[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000489

Length: 2,060

Sequence [FASTA format sequence]
GGCTTCCCTT TTCCACTAGG CGTTCGAGAC TCCTGTTCAC CCATCATAGA GGAACTCCTA
CGCTGTTGCG ATCACACCTT ACTAACTGTG TTCTTAAACT TCTCATTTAC TGTTCTGTGT
CGTTTCACTT ATACTAACAA CAAAACTGAC ACACACTAGC ACAATGGATG CCCAAGAAGT
AGAAACAATT TGAACAATCC TACCCGCTAT TATTCTAATT CTTATTGCCC TTCCATCATT
ACGAATCCTT TATATAATAG ACGAAATTAA TAACCCAGCC TTAACCGTAA AAACCATAGG
ACATCAATGA TACTGAAGCT ACGAGTATAC AGACTATGAA GACCTCACCT TTGACTCATA
TATAATCCCC ACATCAGATC TTAAACCTGG AGAAATACGA CTACTAGAAG TAGACAATCG
AGTTGTTCTA CCAATAGAAA TAACAATCCG AATATTAGTA TCCTCTGAAG ACGTACTGCA
CTCATGAGCC GTCCCATCCC TCGGTTTAAA AACAGATGCT ATCCCAGGAC GACTAAACCA
AACAACTCTA ATATCCACAC GACCTGGCCT TTATTACGGA CAGTGCTCAG AAATCTGTGG
ATCAAACCAC AGCTTCATGC CCATTGTACT TGAACTTGTC CCATTAAAGT ACTTCGAAAA
ATGGTCAACA TCAATATTAA CAGGTTCATT GAGATGCTAG TCAGCACTAA CCTTTTAAGT
TAGAGATCGG GAGCCTAAAT CTCCCCTCAA TGGTTATGCC ACAACTAGAT ACATCTACAT
GATTCATTAC AATTACATCA ATAATTATAA CATTATTTAT TTTATTCCAA CTAAAAATCT
CAAACTACTC ATACCCAGCA AGCCCAGAAT CAACCGAACT CAAAACTCAA AAACATAGCA
CCCCTTGAGA AATAAAATGA ACGAAAATCT ATTTGCCTCT TTCATTGCCC CTACGATAAT
AGGACTACCT ATTGTCACCT TAATTATTAT ATTCCCAAGC TTACTATTCC CAACACCCAA
ACGACTCATT AATAACCGCA CAATCTCGAT CCAACAATGA TTAATCCAAC TAACATCCAA
ACAAATAATA GCTATTCACA ACCAAAAAGG CCAAACCTGA TCACTAATAC TTATATCTCT
AATTATATTC ATTGGCTCAA CAAACATCCT AGGCCTACTA CCACACTCAT TCACACCCAC
CACACAACTA TCAATAAACC TGGGTATAGC AATCCCCCTA TGATCAGCAA CCGTATTCAC
AGGATTCCGC CATAAAACCA AAACATCACT AGCCCACTTT CTACCACAAG GAACACCCGC
CCCATTAATT CCTATGCTCG TAATTATTGA AACTATTAGC CTATTTATTC AACCAGTAGC
CCTAGCCGTA CGACTGACAG CCAACATTAC AGCAGGGCAC CTATTAATTC ATCTAATTGG
AGGGGCCACA TTAGCACTAC TCAACATCAG CACTATAACA GCTTTTATCA CATTTACTAT
CCTCATCCTA TTAACTATTC TTGAATTTGC AGTAGCTCTG ATCCAAGCTT ATGTGTTTAC
ACTGCTAGTA AGCTTATACC TACACGACAA TACATAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAANNGGC
CCCGGGCCCC CGATTCCCCT TTGGGGGGGG GTTTTTGGAC CCCAAAAAAA AAAAAAACTT
GGGGGGGTTG GGGCCACCCC CCCCCGGAGG GGGGGGAAAA AATGGTTTTT TTTGGAAAAT
TTGGGGGGCC TTTGTTTTTT TTGGAACCCT TTAAGGGGGG AAAAAAAAAT TTAAACACCA
CAATTTTTTT TTTTTTTTTT TTCCGGGTCG GGGGGGGGGG GGGAAATTTT TTTTCCAAAA
AAAAAACCCC CCCACCGGGG GGGGAAGGGG GTTTTGCATT TGGGCCCCCC TCCCCTTCCC
CCAAAAAAAA ACCCCTCGCC CGGGGTTTTT GGGGGGGGGA AACGTTTTTC CTCCCCCGGG
GGGGGGTGAA TCGGTTTCCC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Homo sapiens]. 2603e-69O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Homo sapiens]. 2081e-53


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Mus musculus]. 2658e-71O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Mus musculus]. 2559e-74


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Canis lupus familiaris]. 2981e-80O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Canis lupus familiaris]. 2548e-74


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Bos taurus]. 2803e-75O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Bos taurus]. 2671e-76


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Sus scrofa]. 3132e-85O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Sus scrofa]. 2794e-81
Contig/Assembly ProteinATP8ATP synthase F0 subunit 8 [Sus scrofa]. 63.93e-10O


Assembly Members: 150      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010002H05AMP01_0002_H05.bBW955118 
AMP010024G04AMP01_0024_G04.bBW956817 
AMP010032H03AMP01_0032_H03.bBW957311 
AMP010036E10AMP01_0036_E10.bBW957621 
BFLT10124E05BFLT1_0124_E05.bHX203721 
BKFL10057D11BKFL1_0057_D11.bFS652341 
BMWN10027E03BMWN1_0027_E03.b  
BMWN10058F02BMWN1_0058_F02.bHX209098 
CBLT10009B06CBLT1_0009_B06.bHX212406 
CBLT10051G05CBLT1_0051_G05.bHX215257 
CBLT10072E03CBLT1_0072_E03.bHX216905 
CBLT10084H08CBLT1_0084_H08.b  
CBLT10094C08CBLT1_0094_C08.bHX218626 
CBLT10098E04CBLT1_0098_E04.bHX218976 
CLNT10012B10CLNT1_0012_B10.bFS657993 
CLNT10030H07CLNT1_0030_H07.bFS659443 
CLNT10092E02CLNT1_0092_E02.b  
DCI010021D02DCI01_0021_D02.bDB792162 
DCI010023B01DCI01_0023_B01.bDB792321 AK391268
DCI010029B07DCI01_0029_B07.bDB792847 
DCI010034A04DCI01_0034_A04.bDB793285 
DCI010047B05DCI01_0047_B05.bDB794344 
DCI010059D07DCI01_0059_D07.bDB794811 
DCI010068D06DCI01_0068_D06.bDB795624 
DCI010069B05DCI01_0069_B05.bDB795690 
DCI010081H05DCI01_0081_H05.bDB796798 
DCI010089G07DCI01_0089_G07.bDB797495 
DCI010093F03DCI01_0093_F03.bDB797841 
DCI010101D08DCI01_0101_D08.bDB798539 
DCI010106C05DCI01_0106_C05.bDB798960 
DCI010108E05DCI01_0108_E05.bDB799141 
HTMT10001B04HTMT1_0001_B04.bFS664388 
HTMT10002F08HTMT1_0002_F08.bFS664478 
HTMT10003B03HTMT1_0003_B03.bFS664501 
HTMT10003F03HTMT1_0003_F03.b  
HTMT10005A01HTMT1_0005_A01.b  
HTMT10005B12HTMT1_0005_B12.bFS664617 
HTMT10005G02HTMT1_0005_G02.bFS664651 
HTMT10006H08HTMT1_0006_H08.b  
HTMT10008B08HTMT1_0008_B08.b  
HTMT10008D06HTMT1_0008_D06.b  
HTMT10010A12HTMT1_0010_A12.bFS664907 
HTMT10013B09HTMT1_0013_B09.bFS665116 
HTMT10013E09HTMT1_0013_E09.bFS665145 
HTMT10014G06HTMT1_0014_G06.bFS665237 
HTMT10017C10HTMT1_0017_C10.b  
HTMT10018A01HTMT1_0018_A01.bFS665484 
HTMT10018E12HTMT1_0018_E12.bFS665533 
HTMT10019D05HTMT1_0019_D05.bFS665596 AK391736
HTMT10020C08HTMT1_0020_C08.bFS665666 
HTMT10020D11HTMT1_0020_D11.bFS665678 
HTMT10023C11HTMT1_0023_C11.bFS665901 
HTMT10023E04HTMT1_0023_E04.bFS665913 
HTMT10026D03HTMT1_0026_D03.bFS666119 
HTMT10026H08HTMT1_0026_H08.bFS666162 
HTMT10029D02HTMT1_0029_D02.bFS666346 
HTMT10032C04HTMT1_0032_C04.b  AK391907
HTMT10034C09HTMT1_0034_C09.b  
HTMT10034F03HTMT1_0034_F03.bFS666682 AK391931
HTMT10036D01HTMT1_0036_D01.bFS666784 
HTMT10041F04HTMT1_0041_F04.bFS667075 
HTMT10045C09HTMT1_0045_C09.bFS667340 
HTMT10047G10HTMT1_0047_G10.bFS667532 
HTMT10048G04HTMT1_0048_G04.bFS667604 
HTMT10049B03HTMT1_0049_B03.bFS667632 
HTMT10054C11HTMT1_0054_C11.bFS668030 
HTMT10058C09HTMT1_0058_C09.bFS668315 
HTMT10059B04HTMT1_0059_B04.bFS668380 
HTMT10060D07HTMT1_0060_D07.bFS668473 
HTMT10061A11HTMT1_0061_A11.bFS668526 
HTMT10061F04HTMT1_0061_F04.bFS668568 
HTMT10062C06HTMT1_0062_C06.bFS668614 
HTMT10062F03HTMT1_0062_F03.bFS668635 
HTMT10063A11HTMT1_0063_A11.bFS668668 
HTMT10063D10HTMT1_0063_D10.bFS668693 
HTMT10065F09HTMT1_0065_F09.bFS668859 
HTMT10067A01HTMT1_0067_A01.bFS668959 
HTMT10068B02HTMT1_0068_B02.bFS669046 
HTMT10070C01HTMT1_0070_C01.bFS669191 
HTMT10071C05HTMT1_0071_C05.bFS669262 
HTMT10072A06HTMT1_0072_A06.b  
HTMT10073E05HTMT1_0073_E05.bFS669404 
HTMT10078D05HTMT1_0078_D05.bFS669745 
HTMT10079E04HTMT1_0079_E04.bFS669815 
HTMT10079H09HTMT1_0079_H09.bFS669845 
HTMT10081H04HTMT1_0081_H04.bFS669949 
HTMT10085F07HTMT1_0085_F07.bFS670199 
HTMT10086F06HTMT1_0086_F06.bFS670276 AK392564
HTMT10086G07HTMT1_0086_G07.bFS670286 
HTMT10087B06HTMT1_0087_B06.bFS670315 AK392573
HTMT10088A10HTMT1_0088_A10.bFS670381 
HTMT10088E04HTMT1_0088_E04.bFS670416 
HTMT10090D04HTMT1_0090_D04.bFS670551 
HTMT10090E07HTMT1_0090_E07.bFS670562 
HTMT10091C02HTMT1_0091_C02.bFS670606 
HTMT10092G06HTMT1_0092_G06.bFS670732 
HTMT10092G08HTMT1_0092_G08.bFS670734 
HTMT10093H08HTMT1_0093_H08.bFS670822 
HTMT10098H12HTMT1_0098_H12.bFS671192 
HTMT10100G08HTMT1_0100_G08.bFS671324 
HTMT10101B11HTMT1_0101_B11.bHX223259 
HTMT10102D07HTMT1_0102_D07.bHX223337 
HTMT10102D10HTMT1_0102_D10.bHX223340 
HTMT10105F02HTMT1_0105_F02.b  
HTMT10106H07HTMT1_0106_H07.bHX223670 
HTMT10107A03HTMT1_0107_A03.bHX223676 
HTMT10107E08HTMT1_0107_E08.bHX223720 
HTMT10111B12HTMT1_0111_B12.bHX223989 
HTMT10114B08HTMT1_0114_B08.bHX224208 
HTMT10114G09HTMT1_0114_G09.bHX224246 
HTMT10124H09HTMT1_0124_H09.bHX224818 
HTMT10125H09HTMT1_0125_H09.b  
HTMT10128F02HTMT1_0128_F02.b  
HTMT10129E11HTMT1_0129_E11.bHX225108 
HTMT10130A01HTMT1_0130_A01.bHX225128 
HTMT10131D04HTMT1_0131_D04.b  
HTMT10132F06HTMT1_0132_F06.bHX225260 
HTMT10133G03HTMT1_0133_G03.bHX225335 
HTMT10133H07HTMT1_0133_H07.bHX225348 
HTMT10134A12HTMT1_0134_A12.b  
HTMT10137D09HTMT1_0137_D09.bHX225610 
HTMT10140A09HTMT1_0140_A09.bHX225817 
HTMT10143C10HTMT1_0143_C10.bHX226069 
HTMT10143D02HTMT1_0143_D02.bHX226073 
HTMT10144F05HTMT1_0144_F05.bHX226167 
HTMT10144H09HTMT1_0144_H09.bHX226187 
HTMT10147G03HTMT1_0147_G03.bHX226389 
HTMT10150H01HTMT1_0150_H01.bHX226593 
ILNT10001D01ILNT1_0001_D01.bHX226768 
ILNT10006D11ILNT1_0006_D11.bHX227183 
ILNT10009G02ILNT1_0009_G02.bHX227435 
ILNT10063C04ILNT1_0063_C04.bHX231733 
ILNT10064G01ILNT1_0064_G01.bHX231856 
ILNT10083G05ILNT1_0083_G05.bHX233401 
MLTL10041H03MLTL1_0041_H03.bFS682020 
MLTL10049C06MLTL1_0049_C06.bFS682668 
MLTL10057C10MLTL1_0057_C10.bFS683370 
MLTL10079G09MLTL1_0079_G09.bFS684496 
MLTL10094H09MLTL1_0094_H09.bFS685848 
OVRM10082A07OVRM1_0082_A07.bBP145526 
SKNB10031E11SKNB1_0031_E11.b  
SPLT10015H11SPLT1_0015_H11.bHX240391 
SPLT10026D03SPLT1_0026_D03.bHX241215 
SPLT10028F04SPLT1_0028_F04.bHX241385 
SPLT10038B10SPLT1_0038_B10.bHX242130 
SPLT10059H10SPLT1_0059_H10.bHX243814 
SPLT10062A04SPLT1_0062_A04.bHX243974 
SPLT10063B03SPLT1_0063_B03.bHX244060 
SPLT10071A05SPLT1_0071_A05.bHX244693 
TES010101E12TES01_0101_E12.bCJ036639 

  

SNPs: 6      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
573A1700.895WNTAT/Y
G200.105TGT/C
695G600.545W-
T500.455
1271C9500.941WNCAT/H
T600.059TAT/Y
1323C9500.888WNCCA/P
T1200.112CTA/L
1470A1500.140WNAAC/N
G9200.860AGC/S
1507C9100.858WSATC/I
T1500.142ATT/I


Alignment:      TOP

20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0032_C04.b : tttggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
DCI01_0059_D07.b : aatgatxxxxxxxxxxxxx
DCI01_0106_C05.b : nnnaaatgatacta
DCI01_0034_A04.b : nnnnccatacta
DCI01_0081_H05.b : nnnaatcgtaact
DCI01_0108_E05.b : nnnnnnnnnnnnnnnnnnnn
DCI01_0023_B01.b : nttaagtaac
DCI01_0089_G07.b : nnnnaaacatatcta
DCI01_0021_D02.b : ttaaactaaca
DCI01_0093_F03.b : nnaaaaccatact
DCI01_0069_B05.b : nnaaaaccatacta
DCI01_0068_D06.b : nnnnttcgaatcata
DCI01_0101_D08.b : nnnaaacgtaactaa
MLTL1_0057_C10.b : nnnnnnnnnnnnnnnnnnnnnn
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : .GGCTTCCCTTTTCCACTAGGCGTTCGAGACTCCTGTTCACCCATCATAGAGGAACTCCT
---------+---------+---------+---------+---------+---------+ 59
HTMT1_0032_C04.b : tGGCTTCCCTTTTCCACTAGGCGTTCGAGACTCCTGTTCACCCATCATAGAGGAACTCCT
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_A04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H05.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B01.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_G07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_F03.b : atagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B05.b : tagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D06.b : angggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACGCTGTTGCGATCACACCTTACTAACTGTGTTCTTAAACTTCTCATTTACTGTTCTGTG
---------+---------+---------+---------+---------+---------+ 119
HTMT1_0032_C04.b : ACGCTGTTGCGATCACACCTTACTAACTGTGTTCTTAAACTTCTCATTTACTGTTCTGTG
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_B07.b : nnggtatctatagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxx
DCI01_0047_B05.b : nnaaacgatactaaxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : TCGTTTCACTTATACTAACAACAAAACTGACACACACTAGCACAATGGATGCCCAAGAAG
---------+---------+---------+---------+---------+---------+ 179
HTMT1_0032_C04.b : TCGTTTCACTTATACTAACAACAAAACTGACACACACTAACACAATGGATGCCCAAGAAG
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0106_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0108_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0023_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0089_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0069_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0068_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
MLTL1_0057_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0029_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0047_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
BKFL1_0057_D11.b : nnnnnnnnnnnnnnnnnn
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
---------+---------+---------+---------+---------+---------+ 239
HTMT1_0032_C04.b : TAAAAACAATTTGAACAATCCTACCCGCTATTATTTTAATTCTTATTGCCCTTCCATCAT
DCI01_0059_D07.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0106_C05.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0034_A04.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0081_H05.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0108_E05.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0023_B01.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0089_G07.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0021_D02.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0093_F03.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0069_B05.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0068_D06.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0101_D08.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
