 
OVRM10062G02OVRM1_0062_G02.bBP152498 
OVRM10076E06OVRM1_0076_E06.bBP150451 
OVRM10098D07OVRM1_0098_D07.bBP149344 
OVRM10098H08OVRM1_0098_H08.bBP154517 
OVRM10103A10OVRM1_0103_A10.bBP145875 
OVRM10117A03OVRM1_0117_A03.bBP145126 
OVRM10118B04OVRM1_0118_B04.bBP146534 
OVRM10140B02OVRM1_0140_B02.bBP146336 
OVRM10171F08OVRM1_0171_F08.bBP460017 
OVRM10190A08OVRM1_0190_A08.bBP455226 
OVRM10192H06OVRM1_0192_H06.bBP461784 
OVRM10205G12OVRM1_0205_G12.bBP461344 
OVRM10210G12OVRM1_0210_G12.bBP461348 
OVRM10214F01OVRM1_0214_F01.bBP459470 
OVRT10012E03OVRT1_0012_E03.bFS687378 
OVRT10013G11OVRT1_0013_G11.bFS687490 
OVRT10014D10OVRT1_0014_D10.bFS687540 
OVRT10030D09OVRT1_0030_D09.bFS688833 
OVRT10031D07OVRT1_0031_D07.bFS688914 
OVRT10046G01OVRT1_0046_G01.bFS690177 
OVRT10051H04OVRT1_0051_H04.bFS690611 
OVRT10067E07OVRT1_0067_E07.bFS691897 
OVRT10070E12OVRT1_0070_E12.bFS692150 
OVRT10098D01OVRT1_0098_D01.bFS694398 
OVRT10103A10OVRT1_0103_A10.bHX235003 
OVRT10107A09OVRT1_0107_A09.bHX235325 
OVRT10111G11OVRT1_0111_G11.bHX235726 
OVRT10117C08OVRT1_0117_C08.bHX236185 
OVRT10131D05OVRT1_0131_D05.bHX237298 
OVRT10132D01OVRT1_0132_D01.bHX237374 
PBL010013D11PBL01_0013_D11.bBW969335 
PBL010054G12PBL01_0054_G12.bBP462436 
PBL010058A11PBL01_0058_A11.bBP155234 
PBL010094D06PBL01_0094_D06.bBW974445 
PBL010100C11PBL01_0100_C11.bBW974957 
PST010043B01PST01_0043_B01.bFS700189 
PST010045C11PST01_0045_C11.b  
PST010088H11PST01_0088_H11.b  
PTG010009C09PTG01_0009_C09.bFS705182 
PTG010026F05PTG01_0026_F05.bFS706707 
PTG010030D11PTG01_0030_D11.bFS707049 
SKNB10003D05SKNB1_0003_D05.bDB800229 
SKNB10025A10SKNB1_0025_A10.bDB801301 
SKNB10036B06SKNB1_0036_B06.b  
SKNB10038G04SKNB1_0038_G04.bDB802098 
SKNB10047B02SKNB1_0047_B02.b  
SKNB10070C03SKNB1_0070_C03.b  
SMG010002E04SMG01_0002_E04.bFS713609 
SMG010018F02SMG01_0018_F02.bFS714834 
SMG010039G03SMG01_0039_G03.bFS716720 
SMG010067H02SMG01_0067_H02.bFS719099 
SMG010093C02SMG01_0093_C02.bFS721295 
SMG010097E05SMG01_0097_E05.bFS721636 
SPL010001B11SPL01_0001_B11.bBP157264 
SPL010021F04SPL01_0021_F04.bBP158472 
SPL010022G04SPL01_0022_G04.bBP158808 
SPL010029G09SPL01_0029_G09.bCJ016277 
SPL010035E07SPL01_0035_E07.bBP158212 
SPL010037B11SPL01_0037_B11.bBP157288 
SPL010044B10SPL01_0044_B10.bCJ016951 
SPL010054A12SPL01_0054_A12.bCJ017848 
SPL010056F06SPL01_0056_F06.bCJ018075 
SPL010058H08SPL01_0058_H08.bCJ018278 
SPL010073D12SPL01_0073_D12.bCJ019590 
SPL010078C11SPL01_0078_C11.bCJ020033 
SPL010084E06SPL01_0084_E06.bCJ020601 
SPL010086E04SPL01_0086_E04.bCJ020768 
SPL010086E09SPL01_0086_E09.bCJ020773 
SPL010099E12SPL01_0099_E12.bCJ021943 
SPL010099G07SPL01_0099_G07.bCJ021958 
SPLT10004D04SPLT1_0004_D04.bHX239525 
SPLT10029A02SPLT1_0029_A02.bHX241415 
SPLT10031G01SPLT1_0031_G01.bHX241609 
SPLT10034G08SPLT1_0034_G08.bHX241858 
SPLT10056F10SPLT1_0056_F10.bHX243544 
SPLT10065F06SPLT1_0065_F06.bHX244262 
SPLT10068H12SPLT1_0068_H12.bHX244529 
SPLT10086G11SPLT1_0086_G11.bHX245930 
SPLT10090G05SPLT1_0090_G05.bHX246236 
SPLT10092E12SPLT1_0092_E12.bHX246388 
SPLT10092G02SPLT1_0092_G02.bHX246401 
SPLT10095C10SPLT1_0095_C10.bHX246601 
TCH010010F08TCH01_0010_F08.bCJ023207 
TCH010013F10TCH01_0013_F10.bCJ023417 
TCH010013F12TCH01_0013_F12.bCJ023419 
TCH010015G04TCH01_0015_G04.bCJ023572 
TCH010025H12TCH01_0025_H12.bCJ024329 
TCH010027F09TCH01_0027_F09.bCJ024461 
TCH010047C12TCH01_0047_C12.bCJ025938 
TCH010055A08TCH01_0055_A08.bBW975958 
TCH010064B09TCH01_0064_B09.bCJ026990 
TCH010075F11TCH01_0075_F11.bCJ027858 
TCH010080D02TCH01_0080_D02.bCJ028212 
TCH010081C10TCH01_0081_C10.bCJ028287 
TCH010087D12TCH01_0087_D12.bCJ028781 
TCH010102H05TCH01_0102_H05.bCJ029941 
TES010002A05TES01_0002_A05.bCJ030091 
TES010002E05TES01_0002_E05.bCJ030119 
TES010003A09TES01_0003_A09.bCJ030161 
TES010019D11TES01_0019_D11.b  
TES010019H02TES01_0019_H02.bCJ031309 
TES010023F12TES01_0023_F12.bCJ031565 
TES010029D03TES01_0029_D03.bCJ031909 
TES010030D11TES01_0030_D11.bCJ031989 
TES010033A10TES01_0033_A10.bCJ032160 
TES010034F04TES01_0034_F04.bCJ032255 
TES010040A05TES01_0040_A05.bCJ032573 
TES010040B09TES01_0040_B09.bCJ032584 
TES010040E03TES01_0040_E03.bCJ032604 
TES010040G01TES01_0040_G01.bCJ032618 
TES010042C01TES01_0042_C01.bCJ032704 
TES010043F09TES01_0043_F09.bCJ032803 
TES010047B12TES01_0047_B12.bCJ033017 
TES010052A06TES01_0052_A06.bCJ033298 
TES010052D11TES01_0052_D11.bCJ033331 
TES010053A04TES01_0053_A04.bCJ033369 
TES010055E05TES01_0055_E05.bCJ033498 
TES010063H12TES01_0063_H12.bCJ034097 
TES010064D04TES01_0064_D04.b  
TES010071G03TES01_0071_G03.bCJ034608 
TES010072C12TES01_0072_C12.b  
TES010072H06TES01_0072_H06.bCJ034687 
TES010074C12TES01_0074_C12.b  
TES010076E04TES01_0076_E04.bCJ034903 
TES010076E05TES01_0076_E05.bCJ034904 
TES010076G02TES01_0076_G02.bFS722246 
TES010079F05TES01_0079_F05.bCJ035102 
TES010087F11TES01_0087_F11.bCJ035651 
TES010090H05TES01_0090_H05.b  
TES010091H02TES01_0091_H02.bCJ035923 
TES010092G11TES01_0092_G11.bCJ035991 
TES010093E08TES01_0093_E08.b  
TES010098C11TES01_0098_C11.bCJ036401 
TES010099G11TES01_0099_G11.b  
TES010105A12TES01_0105_A12.bCJ036902 
TES010105G05TES01_0105_G05.bCJ036951 
TES010106D09TES01_0106_D09.bCJ037000 
TES010110H04TES01_0110_H04.bCJ037286 
TES010112C06TES01_0112_C06.bCJ037386 
THY010008B01THY01_0008_B01.bBP160580 
THY010038B02THY01_0038_B02.bBP160707 
THY010042D08THY01_0042_D08.bBP163832 
THY010047G03THY01_0047_G03.bBP167070 
THY010048D11THY01_0048_D11.bBP164148 
THY010049D01THY01_0049_D01.bBP163116 
THY010051H09THY01_0051_H09.bBP168997 
THY010066E08THY01_0066_E08.bBP165112 
THY010067C11THY01_0067_C11.bBP162926 
THY010094E03THY01_0094_E03.bBP164615 
THY010095E10THY01_0095_E10.bBP165336 
THY010122H07THY01_0122_H07.bBP168838 
THY010122H11THY01_0122_H11.bBP169273 
UTR010010G01UTR01_0010_G01.bBP172565 
UTR010014A05UTR01_0014_A05.bBP169541 
UTR010033B02UTR01_0033_B02.bBP169958 
UTR010050G04UTR01_0050_G04.bBP464471 
UTR010094C11UTR01_0094_C11.bCJ038663 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
342C21100.515WSGGC/G
T179200.485GGT/G


Alignment:      TOP

20110601C-000449 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0002_H03.b :
TES01_0040_G01.b :
LVRM1_0034_A02.b :
SMG01_0039_G03.b :
ADR01_0043_C02.b :
OVRT1_0103_A10.b :
HTMT1_0008_C08.b :
HTMT1_0008_D12.b :
THY01_0122_H07.b :
TES01_0105_A12.b :
TES01_0034_F04.b :
TES01_0029_D03.b :
TES01_0030_D11.b :
TCH01_0047_C12.b :
TCH01_0010_F08.b :
ADR01_0061_A09.b :
TES01_0019_D11.b :
TES01_0076_E04.b :
TES01_0076_G02.b :
TES01_0092_G11.b :
TES01_0053_A04.b :
TES01_0072_C12.b :
SPL01_0073_D12.b :
TES01_0023_F12.b :
TES01_0112_C06.b :
SMG01_0093_C02.b :
TES01_0055_E05.b :
TES01_0043_F09.b :
TCH01_0075_F11.b :
SMG01_0067_H02.b :
OVR01_0051_D07.b :
TES01_0047_B12.b :
CLNT1_0147_D04.b :
TES01_0090_H05.b :
TES01_0003_A09.b :
SKNB1_0038_G04.b :
TES01_0040_E03.b :
TES01_0002_A05.b :
TES01_0042_C01.b :
UTR01_0050_G04.b :
OVR01_0008_B10.b :
TCH01_0081_C10.b :
KDN01_0026_H03.b :
PST01_0045_C11.b :
TES01_0064_D04.b :
BMWN1_0081_B04.b :
BMWN1_0094_C06.b :
OVRM1_0205_G12.b :
SPLT1_0031_G01.b :
BMWN1_0094_E01.b :
HTMT1_0002_D09.b :
HTMT1_0132_G07.b :
SPLT1_0034_G08.b :
TES01_0093_E08.b :
SKNB1_0003_D05.b :
HTMT1_0024_C01.b :
CBLT1_0023_F12.b :
CBLT1_0039_A08.b :
CBLT1_0028_D12.b :
CBLT1_0074_H11.b :
ILNT1_0076_E12.b :
CBLT1_0031_B10.b :
CBLT1_0082_C03.b :
CBLT1_0065_E04.b :
SPLT1_0065_F06.b :
SPLT1_0092_E12.b :
ILNT1_0052_H09.b :
CBLT1_0065_A01.b :
HTMT1_0075_H04.b :
ILNT1_0051_B05.b :
CBLT1_0099_A12.b :
CBLT1_0063_F12.b :
HTMT1_0114_G07.b :
HTMT1_0113_B04.b :
SPLT1_0056_F10.b :
HTMT1_0130_E05.b :
ILNT1_0032_H02.b :
HTMT1_0114_G08.b :
HTMT1_0128_H09.b :
BMWN1_0011_B08.b :
HTMT1_0054_A03.b :
HTMT1_0017_B02.b :
CBLT1_0016_C02.b :
SMG01_0097_E05.b :
ILNT1_0072_C02.b :
CBLT1_0036_C08.b :
HTMT1_0069_G07.b :
CBLT1_0084_A10.b :
BMWN1_0002_C02.b :
HTMT1_0121_H10.b :
CBLT1_0025_H02.b :
CBLT1_0089_B09.b :
DCI01_0016_E01.b : nntttagatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_F10.b :
CBLT1_0038_H08.b :
SPLT1_0068_H12.b :
CBLT1_0096_E08.b :
TES01_0040_A05.b :
HTMT1_0131_B10.b :
ILNT1_0049_F05.b :
HTMT1_0124_A01.b :
CBLT1_0030_F09.b :
HTMT1_0023_H04.b :
CBLT1_0080_H07.b :
CBLT1_0023_D04.b :
HTMT1_0044_E12.b :
CBLT1_0064_H07.b :
CBLT1_0034_C05.b :
HTMT1_0064_H07.b :
HTMT1_0087_H11.b :
CBLT1_0062_G01.b :
HTMT1_0007_B06.b :
HTMT1_0148_B08.b :
HTMT1_0097_E01.b :
SPLT1_0086_G11.b :
CBLT1_0036_B11.b :
CBLT1_0045_H07.b :
HTMT1_0149_H07.b :
HTMT1_0143_A06.b :
HTMT1_0152_E02.b :
HTMT1_0013_H11.b :
HTMT1_0055_C09.b :
SPLT1_0004_D04.b :
HTMT1_0051_G11.b :
HTMT1_0077_E02.b :
HTMT1_0065_D03.b :
HTMT1_0131_F02.b :
CBLT1_0037_D07.b :
HTMT1_0084_E04.b :
HTMT1_0135_D09.b :
HTMT1_0136_D05.b :
CBLT1_0041_B09.b :
CBLT1_0042_A08.b :
CBLT1_0007_B09.b :
CBLT1_0082_D09.b :
HTMT1_0116_D04.b :
CBLT1_0083_F05.b :
ILNT1_0045_F09.b :
HTMT1_0019_B08.b :
HTMT1_0080_E02.b :
HTMT1_0048_A09.b :
HTMT1_0094_F04.b :
BMWN1_0050_D06.b :
LNG01_0016_C06.b :
HTMT1_0139_A11.b :
HTMT1_0064_G07.b :
HTMT1_0149_B12.b :
HTMT1_0020_F06.b :
HTMT1_0041_F11.b :
CBLT1_0058_H11.b :
HTMT1_0076_D08.b :
ILNT1_0040_F05.b :
CBLT1_0003_B05.b :
CBLT1_0079_G03.b :
CBLT1_0045_F01.b :
HTMT1_0064_E05.b :
HTMT1_0080_A10.b :
CBLT1_0035_D12.b :
SKNB1_0025_A10.b :
CBLT1_0007_E08.b :
CBLT1_0075_C01.b :
CBLT1_0076_F06.b :
HTMT1_0141_C07.b :
ILNT1_0047_G01.b :
SPLT1_0092_G02.b :
ILNT1_0021_D06.b :
HTMT1_0152_G10.b :
CBLT1_0001_B02.b :
HTMT1_0017_D04.b :
HTMT1_0059_E04.b :
HTMT1_0151_H09.b :
ILNT1_0093_H08.b :
ILNT1_0040_B02.b :
SPLT1_0090_G05.b :
HTMT1_0141_C01.b :
HTMT1_0068_B04.b :
BMWN1_0047_G04.b :
CBLT1_0037_G03.b :
HTMT1_0095_E12.b :
CBLT1_0062_B01.b :
BMWN1_0004_F11.b :
CBLT1_0013_A08.b :
CBLT1_0061_B06.b :
CBLT1_0049_F05.b :
ILNT1_0035_B02.b :
CBLT1_0046_H08.b :
CBLT1_0072_E04.b :
ITT01_0055_D03.b :
CBLT1_0001_E12.b :
HTMT1_0079_B01.b :
HTMT1_0039_E07.b :
CBLT1_0070_E03.b :
ILNT1_0046_F12.b :
HTMT1_0063_B02.b :
HTMT1_0096_H11.b :
SPLT1_0095_C10.b :
CBLT1_0057_E08.b :
HTMT1_0067_A11.b :
ILNT1_0002_B07.b :
CBLT1_0069_H07.b :
HTMT1_0142_H07.b :
ADR01_0061_C12.b :
OVRM1_0098_H08.b :
OVR01_0076_C04.b :
OVR01_0073_B04.b :
OVRM1_0140_B02.b :
LVRM1_0093_C02.b :
OVRM1_0076_E06.b :
OVR01_0099_G12.b :
OVRM1_0192_H06.b :
OVRM1_0118_B04.b :
OVRM1_0190_A08.b :
OVRM1_0055_A08.b :
OVRM1_0062_G02.b :
ADR01_0021_G06.b :
OVRM1_0210_G12.b :
OVRM1_0021_E07.b :
PTG01_0026_F05.b :
OVRM1_0098_D07.b :
OVRM1_0103_A10.b :
UTR01_0010_G01.b :
UTR01_0014_A05.b :
ADR01_0024_F11.b :
OVRM1_0049_B04.b : cttcgtatgtcgtcgtc
SPL01_0021_F04.b :
OVRT1_0098_D01.b :
SPL01_0058_H08.b :
SMG01_0002_E04.b :
OVR01_0090_E07.b :
THY01_0049_D01.b :
CLNT1_0008_C09.b :
ADR01_0019_G07.b :
SPL01_0044_B10.b :
CLNT1_0132_D04.b :
UTR01_0094_C11.b :
CLNT1_0111_A10.b :
SPLT1_0029_A02.b :
UTR01_0033_B02.b :
OVRT1_0117_C08.b :
LVR01_0082_A11.b :
OVRT1_0013_G11.b :
BFLT1_0060_B08.b :
OVRT1_0132_D01.b :
OVRT1_0012_E03.b :
LVR01_0065_F09.b :
CLNT1_0041_F03.b :
CLNT1_0114_A01.b :
CLNT1_0102_D09.b :
CLNT1_0133_C12.b :
TES01_0052_A06.b :
OVRT1_0067_E07.b :
OVR01_0007_G07.b :
SPL01_0078_C11.b :
OVRT1_0131_D05.b :
OVRT1_0111_G11.b :
ADR01_0029_B12.b :
OVRT1_0030_D09.b :
OVRT1_0031_D07.b :
OVRT1_0014_D10.b :
OVRT1_0046_G01.b :
SPL01_0001_B11.b :
SPL01_0054_A12.b :
OVR01_0046_H02.b :
CLNT1_0109_H09.b :
PBL01_0058_A11.b :
OVRT1_0070_E12.b :
SPL01_0099_G07.b :
OVR01_0045_E11.b :
PBL01_0054_G12.b :
ADR01_0101_G12.b :
LNG01_0070_G01.b :
ADR01_0054_F10.b :
ADR01_0099_E12.b :
OVR01_0051_D06.b :
MLN01_0084_A01.b :
OVRT1_0051_H04.b :
THY01_0094_E03.b :
MLN01_0048_F05.b :
MLN01_0035_H10.b :
SPL01_0084_E06.b :
LVR01_0067_D02.b :
TCH01_0013_F12.b :
ADR01_0087_H06.b :
ITT01_0008_D07.b :
ADR01_0083_A10.b :
ITT01_0006_B04.b :
ADR01_0074_E03.b :
MLTL1_0088_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
DCI01_0036_C01.b : ngtatctatagggctgctcxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0032_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0031_G05.b : nncccgctaannnnatacgatatctaagggctgctcxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0011_B07.b : nnnnnccgacatnnnnnnnggatactatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E07.b : nttcgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0025_A12.b :
MLTL1_0022_C04.b : nnnttcgattnnnnnnnggatatctaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0011_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0037_A03.b : nnnngggttatnnnnnnnggatacntaagggctxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0093_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0058_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0029_A10.b : ngcgggatnnttaaaagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0033_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLN01_0013_G03.b :
OVRT1_0107_A09.b :
MLTL1_0073_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
DCI01_0043_E12.b : nnggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_A01.b : nngggtaatnnggttacgtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0090_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
MLTL1_0082_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
OVR01_0036_E04.b :
DCI01_0001_C04.b : gacatctattgggatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_D03.b : nnntttccgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_G06.b :
DCI01_0044_C04.b : nagtaactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_H06.b :
OVRM1_0171_F08.b :
OVRM1_0060_D11.b :
HTMT1_0054_E03.b :
THY01_0048_D11.b :
ADR01_0029_G01.b :
ILNT1_0043_B12.b :
THY01_0038_B02.b :
TES01_0002_E05.b :
SKNB1_0047_B02.b :
HTMT1_0095_D09.b :
DCI01_0005_F02.b : tttctaatctatagggctaxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0025_H02.b :
OVRM1_0037_B07.b :
CBLT1_0018_B01.b :
THY01_0066_E08.b :
CLNT1_0083_E10.b :
MLN01_0084_B03.b :
MLN01_0094_D03.b :
PBL01_0100_C11.b :
ADR01_0080_F08.b :
TCH01_0055_A08.b :
OVR01_0019_F02.b :
ADR01_0102_E10.b :
SMG01_0018_F02.b :
SKNB1_0036_B06.b :
TES01_0074_C12.b :
TCH01_0064_B09.b :
SKNB1_0070_C03.b :
PST01_0043_B01.b :
PST01_0088_H11.b :
TES01_0110_H04.b :
TES01_0105_G05.b :
OVRM1_0117_A03.b :
TES01_0099_G11.b :
ADR01_0010_C09.b :
TES01_0052_D11.b :
MLTL1_0018_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0080_D02.b :
TES01_0087_F11.b :
TES01_0106_D09.b :
TES01_0033_A10.b :
TES01_0079_F05.b :
HTMT1_0040_B08.b :
ADR01_0078_A07.b :
PTG01_0009_C09.b :
MLTL1_0032_D08.b : nnnttgaattnnnnnnggatactatagggctgct
MLTL1_0045_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0051_H09.b :
PBL01_0094_D06.b :
OVR01_0029_F09.b :
ILNT1_0018_B02.b :
TES01_0040_B09.b :
TES01_0019_H02.b :
THY01_0008_B01.b :
OVR01_0057_E11.b :
OVR01_0041_H10.b :
LVRM1_0063_G06.b :
THY01_0122_H11.b :
THY01_0047_G03.b :
SPL01_0086_E09.b :
ITT01_0078_F01.b :
ADR01_0068_G08.b :
ADR01_0093_H12.b :
ADR01_0070_C09.b :
THY01_0067_C11.b :
SPL01_0086_E04.b :
MLTL1_0093_H09.b :
SPL01_0035_E07.b :
MLTL1_0071_F06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0102_H05.b :
ADR01_0015_A12.b :
TCH01_0027_F09.b :
TCH01_0015_G04.b :
PBL01_0013_D11.b :
SPL01_0022_G04.b :
ADR01_0013_D03.b :
PTG01_0030_D11.b :
OVR01_0084_H01.b :
OVR01_0080_H01.b :
ADR01_0044_E07.b :
TES01_0071_G03.b :
TES01_0063_H12.b :
OVR01_0064_B08.b :
OVR01_0052_B06.b :
TCH01_0013_F10.b :
SPL01_0029_G09.b :
OVR01_0097_E07.b :
ADR01_0049_G02.b :
THY01_0095_E10.b :
TCH01_0025_H12.b :
THY01_0042_D08.b :
SPL01_0037_B11.b :
ADR01_0022_C06.b :
TCH01_0087_D12.b :
ILNT1_0086_G12.b :
MLTL1_0086_E06.b :
SPL01_0056_F06.b :
TES01_0091_H02.b :
TES01_0098_C11.b :
SPL01_0099_E12.b :
MLTL1_0041_D08.b :
TES01_0076_E05.b :
DCI01_0031_C10.b :
OVRM1_0214_F01.b :
MLTL1_0040_H09.b :
20110601C-000449 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0002_H03.b :
TES01_0040_G01.b :
LVRM1_0034_A02.b : nagttg
SMG01_0039_G03.b : nnnnccgttttnnttttga
ADR01_0043_C02.b :
OVRT1_0103_A10.b : nnnnggtcagcgnacgxx
HTMT1_0008_C08.b :
HTMT1_0008_D12.b :
THY01_0122_H07.b :
TES01_0105_A12.b :
TES01_0034_F04.b :
TES01_0029_D03.b :
TES01_0030_D11.b :
TCH01_0047_C12.b : ttttttgcttggactatnacxxxxxxxx
TCH01_0010_F08.b : nnnggctaggactatgacxxxxxxxx
ADR01_0061_A09.b : ncct
TES01_0019_D11.b :
TES01_0076_E04.b :
TES01_0076_G02.b :
TES01_0092_G11.b :
TES01_0053_A04.b :
TES01_0072_C12.b :
SPL01_0073_D12.b : ntttgcttggactatnacxxxxxxx
TES01_0023_F12.b :
TES01_0112_C06.b :
SMG01_0093_C02.b : nnccgttttttnnnn
TES01_0055_E05.b :
TES01_0043_F09.b :
TCH01_0075_F11.b : nnnnggctaggactatnacxxxxxxx
SMG01_0067_H02.b : ttat
OVR01_0051_D07.b : nnnggcttggactatnacagtttg
TES01_0047_B12.b :
CLNT1_0147_D04.b : nnnccgttcgctgtcgxx
TES01_0090_H05.b :
TES01_0003_A09.b :
SKNB1_0038_G04.b :
TES01_0040_E03.b :
TES01_0002_A05.b :
TES01_0042_C01.b :
UTR01_0050_G04.b : cttttatggtgxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_B10.b : tgggggcccctattttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0081_C10.b : nttgttggactatgacxxxxx
KDN01_0026_H03.b :
PST01_0045_C11.b :
TES01_0064_D04.b :
BMWN1_0081_B04.b : ttttagagagtacgacgccg
BMWN1_0094_C06.b : nttttccgacg
OVRM1_0205_G12.b : agt
SPLT1_0031_G01.b : nnnggggg
BMWN1_0094_E01.b : tttttggc
HTMT1_0002_D09.b :
HTMT1_0132_G07.b : gtattggacggt
SPLT1_0034_G08.b : nnntttgcgagt
TES01_0093_E08.b :
SKNB1_0003_D05.b :
HTMT1_0024_C01.b : ttcgc
CBLT1_0023_F12.b : ntttttcgc
CBLT1_0039_A08.b : ttaag
CBLT1_0028_D12.b : tttttggca
CBLT1_0074_H11.b : tttttgcg
ILNT1_0076_E12.b : nnnggggcga
CBLT1_0031_B10.b : nnnaac
CBLT1_0082_C03.b : nccca
CBLT1_0065_E04.b : ttttaag
SPLT1_0065_F06.b : nnnnggc
SPLT1_0092_E12.b : nnnccgc
ILNT1_0052_H09.b : nnnnaagacg
CBLT1_0065_A01.b : nntttctgact
HTMT1_0075_H04.b : ttttacacg
ILNT1_0051_B05.b : nnnncga
CBLT1_0099_A12.b : nnnncgct
CBLT1_0063_F12.b : nccccctnnnnnnnggc
HTMT1_0114_G07.b : nnnnnggacg
HTMT1_0113_B04.b : nnnaagaca
SPLT1_0056_F10.b : nnggcgc
HTMT1_0130_E05.b : tttgga
ILNT1_0032_H02.b : nntttcgc
HTMT1_0114_G08.b : nnnnnggatg
HTMT1_0128_H09.b : ttttaaga
BMWN1_0011_B08.b : nnnnnggcag
HTMT1_0054_A03.b : nncctttttnnnnnaagac
HTMT1_0017_B02.b : tttttggacgg
CBLT1_0016_C02.b : tttcca
SMG01_0097_E05.b : ngccttttttnnnngg
ILNT1_0072_C02.b : nnnggac
CBLT1_0036_C08.b : ttttggc
HTMT1_0069_G07.b : ntttcgc
CBLT1_0084_A10.b : ttttgga
BMWN1_0002_C02.b : ntttgcaggtacgcggccg
HTMT1_0121_H10.b : nnttacgaggt
CBLT1_0025_H02.b : tttttggcag
CBLT1_0089_B09.b : ttttgg
DCI01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0105_F10.b : tttggat
CBLT1_0038_H08.b : ttttgcga
SPLT1_0068_H12.b : nnnnttga
CBLT1_0096_E08.b : nnnggag
TES01_0040_A05.b :
HTMT1_0131_B10.b : ttttcga
ILNT1_0049_F05.b : nnnnngga
HTMT1_0124_A01.b : tttttggacg
CBLT1_0030_F09.b : ttttccgac
HTMT1_0023_H04.b : ttttagca
CBLT1_0080_H07.b : ntttagc
CBLT1_0023_D04.b : tttgggga
HTMT1_0044_E12.b : ttttttggaca
CBLT1_0064_H07.b : nttacagac
CBLT1_0034_C05.b : nnnccgcagtt
HTMT1_0064_H07.b : nttggaga
HTMT1_0087_H11.b : tttatcgata
CBLT1_0062_G01.b : nnnttgcg
HTMT1_0007_B06.b :
HTMT1_0148_B08.b : tttttaagaa
HTMT1_0097_E01.b : tttttggacg
SPLT1_0086_G11.b : nttaatcgcgg
CBLT1_0036_B11.b : tttccg
CBLT1_0045_H07.b : ttttag
HTMT1_0149_H07.b : tttttggc
HTMT1_0143_A06.b : nnnnaaagac
HTMT1_0152_E02.b : ttttgga
HTMT1_0013_H11.b : nttttccgag
HTMT1_0055_C09.b : ttttaggacg
SPLT1_0004_D04.b : nnnnggcag
HTMT1_0051_G11.b : ttttgggatggt
HTMT1_0077_E02.b : tttttggcaagt
HTMT1_0065_D03.b : ttttccgacgg
HTMT1_0131_F02.b : ttttccg
CBLT1_0037_D07.b : ttttccga
HTMT1_0084_E04.b : aca
HTMT1_0135_D09.b : nggccttttttnnggat
HTMT1_0136_D05.b : nnncccgtttnttnnngga
CBLT1_0041_B09.b : nnnnccgc
CBLT1_0042_A08.b : ngg
CBLT1_0007_B09.b : nnnaacca
CBLT1_0082_D09.b : tttttag
HTMT1_0116_D04.b : naaaacgatag
CBLT1_0083_F05.b : ttttgacaa
ILNT1_0045_F09.b : nnnnaacga
HTMT1_0019_B08.b : nnggcag
HTMT1_0080_E02.b : tttcgc
HTMT1_0048_A09.b : tttttagaagg
HTMT1_0094_F04.b : tttttggaca
BMWN1_0050_D06.b : naaaccg
LNG01_0016_C06.b : cttttggttgacxxxxxxxxxxxxxxxxxx
HTMT1_0139_A11.b : nntttttttttttttggac
HTMT1_0064_G07.b : ttttccgacgg
HTMT1_0149_B12.b : ttttttca
HTMT1_0020_F06.b : nnnccgac
HTMT1_0041_F11.b : tttttggag
CBLT1_0058_H11.b : ttttggc
HTMT1_0076_D08.b : ntttgca
ILNT1_0040_F05.b : nnnnccg
CBLT1_0003_B05.b : tttttccg
CBLT1_0079_G03.b : tttttgg
CBLT1_0045_F01.b : ttttccgagg
HTMT1_0064_E05.b : ttttggtagg
HTMT1_0080_A10.b : nnnnaacgac
CBLT1_0035_D12.b : ttttagc
SKNB1_0025_A10.b :
CBLT1_0007_E08.b : nnnttcga
CBLT1_0075_C01.b : tttcca
CBLT1_0076_F06.b : ttttccgaagt
HTMT1_0141_C07.b : nnnttaggcga
ILNT1_0047_G01.b : nnngggaga
SPLT1_0092_G02.b : nnnttgc
ILNT1_0021_D06.b : nnnccg
HTMT1_0152_G10.b : tttttagc
CBLT1_0001_B02.b : ttttggc
HTMT1_0017_D04.b : ttttacgag
HTMT1_0059_E04.b : nttttccga
HTMT1_0151_H09.b : ttttccgca
ILNT1_0093_H08.b : nnnaaagca
ILNT1_0040_B02.b : ntttaggcga
SPLT1_0090_G05.b : nnnccgcgg
HTMT1_0141_C01.b : tttttccgaggx
HTMT1_0068_B04.b : tttttccgaggt
BMWN1_0047_G04.b : nnnggcaggtagaggxxxx
CBLT1_0037_G03.b : tttttcc
HTMT1_0095_E12.b : tttttcgac
CBLT1_0062_B01.b : nnggctcttttnnnnccg
BMWN1_0004_F11.b : nnnaaaagag
CBLT1_0013_A08.b : ttttgcgacg
CBLT1_0061_B06.b : tttnnnccgacggtagaggccxxx
CBLT1_0049_F05.b : nnnnccgc
ILNT1_0035_B02.b : nnnnnccga
CBLT1_0046_H08.b : ntttaga
CBLT1_0072_E04.b : nnnccg
ITT01_0055_D03.b :
CBLT1_0001_E12.b : ttttttgca
HTMT1_0079_B01.b : nnnggagca
HTMT1_0039_E07.b : ttttggcag
CBLT1_0070_E03.b : nnnncga
ILNT1_0046_F12.b : nnnngggga
HTMT1_0063_B02.b : nttcgaga
HTMT1_0096_H11.b : tttttcgat
SPLT1_0095_C10.b : nnnnggcg
CBLT1_0057_E08.b : ttttccc
HTMT1_0067_A11.b : tttttaca
ILNT1_0002_B07.b : ttccgc
CBLT1_0069_H07.b : nntttcgac
HTMT1_0142_H07.b : ntccagtgagcggcgtcgttttatacactcctatgggatttantnaatttttgttnnnn
ADR01_0061_C12.b : ca
OVRM1_0098_H08.b : tagttgtc
OVR01_0076_C04.b : gcttttgggacxxxxxxxxxxxxxxxxxxx
OVR01_0073_B04.b : agctxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0140_B02.b : cagttgtc
LVRM1_0093_C02.b : ttgtc
OVRM1_0076_E06.b : atxxxxxxxxxx
OVR01_0099_G12.b : tgtgatatagacxxxxxxxxxx
OVRM1_0192_H06.b :
OVRM1_0118_B04.b : tagttgtcx
OVRM1_0190_A08.b :
OVRM1_0055_A08.b : agttgac
OVRM1_0062_G02.b : agttgac
ADR01_0021_G06.b :
OVRM1_0210_G12.b : agttgtc
OVRM1_0021_E07.b : gacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0026_F05.b : nnnggcggttnnnnn
OVRM1_0098_D07.b : tagtttgtc
OVRM1_0103_A10.b : nagttgtc
UTR01_0010_G01.b : cattatggtgxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_A05.b : gggggcactattagxxxxxxxxxxxxxx
ADR01_0024_F11.b :
OVRM1_0049_B04.b : ttttctctttttcttcctttcttttttttttgtgtttcttttcttttctctcccactgtc
SPL01_0021_F04.b : ttttggtggactattagxxxxxxxxxxxxxx
OVRT1_0098_D01.b : nccccgtctgctgacgx
SPL01_0058_H08.b : nggggctaggactatgacxxxxxxxxx
SMG01_0002_E04.b : nnnaaggctttnnnn
OVR01_0090_E07.b : ataggacttanacxxxxxxxxx
THY01_0049_D01.b : ttttaagctgxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0008_C09.b : nggactcgtctgctgtcg
ADR01_0019_G07.b :
SPL01_0044_B10.b : nnnnggctagtgacttnacxxxxxxxxx
CLNT1_0132_D04.b : nnnnccgtttgctgtcngxx
UTR01_0094_C11.b : nttttgcttggactatgacxxxxxxxxx
CLNT1_0111_A10.b : nttttacgttagcgnacgag
SPLT1_0029_A02.b : ttttaagc
UTR01_0033_B02.b : gctttagagccnxxxxxxxxxxxxxxxxxxxx
OVRT1_0117_C08.b : nnncctttagctgtagxx
LVR01_0082_A11.b : ggggcatttggtgxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0013_G11.b : naactcctttagctgacgag
BFLT1_0060_B08.b : ggatccgtctgcgnac
OVRT1_0132_D01.b : nnnccgctttnnnnnnnnccgtttgcgnacgxxx
OVRT1_0012_E03.b : nnnnccgtctgctgacgxx
LVR01_0065_F09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0041_F03.b : tcgtttgctgtcgxx
CLNT1_0114_A01.b : nnnncctttagcctgtggxxxxxxxxxx
CLNT1_0102_D09.b : nnnccccgtcagcgnacgxxx
CLNT1_0133_C12.b : nntttccgttcgctgacgxxx
TES01_0052_A06.b :
OVRT1_0067_E07.b : nnaacactttagcgnacgag
OVR01_0007_G07.b : tcggggccctctcttagcxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_C11.b : nnnggctaggactatnacxxxxxxxxx
OVRT1_0131_D05.b : nnnccgatcccnnngnnnccctcagcgnacgxx
OVRT1_0111_G11.b : nnncctctnnnnnnnnnccgttagcgnaggx
ADR01_0029_B12.b : ttaaat
OVRT1_0030_D09.b : nnnnccgtttgctgtcgx
OVRT1_0031_D07.b : nnnnccgtcagcgnacgx
OVRT1_0014_D10.b : ncccccgttcgcgnacgx
OVRT1_0046_G01.b : ntttccgtctgctnacgxx
SPL01_0001_B11.b : attttgggtgxxxxxxxxxxxxxxxxxxxxxx
SPL01_0054_A12.b : nnnnggctagtgacttnacxxxxxxxxx
OVR01_0046_H02.b : aaagctttgcgtgxxxxxxxxxxxxxxxxxxxxx
CLNT1_0109_H09.b : nntttacgtatcgcgtagna
PBL01_0058_A11.b : nnng
OVRT1_0070_E12.b : nnnnnnnnnnnnnnnccatttgcgnacgxx
SPL01_0099_G07.b : nnnaagctagtgacttnacxxxxxxxxx
OVR01_0045_E11.b : aaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0054_G12.b : nnnaa
ADR01_0101_G12.b : ttataa
LNG01_0070_G01.b : ttttttgctggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0054_F10.b : aaaa
ADR01_0099_E12.b : ccccnng
OVR01_0051_D06.b : nnttgcttgtgacttnacxxxxxxxxx
MLN01_0084_A01.b : nnnttgctagtgacttgacagtttgtc
OVRT1_0051_H04.b : ncgctttnnnnnnccccgttcgcgnacgxx
THY01_0094_E03.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_F05.b : nnnnggctagtgacttnacxxxxxxxxx
MLN01_0035_H10.b : nnnnggctaggacttgacxxxxxxxxx
SPL01_0084_E06.b : nnnggcttggactatnacxxxxxxxxx
LVR01_0067_D02.b : gggtcgttggcgtacaagcatagtgxxxxxxxxxxxxxxxxxxxx
TCH01_0013_F12.b : nntttgcatgtgacttgacxxxxxxxxx
ADR01_0087_H06.b : nnnng
ITT01_0008_D07.b : nn
ADR01_0083_A10.b : ttttt
ITT01_0006_B04.b : nnn
ADR01_0074_E03.b : ccc
MLTL1_0088_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0032_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0031_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0011_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0013_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0025_A12.b : nttatat
MLTL1_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0011_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0037_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0093_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0058_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0029_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0033_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0013_G03.b : nnnnttagtggacttgacagtttgt
OVRT1_0107_A09.b : nnnnccgtcagcgnaggx
MLTL1_0073_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0043_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0089_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0090_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0082_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0036_E04.b : aggagatttggttgxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_G06.b : nnnn
DCI01_0044_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_H06.b :
OVRM1_0171_F08.b : tg
OVRM1_0060_D11.b : agttg
HTMT1_0054_E03.b : nnaaggacgg
THY01_0048_D11.b : ttttgggggxxxxxxxxxxxxxxxxxxx
ADR01_0029_G01.b : nnna
ILNT1_0043_B12.b : nnnnggacgg
THY01_0038_B02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0002_E05.b :
SKNB1_0047_B02.b :
HTMT1_0095_D09.b : ttttacgacg
DCI01_0005_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0025_H02.b : ggtttccgtcagcgnacgx
OVRM1_0037_B07.b : gagtt
CBLT1_0018_B01.b : nnnnn
THY01_0066_E08.b : cctttatggtgxxxxxxxxxxxxxxxxxxx
CLNT1_0083_E10.b : nnnncctcttnnnnnnnnacgtctgcgnacgxx
MLN01_0084_B03.b : nnnnggctaggactatnacxxxxxxxxx
MLN01_0094_D03.b : nnnggctaggactatnacxxxxxx
PBL01_0100_C11.b : nn
ADR01_0080_F08.b : ccaaa
TCH01_0055_A08.b : nnnnnggcttggactatgacxxxxxxx
OVR01_0019_F02.b : gtgggggaacctattagxxxxxxxxxx
ADR01_0102_E10.b : ttaa
SMG01_0018_F02.b : aca
SKNB1_0036_B06.b :
TES01_0074_C12.b :
TCH01_0064_B09.b : nnngggttgtgacttnacxxxxxxxx
SKNB1_0070_C03.b :
PST01_0043_B01.b :
PST01_0088_H11.b :
TES01_0110_H04.b :
TES01_0105_G05.b :
OVRM1_0117_A03.b :
TES01_0099_G11.b :
ADR01_0010_C09.b :
TES01_0052_D11.b :
MLTL1_0018_A02.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_D02.b : nnnnagctagtgacttn
TES01_0087_F11.b :
TES01_0106_D09.b :
TES01_0033_A10.b :
TES01_0079_F05.b :
HTMT1_0040_B08.b : ttggcag
ADR01_0078_A07.b :
PTG01_0009_C09.b :
MLTL1_0032_D08.b : cccgcaccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D04.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_H09.b : txxxxxxxx
PBL01_0094_D06.b :
OVR01_0029_F09.b :
ILNT1_0018_B02.b :
TES01_0040_B09.b :
TES01_0019_H02.b :
THY01_0008_B01.b :
OVR01_0057_E11.b : gcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0041_H10.b :
LVRM1_0063_G06.b :
THY01_0122_H11.b :
THY01_0047_G03.b :
SPL01_0086_E09.b :
ITT01_0078_F01.b :
ADR01_0068_G08.b :
ADR01_0093_H12.b :
ADR01_0070_C09.b :
THY01_0067_C11.b :
SPL01_0086_E04.b :
MLTL1_0093_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
SPL01_0035_E07.b :
MLTL1_0071_F06.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0102_H05.b :
ADR01_0015_A12.b :
TCH01_0027_F09.b :
TCH01_0015_G04.b :
PBL01_0013_D11.b :
SPL01_0022_G04.b :
ADR01_0013_D03.b :
PTG01_0030_D11.b :
OVR01_0084_H01.b :
OVR01_0080_H01.b :
ADR01_0044_E07.b :
TES01_0071_G03.b :
TES01_0063_H12.b :
OVR01_0064_B08.b :
OVR01_0052_B06.b :
TCH01_0013_F10.b :
SPL01_0029_G09.b :
OVR01_0097_E07.b :
ADR01_0049_G02.b :
THY01_0095_E10.b :
TCH01_0025_H12.b :
THY01_0042_D08.b :
SPL01_0037_B11.b :
ADR01_0022_C06.b :
TCH01_0087_D12.b :
ILNT1_0086_G12.b :
MLTL1_0086_E06.b :
SPL01_0056_F06.b :
TES01_0091_H02.b :
TES01_0098_C11.b :
SPL01_0099_E12.b :
MLTL1_0041_D08.b :
TES01_0076_E05.b :
DCI01_0031_C10.b :
OVRM1_0214_F01.b :
MLTL1_0040_H09.b :
20110601C-000449 : .......................................GGATTGGCGCTGGGCTCTCTG
---------+---------+---------+---------+---------+---------+ 21
HTMT1_0002_H03.b : nnccacatactaaGGATTAATGATTGGCTCTCTG
TES01_0040_G01.b : tttGGCTCTGGGCTCTCTG
LVRM1_0034_A02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGCTCTCTG
SMG01_0039_G03.b : ccaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGCTCTCTG
ADR01_0043_C02.b : nttgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGCTCTCTG
OVRT1_0103_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCTGGGCTCTCTG
HTMT1_0008_C08.b : nnccatactaaggattaatgATTGGCTCTCTG
HTMT1_0008_D12.b : nnnnggcatactaaggattaatgATTGGCTCTCTG
THY01_0122_H07.b : gttgcaaaacagcggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCTCTCTG
TES01_0105_A12.b : aactgcggtggctaTGGGCTCTCTG
TES01_0034_F04.b : gcgttggctaTGGGCTCTCTG
TES01_0029_D03.b : tcgcgttggctaTGGGCTCTCTG
TES01_0030_D11.b : tcgcgttggctaTGGGCTCTCTG
TCH01_0047_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCTCTCTG
TCH01_0010_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCTCTCTG
ADR01_0061_A09.b : ttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
TES01_0019_D11.b : gttggctacGGGCTCTC*G
TES01_0076_E04.b : nntctgcgttggctacGGGCTC*CTG
TES01_0076_G02.b : tttttcactgttgctatGGGCTC*CTG
TES01_0092_G11.b : nnnctcgcgttggctctGGGCTC*CTG
TES01_0053_A04.b : ncctgctgtggctatggGGGCTC*CTG
TES01_0072_C12.b : tttttcccacagttgctatGGGCTC*CTG
SPL01_0073_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
TES01_0023_F12.b : taTGGCTCTCTG
TES01_0112_C06.b : tttttcacggtggctGGGCTC*CTG
SMG01_0093_C02.b : ngagtaaagcagcggntcggntccxxxxxxxxxxxxxxxxxxxxxxxctgGGGCTCTCTG
TES01_0055_E05.b : nnnnncctgcggtggcaaggGGGCTC*CTG
TES01_0043_F09.b : tgtggctacggGGGCTCTCTG
TCH01_0075_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacGGGCTCTCTG
SMG01_0067_H02.b : tnnggactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
OVR01_0051_D07.b : tcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
TES01_0047_B12.b : ctcactgtggcaTGGCTCTCTG
CLNT1_0147_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGGGCTCTCTG
TES01_0090_H05.b : nttttcctaacgttggctatGGGCTCTC*G
TES01_0003_A09.b : tctgacgttggctatGGGCTC*CTG
SKNB1_0038_G04.b : nnnnttctcacgttggcanGGGCTCTC*G
TES01_0040_E03.b : ccacaatggctatGGGCTC*CTG
TES01_0002_A05.b : ttttctggctgtggctatGGGCTC*CTG
TES01_0042_C01.b : nctacagtggctatGGGCTC*CTG
UTR01_0050_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
OVR01_0008_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
TCH01_0081_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCTG
KDN01_0026_H03.b : nncctcgctgtggctatGGGCTCTC*G
PST01_0045_C11.b : ttttggctgcggtggctatGGGCTCTC*G
TES01_0064_D04.b : nnttcgcgtggctatgGGCTC*CTG
BMWN1_0081_B04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0094_C06.b : gagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
OVRM1_0205_G12.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0031_G01.b : cggtacacgccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0094_E01.b : aggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0002_D09.b : tcctcaggcgattaatgaattGGCTCTCTG
HTMT1_0132_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0034_G08.b : acgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
TES01_0093_E08.b : tttactaacgttggctacGGCTCTC*G
SKNB1_0003_D05.b : ncccatannnnnccccacagtggccacGGCTCTC*G
HTMT1_0024_C01.b : agtgagacgcagtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCC
CBLT1_0023_F12.b : ggttagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0039_A08.b : caggaagacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0028_D12.b : ggacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0074_H11.b : acggtagaggccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0076_E12.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0031_B10.b : gaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0082_C03.b : attacgaggccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0065_E04.b : acagtagacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0065_F06.b : tggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0092_E12.b : ggaacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0052_H09.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0065_A01.b : ggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0075_H04.b : gtacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0051_B05.b : gggacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0099_A12.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0063_F12.b : tggttagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0114_G07.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0113_B04.b : gtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCG
SPLT1_0056_F10.b : ggttagaggccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0130_E05.b : cggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0032_H02.b : agaacgacgccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0114_G08.b : gtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0128_H09.b : tggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0011_B08.b : agtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0054_A03.b : ggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0017_B02.b : tagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0016_C02.b : cggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SMG01_0097_E05.b : ggtcaagcagcggntcggntccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0072_C02.b : ggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0036_C08.b : aagtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0069_G07.b : agggagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTC
CBLT1_0084_A10.b : gggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0002_C02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttGGCTCTCTG
HTMT1_0121_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCG
CBLT1_0025_H02.b : gacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0089_B09.b : acgtgagaggcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
DCI01_0016_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGCTCTCTG
HTMT1_0105_F10.b : agtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0038_H08.b : ggtacgacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0068_H12.b : cggtacgaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0096_E08.b : acggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
TES01_0040_A05.b : tttccacagttgctatGGGCTCCTG
HTMT1_0131_B10.b : cggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0049_F05.b : cggtagaggccgtagtatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0124_A01.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0030_F09.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0023_H04.b : ggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0080_H07.b : aggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0023_D04.b : cggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0044_E12.b : gtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0064_H07.b : ggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0034_C05.b : aacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0064_H07.b : gtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0087_H11.b : gaacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0062_G01.b : acggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0007_B06.b : nnnnnccatactaaggattaatgattGGCTCTN*G
HTMT1_0148_B08.b : gtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0097_E01.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0086_G11.b : tacgacgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0036_B11.b : agtgacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0045_H07.b : acagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0149_H07.b : aggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0143_A06.b : ggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0152_E02.b : cggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0013_H11.b : gttagacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0055_C09.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0004_D04.b : gtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0051_G11.b : acgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0077_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0065_D03.b : tagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0131_F02.b : cgagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0037_D07.b : ggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0084_E04.b : ggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCT
HTMT1_0135_D09.b : agttagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0136_D05.b : tggaacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0041_B09.b : gattacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0042_A08.b : catgagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0007_B09.b : ggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0082_D09.b : acggtagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0116_D04.b : tacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0083_F05.b : tgagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0045_F09.b : cggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0019_B08.b : ttacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCG
HTMT1_0080_E02.b : tagtacgacgcagtcgtatttatctxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCG
HTMT1_0048_A09.b : ttagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0094_F04.b : gtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0050_D06.b : aggaacgacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
LNG01_0016_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0139_A11.b : ggttagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0064_G07.b : tagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0149_B12.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0020_F06.b : ggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0041_F11.b : agtacgaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0058_H11.b : aggtagaggccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0076_D08.b : gtgagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0040_F05.b : cggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0003_B05.b : aagtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0079_G03.b : caggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0045_F01.b : ttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0064_E05.b : tacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0080_A10.b : gagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0035_D12.b : aagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SKNB1_0025_A10.b : nnnccggttnnnnnnncctgacgttgtgcatGGCTCTC*G
CBLT1_0007_E08.b : ggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0075_C01.b : cagtagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0076_F06.b : agaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaaGGCTCTCTG
HTMT1_0141_C07.b : gtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0047_G01.b : cggtagaggccgtagtattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0092_G02.b : gagtagaggccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0021_D06.b : aggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0152_G10.b : aagtacacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0001_B02.b : aggtagacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0017_D04.b : gtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0059_E04.b : cggaagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0151_H09.b : ggacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0093_H08.b : ggtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0040_B02.b : cggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0090_G05.b : ttagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0141_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0068_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0047_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0037_G03.b : agagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0095_E12.b : ggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0062_B01.b : caggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
BMWN1_0004_F11.b : gaacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0013_A08.b : gtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0049_F05.b : aggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0035_B02.b : ggtacgacgccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0046_H08.b : cggtacaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0072_E04.b : acagacaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ITT01_0055_D03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0001_E12.b : ggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0079_B01.b : ggtacacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0039_E07.b : gtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0070_E03.b : cggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0046_F12.b : cgagtagacgccgtagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0063_B02.b : gtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCCG
HTMT1_0096_H11.b : ggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
SPLT1_0095_C10.b : agtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0057_E08.b : aggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0067_A11.b : cggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
ILNT1_0002_B07.b : aggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
CBLT1_0069_H07.b : ggtacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTG
HTMT1_0142_H07.b : gcaggtagacgcagtagtatttatagactcatatagggaatttaatgaattgGCTCTCTG
ADR01_0061_C12.b : gtgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0098_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0076_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0073_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0140_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
LVRM1_0093_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0076_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0099_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0192_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0118_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0190_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0055_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0062_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0021_G06.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0210_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0021_E07.b : xxxxxxxxxxxxxxxxxxxxxxxtataaattccggctgcagccttcccctgcGCTCTCTG
PTG01_0026_F05.b : nggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0098_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0103_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
UTR01_0010_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
UTR01_0014_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0024_F11.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRM1_0049_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0021_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0098_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0058_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SMG01_0002_E04.b : nggagcaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
THY01_0049_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0008_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtGCTCTCTG
ADR01_0019_G07.b : gtcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0044_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0132_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
UTR01_0094_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0111_A10.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPLT1_0029_A02.b : aggtagacgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
UTR01_0033_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0117_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
LVR01_0082_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0013_G11.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
BFLT1_0060_B08.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0132_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0012_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
LVR01_0065_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0041_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0114_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0102_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0133_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
TES01_0052_A06.b : tttttactactgttgctatggcGCTC*CTG
OVRT1_0067_E07.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0007_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0078_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0131_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0111_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtGCTCTCTG
ADR01_0029_B12.b : tgctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0030_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0031_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0014_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0046_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0001_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0054_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0046_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
CLNT1_0109_H09.b : tgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
PBL01_0058_A11.b : gtgcaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0070_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0099_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0045_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
PBL01_0054_G12.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0101_G12.b : gggatgaacagctgnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
LNG01_0070_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxtaaattccggctgcagccttcccctgcGCTCTCTG
ADR01_0054_F10.b : anggatgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0099_E12.b : gataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVR01_0051_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
MLN01_0084_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
OVRT1_0051_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
THY01_0094_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
MLN01_0048_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
MLN01_0035_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
SPL01_0084_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
LVR01_0067_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
TCH01_0013_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0087_H06.b : ggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ITT01_0008_D07.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0083_A10.b : ttgatcaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ITT01_0006_B04.b : ggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
ADR01_0074_E03.b : cnggtcaacagctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTG
MLTL1_0088_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
DCI01_0036_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0032_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0031_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