MLTL1_0057_C10.b : TAGAAACAATTTGAACAATCCTACCCGCTATTATTCTAATTCTTATTGCCCTTCCATCAT
DCI01_0029_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTGCCCTTCCATCAT
DCI01_0047_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0094_H09.b : nn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
---------+---------+---------+---------+---------+---------+ 299
HTMT1_0032_C04.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0059_D07.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0106_C05.b : TACGAATCCTTTATATAACAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCGTAG
DCI01_0034_A04.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0081_H05.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0108_E05.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0023_B01.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0089_G07.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0021_D02.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0093_F03.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0069_B05.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0068_D06.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0101_D08.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
MLTL1_0057_C10.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
DCI01_0029_B07.b : TACGAATCCTTTATATAATAGACGAAATTAATAACCCAGCCTCAACCGTAAAAACCATAG
DCI01_0047_B05.b : xxxxxATCCTTTATATAATAGACGAAATTAATAACCCAGCCTTAACCGTAAAAACCATAG
MLTL1_0079_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0094_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
---------+---------+---------+---------+---------+---------+ 359
HTMT1_0032_C04.b : GACATCAATGATACTGAAGCTATGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0059_D07.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0106_C05.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0034_A04.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0081_H05.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTCTGACTCAT
DCI01_0108_E05.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0023_B01.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0089_G07.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0021_D02.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0093_F03.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0069_B05.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0068_D06.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0101_D08.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
MLTL1_0057_C10.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0029_B07.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
DCI01_0047_B05.b : GACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
MLTL1_0079_G09.b : xACATCAATGATACTGAAGCTACGAGTATACAGACTATGAAGACCTCACCTTTGACTCAT
BKFL1_0057_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTATGAAGACCTCACCTTTGACTCAT
MLTL1_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
---------+---------+---------+---------+---------+---------+ 419
HTMT1_0032_C04.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0059_D07.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0106_C05.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0034_A04.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0081_H05.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0108_E05.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0023_B01.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0089_G07.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0021_D02.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0093_F03.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0069_B05.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0068_D06.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0101_D08.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
MLTL1_0057_C10.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0029_B07.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
DCI01_0047_B05.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
MLTL1_0079_G09.b : ATATAATCCCCACATCAGATCTTAAACCTGGAGAAATACGACTACTAGAAGTAGACAATC
BKFL1_0057_D11.b : ATATAATCCCCACATCAGATCTTAAGCCTGGAGAAATACGACTACTAGAAGTAGACAATC
MLTL1_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaACAATC
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
---------+---------+---------+---------+---------+---------+ 479
HTMT1_0032_C04.b : GAGTTGTTCTGCCAATAGAAATAACAATCCGAATATTAGTGTCCTCTGAAGACGTACTAC
DCI01_0059_D07.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0106_C05.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0034_A04.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0081_H05.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0108_E05.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0023_B01.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0089_G07.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0021_D02.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0093_F03.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0069_B05.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0068_D06.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0101_D08.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
MLTL1_0057_C10.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0029_B07.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
DCI01_0047_B05.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
MLTL1_0079_G09.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
BKFL1_0057_D11.b : GAGTTGTTCTACCAATAGAAATAACAATCCGAATATTAGTATCCTCTGAAGACGTACTGC
MLTL1_0094_H09.b : TAGTTGTTCTACCAATAGAAATAACAATCCGAATATTACTATCCTCTGAAGACGTACTGC
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
---------+---------+---------+---------+---------+---------+ 539
HTMT1_0032_C04.b : ACTCATGAGCTGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0059_D07.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0106_C05.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0034_A04.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0081_H05.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0108_E05.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0023_B01.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0089_G07.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0021_D02.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0093_F03.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0069_B05.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0068_D06.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0101_D08.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
MLTL1_0057_C10.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0029_B07.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
DCI01_0047_B05.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
MLTL1_0079_G09.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
BKFL1_0057_D11.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCC*AGGACGACTAAACC
MLTL1_0094_H09.b : ACTCATGAGCCGTCCCATCCCTCGGTTTAAAAACAGATGCTATCCCAGGACGACTAAACC
HTMT1_0087_B06.b : tttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
---------+---------+---------+---------+---------+---------+ 599
HTMT1_0032_C04.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0059_D07.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0106_C05.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0034_A04.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0081_H05.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0108_E05.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0023_B01.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0089_G07.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0021_D02.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAAAAATCTGTG
DCI01_0093_F03.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0069_B05.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0068_D06.b : AAACAACTCTAATATCCACACGACCTGGCCTTTGTTACGGACAGTGCTCAGAAATCTGTG
DCI01_0101_D08.b : AAACAACTCTAATATCCACACGACCTGGCCTTTGTTACGGACAGTGCTCAGAAATCTGTG
MLTL1_0057_C10.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0029_B07.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
DCI01_0047_B05.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
MLTL1_0079_G09.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
BKFL1_0057_D11.b : AAACAACTCTAATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
MLTL1_0094_H09.b : AAACAACTCTAATATCCACACGACCTGGACTTTATTACGGACAGTGCTCAGAAATCTGTG
HTMT1_0087_B06.b : xxxxAACTCTCATATCCACACGACCTGGCCTTTATTACGGACAGTGCTCAGAAATCTGTG
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
---------+---------+---------+---------+---------+---------+ 659
HTMT1_0032_C04.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0059_D07.b : GATCAAACCACAGCTTCGTGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0106_C05.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTNAAGTACTTCGAAA
DCI01_0034_A04.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0081_H05.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0108_E05.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTTAAGTACTTCGAAA
DCI01_0023_B01.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0089_G07.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0021_D02.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0093_F03.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0069_B05.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0068_D06.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAT
DCI01_0101_D08.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTTAAGTACTTCGAAT
MLTL1_0057_C10.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0029_B07.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
DCI01_0047_B05.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
MLTL1_0079_G09.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
BKFL1_0057_D11.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
MLTL1_0094_H09.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
HTMT1_0087_B06.b : GATCAAACCACAGCTTCATGCCCATTGTACTTGAACTTGTCCCATTAAAGTACTTCGAAA
HTMT1_0106_H07.b : nnttacgagagaagacxxxxxxx
HTMT1_0017_C10.b : ttttacgacggtagaggxxxxxx
HTMT1_0129_E11.b : tttttcgacagtagaggxxxxxx
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
---------+---------+---------+---------+---------+---------+ 718
HTMT1_0032_C04.b : AATGGT*CAACATCAATATTAACAGGTTAAAACAAAAAgccccccccccgaaaaaaaaat
DCI01_0059_D07.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
DCI01_0106_C05.b : AATGGNGTCACATCA*TATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTT*A
DCI01_0034_A04.b : AATGGT*CAACATCAATATTAACANGTTCATTGAGATGCTAGTCAGCACTACCTTTTTAA
DCI01_0081_H05.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
DCI01_0108_E05.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTTA
DCI01_0023_B01.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
DCI01_0089_G07.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
DCI01_0021_D02.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
DCI01_0093_F03.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
DCI01_0069_B05.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
DCI01_0068_D06.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAAGCTAGTCAGCACTAACCTTTTAA
DCI01_0101_D08.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAAGCTAGTCAGCACTAACCTTTTAA
MLTL1_0057_C10.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
DCI01_0029_B07.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTTA
DCI01_0047_B05.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAGGCTAGTCAGCACTAACCTTTTAA
MLTL1_0079_G09.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
BKFL1_0057_D11.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGAAGCTAGTCAGCACTAACCTTTTAA
MLTL1_0094_H09.b : AATGGT*CAACATCAATATTAACACGTTCATTGAGACGCTAGTCAGCACTAACCTTTTAA
HTMT1_0087_B06.b : AATGGT*CAACATCAATATTAACAGGTTCATTGAGATGCTAGTCAGCACTAACCTTTTAA
HTMT1_0106_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCAGCATTAACCTT**AA
HTMT1_0017_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCCCCTCTAACCTTTTAA
HTMT1_0129_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCAGCACTAACCTTTTAA
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b : nnnaaggcaggtagaxxxxxxxxxxx
SPLT1_0015_H11.b : nnnnttgcaggtagacxxxxxxxxx
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : ttttccgaggtacgaggccxxxxx
HTMT1_0090_E07.b : ttttccgagagtacgaggccgntax
HTMT1_0060_D07.b : tttccgagagtacgaxxxxxxxxx
HTMT1_0079_H09.b : nttttcgcaggaagaggxxxxxx
HTMT1_0092_G06.b : ttttgggacggtacgaggccxxxxxx