BKFL1_0011_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
DCI01_0013_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
BMWN1_0025_A12.b : ccggtacgacgcagtagtatttaacgactcatatagggaatttaatgaattggCTCTCTG
MLTL1_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
BKFL1_0011_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0037_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0093_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0058_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0029_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0033_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLN01_0013_G03.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
OVRT1_0107_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0073_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
DCI01_0043_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0089_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0090_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
MLTL1_0082_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
OVR01_0036_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgctCTCTCTG
DCI01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
DCI01_0091_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
ADR01_0057_G06.b : nggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
DCI01_0044_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTG
TES01_0072_H06.b : nttcgcgttggcacaTCTCTG
OVRM1_0171_F08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
OVRM1_0060_D11.b : acatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
HTMT1_0054_E03.b : tacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
THY01_0048_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
ADR01_0029_G01.b : atgatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
ILNT1_0043_B12.b : tacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
THY01_0038_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
TES01_0002_E05.b : ttttactgctgttgctacCTCCTG
SKNB1_0047_B02.b : nnggggnttannnnccagcgtgtgcaggGCTCTT
HTMT1_0095_D09.b : gtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
DCI01_0005_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTG
CLNT1_0025_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtTCTCTG
OVRM1_0037_B07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
CBLT1_0018_B01.b : cgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTCTG
THY01_0066_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
CLNT1_0083_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctcacaaCTCTG
MLN01_0084_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCTCTG
MLN01_0094_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
PBL01_0100_C11.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
ADR01_0080_F08.b : anggactacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
TCH01_0055_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
OVR01_0019_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
ADR01_0102_E10.b : antggataaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTG
SMG01_0018_F02.b : aaanggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTG
SKNB1_0036_B06.b : nncccgtnnnnnnnggtcacggtgtgcaggCTCG
TES01_0074_C12.b : tttttcctacggttgctatgggctcCTG
TCH01_0064_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCTG
SKNB1_0070_C03.b : nnnngggggtttnnnnnnacctacgtgtgcagggctctTG
PST01_0043_B01.b : nnnttgctcactgtggctatgggctctcG
PST01_0088_H11.b : cgagttggctatgggctctcG
TES01_0110_H04.b : tgctgtggcgggctcct
TES01_0105_G05.b : nttttgcatgcgtggctagctctc
OVRM1_0117_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_G11.b : tttttactacgttgcgctc
ADR01_0010_C09.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_D11.b : ttttcctacagttgctatgnc
MLTL1_0018_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_D02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0087_F11.b : nctgctgtggcgggctcc
TES01_0106_D09.b : ttaagtgcaatggctgctc
TES01_0033_A10.b : cagtggctgctc
TES01_0079_F05.b : tttttgctactgttgctagctct
HTMT1_0040_B08.b : gtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgctctcc
ADR01_0078_A07.b : nnnaaatgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0009_C09.b : nnnngcggttttcnnnggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0032_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0094_D06.b : nnnggatgaacaxxxxxxxxxxxxxxxxx
OVR01_0029_F09.b : gggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0018_B02.b : ttttccgcagtagaggcagtagtattaaxx
TES01_0040_B09.b :
TES01_0019_H02.b :
THY01_0008_B01.b : cattaggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0057_E11.b : xxxxxxxxxxxxxxxxxxccgaaaggttggtggttcgggcccacccagggacgccctctc
OVR01_0041_H10.b : agagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0122_H11.b :
THY01_0047_G03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0086_E09.b : nnnggctaggactataacxx
ITT01_0078_F01.b :
ADR01_0068_G08.b : nnnnn
ADR01_0093_H12.b : nnncc
ADR01_0070_C09.b :
THY01_0067_C11.b : ctttttgggtgxxxxxxxxxxxx
SPL01_0086_E04.b : nnnnggctaggactatnac
MLTL1_0093_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0035_E07.b : aagcttatggtg
MLTL1_0071_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0102_H05.b :
ADR01_0015_A12.b :
TCH01_0027_F09.b :
TCH01_0015_G04.b :
PBL01_0013_D11.b :
SPL01_0022_G04.b :
ADR01_0013_D03.b :
PTG01_0030_D11.b :
OVR01_0084_H01.b :
OVR01_0080_H01.b :
ADR01_0044_E07.b :
TES01_0071_G03.b :
TES01_0063_H12.b :
OVR01_0064_B08.b :
OVR01_0052_B06.b :
TCH01_0013_F10.b :
SPL01_0029_G09.b :
OVR01_0097_E07.b :
ADR01_0049_G02.b :
THY01_0095_E10.b :
TCH01_0025_H12.b :
THY01_0042_D08.b :
SPL01_0037_B11.b :
ADR01_0022_C06.b :
TCH01_0087_D12.b :
ILNT1_0086_G12.b :
MLTL1_0086_E06.b :
SPL01_0056_F06.b :
TES01_0091_H02.b :
TES01_0098_C11.b :
SPL01_0099_E12.b :
MLTL1_0041_D08.b :
TES01_0076_E05.b :
DCI01_0031_C10.b :
OVRM1_0214_F01.b :
MLTL1_0040_H09.b :
20110601C-000449 : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
---------+---------+---------+---------+---------+---------+ 75
HTMT1_0002_H03.b : CTCCTCC*CCGTTCGA*AGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0040_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LVRM1_0034_A02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0039_G03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0043_C02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0103_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0008_C08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGCCCTTTGCATTGCC****AGCCGCGTCCC
HTMT1_0008_D12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0122_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0105_A12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0034_F04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0029_D03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0030_D11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0047_C12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0010_F08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0061_A09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0019_D11.b : CTCCTCC*CCGTTCGACAGA*AGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0076_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0076_G02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0092_G11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0053_A04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCCAGGCAGCCGCGTCCC
TES01_0072_C12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0073_D12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0023_F12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0112_C06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0093_C02.b : CTCCTCC*CGNTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0055_E05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0043_F09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0075_F11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0067_H02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0051_D07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0047_B12.b : CTCCTCC*C*GTTCGA*AGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0147_D04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0090_H05.b : CTCCTCC*CCGTTCAACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0003_A09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0038_G04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0040_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0002_A05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0042_C01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
UTR01_0050_G04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0008_B10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0081_C10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
KDN01_0026_H03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PST01_0045_C11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0064_D04.b : CTCN*CC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0081_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0094_C06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0205_G12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0031_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0094_E01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0002_D09.b : CTCCTCC*CCGTCCGACAGACAGCTCGTGTGTCCCCTTTATTGCC****AGCCGCGTCCC
HTMT1_0132_G07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0034_G08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0093_E08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0003_D05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0024_C01.b : CTTCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0023_F12.b : CTCCTCT*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0039_A08.b : CTCCCTT*TAGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0028_D12.b : CTCCTCC*TTGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0074_H11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0076_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0031_B10.b : CTCCTCT*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0082_C03.b : CCCCTCT*ACGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0065_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0065_F06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0092_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0052_H09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0065_A01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0075_H04.b : TTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0051_B05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0099_A12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0063_F12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0114_G07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0113_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0056_F10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0130_E05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0032_H02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0114_G08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0128_H09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0011_B08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0054_A03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0017_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0016_C02.b : CTCCTCT*TCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0097_E05.b : CTCCTCC*CCNTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0072_C02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0036_C08.b : CTCCTCC*CTGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0069_G07.b : CTTCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0084_A10.b : CCCCTTC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0002_C02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0121_H10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0025_H02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0089_B09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0016_E01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0105_F10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0038_H08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0068_H12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0096_E08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0040_A05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0131_B10.b : CTCTTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0049_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0124_A01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0030_F09.b : CTCCTCTTCCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0023_H04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0080_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0023_D04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0044_E12.b : CTCCTCC*CCGTTCGACAGACAAC*CATGTGTTCCATGCATTGCC****AGCCGCGTCCC
CBLT1_0064_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0034_C05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0064_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0087_H11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0062_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0007_B06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0148_B08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0097_E01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0086_G11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0036_B11.b : CTCCCCC*TTGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0045_H07.b : CTCCTTT*TCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0149_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0143_A06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0152_E02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0013_H11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0055_C09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0004_D04.b : CTCCTCT*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0051_G11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0077_E02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0065_D03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0131_F02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0037_D07.b : CTCCTCC*TTGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0084_E04.b : TTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0135_D09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0136_D05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0041_B09.b : CTCCTCT*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0042_A08.b : CTCCTCC*CTTTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0007_B09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0082_D09.b : CCCCTTC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****ACCCGCGTCCC
HTMT1_0116_D04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0083_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0045_F09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0019_B08.b : TTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0080_E02.b : TTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0048_A09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0094_F04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0050_D06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LNG01_0016_C06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0139_A11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0064_G07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0149_B12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0020_F06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0041_F11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0058_H11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0076_D08.b : CTCTTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0040_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0003_B05.b : CTCCTCC*CCTTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0079_G03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0045_F01.b : CTCCTCT*TCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0064_E05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0080_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0035_D12.b : CTCCTCC*CTTTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0025_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0007_E08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0075_C01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0076_F06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0141_C07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0047_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0092_G02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0021_D06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0152_G10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0001_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0017_D04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0059_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0151_H09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0093_H08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0040_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0090_G05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0141_C01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0068_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0047_G04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0037_G03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0095_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0062_B01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0004_F11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0013_A08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0061_B06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0049_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0035_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0046_H08.b : CTCCTCT*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0072_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ITT01_0055_D03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0001_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0079_B01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0039_E07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0070_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0046_F12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0063_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0096_H11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0095_C10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0057_E08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0067_A11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0002_B07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0069_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0142_H07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0061_C12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0098_H08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0076_C04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0073_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0140_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LVRM1_0093_C02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0076_E06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0099_G12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0192_H06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0118_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0190_A08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0055_A08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0062_G02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0021_G06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0210_G12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0021_E07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PTG01_0026_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0098_D07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0103_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
UTR01_0010_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
UTR01_0014_A05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTCCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0024_F11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0049_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0021_F04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0098_D01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0058_H08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0002_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0090_E07.b : CTCCTCC*CCGTTCGACAGCCTGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0049_D01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0008_C09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0019_G07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0044_B10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0132_D04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
UTR01_0094_C11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0111_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPLT1_0029_A02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
UTR01_0033_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0117_C08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LVR01_0082_A11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0013_G11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BFLT1_0060_B08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0132_D01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0012_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LVR01_0065_F09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0041_F03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGTCGCGTCCC
CLNT1_0114_A01.b : CTCTTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0102_D09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0133_C12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGCGCATTGCC****AGCCGCGTCCC
TES01_0052_A06.b : CTCCTCC*CCGTTCGA*AGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0067_E07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0007_G07.b : CTCCTCC*CCGTTCCACCGACCGC*CGTGTGTTCCCTGCATTGCC****CGCCCCCTCCC
SPL01_0078_C11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0131_D05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0111_G11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0029_B12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0030_D09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0031_D07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0014_D10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0046_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0001_B11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0054_A12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0046_H02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0109_H09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PBL01_0058_A11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTACC****AGCCGCGTCCC
OVRT1_0070_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0099_G07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0045_E11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PBL01_0054_G12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0101_G12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LNG01_0070_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0054_F10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0099_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0051_D06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLN01_0084_A01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCACGTCCC
OVRT1_0051_H04.b : CTCCTCC*CCGCTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0094_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLN01_0048_F05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLN01_0035_H10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SPL01_0084_E06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
LVR01_0067_D02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0013_F12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0087_H06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ITT01_0008_D07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0083_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ITT01_0006_B04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0074_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0088_G08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0036_C01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0032_B01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0031_G05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BKFL1_0011_B07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0013_E07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BMWN1_0025_A12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0022_C04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
BKFL1_0011_B03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0037_A03.b : CTCCTCC*CCGTTCGGCAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0093_D02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0058_H03.b : CTCCTCC*CCGTTCGACAGGCAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0029_A10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0025_B05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0033_C06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLN01_0013_G03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRT1_0107_A09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0073_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0043_E12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0089_A01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0090_B12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0082_D08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0036_E04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0001_C04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0091_D03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0057_G06.b : CTCCCCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0044_C04.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0072_H06.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0171_F08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0060_D11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0054_E03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0048_D11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0029_G01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0043_B12.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0038_B02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0002_E05.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0047_B02.b : GCTCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0095_D09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
DCI01_0005_F02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0025_H02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVRM1_0037_B07.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CBLT1_0018_B01.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0066_E08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
CLNT1_0083_E10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGCTTTGTGAGTTGCC****AGCCGCGTCCC
MLN01_0084_B03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLN01_0094_D03.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PBL01_0100_C11.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0080_F08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0055_A08.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0019_F02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0102_E10.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SMG01_0018_F02.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0036_B06.b : CTCCTCC*CCGTTCGA*AGACAGC*CGTGTGTTCCGTGCATTGCC****ACCCGTGTCCC
TES01_0074_C12.b : CTCCTCC**CGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0064_B09.b : CTCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
SKNB1_0070_C03.b : CTCCTCC**CGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PST01_0043_B01.b : CTCCTCC**CGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****TGCCGCGTCCC
PST01_0088_H11.b : CTCCTCC**CGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0110_H04.b : gcCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0105_G05.b : gcCCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCTTGTCCC
OVRM1_0117_A03.b : xxxCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0099_G11.b : ctgCTCTCCCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ADR01_0010_C09.b : xxgCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0052_D11.b : tgcCCTC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0018_A02.b : xxxCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TCH01_0080_D02.b : xxxCTCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0087_F11.b : tgctCTC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0106_D09.b : ctgcTCTCCCGTTCGA*AGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0033_A10.b : cgctCTC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0079_F05.b : ctgccCC*CCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
HTMT1_0040_B08.b : ctttataagCGTTCGACAGACAGC*CGTGTGTTCCGTGCATTCCT****TATCGAGTCCC
ADR01_0078_A07.b : xxxxxxxxxxGTTCGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PTG01_0009_C09.b : xxxxxxxxxxxxxxGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0032_D08.b : xxxxxxxxxxxxagGACAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
MLTL1_0045_D04.b : xxxxxxxxxxxxxxxxCAGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
THY01_0051_H09.b : xxxxxxxxxxxxxxxxxxGACAGC*CGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
PBL01_0094_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTGTGTTCCGTGCATTGCC****AGCCGCGTCCC
OVR01_0029_F09.b : xxxxxxxxxxxxxxxxxctgttaactggGTGTTCCGTGCATTGCC****AGCCGCGTCCC
ILNT1_0018_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGTTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0040_B09.b : nccgcgttggctatgggtgTCCGTGCATTGCC****AGCCGCGTCCC
TES01_0019_H02.b : cgcatgtggctatgggtgttCGTGCATTGCC****AGCCGCGTCCC
THY01_0008_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCATTGCC****AGCCGCGTCCC
OVR01_0057_E11.b : tgctcctccccgttcgacagacagccgtgtgttccgTGCATTGCC****AGCCGCGTCCC
OVR01_0041_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxccttaaaactggGCATTGCC****AGCCGCGTCCC
LVRM1_0063_G06.b : xxxxxxxxxxgtaaagcctggcggagtggagccacaagggttcgaggactGCCGCGTCCC
THY01_0122_H11.b : gttgcaaaacagcggtacggtcggaatcctcagcctgttggcctactggC
THY01_0047_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttggcctactggC
SPL01_0086_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
ITT01_0078_F01.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
ADR01_0068_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxC
ADR01_0093_H12.b : gttnnnnaatgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
ADR01_0070_C09.b : ttttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
THY01_0067_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
SPL01_0086_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0093_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0035_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0071_F06.b : xxxxxxxxxxxxxxxxxxxxxxtggctgtgctgggaagccaggctggtctggcagggttg
TCH01_0102_H05.b : nnnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_A12.b : cgatgaacaxxxxxxxxxxx
TCH01_0027_F09.b : nnnnggctagtactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0015_G04.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0013_D11.b :
SPL01_0022_G04.b : tttatxxxxxxxx
ADR01_0013_D03.b :
PTG01_0030_D11.b :
OVR01_0084_H01.b : gcttg
OVR01_0080_H01.b : nggct
ADR01_0044_E07.b :
TES01_0071_G03.b :
TES01_0063_H12.b :
OVR01_0064_B08.b : nnntgc
OVR01_0052_B06.b : nnnnnggc
TCH01_0013_F10.b : tttt
SPL01_0029_G09.b : ttttgcca
OVR01_0097_E07.b :
ADR01_0049_G02.b :
THY01_0095_E10.b : ggcxxx
TCH01_0025_H12.b :
THY01_0042_D08.b :
SPL01_0037_B11.b :
ADR01_0022_C06.b :
TCH01_0087_D12.b :
ILNT1_0086_G12.b :
MLTL1_0086_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0056_F06.b :
TES01_0091_H02.b :
TES01_0098_C11.b :
SPL01_0099_E12.b :
MLTL1_0041_D08.b :
TES01_0076_E05.b :
DCI01_0031_C10.b :
OVRM1_0214_F01.b :
MLTL1_0040_H09.b :
20110601C-000449 : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
---------+---------+---------+---------+---------+---------+ 135
HTMT1_0002_H03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0040_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVRM1_0034_A02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0039_G03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0043_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0103_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0008_C08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0008_D12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0122_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0105_A12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0034_F04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0029_D03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0030_D11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0047_C12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0010_F08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0061_A09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0019_D11.b : TGAGACACTATGGTGAAAGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0076_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0076_G02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0092_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGCCACC
TES01_0053_A04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0072_C12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0073_D12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0023_F12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0112_C06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0093_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0055_E05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0043_F09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0075_F11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0067_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0051_D07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0047_B12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0147_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0090_H05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0003_A09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0038_G04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0040_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0002_A05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0042_C01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
UTR01_0050_G04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0008_B10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0081_C10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
KDN01_0026_H03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PST01_0045_C11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0064_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0081_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0094_C06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0205_G12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0031_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0094_E01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0002_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0132_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0034_G08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0093_E08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0003_D05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0024_C01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0023_F12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0039_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0028_D12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0074_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0076_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0031_B10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0082_C03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0065_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0065_F06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0092_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0052_H09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0065_A01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0075_H04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0051_B05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0099_A12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0063_F12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0114_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0113_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0056_F10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0130_E05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0032_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0114_G08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0128_H09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0011_B08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0054_A03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0017_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0016_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0097_E05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0072_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0036_C08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0069_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0084_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0002_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0121_H10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0025_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0089_B09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0016_E01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0105_F10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0038_H08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0068_H12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0096_E08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0040_A05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0131_B10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0049_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0124_A01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0030_F09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0023_H04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0080_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0023_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0044_E12.b : TGACACACGATGGTGAACGTCGGAGTGAAAGGATTTGGACGCATCGGGCGCCTGGTCACC
CBLT1_0064_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0034_C05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0064_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0087_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0062_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0007_B06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0148_B08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0097_E01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0086_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0036_B11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0045_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0149_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0143_A06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0152_E02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0013_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0055_C09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0004_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0051_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0077_E02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0065_D03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0131_F02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0037_D07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0084_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0135_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0136_D05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0041_B09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0042_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0007_B09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0082_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0116_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0083_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0045_F09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0019_B08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0080_E02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0048_A09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0094_F04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0050_D06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LNG01_0016_C06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0139_A11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0064_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0149_B12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0020_F06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0041_F11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0058_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0076_D08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0040_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0003_B05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0079_G03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0045_F01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0064_E05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0080_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0035_D12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0025_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0007_E08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0075_C01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0076_F06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0141_C07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0047_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0092_G02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0021_D06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0152_G10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0001_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0017_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0059_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0151_H09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0093_H08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0040_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0090_G05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0141_C01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0068_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0047_G04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0037_G03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0095_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0062_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BMWN1_0004_F11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0013_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0061_B06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0049_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0035_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0046_H08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0072_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ITT01_0055_D03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0001_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0079_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0039_E07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0070_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0046_F12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0063_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0096_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0095_C10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0057_E08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0067_A11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0002_B07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0069_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0142_H07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0061_C12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0098_H08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0076_C04.b : TGANACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0073_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0140_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVRM1_0093_C02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0076_E06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0099_G12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0192_H06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0118_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGTCGCATCGGGCGCCTGGTCACC
OVRM1_0190_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0055_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0062_G02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0021_G06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0210_G12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0021_E07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PTG01_0026_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0098_D07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0103_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
UTR01_0010_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
UTR01_0014_A05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0024_F11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0049_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0021_F04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0098_D01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0058_H08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0002_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0090_E07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0049_D01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0008_C09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0019_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0044_B10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0132_D04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
UTR01_0094_C11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0111_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPLT1_0029_A02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
UTR01_0033_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0117_C08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVR01_0082_A11.b : TGAGACGCGATGGTGGAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0013_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BFLT1_0060_B08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGACGCCTGGTCACC
OVRT1_0132_D01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0012_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVR01_0065_F09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0041_F03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0114_A01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0102_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0133_C12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0052_A06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0067_E07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0007_G07.b : TGAGACACCATGGTGAAGGTCGGAGTGAACGGATTTGGCCCCATCGGGCGCCTGGTCACC
SPL01_0078_C11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0131_D05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0111_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0029_B12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0030_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0031_D07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0014_D10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0046_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0001_B11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0054_A12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0046_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0109_H09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PBL01_0058_A11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0070_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0099_G07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0045_E11.b : TGGGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PBL01_0054_G12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0101_G12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LNG01_0070_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0054_F10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0099_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0051_D06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0084_A01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0051_H04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0094_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0048_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0035_H10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0084_E06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVR01_0067_D02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0013_F12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0087_H06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ITT01_0008_D07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0083_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ITT01_0006_B04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0074_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCGGGTCACC
MLTL1_0088_G08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0036_C01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0032_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0031_G05.b : TGAAACACAATGGTGAGGGTCAGAGTGAACGATTTTGGCCGCATCGGGCGCCTGGTCACC
BKFL1_0011_B07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0013_E07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCACCGGGCGCCTGGTCACC
BMWN1_0025_A12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0022_C04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
BKFL1_0011_B03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0037_A03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0093_D02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0058_H03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0029_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0025_B05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0033_C06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0013_G03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRT1_0107_A09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0073_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0043_E12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0089_A01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0090_B12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0082_D08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0036_E04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0001_C04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0091_D03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTAGTCACC
ADR01_0057_G06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0044_C04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0072_H06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0171_F08.b : TGAGACACGATGGTGAAGGTCGGAGCGAACGGGTTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0060_D11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0054_E03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0048_D11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0029_G01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0043_B12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0038_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0002_E05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0047_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0095_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
DCI01_0005_F02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0025_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVRM1_0037_B07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CBLT1_0018_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0066_E08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
CLNT1_0083_E10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0084_B03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLN01_0094_D03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PBL01_0100_C11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0080_F08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0055_A08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0019_F02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0102_E10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SMG01_0018_F02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0036_B06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0074_C12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0064_B09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SKNB1_0070_C03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PST01_0043_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PST01_0088_H11.b : CGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0110_H04.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0105_G05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGCCACC
OVRM1_0117_A03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0099_G11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGTGCCTGGTCACC
ADR01_0010_C09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0052_D11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0018_A02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0080_D02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0087_F11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0106_D09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0033_A10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0079_F05.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
HTMT1_0040_B08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0078_A07.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PTG01_0009_C09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0032_D08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0045_D04.b : TGAGACACGATGGTGAAAGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0051_H09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
PBL01_0094_D06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0029_F09.b : TGC*CTTCAATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ILNT1_0018_B02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0040_B09.b : TGAGACACGATGGTGAAGGTCGCAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
TES01_0019_H02.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0008_B01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0057_E11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
OVR01_0041_H10.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
LVRM1_0063_G06.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0122_H11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0047_G03.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0086_E09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ITT01_0078_F01.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0068_G08.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0093_H12.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0070_C09.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
THY01_0067_C11.b : TGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0086_E04.b : xGAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0093_H09.b : xxAGACACGATGGTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
SPL01_0035_E07.b : xxxxxxxxxxxxxTGAAGGTCGGAGTGAACGGATTTGGCCGCATCGGGCGCCTGGTCACC
MLTL1_0071_F06.b : tgcgaggaggaggaaatgagatctcctggtaGATTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGGCCGCATCGGGCGCCTGGTCACC
ADR01_0015_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTTTGGCCGCATCGCGCGCCTGGTCACC
TCH01_0027_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGCCGCATCGGGCGCCTGGTCACC
TCH01_0015_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGGCCGCATCGGGCGCCTGGTCACC
PBL01_0013_D11.b : nnaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0022_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0013_D03.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0030_D11.b : tttttgctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0084_H01.b : gacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0080_H01.b : tgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0044_E07.b : ngtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0071_G03.b : tttttcctg
TES01_0063_H12.b : ttgc
OVR01_0064_B08.b : ttaggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_B06.b : ttggactaanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0013_F10.b : ggataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0029_G09.b : tggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_E07.b : ggacttatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0049_G02.b : ttccaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0025_H12.b : ttggctaggactaaaacxxxxxxxxxxxxxxxxxxxxx
THY01_0042_D08.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0037_B11.b : gaggctxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_C06.b :
TCH01_0087_D12.b : nnnnggct
ILNT1_0086_G12.b :
MLTL1_0086_E06.b : nnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_F06.b :
TES01_0091_H02.b :
TES01_0098_C11.b :
SPL01_0099_E12.b :
MLTL1_0041_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
TES01_0076_E05.b :
DCI01_0031_C10.b : naaagtaacataxxxxxxx
OVRM1_0214_F01.b :
MLTL1_0040_H09.b : nnnnnnnnnnnnnnnnnnnnn
20110601C-000449 : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
---------+---------+---------+---------+---------+---------+ 193
HTMT1_0002_H03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0040_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVRM1_0034_A02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0039_G03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0043_C02.b : AAG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0103_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0008_C08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0008_D12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0122_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0105_A12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0034_F04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0029_D03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0030_D11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0047_C12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GGCCCCTTCATTG
TCH01_0010_F08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0061_A09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0019_D11.b : AGGAGCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0076_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0076_G02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0092_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0053_A04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0072_C12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0073_D12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0023_F12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0112_C06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0093_C02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0055_E05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0043_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0075_F11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0067_H02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0051_D07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0047_B12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0147_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0090_H05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0003_A09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0038_G04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0040_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0002_A05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0042_C01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
UTR01_0050_G04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0008_B10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0081_C10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
KDN01_0026_H03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PST01_0045_C11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0064_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0081_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0094_C06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0205_G12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0031_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0094_E01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0002_D09.b : AGGGACTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0132_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0034_G08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0093_E08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0003_D05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0024_C01.b : ATG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0023_F12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0039_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0028_D12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0074_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0076_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0031_B10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0082_C03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0065_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0065_F06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0092_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0052_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0065_A01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0075_H04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0051_B05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0099_A12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0063_F12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0114_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0113_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0056_F10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0130_E05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0032_H02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0114_G08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0128_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0011_B08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0054_A03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0017_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0016_C02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0097_E05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0072_C02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0036_C08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0069_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0084_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0002_C02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0121_H10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0025_H02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0089_B09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0016_E01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0105_F10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0038_H08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0068_H12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0096_E08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0040_A05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0131_B10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0049_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0124_A01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0030_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0023_H04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0080_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0023_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0044_E12.b : ATG*GCTGCTTTTAACTCTGGCAGAGAGGACATTGTCGCCTTCATT*GACCCCTTCATTG
CBLT1_0064_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0034_C05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0064_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0087_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0062_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0007_B06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0148_B08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0097_E01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0086_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0036_B11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0045_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0149_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0143_A06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0152_E02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0013_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0055_C09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0004_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0051_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0077_E02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0065_D03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0131_F02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0037_D07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0084_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0135_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0136_D05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0041_B09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0042_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0007_B09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0082_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0116_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0083_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0045_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0019_B08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0080_E02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0048_A09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0094_F04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0050_D06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LNG01_0016_C06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0139_A11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0064_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0149_B12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0020_F06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0041_F11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0058_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0076_D08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0040_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0003_B05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0079_G03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0045_F01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0064_E05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0080_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0035_D12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0025_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0007_E08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0075_C01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0076_F06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0141_C07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0047_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0092_G02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0021_D06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0152_G10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0001_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0017_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0059_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0151_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0093_H08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0040_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0090_G05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0141_C01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0068_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0047_G04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0037_G03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0095_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0062_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0004_F11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0013_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0061_B06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0049_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0035_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0046_H08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0072_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ITT01_0055_D03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0001_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0079_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0039_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0070_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0046_F12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0063_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0096_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0095_C10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0057_E08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0067_A11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0002_B07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0069_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0142_H07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0061_C12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0098_H08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0076_C04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0073_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0140_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVRM1_0093_C02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0076_E06.b : AGG*GCTGCTTTTAACTCAGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0099_G12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0192_H06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0118_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0190_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0055_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0062_G02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0021_G06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0210_G12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0021_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PTG01_0026_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0098_D07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0103_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
UTR01_0010_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
UTR01_0014_A05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0024_F11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0049_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0021_F04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0098_D01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0058_H08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0002_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0090_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0049_D01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0008_C09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0019_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0044_B10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0132_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
UTR01_0094_C11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0111_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPLT1_0029_A02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
UTR01_0033_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0117_C08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVR01_0082_A11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0013_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BFLT1_0060_B08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0132_D01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0012_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVR01_0065_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0041_F03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0114_A01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0102_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0133_C12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0052_A06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0067_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0007_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCCCCCTCAAT*GACCCCTTCATTG
SPL01_0078_C11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0131_D05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0111_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0029_B12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0030_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0031_D07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0014_D10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0046_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0001_B11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0054_A12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0046_H02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0109_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PBL01_0058_A11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0070_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0099_G07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0045_E11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PBL01_0054_G12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0101_G12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LNG01_0070_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0054_F10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0099_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0051_D06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0084_A01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0051_H04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0094_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0048_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0035_H10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACGTTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0084_E06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVR01_0067_D02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0013_F12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0087_H06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ITT01_0008_D07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0083_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ITT01_0006_B04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0074_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0088_G08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0036_C01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0032_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0031_G05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BKFL1_0011_B07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0013_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BMWN1_0025_A12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0022_C04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
BKFL1_0011_B03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0037_A03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0093_D02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0058_H03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0029_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0025_B05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTTTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0033_C06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0013_G03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRT1_0107_A09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0073_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0043_E12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0089_A01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0090_B12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0082_D08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0036_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0001_C04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0091_D03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0057_G06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0044_C04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0072_H06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0171_F08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0060_D11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0054_E03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0048_D11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0029_G01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0043_B12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0038_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0002_E05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0047_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0095_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
DCI01_0005_F02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0025_H02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0037_B07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CBLT1_0018_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0066_E08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
CLNT1_0083_E10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0084_B03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLN01_0094_D03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PBL01_0100_C11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0080_F08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0055_A08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTTGCCATCAAT*GACCCCTTCATTG
OVR01_0019_F02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0102_E10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SMG01_0018_F02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0036_B06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0074_C12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0064_B09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SKNB1_0070_C03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGTCATTGTCGCCATCAAT*GACCCCTTCATTG
PST01_0043_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PST01_0088_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0110_H04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0105_G05.b : AGG*GCTGCTTTTAACCCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVRM1_0117_A03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0099_G11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0010_C09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0052_D11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0018_A02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0080_D02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0087_F11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0106_D09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0033_A10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0079_F05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
HTMT1_0040_B08.b : ATT*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0078_A07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PTG01_0009_C09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0032_D08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0045_D04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0051_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PBL01_0094_D06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0029_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ILNT1_0018_B02.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0040_B09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0019_H02.b : AGG*GCTGCTTTTAACTCTGGTAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0008_B01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0057_E11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0041_H10.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
LVRM1_0063_G06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0122_H11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0047_G03.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0086_E09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ITT01_0078_F01.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0068_G08.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0093_H12.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0070_C09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0067_C11.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0086_E04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0093_H09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0035_E07.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
MLTL1_0071_F06.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0102_H05.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0015_A12.b : AGGAGCTGCTTTTAACTCTGGCAAAGTGCACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0027_F09.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0015_G04.b : AGG*GCTGCTTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PBL01_0013_D11.b : xxxxxxxxxxTTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0022_G04.b : xxxxxxxxxxxTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0013_D03.b : xxxxxxxxxxxTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
PTG01_0030_D11.b : xxxxxxxxxxgTTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0084_H01.b : xxxxxxxxxxxxTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0080_H01.b : xxxxxxxxxxxxTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
ADR01_0044_E07.b : xxxxxxxxxxggTAACTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0071_G03.b : ctgtggctatggttACTCTGGCAA*GTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TES01_0063_H12.b : cacgttggcactggACTCTGGCAA*GTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0064_B08.b : xxxxxxxxxxxxxxxCTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0052_B06.b : xxxxxxxxxxxxxxxCTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0013_F10.b : xxxxxxxxxxxxxxxxTCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
SPL01_0029_G09.b : xxxxxxxxxxxxxtgggCTGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
OVR01_0097_E07.b : xxxxxxxxxxxxxxxxxCTGGCAAAGTGGACATTGTCGCCATCACCCGATCCCTTCATTG
ADR01_0049_G02.b : xxxxxxxxxxxxxxxxtcaGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
THY01_0095_E10.b : xxxxxxxxxxxxxxxxxxxGGCAAAGTGGACATTGTCGCCATCAAT*GACCCCTTCATTG
TCH01_0025_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAAT*GACCCCTTCATTG
THY01_0042_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTCATTG
SPL01_0037_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTG
ADR01_0022_C06.b : naaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
TCH01_0087_D12.b : aggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0086_G12.b : nnnngggcgagtacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0086_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_F06.b : nnnnggctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0091_H02.b :
TES01_0098_C11.b : tt
SPL01_0099_E12.b : ntttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0076_E05.b :
DCI01_0031_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_F01.b :
MLTL1_0040_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000449 : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
---------+---------+---------+---------+---------+---------+ 253
HTMT1_0002_H03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0040_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVRM1_0034_A02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SMG01_0039_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0043_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0103_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0008_C08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0008_D12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0122_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0105_A12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0034_F04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0029_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0030_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0047_C12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0010_F08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0061_A09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0019_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0076_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0076_G02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0092_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAGGTTCCACGGCA
TES01_0053_A04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0072_C12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0073_D12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0023_F12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0112_C06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACAGCAAGTTCCACGGCA
SMG01_0093_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0055_E05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0043_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0075_F11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SMG01_0067_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0051_D07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0047_B12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGACTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0147_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0090_H05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0003_A09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0038_G04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0040_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0002_A05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0042_C01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
UTR01_0050_G04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0008_B10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0081_C10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
KDN01_0026_H03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PST01_0045_C11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0064_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0081_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0094_C06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0205_G12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0031_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0094_E01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0002_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0132_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0034_G08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0093_E08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0003_D05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0024_C01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0023_F12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0039_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0028_D12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0074_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0076_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0031_B10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0082_C03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0065_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0065_F06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0092_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0052_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0065_A01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0075_H04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0051_B05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0099_A12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0063_F12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0114_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0113_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0056_F10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0130_E05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0032_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0114_G08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0128_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0011_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0054_A03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0017_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0016_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SMG01_0097_E05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0072_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0036_C08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0069_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0084_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0002_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0121_H10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0025_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0089_B09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0016_E01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0105_F10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0038_H08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0068_H12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0096_E08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0040_A05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0131_B10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0049_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0124_A01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0030_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0023_H04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0080_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0023_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0044_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0064_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0034_C05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0064_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0087_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0062_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0007_B06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0148_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0097_E01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0086_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0036_B11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0045_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0149_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0143_A06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0152_E02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0013_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0055_C09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0004_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0051_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0077_E02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0065_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0131_F02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0037_D07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0084_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0135_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0136_D05.b : ACCTCCACTACGTGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0041_B09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0042_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0007_B09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0082_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0116_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0083_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0045_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0019_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0080_E02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0048_A09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0094_F04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0050_D06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LNG01_0016_C06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0139_A11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0064_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0149_B12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0020_F06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0041_F11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0058_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0076_D08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0040_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0003_B05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0079_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0045_F01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0064_E05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0080_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0035_D12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0025_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0007_E08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0075_C01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0076_F06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0141_C07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0047_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0092_G02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0021_D06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0152_G10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0001_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0017_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0059_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0151_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0093_H08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0040_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0090_G05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0141_C01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0068_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0047_G04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0037_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0095_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0062_B01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0004_F11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0013_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0061_B06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0049_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0035_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0046_H08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0072_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ITT01_0055_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0001_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0079_B01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0039_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0070_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0046_F12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0063_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0096_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0095_C10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0057_E08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0067_A11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0002_B07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0069_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0142_H07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0061_C12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0098_H08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0076_C04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0073_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0140_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVRM1_0093_C02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0076_E06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0099_G12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0192_H06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0118_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0190_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0055_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0062_G02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0021_G06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0210_G12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0021_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PTG01_0026_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0098_D07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0103_A10.b : ACCTCCGCTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