HTMT1_0079_E04.b : ttttccgcaggaagaggccgtaxx
HTMT1_0111_B12.b : nttttcgatggtaagaggxxxxxx
HTMT1_0102_D07.b : nnnnnggagagtacgaxxxxxxxxxx
HTMT1_0114_G09.b : tttttagatggtxxxxxxxxxxxxxx
HTMT1_0026_H08.b : ttttacgacggtagcggccgtxx
HTMT1_0018_A01.b : tttttacgacggtacgaggccxxxxx
HTMT1_0023_C11.b : ttttccgcggtacgaxxxxxxxxx
HTMT1_0041_F04.b : ttttccgacggtacgaggccxxxxx
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : ggagagtacgaxxxxxxxx
HTMT1_0105_F02.b : ttccatgattacgaxxxxxxxx
HTMT1_0067_A01.b : tttttagacgagaagaggxxxxx
HTMT1_0058_C09.b : nnnccgagagtacgaxxxxxxxx
HTMT1_0107_E08.b : nnnnccgagggtacgaxxxxxxxxx
HTMT1_0013_B09.b : ttttccgaggtacgaxxxxxxxx
SPLT1_0062_A04.b : nnnccgcgagtagaggccgnta
HTMT1_0014_G06.b : tttttacgcagtaagaxxxxxxxx
HTMT1_0073_E05.b : ttttccgacggtacgaxxxxxxxxx
HTMT1_0047_G10.b : ttttaggagggtacgaggccxxxx
HTMT1_0102_D10.b : tttttcgagagtacgaxxxxxxxx
HTMT1_0018_E12.b : nnaacgagagtacgaxxxxxxxx
HTMT1_0054_C11.b : tttttccgacggtacgaxxxxxxxxx
SPLT1_0071_A05.b : nncccgcgagtagaggxxxxx
HTMT1_0062_F03.b : tttttccgacgggtacgaxxxxxxxxx
HTMT1_0114_B08.b : nnnnnggacgggtacgaxxxxxxxxx
HTMT1_0061_A11.b : tttttacgacggtxxxxxxxxxxxx
HTMT1_0098_H12.b : ttttccgacggtxxxxxxxxxxx
HTMT1_0132_F06.b : tttttcgacggtacgaggcagnta
HTMT1_0020_D11.b : tttccgcaggtacgaggccxxxx
HTMT1_0062_C06.b : tttcgcaggtacgaxxxxxxxx
HTMT1_0133_H07.b : naaccatttnnttnntggacgggaacgaggxxxxx
HTMT1_0048_G04.b : tttttcgagagtacgaxxxxxxxx
HTMT1_0093_H08.b : ttttaggatggtacgaxxxxxxxx
HTMT1_0107_A03.b : nttccgagagtacgaxxxxxxxx
HTMT1_0034_C09.b : aatttatttagatatcttatattggcaggtaacacagccaax
HTMT1_0100_G08.b : tttggcgagagtacgaxxxxxxx
SPLT1_0063_B03.b : nnncgcgagtacgaggccgnt
ILNT1_0083_G05.b : nnnggcgcgagtagacgccgnt
HTMT1_0125_H09.b : nttttgatgagaa
HTMT1_0140_A09.b : ntttttttttttttttggacggtxxxxxxxxxxxx
HTMT1_0049_B03.b : tttttccgacggtacgaggccxxxx
HTMT1_0081_H04.b : tttttggacggtacgaxxxxxxx
HTMT1_0143_D02.b : tttttccgacggtagacxxxxxxx
HTMT1_0091_C02.b : nnnncgacggtacgaggccxxx
HTMT1_0137_D09.b : ttttttacgacggtxxxxxxxxxxx
HTMT1_0063_D10.b : nnccgatggtacgaxxxxxxx
HTMT1_0130_A01.b : ttttccgacggtacgaxxxxxxxx
HTMT1_0088_A10.b : ttttacgacggtacgaxxxxxxx
HTMT1_0131_D04.b : nnccgagagtacgaggccxxx
HTMT1_0045_C09.b : tttagagagtacgaggccxxx
HTMT1_0034_F03.b : gaaggtacgaxxxxxxx
HTMT1_0029_D02.b : ttttccgacggtacgaxxxxxxx
HTMT1_0143_C10.b : ttttttccgcagtxxxxxxxxxxxxx
HTMT1_0006_H08.b :
HTMT1_0070_C01.b : ttttncg
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG*TTATGCCACAACTAGATACATCT
---------+---------+---------+---------+---------+---------+ 776
HTMT1_0032_C04.b : aaaaaaaatcccccctcaattcaaagggggaaaaacccaangggtttgggccgggcccgc
DCI01_0059_D07.b : GTNAGAGATCGGGAG*CCCTAATCTCCCCCTCATGG**TATGCCACACCTAGATACATCC
DCI01_0106_C05.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTC*ATGG**TATGCCACAACTAGATACATCC
DCI01_0034_A04.b : G*TAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCCACACTAGATACATCC
DCI01_0081_H05.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
DCI01_0108_E05.b : GTTAGAGATCGGGAGCCCCTAATCTCCCCTC*ATGG**TATGCCACAACTAGATACATCC
DCI01_0023_B01.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
DCI01_0089_G07.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
DCI01_0021_D02.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTTCATGG**TATGCCACAACTAGATACATCC
DCI01_0093_F03.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
DCI01_0069_B05.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCCTCATGG**TATGCCACAACTAGATACATCC
DCI01_0068_D06.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
DCI01_0101_D08.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTTCATGG**TATGCCCACACTAGATACATCC
MLTL1_0057_C10.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCCTCATGG**TATGCCANCACTAGATACATCC
DCI01_0029_B07.b : AGTAGAGATCGGGAG*CCTAAATCTCCCCTTCATGG**TATGCCACAACTAGATACATCC
DCI01_0047_B05.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
MLTL1_0079_G09.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
BKFL1_0057_D11.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
MLTL1_0094_H09.b : GTTAGAGATCAGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCC
HTMT1_0087_B06.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCT
HTMT1_0106_H07.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCT
HTMT1_0017_C10.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCT
HTMT1_0129_E11.b : GTTAGAGATCGGGAG*CCTAAATCTCCCCTCAATGG**TATGCCACAACTAGATACATCT
HTMT1_0003_B03.b : nnnggatatctaaggatTTAATGAATTATGCC*CAACTAGATACATCT
HTMT1_0008_D06.b : nnggcatatctataggaTTAATGAATTATGCCACAACTAGATACATCT
HTMT1_0005_B12.b : nnnccgcatactaaggatttaatgaaT**TATGCCACAACTAGATACATCT
HTMT1_0010_A12.b : ccctaactaaggatttaatgA*TTATGCC*CAACTAGATACATCT
SPLT1_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
SPLT1_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0005_A01.b : nncccattcatacaagggtatttaatgATTTTGCCCAACTAGATACATCT
HTMT1_0008_B08.b : ngggataccatgggattaatgaATTTTGCCCAACTAGATACATCT
HTMT1_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0060_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACACCTAGATACATCT
HTMT1_0079_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAATTAGATACATCT
HTMT1_0092_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0079_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0111_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0102_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0114_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0026_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACCACTAGATACATCT
HTMT1_0018_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0023_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0041_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0005_G02.b : nnnccactaacatataggattaatgaattTATGCCACAACTAGATACATCT
HTMT1_0036_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACATTTAGATACATCT
HTMT1_0105_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0058_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0107_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0013_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
SPLT1_0062_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0014_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0073_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0047_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0102_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0018_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0054_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
SPLT1_0071_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0062_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0114_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0061_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0098_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0132_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACACCTATATACATCT
HTMT1_0020_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0062_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0133_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0048_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0093_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0107_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACCCTTAGATACATCT
HTMT1_0100_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
SPLT1_0063_B03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
ILNT1_0083_G05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0125_H09.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgATGCCACAACTAGATACATCT
HTMT1_0140_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0049_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0081_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0143_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0091_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0137_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0063_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0130_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0088_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0131_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACCATTTACATCT
HTMT1_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0034_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0143_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0006_H08.b : ntcaggatatcataaggattaatgaattaAACTAGATACATCT
HTMT1_0070_C01.b : acggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCT
ILNT1_0009_G02.b : nnnnncgcgagtagaxxxxxxxxxxxxxx
HTMT1_0072_A06.b : taaagcaagaagaggccgtattattaaxxxxxxxxxxxxx
BFLT1_0124_E05.b : nnnccgtcagcgnacgxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
---------+---------+---------+---------+---------+---------+ 836
HTMT1_0032_C04.b : gggtttccccttgggggggccttatgggcccccaagttaaaaacacttgtttaagttaga
DCI01_0059_D07.b :
DCI01_0106_C05.b : ACATGATTCATTACAATTACATNCATAATTATAACATTNATTATTTTAT*CCAACT*AAA
DCI01_0034_A04.b : ACATGATTCATTACAATTACATNCATAATTATAACATTATTTATTTTATTCCAACTAAAA
DCI01_0081_H05.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
DCI01_0108_E05.b : ACATGATTCATTTACATTACATCAATAATTATAACATTATTTAATTTTATCCNACTAAAA
DCI01_0023_B01.b : ACATGATTCATTACANTTACATCAATAATTATAACATTATTTATTTTTATCCAACTTAAA
DCI01_0089_G07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
DCI01_0021_D02.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTAT*CCAACTAAAA
DCI01_0093_F03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
DCI01_0069_B05.b : ACATGATTCNATTACATTACATCAATAATTATAACATTATTTATTTTATTCCTACTAAAA
DCI01_0068_D06.b : ACATGATTCATTANCATTACATCAATAATTATAACATTATTTATTTTATTCCCACT*AAA
DCI01_0101_D08.b : ACATGATTCATTACNATTACATNCAATATTATAACATTATTTATTTTATTCCAACTA*AA
MLTL1_0057_C10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
DCI01_0029_B07.b : ACATGATTCATTACAATTACATCAATAATTATA*CATTATTTATTTTATTCC*ACTAAAA
DCI01_0047_B05.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
MLTL1_0079_G09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
BKFL1_0057_D11.b : ACATGATTCAT*ACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
MLTL1_0094_H09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAACA
HTMT1_0087_B06.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0106_H07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0017_C10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0129_E11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0003_B03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0008_D06.b : ACATGATTCATTACAATTCCtttaataattataacattatttattttattCCAACTAAAA
HTMT1_0005_B12.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0010_A12.b : ACATGATTCATTACAATTACATCACTTATTATAACATTATTTATTTTATTCCAACTAAAA
SPLT1_0026_D03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
SPLT1_0015_H11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0005_A01.b : ACATGATTCATTACAATC*CCTTTAGGGTTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0008_B08.b : ACATGATTCATTACAATTCCTTCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0026_D03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0090_E07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0060_D07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0079_H09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0092_G06.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0079_E04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0111_B12.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0102_D07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0114_G09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0026_H08.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0018_A01.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0023_C11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0041_F04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0005_G02.b : ACATGATTCATTACAATCACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0036_D01.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0105_F02.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0067_A01.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0058_C09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0107_E08.b : ACATGATTCATTACAATTACATCAATAACTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0013_B09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
SPLT1_0062_A04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0014_G06.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0073_E05.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0047_G10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0102_D10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0018_E12.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0054_C11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