UTR01_0010_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
UTR01_0014_A05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0024_F11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0049_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0021_F04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0098_D01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0058_H08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SMG01_0002_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0090_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0049_D01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0008_C09.b : ACCTCCACTACATGGTCTACATGTTCCAGTACGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0019_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0044_B10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0132_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
UTR01_0094_C11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0111_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPLT1_0029_A02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
UTR01_0033_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0117_C08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVR01_0082_A11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0013_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BFLT1_0060_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0132_D01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0012_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVR01_0065_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGCTCCACGGCA
CLNT1_0041_F03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0114_A01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0102_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0133_C12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0052_A06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0067_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0007_G07.b : ACCTCCACTACATGGTCTACCTGTTCCAGTATGATTCCCCCCACGGCAAGTTCCACGGCA
SPL01_0078_C11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0131_D05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0111_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0029_B12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0030_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0031_D07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0014_D10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0046_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0001_B11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0054_A12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0046_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0109_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PBL01_0058_A11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0070_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0099_G07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0045_E11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PBL01_0054_G12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0101_G12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LNG01_0070_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0054_F10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0099_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0051_D06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLN01_0084_A01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0051_H04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0094_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCCAGTTCCACGGCA
MLN01_0048_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLN01_0035_H10.b : ACCTCCACTACATGATCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0084_E06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVR01_0067_D02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0013_F12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0087_H06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ITT01_0008_D07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0083_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ITT01_0006_B04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0074_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0088_G08.b : ACCTCCACTACATGGTCTACATATTCCAGTATGATTCCACCCACGGCAAGTTTCACGGCA
DCI01_0036_C01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0032_B01.b : ACCTCCACTACATGGTTTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0031_G05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BKFL1_0011_B07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0013_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BMWN1_0025_A12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0022_C04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
BKFL1_0011_B03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0037_A03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0093_D02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0058_H03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0029_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0025_B05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0033_C06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLN01_0013_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRT1_0107_A09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0073_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0043_E12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0089_A01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0090_B12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0082_D08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0036_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0001_C04.b : ACCTCCACTACATGGTCTACATGTTCCAGTACGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0091_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0057_G06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0044_C04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0072_H06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0171_F08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0060_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0054_E03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0048_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0029_G01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0043_B12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0038_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0002_E05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0047_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0095_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
DCI01_0005_F02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0025_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0037_B07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CBLT1_0018_B01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0066_E08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
CLNT1_0083_E10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLN01_0084_B03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLN01_0094_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PBL01_0100_C11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0080_F08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0055_A08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0019_F02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0102_E10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SMG01_0018_F02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0036_B06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0074_C12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0064_B09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SKNB1_0070_C03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PST01_0043_B01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PST01_0088_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0110_H04.b : ACCTCCACTACATGGTCCACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0105_G05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVRM1_0117_A03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0099_G11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0010_C09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0052_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0018_A02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0080_D02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0087_F11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0106_D09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0033_A10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0079_F05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
HTMT1_0040_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0078_A07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PTG01_0009_C09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0032_D08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0045_D04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0051_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PBL01_0094_D06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0029_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0018_B02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0040_B09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0019_H02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0008_B01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0057_E11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0041_H10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
LVRM1_0063_G06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0122_H11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0047_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0086_E09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ITT01_0078_F01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0068_G08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0093_H12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0070_C09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0067_C11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0086_E04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0093_H09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0035_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0071_F06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCGCGGCAAGTTCCACGGCA
TCH01_0102_H05.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0015_A12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0027_F09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0015_G04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PBL01_0013_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0022_G04.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0013_D03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
PTG01_0030_D11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0084_H01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0080_H01.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0044_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0071_G03.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0063_H12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0064_B08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0052_B06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0013_F10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0029_G09.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
OVR01_0097_E07.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0049_G02.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0095_E10.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0025_H12.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
THY01_0042_D08.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0037_B11.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ADR01_0022_C06.b : ACCTCCACTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TCH01_0087_D12.b : xxxxxxxCTACATGGTCTACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
ILNT1_0086_G12.b : xxxxxxxxxxxxxxxxxxACATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0086_E06.b : xxxxxxxxxxxxxxxxxxxCATGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0056_F06.b : xxxxxxxxxxxxxxxxxxxxxxGTTCCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0091_H02.b : nttttcctgcgtttgctctggatgttCAGTATGATTCCACCCACGGCAAGTTCCACGGCA
TES01_0098_C11.b : tcccgcgttggctctgnatacatgttccGTATGATTCCACCCACGGCAAGTTCCACGGCA
SPL01_0099_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTCCACCCACGGCAAGTTCCACGGCA
MLTL1_0041_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0076_E05.b : nnattgcgttggcttccgg
DCI01_0031_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0040_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000449 : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
---------+---------+---------+---------+---------+---------+ 313
HTMT1_0002_H03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0040_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVRM1_0034_A02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0039_G03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0043_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0103_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0008_C08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0008_D12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0122_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0105_A12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0034_F04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0029_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0030_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0047_C12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0010_F08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0061_A09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0019_D11.b : CAGACAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0076_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0076_G02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0092_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0053_A04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0072_C12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0073_D12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0023_F12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0112_C06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0093_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0055_E05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0043_F09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0075_F11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0067_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0051_D07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0047_B12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0147_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0090_H05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0003_A09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0038_G04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCGTCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0040_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0002_A05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0042_C01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
UTR01_0050_G04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0008_B10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0081_C10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
KDN01_0026_H03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PST01_0045_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0064_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0081_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0094_C06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0205_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0031_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0094_E01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0002_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0132_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0034_G08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0093_E08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0003_D05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0024_C01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0023_F12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0039_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0028_D12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0074_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0076_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0031_B10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0082_C03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0065_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0065_F06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0092_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0052_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0065_A01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0075_H04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCCATGGAAAGGCCATCACGATCTTCCAGG
ILNT1_0051_B05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0099_A12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0063_F12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0114_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0113_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0056_F10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0130_E05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0032_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0114_G08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0128_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0011_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0054_A03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0017_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0016_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0097_E05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0072_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0036_C08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0069_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0084_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0002_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0121_H10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0025_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0089_B09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0016_E01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0105_F10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0038_H08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0068_H12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0096_E08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0040_A05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0131_B10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0049_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0124_A01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0030_F09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0023_H04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0080_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0023_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0044_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0064_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0034_C05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0064_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0087_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0062_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0007_B06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0148_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0097_E01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0086_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0036_B11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0045_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0149_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0143_A06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0152_E02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0013_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0055_C09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0004_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0051_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0077_E02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0065_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0131_F02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0037_D07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0084_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0135_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0136_D05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0041_B09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0042_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0007_B09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0082_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0116_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0083_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0045_F09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0019_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0080_E02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0048_A09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0094_F04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0050_D06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LNG01_0016_C06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0139_A11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0064_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0149_B12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0020_F06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0041_F11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0058_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0076_D08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0040_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0003_B05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0079_G03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0045_F01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0064_E05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0080_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0035_D12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0025_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0007_E08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0075_C01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0076_F06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0141_C07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0047_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0092_G02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0021_D06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0152_G10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0001_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0017_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0059_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0151_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0093_H08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0040_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0090_G05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0141_C01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0068_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0047_G04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0037_G03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0095_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0062_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0004_F11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0013_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0061_B06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0049_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0035_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0046_H08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0072_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ITT01_0055_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0001_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0079_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0039_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0070_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0046_F12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0063_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0096_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0095_C10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0057_E08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0067_A11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0002_B07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0069_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0142_H07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0061_C12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0098_H08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0076_C04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0073_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0140_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVRM1_0093_C02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0076_E06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0099_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0192_H06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0118_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0190_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0055_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0062_G02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0021_G06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0210_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0021_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PTG01_0026_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0098_D07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0103_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
UTR01_0010_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
UTR01_0014_A05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0024_F11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0049_B04.b : CAGTCTAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0021_F04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0098_D01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0058_H08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0002_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0090_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0049_D01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0008_C09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0019_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0044_B10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0132_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
UTR01_0094_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0111_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPLT1_0029_A02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
UTR01_0033_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0117_C08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVR01_0082_A11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0013_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BFLT1_0060_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0132_D01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0012_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVR01_0065_F09.b : CAGTCAAGGCGGGGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0041_F03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0114_A01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0102_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0133_C12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0052_A06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0067_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0007_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCCCCATCTTCCAGG
SPL01_0078_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0131_D05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0111_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0029_B12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0030_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0031_D07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0014_D10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0046_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0001_B11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0054_A12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0046_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0109_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PBL01_0058_A11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0070_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0099_G07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGGAAGGCCATCACCATCTTCCAGG
OVR01_0045_E11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PBL01_0054_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0101_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LNG01_0070_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0054_F10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0099_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0051_D06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0084_A01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0051_H04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0094_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0048_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0035_H10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0084_E06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVR01_0067_D02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0013_F12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0087_H06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ITT01_0008_D07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0083_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ITT01_0006_B04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0074_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0088_G08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0036_C01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0032_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0031_G05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BKFL1_0011_B07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0013_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BMWN1_0025_A12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0022_C04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
BKFL1_0011_B03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0037_A03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0093_D02.b : CAGTCAAGGCGGAGAATGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0058_H03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0029_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0025_B05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0033_C06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0013_G03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRT1_0107_A09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0073_E12.b : CAGCCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0043_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0089_A01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0090_B12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0082_D08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0036_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0001_C04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0091_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0057_G06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0044_C04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0072_H06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0171_F08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0060_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0054_E03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0048_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0029_G01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0043_B12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0038_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0002_E05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0047_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0095_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0005_F02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0025_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0037_B07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATNCATGGAAAGGCCATCACCATCTTCCAGG
CBLT1_0018_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0066_E08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
CLNT1_0083_E10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0084_B03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLN01_0094_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PBL01_0100_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0080_F08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0055_A08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0019_F02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0102_E10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SMG01_0018_F02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0036_B06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGGAAGGCCATCACCATCTTCCAGG
TES01_0074_C12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0064_B09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SKNB1_0070_C03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PST01_0043_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PST01_0088_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0110_H04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0105_G05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0117_A03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0099_G11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0010_C09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0052_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0018_A02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0080_D02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0087_F11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0106_D09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0033_A10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0079_F05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
HTMT1_0040_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0078_A07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PTG01_0009_C09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0032_D08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0045_D04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCACG
THY01_0051_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PBL01_0094_D06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0029_F09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0018_B02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0040_B09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0019_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0008_B01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0057_E11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0041_H10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
LVRM1_0063_G06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0122_H11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0047_G03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0086_E09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ITT01_0078_F01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0068_G08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0093_H12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0070_C09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0067_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAGAGGCCATCACCATCTTCCAGG
SPL01_0086_E04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0093_H09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0035_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0071_F06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0102_H05.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0015_A12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0027_F09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0015_G04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PBL01_0013_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0022_G04.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0013_D03.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
PTG01_0030_D11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0084_H01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0080_H01.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0044_E07.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0071_G03.b : CAGTCAAGGCGGAGAGCGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0063_H12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0064_B08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0052_B06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0013_F10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0029_G09.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVR01_0097_E07.b : CACTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0049_G02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0095_E10.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0025_H12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
THY01_0042_D08.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0037_B11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ADR01_0022_C06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TCH01_0087_D12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
ILNT1_0086_G12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0086_E06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0056_F06.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0091_H02.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0098_C11.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
SPL01_0099_E12.b : CAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0041_D08.b : xAGTCAAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
TES01_0076_E05.b : ccantcAGGCGGAGAACGGGAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
DCI01_0031_C10.b : xxxxxxxxxxxxxxxxxxxxAAGCTTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
OVRM1_0214_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTGTCATCAATGGAAAGGCCATCACCATCTTCCAGG
MLTL1_0040_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCAATGGAAAGGCCATCACCATCTTCCAGG
20110601C-000449 : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
---------+---------+---------+---------+---------+---------+ 373
HTMT1_0002_H03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0040_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVRM1_0034_A02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0039_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0043_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0103_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGCGGAGTCCA
HTMT1_0008_C08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0008_D12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0122_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0105_A12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0034_F04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0029_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0030_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0047_C12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0010_F08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0061_A09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0019_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0076_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0076_G02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0092_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0053_A04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0072_C12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0073_D12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0023_F12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0112_C06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0093_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0055_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0043_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0075_F11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0067_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0051_D07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0047_B12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0147_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0090_H05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0003_A09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0038_G04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0040_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0002_A05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0042_C01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
UTR01_0050_G04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0008_B10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0081_C10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
KDN01_0026_H03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PST01_0045_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0064_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0081_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0094_C06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0205_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0031_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0094_E01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0002_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGAGGAGTCCA
HTMT1_0132_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0034_G08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0093_E08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0003_D05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0024_C01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0023_F12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0039_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0028_D12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0074_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0076_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0031_B10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0082_C03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0065_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0065_F06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0092_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0052_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0065_A01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0075_H04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0051_B05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0099_A12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0063_F12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0114_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0113_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0056_F10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0130_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0032_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0114_G08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0128_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0011_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0054_A03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0017_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0016_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0097_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0072_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0036_C08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0069_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0084_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0002_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0121_H10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0025_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0089_B09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0016_E01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0105_F10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0038_H08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0068_H12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0096_E08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0040_A05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0131_B10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0049_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0124_A01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0030_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0023_H04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0080_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0023_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0044_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0064_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0034_C05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0064_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0087_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0062_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0007_B06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0148_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0097_E01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0086_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0036_B11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0045_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0149_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0143_A06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0152_E02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0013_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0055_C09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0004_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0051_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0077_E02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0065_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0131_F02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0037_D07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0084_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0135_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0136_D05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACATATGTTGTGGAGTCCA
CBLT1_0041_B09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0042_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0007_B09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0082_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0116_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0083_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0045_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0019_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0080_E02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0048_A09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0094_F04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0050_D06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LNG01_0016_C06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0139_A11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0064_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0149_B12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0020_F06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0041_F11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0058_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0076_D08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0040_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0003_B05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0079_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0045_F01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0064_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0080_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0035_D12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0025_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0007_E08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0075_C01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0076_F06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0141_C07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0047_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0092_G02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0021_D06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0152_G10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0001_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0017_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0059_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0151_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0093_H08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0040_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0090_G05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0141_C01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0068_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0047_G04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0037_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0095_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0062_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0004_F11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0013_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0061_B06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0049_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0035_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0046_H08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0072_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ITT01_0055_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0001_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0079_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0039_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0070_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0046_F12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0063_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0096_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0095_C10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0057_E08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0067_A11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0002_B07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0069_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0142_H07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0061_C12.b : AGCGAGATCCCGCCNAACATCAATGNNGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0098_H08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0076_C04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0073_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0140_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVRM1_0093_C02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0076_E06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0099_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0192_H06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0118_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0190_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0055_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTTTGTTGTGGAGTCCA
OVRM1_0062_G02.b : AGCGAGATCCCGCCNACATCANATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0021_G06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0210_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0021_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PTG01_0026_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0098_D07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0103_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
UTR01_0010_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
UTR01_0014_A05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0024_F11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0049_B04.b : AGCGAGATCCCGCCTACATCATATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0021_F04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0098_D01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0058_H08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0002_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0090_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0049_D01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0008_C09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0019_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0044_B10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0132_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
UTR01_0094_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0111_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPLT1_0029_A02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
UTR01_0033_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0117_C08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVR01_0082_A11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0013_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BFLT1_0060_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0132_D01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0012_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVR01_0065_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0041_F03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0114_A01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0102_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0133_C12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0052_A06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0067_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0007_G07.b : AGCGAGATCCCCCCAACATCAAATGGGGCGATGCTGGTGCTACCTATGTTGTGGAGTCCA
SPL01_0078_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0131_D05.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0111_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0029_B12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0030_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0031_D07.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0014_D10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0046_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0001_B11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0054_A12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0046_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0109_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PBL01_0058_A11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0070_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0099_G07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0045_E11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PBL01_0054_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0101_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LNG01_0070_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0054_F10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0099_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0051_D06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0084_A01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0051_H04.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0094_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0048_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0035_H10.b : AGCGAGATCCCGCCAACACCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0084_E06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVR01_0067_D02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0013_F12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0087_H06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ITT01_0008_D07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0083_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ITT01_0006_B04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0074_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0088_G08.b : GGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0036_C01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0032_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0031_G05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BKFL1_0011_B07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0013_E07.b : AGCGGGATCCCGCCAGCATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BMWN1_0025_A12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0022_C04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
BKFL1_0011_B03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0037_A03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0093_D02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0058_H03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0029_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0025_B05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0033_C06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0013_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRT1_0107_A09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0073_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0043_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0089_A01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0090_B12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0082_D08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0036_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0001_C04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0091_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0057_G06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0044_C04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0072_H06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0171_F08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0060_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0054_E03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0048_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0029_G01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0043_B12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0038_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0002_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0047_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0095_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0005_F02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0025_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0037_B07.b : AGCGAGATCCCGCCCACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CBLT1_0018_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0066_E08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
CLNT1_0083_E10.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0084_B03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLN01_0094_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PBL01_0100_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0080_F08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0055_A08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0019_F02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0102_E10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SMG01_0018_F02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0036_B06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0074_C12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0064_B09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SKNB1_0070_C03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PST01_0043_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PST01_0088_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0110_H04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0105_G05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0117_A03.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0099_G11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0010_C09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0052_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0018_A02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0080_D02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0087_F11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0106_D09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0033_A10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTTGTGCTACGTATGTTGTGGAGTCCA
TES01_0079_F05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
HTMT1_0040_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0078_A07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PTG01_0009_C09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0032_D08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0045_D04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0051_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PBL01_0094_D06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0029_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0018_B02.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0040_B09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0019_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0008_B01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0057_E11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0041_H10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
LVRM1_0063_G06.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0122_H11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0047_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0086_E09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ITT01_0078_F01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0068_G08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0093_H12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0070_C09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0067_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0086_E04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0093_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0035_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0071_F06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0102_H05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0015_A12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0027_F09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0015_G04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PBL01_0013_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0022_G04.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0013_D03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
PTG01_0030_D11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0084_H01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0080_H01.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0044_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0071_G03.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0063_H12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0064_B08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0052_B06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0013_F10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0029_G09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVR01_0097_E07.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0049_G02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0095_E10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0025_H12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
THY01_0042_D08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0037_B11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ADR01_0022_C06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TCH01_0087_D12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
ILNT1_0086_G12.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0086_E06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0056_F06.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0091_H02.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0098_C11.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
SPL01_0099_E12.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0041_D08.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
TES01_0076_E05.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
DCI01_0031_C10.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
OVRM1_0214_F01.b : AGCGAGATCCCGCCAACATCAAATGGGGTGATGCTGGTGCTACGTATGTTGTGGAGTCCA
MLTL1_0040_H09.b : AGCGAGATCCCGCCAACATCAAATGGGGCGATGCTGGTGCTACGTATGTTGTGGAGTCCA
20110601C-000449 : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
---------+---------+---------+---------+---------+---------+ 431
HTMT1_0002_H03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0040_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVRM1_0034_A02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0039_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0043_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0103_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0008_C08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0008_D12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0122_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0105_A12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0034_F04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0029_D03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0030_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0047_C12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0010_F08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0061_A09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0019_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAAAG
TES01_0076_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0076_G02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0092_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0053_A04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0072_C12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0073_D12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0023_F12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0112_C06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0093_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0055_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0043_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0075_F11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0067_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0051_D07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0047_B12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0147_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0090_H05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0003_A09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0038_G04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0040_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0002_A05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0042_C01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
UTR01_0050_G04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0008_B10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0081_C10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
KDN01_0026_H03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PST01_0045_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0064_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CAAAGAG
BMWN1_0081_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0094_C06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0205_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0031_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0094_E01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0002_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0132_G07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0034_G08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0093_E08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0003_D05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0024_C01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0023_F12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0039_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0028_D12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0074_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0076_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0031_B10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0082_C03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0065_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0065_F06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0092_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0052_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0065_A01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0075_H04.b : CTGGTGTCTTCACGACCATGGAGAATGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAA
ILNT1_0051_B05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0099_A12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0063_F12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0114_G07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0113_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0056_F10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0130_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0032_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0114_G08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0128_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0011_B08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0054_A03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0017_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0016_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0097_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0072_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0036_C08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0069_G07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0084_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0002_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0121_H10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0025_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0089_B09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0016_E01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0105_F10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0038_H08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0068_H12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0096_E08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0040_A05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0131_B10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0049_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0124_A01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0030_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0023_H04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0080_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0023_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0044_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0064_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0034_C05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0064_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0087_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0062_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0007_B06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0148_B08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0097_E01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0086_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0036_B11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0045_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0149_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0143_A06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0152_E02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0013_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0055_C09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0004_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0051_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0077_E02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0065_D03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0131_F02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0037_D07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0084_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0135_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0136_D05.b : CTGGTGTCTTCACCACCATGGAGAATGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0041_B09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0042_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0007_B09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0082_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0116_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0083_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0045_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0019_B08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0080_E02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0048_A09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0094_F04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0050_D06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LNG01_0016_C06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0139_A11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0064_G07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0149_B12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0020_F06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0041_F11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0058_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0076_D08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0040_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0003_B05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0079_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0045_F01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0064_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0080_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0035_D12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0025_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0007_E08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0075_C01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0076_F06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0141_C07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0047_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0092_G02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0021_D06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0152_G10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0001_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0017_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0059_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0151_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0093_H08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0040_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0090_G05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0141_C01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0068_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0047_G04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0037_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0095_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0062_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BMWN1_0004_F11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0013_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0061_B06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0049_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0035_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0046_H08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0072_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ITT01_0055_D03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0001_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0079_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0039_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0070_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0046_F12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0063_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0096_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPLT1_0095_C10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0057_E08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0067_A11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0002_B07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CBLT1_0069_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0142_H07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTTGGG*GCAAGAA
ADR01_0061_C12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGGNCCNAGAG
OVRM1_0098_H08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0076_C04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0073_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0140_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVRM1_0093_C02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*TGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0076_E06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0099_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0192_H06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0118_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0190_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0055_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0062_G02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0021_G06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0210_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0021_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PTG01_0026_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0098_D07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0103_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
UTR01_0010_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
UTR01_0014_A05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0024_F11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0049_B04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0021_F04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0098_D01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0058_H08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0002_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0090_E07.b : TTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0049_D01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0008_C09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0019_G07.b : CTGGTGTCTCCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0044_B10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0132_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
UTR01_0094_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0111_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAAAG
SPLT1_0029_A02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
UTR01_0033_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0117_C08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVR01_0082_A11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAGGGGTGGGG*CCAAGAG
OVRT1_0013_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BFLT1_0060_B08.b : CTGGTGCCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0132_D01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0012_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVR01_0065_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0041_F03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0114_A01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0102_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0133_C12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0052_A06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0067_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0007_G07.b : CTGGTGTCTTCCCGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0078_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0131_D05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0111_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0029_B12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0030_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0031_D07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0014_D10.b : CTGGTGTCTTCACGACTATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0046_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0001_B11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0054_A12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0046_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0109_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PBL01_0058_A11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0070_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0099_G07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0045_E11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PBL01_0054_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0101_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LNG01_0070_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0054_F10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0099_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0051_D06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0084_A01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0051_H04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0094_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0048_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0035_H10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0084_E06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVR01_0067_D02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0013_F12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0087_H06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ITT01_0008_D07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0083_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ITT01_0006_B04.b : CTGGTGTCTTCACGACCATGAAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0074_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0088_G08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0036_C01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0032_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0031_G05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BKFL1_0011_B07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0013_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*TCAAGAG
BMWN1_0025_A12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0022_C04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
BKFL1_0011_B03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0037_A03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0093_D02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0058_H03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0029_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0025_B05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0033_C06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0013_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRT1_0107_A09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0073_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0043_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0089_A01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0090_B12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0082_D08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0036_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAC
DCI01_0001_C04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0091_D03.b : CTGGTGTCTCCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0057_G06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0044_C04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0072_H06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0171_F08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0060_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0054_E03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0048_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0029_G01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0043_B12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0038_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0002_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0047_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0095_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0005_F02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0025_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0037_B07.b : CTGGTGTCTTCACGACCATGGAGAAAGCCGGGGGCTCACTTGAANGGGTGGGGCCCAGAG
CBLT1_0018_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0066_E08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
CLNT1_0083_E10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0084_B03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLN01_0094_D03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PBL01_0100_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0080_F08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0055_A08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0019_F02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0102_E10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SMG01_0018_F02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0036_B06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0074_C12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0064_B09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SKNB1_0070_C03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PST01_0043_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PST01_0088_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0110_H04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0105_G05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0117_A03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0099_G11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0010_C09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0052_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0018_A02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0080_D02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0087_F11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0106_D09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0033_A10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0079_F05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
HTMT1_0040_B08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0078_A07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PTG01_0009_C09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0032_D08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0045_D04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0051_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PBL01_0094_D06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0029_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0018_B02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0040_B09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0019_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0008_B01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0057_E11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0041_H10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
LVRM1_0063_G06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0122_H11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0047_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0086_E09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ITT01_0078_F01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0068_G08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0093_H12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0070_C09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0067_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0086_E04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0093_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0035_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0071_F06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0102_H05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0015_A12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0027_F09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0015_G04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PBL01_0013_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0022_G04.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0013_D03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
PTG01_0030_D11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0084_H01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0080_H01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0044_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0071_G03.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0063_H12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0064_B08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0052_B06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0013_F10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0029_G09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVR01_0097_E07.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0049_G02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0095_E10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0025_H12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
THY01_0042_D08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0037_B11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ADR01_0022_C06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TCH01_0087_D12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
ILNT1_0086_G12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0086_E06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0056_F06.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0091_H02.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0098_C11.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
SPL01_0099_E12.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0041_D08.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
TES01_0076_E05.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
DCI01_0031_C10.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
OVRM1_0214_F01.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
MLTL1_0040_H09.b : CTGGTGTCTTCACGACCATGGAGAAGGCC*GGGGCTCACTTGAAGGGTGGGG*CCAAGAG
20110601C-000449 : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
---------+---------+---------+---------+---------+---------+ 490
HTMT1_0002_H03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0040_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVRM1_0034_A02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0039_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0043_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0103_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0008_C08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0008_D12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0122_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTTAACCATG
TES01_0105_A12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0034_F04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGCTTGTGATGGGCGTGAACCATG
TES01_0029_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0030_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0047_C12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0010_F08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0061_A09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0019_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0076_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0076_G02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0092_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0053_A04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0072_C12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0073_D12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0023_F12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0112_C06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0093_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0055_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0043_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0075_F11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0067_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0051_D07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0047_B12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0147_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0090_H05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0003_A09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0038_G04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0040_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0002_A05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0042_C01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
UTR01_0050_G04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0008_B10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0081_C10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