SPLT1_0071_A05.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0062_F03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0114_B08.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0061_A11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0098_H12.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0132_F06.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0020_D11.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0062_C06.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0133_H07.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0048_G04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0093_H08.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0107_A03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0034_C09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0100_G08.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
SPLT1_0063_B03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
ILNT1_0083_G05.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0125_H09.b : ATATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0140_A09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0049_B03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0081_H04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0143_D02.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0091_C02.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0137_D09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0063_D10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0130_A01.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0088_A10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0131_D04.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0045_C09.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0034_F03.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0029_D02.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0143_C10.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0006_H08.b : ACATGATTCATTACAATTACATCACCTTTTATAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0070_C01.b : ACATGATTCATTACAATTACATCAATAATTATAACATTATTTATTTTATTCCAACTAAAA
ILNT1_0009_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0072_A06.b : xxxxxxxxxxxxxxxxxtttactccctataagggacattatnATTTAATTCCAACTAAAA
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTTATTCCAACTAAAA
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b : nnccgataatt
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
---------+---------+---------+---------+---------+---------+ 894
HTMT1_0032_C04.b : caaacccccctttcaacgtttggaaaaaagggcctttttttaaaaattcgggggggtttt
DCI01_0059_D07.b :
DCI01_0106_C05.b : ATCTCNAACTACTCATACCCAGCAAGCCC*AGAATCATTTGActcaaactcaaaaactag
DCI01_0034_A04.b : ATCTCAAACTACTCATACCCAGCAAGCCCCAGAATCATTTGACTTCAAACTCAAAAACtt
DCI01_0081_H05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTTGACTCAAAACTCAAAA**C
DCI01_0108_E05.b : ATCTCAAACTACTCATACCCAGGCAGCCC*AGAATCA*TTGAACTCAAAACTCAAAACAT
DCI01_0023_B01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCATTGAACTCAAAACTCAAAAA**C
DCI01_0089_G07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAAATCATTGAACTCAAAACTCAAAAA*C
DCI01_0021_D02.b : ATCTCAAACTACTCATACCCAGCAAGCCCCAGATTCAATTGAACTCAAAACTTCAAAACC
DCI01_0093_F03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAAATCATTGAACTCAAAACTCNAAAA*C
DCI01_0069_B05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAA**C
DCI01_0068_D06.b : ATCTCNAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAAACTCAAACTCAAAAACA
DCI01_0101_D08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAAA*C
MLTL1_0057_C10.b : ATCTNCAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAAA*C
DCI01_0029_B07.b : ATCTCAAACTACTCATACCCACAAGCCC**AGAATCAATTGAACTCAAAACTCAAAAACT
DCI01_0047_B05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAAA*C
MLTL1_0079_G09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAAA*C
BKFL1_0057_D11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAATTGAACTCAAAACTCAAAAA*C
MLTL1_0094_H09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*ACAATCAATTGAACTCAAAACTCACAAA*C
HTMT1_0087_B06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0106_H07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0017_C10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0129_E11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0003_B03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0008_D06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0005_B12.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0010_A12.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
SPLT1_0026_D03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
SPLT1_0015_H11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0005_A01.b : CTCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0008_B08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0026_D03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0090_E07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0060_D07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0079_H09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0092_G06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0079_E04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0111_B12.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0102_D07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0114_G09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0026_H08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0018_A01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0023_C11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0041_F04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0005_G02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0036_D01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0105_F02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0067_A01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0058_C09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0107_E08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0013_B09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
SPLT1_0062_A04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0014_G06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0073_E05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0047_G10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0102_D10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0018_E12.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0054_C11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
SPLT1_0071_A05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0062_F03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0114_B08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0061_A11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0098_H12.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0132_F06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0020_D11.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0062_C06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0133_H07.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0048_G04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0093_H08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0107_A03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0034_C09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0100_G08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
SPLT1_0063_B03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
ILNT1_0083_G05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0125_H09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0140_A09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0049_B03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0081_H04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0143_D02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0091_C02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0137_D09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0063_D10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0130_A01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0088_A10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0131_D04.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0045_C09.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0034_F03.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0029_D02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0143_C10.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0006_H08.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0070_C01.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
ILNT1_0009_G02.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
HTMT1_0072_A06.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
BFLT1_0124_E05.b : ATCTCAAACTACTCATACCCAGCAAGCCC*AGAATCAACCGAACTCAAAACTCAAAAA*C
CBLT1_0098_E04.b : tttcgcgagacgaggxxxxxxxxxxxxxxxxxx
HTMT1_0133_G03.b : nnccatatttnntnnnnggacgagtagacgccantagtatttatac
HTMT1_0059_B04.b : ttttacga
HTMT1_0065_F09.b : tt
SPLT1_0038_B10.b : nnaaaataatttttnn
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b : taagggatatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
---------+---------+---------+---------+---------+---------+ 954
HTMT1_0032_C04.b : ctttatttgggaaaaattaaccccccaaaaaaggttaaagaacaaatccctctttttttt
DCI01_0059_D07.b :
DCI01_0106_C05.b : cacccttgagaataaaatgacgaaatctatttgctcttttatgccccacgatatagacta
DCI01_0034_A04.b : gccacccctgagaaataaaatgaacgaaatctatttgcttctttaattgccccccgaaaa
DCI01_0081_H05.b : ATAGCACCCCCTGAGAA*ATAAATGAACGAAAtccatttgcctctttnatgccccccacg
DCI01_0108_E05.b : AA***CACCCCTGAGAA*ATAAATGAACGAAAtctattgccccttttatgccccacgatn
DCI01_0023_B01.b : ATAGCACCCCTCGAGAAAATAAATGAACCGAAATCTTTTGGCCTCTTTattgccccacca
DCI01_0089_G07.b : ATAGCACCCCTTGAGAA*ATAAATGAACGAAAATCTATTTGCCTCTTTTATgcccccacg
DCI01_0021_D02.b : TAACCACCCCCTGAAGAATAAAATGAACGAAAATCCATTTGCCTCCTTTTATGCCCCCAC
DCI01_0093_F03.b : ATAGCACCCCTTGAGAAATAAAATGA*CGAAAATCTATTTGCCTCTTTTATCGCCCCCAC
DCI01_0069_B05.b : ATAGCACCCCTTGAGAAAATAAATGAACGAAAATCTATTTGCCTCTTTTTATGCCCCCAC
DCI01_0068_D06.b : TAGCACCCCTTTGAGAATAAAAATGAACGAAAATCTATTTGCCCTCTTTATTGCCCCCAC
DCI01_0101_D08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCCTCTTTTATGCCCCCAC
MLTL1_0057_C10.b : ATACCACCCCCTGAGAA*ATAAATGAACGAAAATCTATTTGCCTCTTTTATTGCCCCCAC
DCI01_0029_B07.b : TACACCCCttgaaaaataaaagaccaaaatccattgccccctttattgccccccaaaaaa
DCI01_0047_B05.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTTATTGCCCCCAC
MLTL1_0079_G09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTTATTGCCCCCAC
BKFL1_0057_D11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTTATTGCCCCCAC
MLTL1_0094_H09.b : ATACCGCCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTTATTGCCCCCAC
HTMT1_0087_B06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0106_H07.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0017_C10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0129_E11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0003_B03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0008_D06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0005_B12.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0010_A12.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
SPLT1_0026_D03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
SPLT1_0015_H11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0005_A01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0008_B08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0026_D03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0090_E07.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0060_D07.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0079_H09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0092_G06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0079_E04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0111_B12.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0102_D07.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0114_G09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0026_H08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0018_A01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0023_C11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0041_F04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0005_G02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0036_D01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0105_F02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0067_A01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0058_C09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0107_E08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0013_B09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
SPLT1_0062_A04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0014_G06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0073_E05.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0047_G10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0102_D10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0018_E12.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0054_C11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
SPLT1_0071_A05.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0062_F03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0114_B08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0061_A11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0098_H12.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0132_F06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0020_D11.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0062_C06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0133_H07.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0048_G04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0093_H08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0107_A03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0034_C09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0100_G08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
SPLT1_0063_B03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
ILNT1_0083_G05.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0125_H09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0140_A09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0049_B03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0081_H04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0143_D02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0091_C02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0137_D09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0063_D10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0130_A01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0088_A10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0131_D04.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0045_C09.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0034_F03.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0029_D02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0143_C10.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0006_H08.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0070_C01.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
ILNT1_0009_G02.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0072_A06.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
BFLT1_0124_E05.b : ATAGCACCCCTTGAGAAATAAAATGAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
CBLT1_0098_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxAACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0133_G03.b : gactcctatagggaatttaatgaattACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0059_B04.b : cggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCCTAC
HTMT1_0065_F09.b : ttccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
SPLT1_0038_B10.b : nnnagctagtagacgcantaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
CLNT1_0030_H07.b : ntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : nnnnaacgagagtxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b : ttttggagagtacg
HTMT1_0134_A12.b : tttttcgctattac
MLTL1_0049_C06.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
---------+---------+---------+---------+---------+---------+ 1014
HTMT1_0032_C04.b : tttctcggtccgggggaagggagaaagttttttacccaaaagaaaaaccaacaccgggga
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctatgtcaccctatataaatccaagctactatccnacaccaacgatcataataccgccat
DCI01_0034_A04.b : tagactactaatgccacctaaatataaattcccaagttactttcccaaacccaacgaatc
DCI01_0081_H05.b : atatagactacctattgtcacctnnaatatatattccnagcttactattccaacaccaaa
DCI01_0108_E05.b : atagactactatgtcaccntattataaatcccaactactatcccacaccaacgactcata
DCI01_0023_B01.b : aaataagactacctattgtccccttaattataaaatcccaagcttacaattcccaacaac
DCI01_0089_G07.b : atataggactacctatgtcaccnttaatatatattcccnnagctactatccnacaccnaa
DCI01_0021_D02.b : GAaataagactaaccaattgtcacctaattataaatttccaaagctaatattcccaaccc
DCI01_0093_F03.b : GATAtangactaccctatgtcaccttaatnnatatatcccaagctactatttccaacacc
DCI01_0069_B05.b : GATA*TAGGACTACCTATTGTC*ACCTAAnnntatatatcccnagctactattccnacac
DCI01_0068_D06.b : GATAATAGGACTACCCTATGTC*ACCTAAATATTATATCCC*AAGCTTACTATT*CCCAA
DCI01_0101_D08.b : GATAATAGGACTACCTATTGTC*ACCTTATTATTATATTCC*CAGCTTACTATT*CCCAC
MLTL1_0057_C10.b : AATAATAGGACTACTTATTGTCCACTTAATTATAATATTCC*CAGCTTACTATT*CCCAA
DCI01_0029_B07.b : aggataccatggccccctaatttataattcccagcttaatatttccaaccccaaagaact
DCI01_0047_B05.b : GATAATAGGGCTACCTATTGTCACCTTAAATTATATATTCC*AAGCTTACTATT*CCCAC
MLTL1_0079_G09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCC*CAGCTTACTATT*TCCAC
BKFL1_0057_D11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTNCCCAC
MLTL1_0094_H09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0087_B06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0106_H07.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0017_C10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0129_E11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0003_B03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0008_D06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0005_B12.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0010_A12.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0026_D03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0015_H11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0005_A01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0008_B08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0026_D03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0090_E07.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0060_D07.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0079_H09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0092_G06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0079_E04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0111_B12.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0102_D07.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0114_G09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0026_H08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0018_A01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0023_C11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0041_F04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0005_G02.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0036_D01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0105_F02.b : TATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0067_A01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0058_C09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0107_E08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0013_B09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0062_A04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0014_G06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0073_E05.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0047_G10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0102_D10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0018_E12.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0054_C11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0071_A05.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0062_F03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0114_B08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0061_A11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0098_H12.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0132_F06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0020_D11.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0062_C06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0133_H07.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0048_G04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0093_H08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0107_A03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0034_C09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0100_G08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0063_B03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
ILNT1_0083_G05.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0125_H09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0140_A09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0049_B03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0081_H04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0143_D02.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0091_C02.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0137_D09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0063_D10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0130_A01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0088_A10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0131_D04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0045_C09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0034_F03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0029_D02.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0143_C10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0006_H08.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0070_C01.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
ILNT1_0009_G02.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0072_A06.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
BFLT1_0124_E05.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
CBLT1_0098_E04.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0133_G03.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0059_B04.b : GATCATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0065_F09.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
SPLT1_0038_B10.b : GATAATAGGACTACCTATTGTCACCTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
CLNT1_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTAATTATTATATTCCCAAGCTTACTATTCCCAAC
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTAATTATTATATTCCCAAGCTTACTATTCCCAAC
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCCCAAGCTTACTATTCCCAAC
HTMT1_0101_B11.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaTATTCCCCCC
HTMT1_0134_A12.b : gacgcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcttactaccctatc
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b : nnnnccgacggtacgaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_G08.b : ttttccgacagtacgaxxxxxxxxxxxxxxxxxxx
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : atatgtatax
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
---------+---------+---------+---------+---------+---------+ 1074
HTMT1_0032_C04.b : gagggggtttcgcattggaccctttttcctccccgcataaaacccgggccctgggtttgt
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctcatcacatgatatccactacatccacataatactatccacaaaaggcaactgaccaaa
DCI01_0034_A04.b : attaaaacccccaatccccttccacatggttactcaactaactccaacaaaaaagctttc
DCI01_0081_H05.b : cgactcatttataccgcacatctcgatccacaatgattattcaactaacatcaaacaaat
DCI01_0108_E05.b : taaccgccatcccatccacatgatatccactacatccacaatatagcattccnacaaaag
DCI01_0023_B01.b : caaacgctcctttaaaaccgcacaatccgatccaacatgataattcacctaactccaaac
DCI01_0089_G07.b : cgactcattataaccgcaaatctcgatccaacatgattatcccactacatcaacaaatat
DCI01_0021_D02.b : ccaacaatcctttaataaccccacaatcccattccacatgattaactccactaccttcaa
DCI01_0093_F03.b : caacgactcattataaccgcacatctcgatccaacatgattaatccactaacatcaaaca
DCI01_0069_B05.b : cnaacgactcattaataccgcacatctcgatccanncatgatnatccnactacatccaac
DCI01_0068_D06.b : CACCaacgactcataataaccgcacatctcgatcaacatgattatccactaacatcaaac
DCI01_0101_D08.b : ACCCAAcgactcataataaccgcacatctcgatcccacatgatttatcaactaacatcaa
MLTL1_0057_C10.b : CACCaaacgactcattattaccgccaaatctcatccacaatgattatcaactaactccaa
DCI01_0029_B07.b : tttaataaccgcaattcccttccacagggtaatccccctaaccccaaccaaaaaaccctt
DCI01_0047_B05.b : ACCCAAACGACTCATTAATACCCGCAC*ATCTCGATCCACA*ATGATTAATCCNACTAca
MLTL1_0079_G09.b : ACCCA*ACGACTCATTAATAccgcacatctcgatccacatgattaatccnactacatcca
BKFL1_0057_D11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCNNACATGATTAATCCCCACTAC
MLTL1_0094_H09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0087_B06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0106_H07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0017_C10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0129_E11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0003_B03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0008_D06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0005_B12.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0010_A12.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0026_D03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0015_H11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0005_A01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0008_B08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0026_D03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0090_E07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0060_D07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0079_H09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0092_G06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0079_E04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0111_B12.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0102_D07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0114_G09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0026_H08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0018_A01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0023_C11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0041_F04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0005_G02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0036_D01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0105_F02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0067_A01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0058_C09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0107_E08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0013_B09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0062_A04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0014_G06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0073_E05.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0047_G10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0102_D10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0018_E12.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0054_C11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0071_A05.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0062_F03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0114_B08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0061_A11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0098_H12.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0132_F06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0020_D11.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0062_C06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0133_H07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0048_G04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0093_H08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0107_A03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0034_C09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0100_G08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0063_B03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
ILNT1_0083_G05.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0125_H09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0140_A09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0049_B03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0081_H04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0143_D02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0091_C02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0137_D09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0063_D10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0130_A01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0088_A10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0131_D04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0045_C09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0034_F03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0029_D02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0143_C10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0006_H08.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0070_C01.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
ILNT1_0009_G02.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0072_A06.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
BFLT1_0124_E05.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
CBLT1_0098_E04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0133_G03.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0059_B04.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0065_F09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
SPLT1_0038_B10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
CLNT1_0030_H07.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0124_H09.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
AMP01_0036_E10.b : ACCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0101_B11.b : TTCCAAACGACTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0134_A12.b : aggCAAACGACTCATTAATAACCGCACAATCTCGATCCATTTATGATTAATCCAACTAAC
MLTL1_0049_C06.b : xxxxxxxxxxCTCATTAATAACCGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
ILNT1_0063_C04.b : xxxxxxxxxxxxxxxxxxxxxxxGCACAATCTCGATCCAACAATGATTAATCCAACTAAC
HTMT1_0092_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATCTCGATCCAACAATGATTAATCCAACTAAC
ILNT1_0001_D01.b : ttagaaagtacacgccanxxxxxxxxxxxxxxx
HTMT1_0147_G03.b : ttttttggcaagtacgaxxxxxxxxxxxxxxxxxx
HTMT1_0020_C08.b : tttttcgacggtacgaxxx
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : tatttaggatatcaaxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b :
MLTL1_0041_H03.b : nccgttcatnnnncctcgatactaaxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
---------+---------+---------+---------+---------+---------+ 1134
HTMT1_0032_C04.b : gagggggggactaatcctcccccaaagaaaatttttttttcccactcgggagacccaaaa
DCI01_0059_D07.b :
DCI01_0106_C05.b : actaatcctataatctcgctcacaaatctagctataccctcttcaccccaaaattaataa
DCI01_0034_A04.b : caacccaaagccaacccgaacccaaactaaatcccattattcatcggtcaaaaatctagg
DCI01_0081_H05.b : atagctattcccaccaaaagggcaaacctgatccaaaaactaatcccaaataattcatcg
DCI01_0108_E05.b : gcaactgatccaaacttaacctaataatctcgctcaaaattctagctatacacctcttcc
DCI01_0023_B01.b : aaaaaagactttcccaccaaaaggccaacccgatccccaaacttaatcccaattaatcca
DCI01_0089_G07.b : agctatcacaccnaaaggcaaactgatcacaatactaatctctataaatcatcgctcaac
DCI01_0021_D02.b : acaaaaaatacttttccaaaccaaagaggcaaaccggatcccaaaacttaaaccccaaat
DCI01_0093_F03.b : atatagctatcccaccaaaaaggcaacctgatcctaaacttaatcccaattaatcatcgg
DCI01_0069_B05.b : aaatatagctatcccaacaaaagggcaanctgatcccatacttaatcccaattaatcatc
DCI01_0068_D06.b : aatatagctatccacacaaaaaggcaaactgatcctatacttaatccccataaatcatcg
DCI01_0101_D08.b : ncaaatatagctattcccaccaaaaaggcaaaccgatacacaaacttaaccccaaataaa
MLTL1_0057_C10.b : ccaataaacctatctcaccaaaaggccaaccgaccacaaacttaatcccaattaatcatg
DCI01_0029_B07.b : tcaacccaaaggccaccgggaccaaaactaattccaaataaatccggggccaaaaatcct
DCI01_0047_B05.b : tccaaacaataatagctattcacaccnaaaggccaaactgatcactaatactatatctct
MLTL1_0079_G09.b : aacnataatagctattcacacaaaagggccaactgatcactatactatatctctaatata
BKFL1_0057_D11.b : ATCCAAACAAATAATAGCTATTCACACCCAAAAAGGC*AAACCTGATCACTNNATACTAT
MLTL1_0094_H09.b : ATCTCAACGAATAATAGCTATTCACAACCGATGAGGCCAAACCTGATCACTGATACTTAT
HTMT1_0087_B06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0106_H07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0017_C10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0129_E11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0003_B03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0008_D06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0005_B12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0010_A12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0026_D03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0015_H11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0005_A01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0008_B08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0026_D03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0090_E07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0060_D07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0079_H09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0092_G06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0079_E04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0111_B12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0102_D07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0114_G09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0026_H08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0018_A01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0023_C11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0041_F04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0005_G02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0036_D01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0105_F02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0067_A01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0058_C09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0107_E08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0013_B09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0062_A04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0014_G06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0073_E05.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0047_G10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0102_D10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0018_E12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0054_C11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0071_A05.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0062_F03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0114_B08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0061_A11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0098_H12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0132_F06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0020_D11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0062_C06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0133_H07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0048_G04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0093_H08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0107_A03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0034_C09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0100_G08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0063_B03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
ILNT1_0083_G05.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0125_H09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0140_A09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0049_B03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0081_H04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0143_D02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0091_C02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0137_D09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0063_D10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0130_A01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0088_A10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0131_D04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0045_C09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0034_F03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0029_D02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0143_C10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0006_H08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0070_C01.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
ILNT1_0009_G02.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0072_A06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
BFLT1_0124_E05.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
CBLT1_0098_E04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0133_G03.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0059_B04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0065_F09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
SPLT1_0038_B10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
CLNT1_0030_H07.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0124_H09.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
AMP01_0036_E10.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0101_B11.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0134_A12.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
MLTL1_0049_C06.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
ILNT1_0063_C04.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0092_G08.b : ATCCAAACAAATAATAGCTATTCACAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