KDN01_0026_H03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PST01_0045_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0064_D04.b : GGTCATCATCTCTGCCCCCTTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0081_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0094_C06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0205_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCTCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0031_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0094_E01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0002_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0132_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0034_G08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0093_E08.b : GGCCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0003_D05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0024_C01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0023_F12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0039_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0028_D12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0074_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0076_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0031_B10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0082_C03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0065_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0065_F06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0092_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0052_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0065_A01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0075_H04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0051_B05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0099_A12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0063_F12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0114_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0113_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0056_F10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0130_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0032_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0114_G08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0128_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0011_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0054_A03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0017_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0016_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0097_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0072_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0036_C08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0069_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0084_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0002_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0121_H10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0025_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0089_B09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0016_E01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0105_F10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0038_H08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0068_H12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0096_E08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0040_A05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0131_B10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0049_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0124_A01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0030_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0023_H04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0080_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0023_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0044_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0064_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0034_C05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0064_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0087_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0062_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0007_B06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0148_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0097_E01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0086_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0036_B11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0045_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0149_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0143_A06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0152_E02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0013_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0055_C09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0004_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0051_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0077_E02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0065_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0131_F02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0037_D07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0084_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0135_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0136_D05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0041_B09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0042_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0007_B09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0082_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0116_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0083_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0045_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0019_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0080_E02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0048_A09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0094_F04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0050_D06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LNG01_0016_C06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0139_A11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0064_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0149_B12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0020_F06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0041_F11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0058_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0076_D08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0040_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0003_B05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0079_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0045_F01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0064_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0080_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0035_D12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0025_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0007_E08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0075_C01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0076_F06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0141_C07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0047_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0092_G02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0021_D06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0152_G10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0001_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0017_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0059_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0151_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0093_H08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0040_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0090_G05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0141_C01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0068_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0047_G04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0037_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0095_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0062_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0004_F11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0013_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0061_B06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0049_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0035_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0046_H08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0072_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ITT01_0055_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0001_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0079_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0039_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0070_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0046_F12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0063_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0096_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0095_C10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0057_E08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0067_A11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0002_B07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CBLT1_0069_H07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0142_H07.b : GGTCATCATCTCTGCCCC*TTCTGCgatgccccctgtttgtgatggcgtgaacctgagaa
ADR01_0061_C12.b : GNTCATCATCTCTGCCCC*TTCTTGCGATGCCCCCATGTTTGTGATGGGCGTTGACCATG
OVRM1_0098_H08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0076_C04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0073_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0140_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVRM1_0093_C02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0076_E06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0099_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0192_H06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTAAACCATG
OVRM1_0118_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0190_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0055_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0062_G02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0021_G06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0210_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0021_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PTG01_0026_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0098_D07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0103_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
UTR01_0010_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
UTR01_0014_A05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0024_F11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0049_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0021_F04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0098_D01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0058_H08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0002_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0090_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0049_D01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0008_C09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0019_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0044_B10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0132_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
UTR01_0094_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0111_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPLT1_0029_A02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
UTR01_0033_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0117_C08.b : GGTTATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVR01_0082_A11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0013_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGAGCGTGAACCATG
BFLT1_0060_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0132_D01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0012_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVR01_0065_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGGACCATG
CLNT1_0041_F03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0114_A01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0102_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0133_C12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0052_A06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0067_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0007_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0078_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTATGATGGGCGTGAACCATG
OVRT1_0131_D05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0111_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0029_B12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0030_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0031_D07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0014_D10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATAGGCGTGAACCATG
OVRT1_0046_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0001_B11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0054_A12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0046_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0109_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PBL01_0058_A11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0070_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0099_G07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0045_E11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PBL01_0054_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0101_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LNG01_0070_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0054_F10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0099_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0051_D06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0084_A01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0051_H04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0094_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0048_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0035_H10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0084_E06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVR01_0067_D02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0013_F12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0087_H06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ITT01_0008_D07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0083_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ITT01_0006_B04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0074_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0088_G08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0036_C01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCCATGTTGTGATGGGCGTGAACCATG
MLTL1_0032_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0031_G05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTCGTGATGGGCGTGAACCATG
BKFL1_0011_B07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0013_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BMWN1_0025_A12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0022_C04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
BKFL1_0011_B03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0037_A03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0093_D02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0058_H03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0029_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0025_B05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0033_C06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0013_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRT1_0107_A09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0073_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCGTGTTTGTGATGGGCGTGAACCATG
DCI01_0043_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0089_A01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0090_B12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0082_D08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0036_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0001_C04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0091_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0057_G06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0044_C04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0072_H06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0171_F08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0060_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0054_E03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0048_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0029_G01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0043_B12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0038_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0002_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0047_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0095_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0005_F02.b : GGTCGTCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0025_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0037_B07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGGACCATG
CBLT1_0018_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0066_E08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
CLNT1_0083_E10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0084_B03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLN01_0094_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PBL01_0100_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0080_F08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0055_A08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0019_F02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0102_E10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SMG01_0018_F02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0036_B06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0074_C12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0064_B09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SKNB1_0070_C03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PST01_0043_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PST01_0088_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0110_H04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0105_G05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0117_A03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0099_G11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0010_C09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0052_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCACGTTTGTGATGGGCGTGAACCATG
MLTL1_0018_A02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0080_D02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0087_F11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0106_D09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0033_A10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0079_F05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
HTMT1_0040_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0078_A07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PTG01_0009_C09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0032_D08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0045_D04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0051_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PBL01_0094_D06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0029_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0018_B02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0040_B09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0019_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0008_B01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0057_E11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0041_H10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
LVRM1_0063_G06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0122_H11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0047_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0086_E09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ITT01_0078_F01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0068_G08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0093_H12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0070_C09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0067_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0086_E04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0093_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0035_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0071_F06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0102_H05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0015_A12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0027_F09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0015_G04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PBL01_0013_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0022_G04.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0013_D03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
PTG01_0030_D11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0084_H01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCCTG
OVR01_0080_H01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0044_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0071_G03.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0063_H12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0064_B08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVR01_0052_B06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0013_F10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0029_G09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCC*ATGTTTGTGATGGGCGTGAACCATG
OVR01_0097_E07.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0049_G02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0095_E10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGCGAACCATG
TCH01_0025_H12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
THY01_0042_D08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0037_B11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ADR01_0022_C06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TCH01_0087_D12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
ILNT1_0086_G12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0086_E06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0056_F06.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0091_H02.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0098_C11.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
SPL01_0099_E12.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0041_D08.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
TES01_0076_E05.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
DCI01_0031_C10.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
OVRM1_0214_F01.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
MLTL1_0040_H09.b : GGTCATCATCTCTGCCCC*TTCTGCCGATGCCCCCATGTTTGTGATGGGCGTGAACCATG
20110601C-000449 : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
---------+---------+---------+---------+---------+---------+ 549
HTMT1_0002_H03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0040_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LVRM1_0034_A02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0039_G03.b : AGAAGTATGACAACTCCCTNCAGATCGTCAGCAATGCCTCCCTGCACACCAACTG*CTTG
ADR01_0043_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0103_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0008_C08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0008_D12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0122_H07.b : AAAAGTATGACAAATCCCTCAAaatctcagcaatgcccctgcaccaccaatggttggccc
TES01_0105_A12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0034_F04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0029_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0030_D11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0047_C12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0010_F08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0061_A09.b : AGAAGTNATGACACTCCCTNCAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0019_D11.b : ACAAGTATGACTACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCTACTG*CTTG
TES01_0076_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0076_G02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0092_G11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0053_A04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0072_C12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0073_D12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0023_F12.b : AAAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0112_C06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0093_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0055_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0043_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0075_F11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0067_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0051_D07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0047_B12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0147_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0090_H05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0003_A09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0038_G04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0040_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0002_A05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0042_C01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
UTR01_0050_G04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0008_B10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0081_C10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
KDN01_0026_H03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PST01_0045_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0064_D04.b : AGAAGTATGACACCTCCCTCAAGATCTTCAGCAAGGCTTCTTGCACAACAACTGC*CTTG
BMWN1_0081_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0094_C06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0205_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0031_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0094_E01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0002_D09.b : ATAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0132_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0034_G08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0093_E08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0003_D05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0024_C01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0023_F12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0039_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0028_D12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0074_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0076_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0031_B10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0082_C03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0065_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0065_F06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0092_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0052_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0065_A01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0075_H04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0051_B05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0099_A12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0063_F12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0114_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0113_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0056_F10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0130_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0032_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0114_G08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0128_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0011_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0054_A03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0017_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0016_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0097_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0072_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0036_C08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0069_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0084_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0002_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0121_H10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0025_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0089_B09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0016_E01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0105_F10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0038_H08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0068_H12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0096_E08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0040_A05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0131_B10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0049_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0124_A01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0030_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0023_H04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0080_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0023_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0044_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0064_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0034_C05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0064_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0087_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0062_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0007_B06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0148_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0097_E01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0086_G11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0036_B11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0045_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0149_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0143_A06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0152_E02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0013_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0055_C09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0004_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0051_G11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0077_E02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0065_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0131_F02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0037_D07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0084_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0135_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0136_D05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0041_B09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0042_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0007_B09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0082_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0116_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0083_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0045_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0019_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0080_E02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0048_A09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0094_F04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0050_D06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LNG01_0016_C06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0139_A11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0064_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0149_B12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0020_F06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0041_F11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0058_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0076_D08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0040_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0003_B05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0079_G03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0045_F01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0064_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0080_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0035_D12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0025_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0007_E08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0075_C01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0076_F06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0141_C07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0047_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0092_G02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0021_D06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0152_G10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0001_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0017_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0059_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0151_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0093_H08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0040_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCCGCACCACCAACTG*CTTG
SPLT1_0090_G05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0141_C01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0068_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0047_G04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0037_G03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0095_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0062_B01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0004_F11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0013_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0061_B06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0049_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0035_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0046_H08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0072_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ITT01_0055_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0001_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0079_B01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0039_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0070_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0046_F12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0063_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0096_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0095_C10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0057_E08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0067_A11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0002_B07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CBLT1_0069_H07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0142_H07.b : ttatgacactcctcaagaattctcacaatgctcctgcacaccaagggttgggcccctggc
ADR01_0061_C12.b : AAAAGTTTGACAACTCCCTCCAGATCGTCAGCAATGCTTCCTGCcacaaccaatgctttg
OVRM1_0098_H08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0076_C04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0073_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0140_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LVRM1_0093_C02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0076_E06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTAG
OVR01_0099_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0192_H06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0118_B04.b : AGAAGTATGACAACTCCCTCGAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0190_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0055_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0062_G02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0021_G06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0210_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0021_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PTG01_0026_F05.b : AGAAGTATGACAACTCCCTNCAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0098_D07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0103_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
UTR01_0010_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
UTR01_0014_A05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0024_F11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0049_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0021_F04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0098_D01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0058_H08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0002_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0090_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0049_D01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0008_C09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0019_G07.b : AGGAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0044_B10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0132_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
UTR01_0094_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0111_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPLT1_0029_A02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
UTR01_0033_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0117_C08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LVR01_0082_A11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0013_G11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BFLT1_0060_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0132_D01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0012_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTA*CTTG
LVR01_0065_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0041_F03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0114_A01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0102_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0133_C12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0052_A06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0067_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0007_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0078_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0131_D05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0111_G11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0029_B12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0030_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0031_D07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0014_D10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0046_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0001_B11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0054_A12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0046_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0109_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PBL01_0058_A11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0070_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0099_G07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0045_E11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PBL01_0054_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0101_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LNG01_0070_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0054_F10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0099_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0051_D06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0084_A01.b : AGAAGTATGACAACTCCCTCAGGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0051_H04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0094_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0048_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0035_H10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0084_E06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LVR01_0067_D02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0013_F12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0087_H06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ITT01_0008_D07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0083_A10.b : AGAAGTATGACAACTCCCTCAAGAACGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ITT01_0006_B04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0074_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0088_G08.b : AGAAGTATGANCACTCCCTCAAGATCGTCAGCAATGCCCTCTGGCACACCCACTG*CTTG
DCI01_0036_C01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCAC*AACTG*CTTG
MLTL1_0032_B01.b : AGAAGTATGACAACTCCCTNCAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0031_G05.b : AGAAGTATGACAACTCCCTNCAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BKFL1_0011_B07.b : AGAAGTATGGCAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0013_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BMWN1_0025_A12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0022_C04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
BKFL1_0011_B03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0037_A03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0093_D02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0058_H03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0029_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0025_B05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0033_C06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0013_G03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRT1_0107_A09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0073_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0043_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0089_A01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0090_B12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0082_D08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0036_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0001_C04.b : AGAAGTATGACCACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0091_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0057_G06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0044_C04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0072_H06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCCATGCCTCCTGCACCACCAACTGGCTTG
OVRM1_0171_F08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0060_D11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0054_E03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0048_D11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0029_G01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0043_B12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0038_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0002_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0047_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0095_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0005_F02.b : AGAAGTATGACAGCTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0025_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0037_B07.b : GAGAATATGACAGCTCCCTCCAGATCGTCCACAATGCCTCCCGCACCACCAACTG*CTTG
CBLT1_0018_B01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0066_E08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
CLNT1_0083_E10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0084_B03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLN01_0094_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PBL01_0100_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCGATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0080_F08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0055_A08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0019_F02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0102_E10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SMG01_0018_F02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0036_B06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0074_C12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0064_B09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SKNB1_0070_C03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PST01_0043_B01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PST01_0088_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0110_H04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0105_G05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0117_A03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0099_G11.b : AGAAGTATGGCAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0010_C09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0052_D11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0018_A02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0080_D02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0087_F11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0106_D09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0033_A10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0079_F05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
HTMT1_0040_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0078_A07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PTG01_0009_C09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0032_D08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0045_D04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0051_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PBL01_0094_D06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0029_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0018_B02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0040_B09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0019_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0008_B01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0057_E11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0041_H10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
LVRM1_0063_G06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0122_H11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0047_G03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0086_E09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ITT01_0078_F01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0068_G08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0093_H12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0070_C09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0067_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0086_E04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0093_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0035_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0071_F06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0102_H05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0015_A12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0027_F09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0015_G04.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
PBL01_0013_D11.b : AGAAGTATGACAACTCCCTCAGGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0022_G04.b : AGGAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0013_D03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCCGCACCACCAACTG*CTTG
PTG01_0030_D11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0084_H01.b : AGAAGTATGACAACTCCCTCAAGATTGTCAGCAATGCCTCCTGCACCACCAAATG*CTTG
OVR01_0080_H01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0044_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0071_G03.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0063_H12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0064_B08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0052_B06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0013_F10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0029_G09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVR01_0097_E07.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0049_G02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0095_E10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0025_H12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
THY01_0042_D08.b : AGAAGTATGACAACTCCCTCAAGATCGTCTCCAATGCCTCCTGCACCACCTACTG*CTTG
SPL01_0037_B11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ADR01_0022_C06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TCH01_0087_D12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