ILNT1_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxAACCAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0147_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0020_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGATCACTAATACTTAT
HTMT1_0088_E04.b : tttttccgacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0101_E12.b : nttac
HTMT1_0086_G07.b : ttttacgatagtacgaxxxxxxxxxxxxxxxxx
HTMT1_0086_F06.b : tttttacgacagtxxxxxxxxxxxxxxxxxxx
HTMT1_0085_F07.b : tttttcgacggtacgaxxxxxxxxx
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0078_D05.b : tttttncgagagtacgaxx
CLNT1_0012_B10.b : nnnnccgttagcgnacgxxxxxxx
HTMT1_0061_F04.b : tttttn
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b :
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
---------+---------+---------+---------+---------+---------+ 1194
HTMT1_0032_C04.b : aaaaaaagaaaaaggccttaaacgcaaaaaaaagcggggttgggttttttttcgccccct
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctggtagcatcccagatccacgatcggatcccttaacaaatctgcccttccagaaccgca
DCI01_0034_A04.b : ctataccattctttaacccccaaaattataaaactggtaagcaccccctgatcgaacctt
DCI01_0081_H05.b : ctcaaaaaattctagcctatacccattctttcacccccacaactttaaaaaactgggtag
DCI01_0108_E05.b : ccccacaatttaaaactgtatacatccctgatccacgcatcggatccttaacaaaatcta
DCI01_0023_B01.b : cgggctaaaaaatcctagccttatccaatttttcaccccccaaaaaattaaaaacgggtt
DCI01_0089_G07.b : acaatctagctatacacatcattcaaccacacacatttaatacctggntagcaacccttt
DCI01_0021_D02.b : taattcccggggcaaaaaaattcttaggcctataccaacttttttccccccccaacaaaa
DCI01_0093_F03.b : ctcacaaaatcctagctatacaactccttccacccccacaatataaaaactgggaaacat
DCI01_0069_B05.b : gctcaacaaatctaggctactacccctcattcactccccacaatataataaccgggataa
DCI01_0068_D06.b : ctcacaaaatctaggctataccactcttccaccccccaaaatatataactggatacaatc
DCI01_0101_D08.b : ttcacgctcacaaaatctagggctatacaaattctttccccccccacaaattttaaaaac
MLTL1_0057_C10.b : gctcaaaaattctaggctaaacccattattcacccccaaaatttaaaaccgggaaacacc
DCI01_0029_B07.b : agggcttataacaatttttcaccccccacaaatataaaaacggggaaaaaacccttttat
DCI01_0047_B05.b : aatatatcatcggctcacaaacatcctaggctactacaaactcatcaaacccacaaacac
MLTL1_0079_G09.b : tcatcggctcacaaaatcctagctactacaactcatcacaccacacacacttcataaact
BKFL1_0057_D11.b : ATCTCTAATTATATTCATCGGCTCAcaacatccctagcctactacacactcattcacacc
MLTL1_0094_H09.b : ATCTCTAATTATATTCATANCGCTCACAANNCATCTAGGACTACTACTACACTCATTC*C
HTMT1_0087_B06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0106_H07.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0017_C10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0129_E11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0003_B03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0008_D06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0005_B12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0010_A12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0026_D03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0015_H11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0005_A01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0008_B08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0026_D03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0090_E07.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0060_D07.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0079_H09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0092_G06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0079_E04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0111_B12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0102_D07.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0114_G09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0026_H08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0018_A01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0023_C11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0041_F04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0005_G02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0036_D01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0105_F02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0067_A01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0058_C09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0107_E08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0013_B09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0062_A04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0014_G06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0073_E05.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0047_G10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0102_D10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0018_E12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0054_C11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0071_A05.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0062_F03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0114_B08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0061_A11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0098_H12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0132_F06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0020_D11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0062_C06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0133_H07.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0048_G04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0093_H08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0107_A03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0034_C09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0100_G08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0063_B03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
ILNT1_0083_G05.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0125_H09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0140_A09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0049_B03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0081_H04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0143_D02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0091_C02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0137_D09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0063_D10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0130_A01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0088_A10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0131_D04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0045_C09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0034_F03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0029_D02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0143_C10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0006_H08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0070_C01.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
ILNT1_0009_G02.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0072_A06.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
BFLT1_0124_E05.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
CBLT1_0098_E04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0133_G03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0059_B04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0065_F09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
SPLT1_0038_B10.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
CLNT1_0030_H07.b : ATCTCTAATTATATTCATCGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0124_H09.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
AMP01_0036_E10.b : ATCTCTAATTATATTCATCGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0101_B11.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0134_A12.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
MLTL1_0049_C06.b : ATCTCTAATTATATTCATCGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
ILNT1_0063_C04.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0092_G08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
ILNT1_0001_D01.b : ATCTCTAATTATATTCATCGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0147_G03.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0020_C08.b : ATCTCTAATTATATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0088_E04.b : xxxxxxxxxxxTATTCATTGGCTCAACAAACATCCTAGGCCTACTACCACACTCATTCAC
TES01_0101_E12.b : tacgttggctatggttcatcggctcACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0086_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCTACGCCTACTACCACACTCATTCAC
HTMT1_0085_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTACTACCACACTCATTCAC
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTACTACCACACTCATTCAC
HTMT1_0078_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCACACTCATTCAC
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCACACTCATTCAC
HTMT1_0061_F04.b : cgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
ILNT1_0064_G01.b : nccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : tttccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnggcgataannnnatgagatacttggg
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
---------+---------+---------+---------+---------+---------+ 1254
HTMT1_0032_C04.b : caacaaacaaacaccaaaaagattgttctccgggaataaaaagggtccccgaggcttggt
DCI01_0059_D07.b :
DCI01_0106_C05.b : tattcgcctatgagatacttttcgaccccgaaagccaataggccttattttgggcctccc
DCI01_0034_A04.b : ttccgatctcctaaaccaaatccttccttttcacaggaaacccccatattctggccgaat
DCI01_0081_H05.b : aatcccctgaacgcacgattcccggattccctataaccaaatccttgccttttccacaga
DCI01_0108_E05.b : cccttctcaggaaccccatatctggccatattaaatacttttccggccgcgaaggcacat
DCI01_0023_B01.b : aacaaccccttgattcaaccctatccagattcccttaaaaaaaatctctccctttttccc
DCI01_0089_G07.b : gacaccaccaatcaggatccgttaaaccaaatcctgccattcaccaagaaacccccctaa
DCI01_0021_D02.b : taaaaaaccggggtaaaaactccctagaatcaaccgttttccggattcctttaaacaaaa
DCI01_0093_F03.b : cccctagaatacacgtatccggatcctttaaacaaattctagcccttctcaaagaaccgc
DCI01_0069_B05.b : catccctttataccaccgttccggaatccgttaaacaaaatctagccctttttacaagga
DCI01_0068_D06.b : ccttgaaccaccgattccggattccttaaaccaatctacccttttacaggacccccctat
DCI01_0101_D08.b : cgggtataaatccccataaagcaacgttttcaggatccgtataaaaaaaatctagcctct
MLTL1_0057_C10.b : cctattacaaccgtttcggtttccttaaacaaattctcccttttccagggaaccccctta
DCI01_0029_B07.b : accaaccttttccgggtcccctaaaacaaaaattttacccctttcttcaaggaacccccc
DCI01_0047_B05.b : tataataaactgggtatagcatcccctagatcagcaccgtatcccaggattcgctaaaac
MLTL1_0079_G09.b : ggtatgcatcccctagatcacacgtatcacggattcgcttaaacaaaatcctagcccctt
BKFL1_0057_D11.b : acccaccaactatcataaaactgggtaaagcaatcccctatgatcagcacccgtatccca
MLTL1_0094_H09.b : ACCCACCACACGACTATCAATAAACCTGGGTATAGCAATCacctatgatcagncaccgta
HTMT1_0087_B06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0106_H07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0017_C10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0129_E11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0003_B03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0008_D06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0005_B12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0010_A12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0026_D03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0015_H11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0005_A01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0008_B08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0026_D03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0090_E07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0060_D07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0079_H09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0092_G06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0079_E04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0111_B12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0102_D07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0114_G09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0026_H08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0018_A01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0023_C11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0041_F04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0005_G02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0036_D01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0105_F02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0067_A01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0058_C09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0107_E08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0013_B09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0062_A04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0014_G06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0073_E05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0047_G10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0102_D10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0018_E12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0054_C11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0071_A05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0062_F03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0114_B08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0061_A11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0098_H12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0132_F06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0020_D11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0062_C06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0133_H07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0048_G04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0093_H08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0107_A03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0034_C09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0100_G08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0063_B03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