ILNT1_0086_G12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0086_E06.b : AGAAGTATGACAACTCCCCCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0056_F06.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0091_H02.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0098_C11.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
SPL01_0099_E12.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0041_D08.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
TES01_0076_E05.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
DCI01_0031_C10.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
OVRM1_0214_F01.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
MLTL1_0040_H09.b : AGAAGTATGACAACTCCCTCAAGATCGTCAGCAATGCCTCCTGCACCACCAACTG*CTTG
20110601C-000449 : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
---------+---------+---------+---------+---------+---------+ 607
HTMT1_0002_H03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0040_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LVRM1_0034_A02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0039_G03.b : G*CACCCCTGGGCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAA*CA
ADR01_0043_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0103_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0008_C08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0008_D12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0122_H07.b : cctggccaagggtttcataacccntttgggtttgggaggattattaaccgggccttcccc
TES01_0105_A12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0034_F04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0029_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0030_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0047_C12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0010_F08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0061_A09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0019_D11.b : G*CACCCCTGGCCAAGGTCATCCTTGACCACTTCGGCATCTTGGAGGGACTCATGAC*CA
TES01_0076_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0076_G02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0092_G11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0053_A04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0072_C12.b : G*CACCCCTGGCCAAGGTCATCCATGGCCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0073_D12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0023_F12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATGAC*CA
TES01_0112_C06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0093_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0055_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0043_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0075_F11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0067_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0051_D07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0047_B12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0147_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0090_H05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0003_A09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0038_G04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0040_E03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0002_A05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0042_C01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
UTR01_0050_G04.b : G*CATCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0008_B10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0081_C10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
KDN01_0026_H03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PST01_0045_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0064_D04.b : C*AACCCCTGGCAAAGTTCATCCATGAacaatttcggcatctggaaggagacctgaacca
BMWN1_0081_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0094_C06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0205_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0031_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0094_E01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0002_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCCGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0132_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATNGA*CA
SPLT1_0034_G08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0093_E08.b : G*CGCCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0003_D05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0024_C01.b : G*CACTCCTGGCCAAGGTCATCCATGACCACTTCCGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0023_F12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0039_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0028_D12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0074_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0076_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0031_B10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0082_C03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0065_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0065_F06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0092_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0052_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0065_A01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0075_H04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0051_B05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0099_A12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0063_F12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0114_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0113_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0056_F10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0130_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0032_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0114_G08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0128_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0011_B08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0054_A03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0017_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0016_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0097_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0072_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0036_C08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0069_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0084_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0002_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0121_H10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0025_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0089_B09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0016_E01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0105_F10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0038_H08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0068_H12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0096_E08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0040_A05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0131_B10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0049_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0124_A01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0030_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0023_H04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0080_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0023_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0044_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0064_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0034_C05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0064_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0087_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0062_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0007_B06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0148_B08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0097_E01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0086_G11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0036_B11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0045_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0149_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0143_A06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0152_E02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0013_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0055_C09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0004_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0051_G11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0077_E02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0065_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0131_F02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0037_D07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0084_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0135_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0136_D05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0041_B09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0042_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0007_B09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0082_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0116_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0083_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0045_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0019_B08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0080_E02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0048_A09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0094_F04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0050_D06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LNG01_0016_C06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0139_A11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0064_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0149_B12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0020_F06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0041_F11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0058_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0076_D08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0040_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0003_B05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0079_G03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0045_F01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0064_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0080_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0035_D12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0025_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0007_E08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0075_C01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0076_F06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0141_C07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0047_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0092_G02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0021_D06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0152_G10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0001_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0017_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0059_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0151_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0093_H08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0040_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0090_G05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0141_C01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0068_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0047_G04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0037_G03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0095_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0062_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0004_F11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0013_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0061_B06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0049_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0035_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0046_H08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0072_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ITT01_0055_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0001_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0079_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0039_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0070_E03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0046_F12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0063_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0096_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0095_C10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0057_E08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0067_A11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0002_B07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CBLT1_0069_H07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0142_H07.b : caaggtcaccatgaacctttcgcacccggagggactatggacccggtcttgccctccggc
ADR01_0061_C12.b : gacccctgggccaaggtcatcaggaaccatttcggaatctggaaggaaccttggacccgg
OVRM1_0098_H08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0076_C04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0073_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0140_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCCGCATCGTGGAGGGACTCATGAC*NA
LVRM1_0093_C02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0076_E06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0099_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0192_H06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0118_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGGAGGACTCATGAC*CA
OVRM1_0190_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0055_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0062_G02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0021_G06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0210_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0021_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTTATGAC*CA
PTG01_0026_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0098_D07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGGC*CA
OVRM1_0103_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
UTR01_0010_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
UTR01_0014_A05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0024_F11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0049_B04.b : G*CACCCCTGGCCTAGGTCATCCATGACCACTTCGGCCTCGTGGAGGGACTCATGAC*CA
SPL01_0021_F04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0098_D01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0058_H08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0002_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0090_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0049_D01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0008_C09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0019_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGACCCA
SPL01_0044_B10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0132_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
UTR01_0094_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0111_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPLT1_0029_A02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
UTR01_0033_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0117_C08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LVR01_0082_A11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0013_G11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BFLT1_0060_B08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0132_D01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0012_E03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LVR01_0065_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0041_F03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0114_A01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0102_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0133_C12.b : G*CACCCCTGGCCAAGGTCATCCGTGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0052_A06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0067_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0007_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0078_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0131_D05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0111_G11.b : G*CACCCCTGGCCAAGGTCGTCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0029_B12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0030_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0031_D07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0014_D10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0046_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0001_B11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0054_A12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0046_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0109_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PBL01_0058_A11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0070_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0099_G07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0045_E11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PBL01_0054_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0101_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LNG01_0070_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0054_F10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0099_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0051_D06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0084_A01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0051_H04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0094_E03.b : G*CACCCCTGGCCAAGGTCATCCATGGCCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0048_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0035_H10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0084_E06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCACGAC*CA
LVR01_0067_D02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0013_F12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0087_H06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ITT01_0008_D07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0083_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ITT01_0006_B04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0074_E03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0088_G08.b : GGCACCCCTGCCCAAGGTCATCCATGACCACTTCGGCATCGGGGAAGGACTCATGGA*CA
DCI01_0036_C01.b : G*CACCCCTGGCCAAG*TCATCCATGAACACTTTCGCATCGGGAAGGAACTCTGGAC*AA
MLTL1_0032_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0031_G05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATGAC*CA
BKFL1_0011_B07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0013_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BMWN1_0025_A12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0022_C04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
BKFL1_0011_B03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0037_A03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTACGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0093_D02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CT
MLTL1_0058_H03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0029_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0025_B05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0033_C06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0013_G03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRT1_0107_A09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0073_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0043_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0089_A01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0090_B12.b : G*CACCCCTGGCCCAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0082_D08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0036_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0001_C04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0091_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0057_G06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0044_C04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATGAC*CA
TES01_0072_H06.b : G*CACCCTTGCCCAAAGTCATCCATGACCACTTtcggcatcttgggagggactcatgaac
OVRM1_0171_F08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATGAC*CA
OVRM1_0060_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0054_E03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0048_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0029_G01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0043_B12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0038_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0002_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0047_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0095_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0005_F02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0025_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0037_B07.b : G*CACCCCTGGGCAAAGTCATCCATGACCcctccgctccgggaaggactcctgaaccggg
CBLT1_0018_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0066_E08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
CLNT1_0083_E10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0084_B03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLN01_0094_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PBL01_0100_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0080_F08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0055_A08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0019_F02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0102_E10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SMG01_0018_F02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0036_B06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0074_C12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0064_B09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SKNB1_0070_C03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PST01_0043_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PST01_0088_H11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0110_H04.b : G*CACCCCTGGTCAAGGTCATCCATGACCACTTCGGCATCCTGGAAGGACTCATGAC*CA
TES01_0105_G05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAAGGACTCATGAC*CA
OVRM1_0117_A03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0099_G11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0010_C09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0052_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0018_A02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0080_D02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0087_F11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0106_D09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0033_A10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0079_F05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
HTMT1_0040_B08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0078_A07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PTG01_0009_C09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0032_D08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCACGAC*CA
MLTL1_0045_D04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0051_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PBL01_0094_D06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0029_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0018_B02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0040_B09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0019_H02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0008_B01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0057_E11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0041_H10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
LVRM1_0063_G06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0122_H11.b : G*CACCCCTGGCCAAGGTCATCCATGAACACTTCGGCATCGTGGAGGGACTCATGAA*CA
THY01_0047_G03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0086_E09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ITT01_0078_F01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0068_G08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGAACTCATGAC*CA
ADR01_0093_H12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0070_C09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0067_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0086_E04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0093_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0035_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0071_F06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0102_H05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0015_A12.b : G*CACCCCTGGCCAAGGTCATTCATGACCACTTCcgccatcttggaggggactcatgacc
TCH01_0027_F09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0015_G04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PBL01_0013_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0022_G04.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0013_D03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
PTG01_0030_D11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGACATCGTGGAGGGACTCATGAC*CA
OVR01_0084_H01.b : G*CACCCCTGGCCAAGGTCATCCATGAACACTTTCGCATCGTGGAAGGACTCATGAC*CA
OVR01_0080_H01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0044_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0071_G03.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0063_H12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0064_B08.b : G*CACCCCTGGCCAAAGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0052_B06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0013_F10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0029_G09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVR01_0097_E07.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0049_G02.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0095_E10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0025_H12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
THY01_0042_D08.b : GCACCCCCTGGCCCAGGTCATCCCTGACCACCTCATCATCGTGGAGCGACTCtatgcaaa
SPL01_0037_B11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ADR01_0022_C06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TCH01_0087_D12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
ILNT1_0086_G12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0086_E06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0056_F06.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0091_H02.b : G*CACCCCTGGCCAAGGACATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0098_C11.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
SPL01_0099_E12.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0041_D08.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
TES01_0076_E05.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
DCI01_0031_C10.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
OVRM1_0214_F01.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
MLTL1_0040_H09.b : G*CACCCCTGGCCAAGGTCATCCATGACCACTTCGGCATCGTGGAGGGACTCATGAC*CA
20110601C-000449 : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
---------+---------+---------+---------+---------+---------+ 662
HTMT1_0002_H03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0040_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LVRM1_0034_A02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0039_G03.b : CGGTCCATGCCAT*CACTGGC*ACCCAGAAAAC*TGTGGATGG*CCCGTCTGGG*AANCT
ADR01_0043_C02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
OVRT1_0103_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0008_C08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0008_D12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0122_H07.b : tcttccccca
TES01_0105_A12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0034_F04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0029_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0030_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0047_C12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0010_F08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0061_A09.b : CNGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0019_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAATAC*TGTGGATGG*CCCGCCTGGG*CAACT
TES01_0076_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCCAAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
TES01_0076_G02.b : CNGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGAATGG*CCCGTCTGGG*AAACT
TES01_0092_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0053_A04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0072_C12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0073_D12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGACTTGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0023_F12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAAAC*TGTGGATGG*CCCCTCTGGG*AACCT
TES01_0112_C06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0093_C02.b : CGGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
TES01_0055_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0043_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0075_F11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0067_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0051_D07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0047_B12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0147_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0090_H05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0003_A09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SKNB1_0038_G04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0040_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0002_A05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0042_C01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
UTR01_0050_G04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0008_B10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0081_C10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
KDN01_0026_H03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PST01_0045_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0064_D04.b : cggtcaatgcaatccttgcccccaaaaaatggtgaaaggccccttcggaaacctttggcg
BMWN1_0081_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0094_C06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0205_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0031_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0094_E01.b : CGGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGGATGG*CCCGTCTGGG*GAACT
HTMT1_0002_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAAAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0132_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAAAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0034_G08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0093_E08.b : CGGTCCATGCCATTCACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAACT
SKNB1_0003_D05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0024_C01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGT*AAGCT
CBLT1_0023_F12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0039_A08.b : CGGTCCATGCCAT*CACTGCT*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
CBLT1_0028_D12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0074_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
ILNT1_0076_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0031_B10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0082_C03.b : CGGTCCATGCCAT*CACTGCC*ACCCATAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0065_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0065_F06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0092_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0052_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAAAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0065_A01.b : CGGGTCATGCCAT*CACTGCC*ACCCAAAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0075_H04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0051_B05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0099_A12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0063_F12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0114_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0113_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0056_F10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0130_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0032_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0114_G08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0128_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0011_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0054_A03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0017_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0016_C02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0097_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0072_C02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0036_C08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0069_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0084_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0002_C02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0121_H10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0025_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0089_B09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0016_E01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0105_F10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0038_H08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0068_H12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0096_E08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0040_A05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0131_B10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0049_F05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0124_A01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0030_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0023_H04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0080_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0023_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0044_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0064_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0034_C05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
HTMT1_0064_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0087_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0062_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0007_B06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0148_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0097_E01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0086_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0036_B11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0045_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0149_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0143_A06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0152_E02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0013_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0055_C09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0004_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0051_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0077_E02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0065_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0131_F02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0037_D07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0084_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
HTMT1_0135_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0136_D05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0041_B09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0042_A08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0007_B09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0082_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0116_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0083_F05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0045_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0019_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0080_E02.b : CGGTCCATGCCAT*CACTGCC*ACCCAAAAAAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0048_A09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0094_F04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0050_D06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LNG01_0016_C06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0139_A11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0064_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0149_B12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0020_F06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0041_F11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0058_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0076_D08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0040_F05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0003_B05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0079_G03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0045_F01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0064_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0080_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0035_D12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SKNB1_0025_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0007_E08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0075_C01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0076_F06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0141_C07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0047_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0092_G02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0021_D06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0152_G10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0001_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0017_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0059_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0151_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0093_H08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0040_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0090_G05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0141_C01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0068_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0047_G04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0037_G03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0095_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0062_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BMWN1_0004_F11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0013_A08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0061_B06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0049_F05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0035_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0046_H08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0072_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ITT01_0055_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0001_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0079_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0039_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0070_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0046_F12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0063_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0096_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0095_C10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0057_E08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0067_A11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0002_B07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CBLT1_0069_H07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0142_H07.b : ccccaaaaaattggaaggcccccctggaaaactttggctgtagcccaagggccccccaaa
ADR01_0061_C12.b : tccatgccttccttgcccccaaaaaattttgaaggccccctcggaaccctttggggtaat
OVRM1_0098_H08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*CAGCT
OVR01_0076_C04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0073_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0140_B02.b : CNGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAACT
LVRM1_0093_C02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0076_E06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0099_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCCGAAAAC*TGTGGATGG*CCCGTCCTGGGAAGCT
OVRM1_0192_H06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAACT
OVRM1_0118_B04.b : CGGTCCATGCCAT*CTTTGCC*ACCCCGAATAC*TGTGGATGG*CCCGTCTGTG*AAGCT
OVRM1_0190_A08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0055_A08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0062_G02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAAAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0021_G06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
OVRM1_0210_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0021_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAAAAGAC*TGTGGATGG*CCCGTCTGTG*AAGCT
PTG01_0026_F05.b : CNGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AANCT
OVRM1_0098_D07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0103_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGTG*AAGCT
UTR01_0010_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
UTR01_0014_A05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0024_F11.b : CNGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAACT
OVRM1_0049_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGTG*AAGCT
SPL01_0021_F04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0098_D01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*TAGCT
SPL01_0058_H08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0002_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0090_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0049_D01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0008_C09.b : CGGTCCATGCCAT*CACTGCC*ACCCATAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0019_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGGGAAGCT
SPL01_0044_B10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0132_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
UTR01_0094_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0111_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPLT1_0029_A02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
UTR01_0033_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0117_C08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LVR01_0082_A11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0013_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BFLT1_0060_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0132_D01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0012_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LVR01_0065_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0041_F03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0114_A01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0102_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0133_C12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0052_A06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*CGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0067_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0007_G07.b : CGGTCCATGCCAT*CACTGCC*CCCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0078_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0131_D05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
OVRT1_0111_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0029_B12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0030_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0031_D07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0014_D10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0046_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0001_B11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0054_A12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0046_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0109_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PBL01_0058_A11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0070_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0099_G07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0045_E11.b : CGGTCCATGCCAT*CACTGCC*GCCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PBL01_0054_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0101_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LNG01_0070_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0054_F10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0099_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0051_D06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLN01_0084_A01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0051_H04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0094_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCA
MLN01_0048_F05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLN01_0035_H10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0084_E06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LVR01_0067_D02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0013_F12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0087_H06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ITT01_0008_D07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0083_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ITT01_0006_B04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0074_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0088_G08.b : CGGTTCATGCCAT*CACTGCC*CACCcnaaaaactgtggatgccccgttcgggaaaactg
DCI01_0036_C01.b : CGG*CCATGCCAT*CACTGCC*ACCCCGAAAAC*TGTGAATGG*CCCCTCTGGA*AActg
MLTL1_0032_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCCAAAAAC*TGTGGATGG*CCCGTCTGGG*AANCT
MLTL1_0031_G05.b : CGGTTCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*GCCGTCTGGG*GAACT
BKFL1_0011_B07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0013_E07.b : CGGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGGATGC*CCCGTCTGGG*AAGCT
BMWN1_0025_A12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0022_C04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
BKFL1_0011_B03.b : CGGTCCATGCCAT*CACTGCC*ACCCAG*AGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0037_A03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0093_D02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
MLTL1_0058_H03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
MLTL1_0029_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0025_B05.b : CGGTCCATGCCAT*CACTGCC*CACCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0033_C06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLN01_0013_G03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRT1_0107_A09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0073_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0043_E12.b : CGGTCCATGCCAT*CACTGCCCACCCAGAAGAC*TGTGGATGGCCCCGTCTGGG*AAACT
MLTL1_0089_A01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0090_B12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0082_D08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0036_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0001_C04.b : CGGTCCATGCCAT*CACTGCC*ACCCANAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0091_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0057_G06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0044_C04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCA
TES01_0072_H06.b : cacggtccaggccatcactgccacccaaaaaaattgtggaagggcccgtctgggaaacct
OVRM1_0171_F08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0060_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0054_E03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0048_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0029_G01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGN*AAGCT
ILNT1_0043_B12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0038_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0002_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SKNB1_0047_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0095_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0005_F02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0025_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0037_B07.b : tcatggcacattggcaccaaaaaaatgtgaatggccctcctgggaactcttgccttatag
CBLT1_0018_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0066_E08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
CLNT1_0083_E10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLN01_0084_B03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLN01_0094_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PBL01_0100_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0080_F08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0055_A08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0019_F02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0102_E10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SMG01_0018_F02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SKNB1_0036_B06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0074_C12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0064_B09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SKNB1_0070_C03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PST01_0043_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PST01_0088_H11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0110_H04.b : CTGTCAATGCCAT*CACTGCC*ACTCATAATAA*TGTGGAAGG*CCCCTCCTGGAAACCT
TES01_0105_G05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGC*CCCGTCTGGG*AAGCT
OVRM1_0117_A03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0099_G11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0010_C09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0052_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0018_A02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0080_D02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0087_F11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCCGGGAAAGCT
TES01_0106_D09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0033_A10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0079_F05.b : CNGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
HTMT1_0040_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0078_A07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PTG01_0009_C09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0032_D08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0045_D04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCATCTGGG*AAGCT
THY01_0051_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PBL01_0094_D06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0029_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0018_B02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0040_B09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0019_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0008_B01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0057_E11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0041_H10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
LVRM1_0063_G06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0122_H11.b : CCGTCCATGCCAT*Cccttgcccccaaaaaattgtggatgcccgtttgggaagctgtggg
THY01_0047_G03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0086_E09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ITT01_0078_F01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0068_G08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0093_H12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0070_C09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0067_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0086_E04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0093_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0035_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0071_F06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0102_H05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0015_A12.b : acagtccatggccatcactgccaaccaaaaatactgtggaatggcccgtctgggaaacct
TCH01_0027_F09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0015_G04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PBL01_0013_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0022_G04.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0013_D03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
PTG01_0030_D11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0084_H01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAAAC*TGTGGATGGTCCCGTCTGGG*AAGCT
OVR01_0080_H01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0044_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0071_G03.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0063_H12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0064_B08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0052_B06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0013_F10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0029_G09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVR01_0097_E07.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0049_G02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGA*AAGCT
THY01_0095_E10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0025_H12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
THY01_0042_D08.b : acgtctcactagccataacttgccaatccaaaaataatgtggatggcccgtcaccaatcc
SPL01_0037_B11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ADR01_0022_C06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TCH01_0087_D12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
ILNT1_0086_G12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0086_E06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0056_F06.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0091_H02.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0098_C11.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
SPL01_0099_E12.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AGGCT
MLTL1_0041_D08.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
TES01_0076_E05.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
DCI01_0031_C10.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
OVRM1_0214_F01.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
MLTL1_0040_H09.b : CGGTCCATGCCAT*CACTGCC*ACCCAGAAGAC*TGTGGATGG*CCCGTCTGGG*AAGCT
20110601C-000449 : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
---------+---------+---------+---------+---------+---------+ 718
HTMT1_0002_H03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0040_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVRM1_0034_A02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0039_G03.b : GTGGCTTGATGGCCA*AGGGGCTGCCCAGAACATT*ATCCCTGCT*TCTAACGG*GGCTG
ADR01_0043_C02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0103_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0008_C08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0008_D12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0122_H07.b :
TES01_0105_A12.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAAAAAATC*ATCCCTGCTTTCTACCGG*CGCTG
TES01_0034_F04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0029_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0030_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCATAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0047_C12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0010_F08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0061_A09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGcgcn
TES01_0019_D11.b : GTGGCGTGATGGCCA*AATGGCTGCCCAAAACATC*TTCCCTGCT*TCTACCGG*CACTG
TES01_0076_E04.b : GTNGCCTGATGGCCA*AGGGGCTGCCCAAAAAA*C*ATCCCTGCT*TCTACCGG*CGCCG
TES01_0076_G02.b : GTGGCGTGATGGCCG*AGGGGCTTGCCAGAACATC*ATCCCTGCT*TCTACGGG*CGCTG
TES01_0092_G11.b : GTGGCGTGATGGCCC*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0053_A04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0072_C12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGA*CATC*ATCCCTGCT*TCTACGGG*CGCTG
SPL01_0073_D12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0023_F12.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAAAAAATC*ATCCCTGGT*TCTACCGG*CGCTT
TES01_0112_C06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0093_C02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCA*AACATC*ATCCCTGTT*TCTACCGG*CGCTG
TES01_0055_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0043_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0075_F11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0067_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0051_D07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0047_B12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0147_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0090_H05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0003_A09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SKNB1_0038_G04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0040_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0002_A05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0042_C01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
UTR01_0050_G04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0008_B10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0081_C10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
KDN01_0026_H03.b : GTGGCGTGATGGCCG*TGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PST01_0045_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0064_D04.b : gtaaggccaaagggtttcccaaaaaattttccttgggttttacggggcgtcaaagggttg
BMWN1_0081_B04.b : GTGGCGTGATTGCCG*AAGGGCTGCCCA*AACATC*ATCCCCGCT*TCTACCGG*CGCTG
BMWN1_0094_C06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0205_G12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0031_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTNACGG*CGCTG
BMWN1_0094_E01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCANAACATC*ATCCCTGCT*TCTACCCG*CGCTG
HTMT1_0002_D09.b : GTGGCGTGATGGCCA*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTAACGG*CGCTG
HTMT1_0132_G07.b : GTGGCGTGATGGCCG*AGGGGCCTGCCAAAAAATC*ATCCCGGCT*TCTACGGG*CGCTG
SPLT1_0034_G08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCANAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0093_E08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TTCTACGG*CGCTG
SKNB1_0003_D05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0024_C01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCATA*CATC*ATCCCTGCT*TCTACCTG*CGCTG
CBLT1_0023_F12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0039_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAAAATC*TTCCCCGCT*TCTACCGG*CGCTT
CBLT1_0028_D12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0074_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCANAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0076_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0031_B10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0082_C03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0065_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0065_F06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0092_E12.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0052_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0065_A01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0075_H04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0051_B05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0099_A12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0063_F12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0114_G07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0113_B04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0056_F10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0130_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0032_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0114_G08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0128_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BMWN1_0011_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0054_A03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TTCTACGG*CGCTG
HTMT1_0017_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0016_C02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0097_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0072_C02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0036_C08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0069_G07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0084_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BMWN1_0002_C02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0121_H10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0025_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0089_B09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0016_E01.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0105_F10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0038_H08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0068_H12.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCTTTCTACC*G*CGCTG
CBLT1_0096_E08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0040_A05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0131_B10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0049_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0124_A01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0030_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0023_H04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0080_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0023_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0044_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0064_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0034_C05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0064_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0087_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0062_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0007_B06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0148_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0097_E01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0086_G11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0036_B11.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0045_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0149_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0143_A06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0152_E02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0013_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0055_C09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0004_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0051_G11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0077_E02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0065_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0131_F02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0037_D07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0084_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAAAATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0135_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0136_D05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0041_B09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0042_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0007_B09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0082_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0116_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0083_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0045_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0019_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0080_E02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0048_A09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0094_F04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BMWN1_0050_D06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LNG01_0016_C06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0139_A11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0064_G07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0149_B12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0020_F06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0041_F11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0058_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0076_D08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0040_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0003_B05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0079_G03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0045_F01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0064_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0080_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0035_D12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SKNB1_0025_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0007_E08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0075_C01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0076_F06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0141_C07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0047_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0092_G02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0021_D06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0152_G10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0001_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0017_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0059_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0151_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0093_H08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0040_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0090_G05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0141_C01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0068_B04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BMWN1_0047_G04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0037_G03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0095_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0062_B01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BMWN1_0004_F11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0013_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0061_B06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0049_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0035_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0046_H08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0072_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ITT01_0055_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0001_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0079_B01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0039_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0070_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0046_F12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0063_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0096_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0095_C10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0057_E08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0067_A11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0002_B07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CBLT1_0069_H07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0142_H07.b : aattaccctgttttacgggcgctccagggtggtgtgaaagttttccttagccccccggga
ADR01_0061_C12.b : gccaaagggtttcccaaaaaatttcctggtttttacagggtttcaaagggttgggggagg
OVRM1_0098_H08.b : GTGGCGTGACGTTCG*AGGGCCTGTCCccaactcatcccttcttctaccggcgcttttaa
OVR01_0076_C04.b : GANGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCT
OVR01_0073_B04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTA
OVRM1_0140_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVRM1_0093_C02.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0076_E06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0099_G12.b : GTGGCGTGATGGCCC*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TTTACCGG*GGCTG
OVRM1_0192_H06.b : GTGGCGTGATGGCCG*AGGGGCTGNCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0118_B04.b : GTGGCGTGATGGCCG*AAGNGCTGCCCATAACATC*ATCCCTGCT*TCTACCGG*CGCTT
OVRM1_0190_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0055_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0062_G02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0021_G06.b : GTGNCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0210_G12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0021_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCATAACATA*ATCCCTGAT*TATACAAG*CGCTG
PTG01_0026_F05.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAAAACATT*ATCCCTGCT*TTTAACGG*CGCTG
OVRM1_0098_D07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0103_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
UTR01_0010_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
UTR01_0014_A05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0024_F11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAA*ATC*ATCCCTGCT*TCTACCGG*CGCTT
OVRM1_0049_B04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGA*CATC*ATCCCTGCT*TCTACCGT*GTCTG
SPL01_0021_F04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0098_D01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0058_H08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0002_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TTCTACGG*CGCTG
OVR01_0090_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TTCTACGG*CGCTG
THY01_0049_D01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0008_C09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0019_G07.b : GTGGCGTGATGGCCGAAGGGGCTGCCCAGAACATCATCCCCTGCT*TCTAACCG*CGCTG
SPL01_0044_B10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0132_D04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
UTR01_0094_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0111_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPLT1_0029_A02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTNACGG*CGCTG
UTR01_0033_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0117_C08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVR01_0082_A11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0013_G11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
BFLT1_0060_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0132_D01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCTTTCTACCG**CGCTG
OVRT1_0012_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVR01_0065_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0041_F03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0114_A01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0102_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0133_C12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGTT*TCTACCGG*CGCTG
TES01_0052_A06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0067_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0007_G07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*TCCCCTGCT*TCTACCGG*CGCTG
SPL01_0078_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0131_D05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0111_G11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0029_B12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0030_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0031_D07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0014_D10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0046_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0001_B11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0054_A12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0046_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0109_H09.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PBL01_0058_A11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0070_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0099_G07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0045_E11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PBL01_0054_G12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0101_G12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LNG01_0070_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0054_F10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0099_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0051_D06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGGGCGCTG
MLN01_0084_A01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0051_H04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0094_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLN01_0048_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCCGCT*TCTACCGG*CGCTG
MLN01_0035_H10.b : GTGGCGTGATGGCCG*AGGGGCTTCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0084_E06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVR01_0067_D02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0013_F12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0087_H06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ITT01_0008_D07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0083_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ITT01_0006_B04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0074_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0088_G08.b : gggcctgatggcccagggggctccccaaaatttatccttggtttttacgggggttgccaa
DCI01_0036_C01.b : tgncttgatgccctagggctggccaaaaattcttcccttgctcaaccgggcctccaaagg
MLTL1_0032_B01.b : GGTGCCTGATGGCC**AAGGGCTGCCCA*AACATC*ATCCCTGCT*TCTACggcgctgcc
MLTL1_0031_G05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAAAATC*ATCCCTGGC*TTCACCGG*CCCTG
BKFL1_0011_B07.b : GNTGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0013_E07.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTAACGG*CGCTG
BMWN1_0025_A12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0022_C04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCANAACATC*ATCCCTGCT*TTCTACGG*CGCTG
BKFL1_0011_B03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0037_A03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCTTTCTACC*G*CGCTG
MLTL1_0093_D02.b : GNTGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0058_H03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCNG*CGCTG
MLTL1_0029_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0025_B05.b : GTGGCGTGATGGCCG*AAGGGCTGCCC*GAACATC*ATCCCNNTGCTCTACCG**CGCTG
MLTL1_0033_C06.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TTCTACGG*CGCTG
MLN01_0013_G03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRT1_0107_A09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0073_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0043_E12.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0089_A01.b : GTGGCGTGATGGCCG*AGGGGCTNGCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0090_B12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACGGG*CGCTG
MLTL1_0082_D08.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAAANCATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0036_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0001_C04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0091_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0057_G06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0044_C04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0072_H06.b : gtggcttgatggcccaagggccttcccaaaaaattcttccctgttttttaccgggcctgc
OVRM1_0171_F08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0060_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0054_E03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0048_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0029_G01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0043_B12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0038_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0002_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SKNB1_0047_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0095_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
DCI01_0005_F02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0025_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0037_B07.b : ccaagggccgccaaaaaaacaccctgctcaaccaggcctccaagctatgggcaagtcatc
CBLT1_0018_B01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0066_E08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
CLNT1_0083_E10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLN01_0084_B03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLN01_0094_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PBL01_0100_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0080_F08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0055_A08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0019_F02.b : GTGGCGTGATGACCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0102_E10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SMG01_0018_F02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SKNB1_0036_B06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0074_C12.b : GTGGCGTGATGGGCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCNG*CGCTG
TCH01_0064_B09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SKNB1_0070_C03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PST01_0043_B01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PST01_0088_H11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0110_H04.b : GTGGCTTGATGGCCA*AAGGGCTGCCCTAAATATCTATCCCTGCT*TCTACCGGacctgt
TES01_0105_G05.b : GTGGCTTGATGGCCG*AGGGGCTGCCCN*AACATC*ATCCCTGCT*TCTACNGG*CGCTG
OVRM1_0117_A03.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0099_G11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0010_C09.b : GTGGCGTGATGGCCG*AAGGGCTGCCCAGAACATC*NATCCTGCT*TCTACCGG*CGCTG
TES01_0052_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0018_A02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TTCTACGG*CGCTG
TCH01_0080_D02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0087_F11.b : GTGGTGTGAATGGCC*AAGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0106_D09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0033_A10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0079_F05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
HTMT1_0040_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAAAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0078_A07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PTG01_0009_C09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0032_D08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0045_D04.b : GTGGCGTGATGACCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0051_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PBL01_0094_D06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0029_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0018_B02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0040_B09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0019_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0008_B01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0057_E11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0041_H10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
LVRM1_0063_G06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCA*AACATC*ATCCCTGCT*TTTACCCG*CGCTG
THY01_0122_H11.b : ttatgggcgaggggttccaaaa
THY01_0047_G03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0086_E09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ITT01_0078_F01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0068_G08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0093_H12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0070_C09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0067_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0086_E04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0093_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0035_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0071_F06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0102_H05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0015_A12.b : ttggcgtgattggccgaggggcttgccaaaaacatcatcccttgcttctaaccgcactgg
TCH01_0027_F09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0015_G04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PBL01_0013_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0022_G04.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0013_D03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
PTG01_0030_D11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0084_H01.b : GTGGCGTGATGGCCC*AGGGGCTGTCCACAACATCATCCCCTGCT*TTTACCGG*TGCTG
OVR01_0080_H01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0044_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0071_G03.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0063_H12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0064_B08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0052_B06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0013_F10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0029_G09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVR01_0097_E07.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0049_G02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0095_E10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0025_H12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
THY01_0042_D08.b : cttgccgcgccagcctatctcctaccccacaaccttatcctctcgttccaccaacccttc
SPL01_0037_B11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ADR01_0022_C06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TCH01_0087_D12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
ILNT1_0086_G12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0086_E06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0056_F06.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0091_H02.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0098_C11.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
SPL01_0099_E12.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0041_D08.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
TES01_0076_E05.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCTTGCT*TCTACCGG*CGCTG
DCI01_0031_C10.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
OVRM1_0214_F01.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
MLTL1_0040_H09.b : GTGGCGTGATGGCCG*AGGGGCTGCCCAGAACATC*ATCCCTGCT*TCTACCGG*CGCTG
20110601C-000449 : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
---------+---------+---------+---------+---------+---------+ 773
HTMT1_0002_H03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0040_G01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
LVRM1_0034_A02.b : CCNA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGG
SMG01_0039_G03.b : CCAA*GGCTGTGGGCA*AAGGCATC*CCTGGA*CTCAACGGGGA*ACCTCATGGCTTGGC
ADR01_0043_C02.b : CCCA*AGCTGTGGGCA*AAGTCACC*CCTGAA*CTCAACGGGAA*GCTCACTGGCATGGC
OVRT1_0103_A10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0008_C08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0008_D12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
THY01_0122_H07.b :
TES01_0105_A12.b : CCAA*GGCTGTGGGCAAAGGCCACC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGGC
TES01_0034_F04.b : CCAA*AGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0029_D03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0030_D11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCCACGGGAA*GCTCACTGGCATGGC
TCH01_0047_C12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TCH01_0010_F08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ADR01_0061_A09.b :
TES01_0019_D11.b : CCAA*GGCTGTGAGTG*AGGTCATC*CCTGTA*CTCAACGGTAA*TCTCCACTGGCATGG
TES01_0076_E04.b : CCAA*AGCTGTGGGCAAAGGGCTTC*CCTGAC*CTCCACGGGAA*GCTCATGGCCATGGC
TES01_0076_G02.b : C*AA*AGCGGTGGGCA*AAGTCATC*CCCGAA*CCTCACGGGAA*ACTCCATGGCAGGGC
TES01_0092_G11.b : CCAA*AGCTGTGGGCA*AGGTCTTC*CCCGAG*CTCAACG*GAA*ACTCACGGGCATGGC
TES01_0053_A04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAA*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0072_C12.b : CCAA*GGCTGTGGGCA*AAGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPL01_0073_D12.b : CCAA*GGCTGTGGGCC*AAGTCATC*CCTGAA*CCTCACGGGAA*ACTCACTGGCATTGG
TES01_0023_F12.b : CCAA*AGCTGTGGGCA*AAGTCATC*CCTGAA*CTCAACGGGAA*ACTCACAGGGATGGC
TES01_0112_C06.b : CCAA*GGCTGTGGGCA*GGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SMG01_0093_C02.b : CCNA*GGCTGTGGGGC*AGGTCATC*CCTGAC*CTC*ACGGGAA*GCTCACTGGCATGGC
TES01_0055_E05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0043_F09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TCH01_0075_F11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGGA*GCTCACTGGCATGGC
SMG01_0067_H02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
OVR01_0051_D07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0047_B12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CLNT1_0147_D04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0090_H05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0003_A09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SKNB1_0038_G04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0040_E03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0002_A05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0042_C01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
UTR01_0050_G04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
OVR01_0008_B10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TCH01_0081_C10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
KDN01_0026_H03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
PST01_0045_C11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0064_D04.b : gggaaagggtcccccgagaacttcagggaaaaccccgggggggggccttctcgggccccc
BMWN1_0081_B04.b : CCAggctgtgggcaagtcatccctgaactcaagggaaagccactggcatggctttcgtgt
BMWN1_0094_C06.b : CCAA*AGCTGTNGGGC*AAGTCATC*CCTGAG*CTCAACGGGtgaggctctttgctgctc
OVRM1_0205_G12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0031_G01.b : CCNA*AGCTGTGGGCA*AGGTCATC*CCTGAG*NCTCACGGGGA*GCTCACTGGCATGGC
BMWN1_0094_E01.b : CCCA*GGCTGTGGGGC*AGGTCATC*CCTGAG*CTCAACG*GAA*ACTCACTGGCATGCC
HTMT1_0002_D09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACTGGAA*ACTCACTGGAATGGC
HTMT1_0132_G07.b : CCAA*AGGTGTGGGCC*AGGTCTTC*CCGGAA*CCTCAAGGGAA*CCTCCTGGGCAGGGC
SPLT1_0034_G08.b : CCAA*GGCTGTGGGGC*AAGTCATT*CCTGAG*CCTCACGGGAA*GCTCACTGGCATGGC
TES01_0093_E08.b : CCAA*GGCTGTGGGCA*AGGCCTCC*CCTGAA*CTCAACGGGAA*TC*CACTGGCATGGC
SKNB1_0003_D05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0024_C01.b : CCAA*AGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGATTGGC
CBLT1_0023_F12.b : CCAA*GGCTGTGGGCAANGTCATTC*CCTGAG*CTCAACGGGGA*GCTCCCTGGCATGGC
CBLT1_0039_A08.b : GCCA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0028_D12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCCTGA*GCTCACGGGAA*GCTCACTGGCATGGC
CBLT1_0074_H11.b : CCAA*GGCTGTGGGGC*AGGTCATC*CCTGAC*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0076_E12.b : CCAA*GGCTGTGGGCA*AAGTCATC*CCTGAG*CTCAACCGGAA*GCTCACTGGCATGGC
CBLT1_0031_B10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGG*AA*GCTCACTGGCATGGC
CBLT1_0082_C03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0065_E04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0065_F06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0092_E12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0052_H09.b : CCAA*GGCTGTGGGCA*AAGTCATC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGCC
CBLT1_0065_A01.b : CCAA*AGCTGTGGGCA*AGGTCATC*CCTGAA*CTCACCGGGAA*GCTCACTGGGATTNC
HTMT1_0075_H04.b : CCAA*GGCTGTGGGGC*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0051_B05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0099_A12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
CBLT1_0063_F12.b : CCNA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0114_G07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
HTMT1_0113_B04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0056_F10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGNA*GCTCACGGGAA*GCTCACTGGCATGGC
HTMT1_0130_E05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0032_H02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGGC
HTMT1_0114_G08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0128_H09.b : CCAA*GGCTGTGGGNC*AGGTCATC*CCTGAG*CTNCACGGGA**GCTCACTGGCATGGC
BMWN1_0011_B08.b : CCAA*GGCTGTNNGGC*AGGTCATC*CCCTGA*GCTCACGGGAA*GCTCACTGGCATGGC
HTMT1_0054_A03.b : CCNA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGGA*GCTCACTGGCATGGC
HTMT1_0017_B02.b : CCNA*GGCTGTGGGCA*AGGTCATC*CCTGNA*GCTCACGGGAA*GCTCACTGGCATGGC
CBLT1_0016_C02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SMG01_0097_E05.b : CCAA*GGCTGTGGGGC*AAGTCATC*CCTGAG*CTCAACGGGGA*GCTCACTGGCATGGC
ILNT1_0072_C02.b : CCAA*AGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0036_C08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCACCGGGAA*GCTCACTGGCATGGC
HTMT1_0069_G07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0084_A10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
BMWN1_0002_C02.b : CCAA*GGCTGTGGGCA*AAGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0121_H10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGG
CBLT1_0025_H02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0089_B09.b : CCAA*GGCTGTGGGGC*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
DCI01_0016_E01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0105_F10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0038_H08.b : CCAA*GGCTGTGGGNC*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
SPLT1_0068_H12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0096_E08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
TES01_0040_A05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAA*GCTCACGGGAA*GCTCACTGGCATGGC
HTMT1_0131_B10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0049_F05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0124_A01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
CBLT1_0030_F09.b : CCAA*GGCTGTGGGCA*AAGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0023_H04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0080_H07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0023_D04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGCC
HTMT1_0044_E12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0064_H07.b : CCAA*GGCTGTGGGGC*AAGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0034_C05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCCTGGC
HTMT1_0064_H07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0087_H11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0062_G01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0007_B06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0148_B08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0097_E01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGGA*GCTCACTGGCATGGC
SPLT1_0086_G11.b : CCAA*GGCTGTGGGCN*AGGTCATC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGGC
CBLT1_0036_B11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGGC
CBLT1_0045_H07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0149_H07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0143_A06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
HTMT1_0152_E02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0013_H11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0055_C09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
SPLT1_0004_D04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0051_G11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
HTMT1_0077_E02.b : CCNA*GGCTGTGGGCA*AGGTCATC*CCCTGA*GCTCACGGGAA*GCTCACTGGCATGGC
HTMT1_0065_D03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTNGA*GCTCACGGGAA*GCTCACTGGCATGGC
HTMT1_0131_F02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0037_D07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0084_E04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCCTGA*CTCAACGGGAA*ACTCACTGGCATGGC
HTMT1_0135_D09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0136_D05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0041_B09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0042_A08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0007_B09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0082_D09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0116_D04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0083_F05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0045_F09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0019_B08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*ACTCACTGGCATGGC
HTMT1_0080_E02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0048_A09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0094_F04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
BMWN1_0050_D06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
LNG01_0016_C06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0139_A11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0064_G07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0149_B12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0020_F06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0041_F11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
CBLT1_0058_H11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0076_D08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0040_F05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0003_B05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0079_G03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0045_F01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0064_E05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0080_A10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0035_D12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SKNB1_0025_A10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0007_E08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0075_C01.b : CCAA*GGCTGTGGGNC*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0076_F06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0141_C07.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0047_G01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0092_G02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
ILNT1_0021_D06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0152_G10.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
CBLT1_0001_B02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0017_D04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0059_E04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGG
HTMT1_0151_H09.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
ILNT1_0093_H08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0040_B02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
SPLT1_0090_G05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0141_C01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0068_B04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
BMWN1_0047_G04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0037_G03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
HTMT1_0095_E12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0062_B01.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
BMWN1_0004_F11.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0013_A08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0061_B06.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0049_F05.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ILNT1_0035_B02.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTNCACGGGAA*GCTCACTGGCATGGC
CBLT1_0046_H08.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0072_E04.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
ITT01_0055_D03.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAACGGGAA*GCTCACTGGCATGGC
CBLT1_0001_E12.b : CCAA*GGCTGTGGGCA*AGGTCATC*CCTGAG*CTCAAC