ILNT1_0083_G05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0125_H09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0140_A09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0049_B03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0081_H04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0143_D02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0091_C02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0137_D09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0063_D10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0130_A01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0088_A10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0131_D04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0045_C09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0034_F03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0029_D02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0143_C10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0006_H08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0070_C01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
ILNT1_0009_G02.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0072_A06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
BFLT1_0124_E05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
CBLT1_0098_E04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0133_G03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0059_B04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0065_F09.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
SPLT1_0038_B10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
CLNT1_0030_H07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0124_H09.b : ACCCACCACACAACTATCAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
AMP01_0036_E10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0101_B11.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0134_A12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
MLTL1_0049_C06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
ILNT1_0063_C04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0092_G08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
ILNT1_0001_D01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0147_G03.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0020_C08.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0088_E04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
TES01_0101_E12.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0086_G07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0086_F06.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0085_F07.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
AMP01_0002_H05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0078_D05.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
CLNT1_0012_B10.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0061_F04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
ILNT1_0064_G01.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
AMP01_0024_G04.b : ACCCACCACACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0019_D05.b : xxxxxxxxxACAACTATCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxCAATAAACCTGGGTATAGCAATCCCCCTATGATCAGCAACCGT
HTMT1_0144_H09.b : nnnttggggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0094_C08.b : tttttgggacggtacgaggxxxxxxxxxxxxxxxxxx
HTMT1_0068_B02.b : ttttttcgacggtacgaxxxxxxxxxxxxxxxx
HTMT1_0150_H01.b : nttccgcaggaagaxxxxxxxxxxxxxxxx
SPLT1_0028_F04.b : nnnnacgacggtagaggxxxxxxxxxxx
HTMT1_0023_E04.b : ttttacgcaggtagaxxxxxxxxxxxx
CBLT1_0009_B06.b : nttttacgacggtagaggxxxxx
AMP01_0032_H03.b : ctgctcccgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
---------+---------+---------+---------+---------+---------+ 1314
HTMT1_0032_C04.b : ctttcaaagatcaaaattcttattagaagagctataaacaataatattgtgtttcggggt
DCI01_0059_D07.b :
DCI01_0106_C05.b : caccaaatttttccttattgtggggcaggggggcaccaaaaaaaaaacccccttccnnnn
DCI01_0034_A04.b : tgaaataccctttttccgaagcccccgcaaaacaaataaagggccttatttttgggggct
DCI01_0081_H05.b : acccccttaatccaaccccaattgacaaagcctttttaccggccccgcccaagagacaaa
DCI01_0108_E05.b : tagggctatttttggggctacccaacaagtttttatcctattttggcgactgggcgaacc
DCI01_0023_B01.b : agaaacccccccatattcctggcgaaattagaatttccctttttacagagccccgcgaaa
DCI01_0089_G07.b : tctggccgaatggaacaaccattttccgagcctcgcgaagaccaattggggcccttttca
DCI01_0021_D02.b : atttataccctttttaaaaggaacacccccatatatcccggcgaaattaaaaataccctt
DCI01_0093_F03.b : ccataatctggccgaattgaaataacattttaacaagcctgccaaaggacacattaaggc
DCI01_0069_B05.b : ccccccatattccgggcctatttgaaaattactatttaacagaccccccgaaggaaccat
DCI01_0068_D06.b : tctggcctatttgaaattacttttaaccgcccgccaaagaacaatagggcccatttttat
DCI01_0101_D08.b : ttaccaggaaccccctaattcaggccgaattgaaataccctttttccaagcccgcgagag
MLTL1_0057_C10.b : ttctgccgtatatgaattccttttaaccacccccccaaagagaacttaggggcttttttt
DCI01_0029_B07.b : aatttcctggcctatttaaaaaatcctttttttccgggccccccaaaaaagaacaataaa
DCI01_0047_B05.b : caaaaatcctagccactttcacccaaggaaaccgcctataaatcctgccgcaatatggaa
MLTL1_0079_G09.b : taccaaggacccgcccataatctaggccaattttaaattagcttttttccggaacctccg
BKFL1_0057_D11.b : ggatccgctttaaaccaaaacatcctaacccctttccaccacaagaaacccggccaataa
MLTL1_0094_H09.b : tcacaggattcgctatagagcaaacatactagcccacttctacacagggacaccagccta
HTMT1_0087_B06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0106_H07.b : ATTCACAGGATTCCGCCATAAAACCAAA
HTMT1_0017_C10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0129_E11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0003_B03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0008_D06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0005_B12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0010_A12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0026_D03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0015_H11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0005_A01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0008_B08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0026_D03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0090_E07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0060_D07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0079_H09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0092_G06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0079_E04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0111_B12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0102_D07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0114_G09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0026_H08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0018_A01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0023_C11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0041_F04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0005_G02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0036_D01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0105_F02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0067_A01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0058_C09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0107_E08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0013_B09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0062_A04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0014_G06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0073_E05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0047_G10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0102_D10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0018_E12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0054_C11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0071_A05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0062_F03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0114_B08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0061_A11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0098_H12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0132_F06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0020_D11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0062_C06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0133_H07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0048_G04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0093_H08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0107_A03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0034_C09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0100_G08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0063_B03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
ILNT1_0083_G05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0125_H09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0140_A09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0049_B03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0081_H04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0143_D02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0091_C02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0137_D09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0063_D10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0130_A01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0088_A10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0131_D04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0045_C09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0034_F03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0029_D02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0143_C10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0006_H08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0070_C01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
ILNT1_0009_G02.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0072_A06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
BFLT1_0124_E05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
CBLT1_0098_E04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0133_G03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0059_B04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0065_F09.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0038_B10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
CLNT1_0030_H07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0124_H09.b : aaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0101_B11.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0134_A12.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
MLTL1_0049_C06.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
ILNT1_0063_C04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0092_G08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
ILNT1_0001_D01.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0147_G03.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0020_C08.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0088_E04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
TES01_0101_E12.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0086_G07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0086_F06.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0085_F07.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
AMP01_0002_H05.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0078_D05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
CLNT1_0012_B10.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0061_F04.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
ILNT1_0064_G01.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
AMP01_0024_G04.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0019_D05.b : ATTCACAGGATTCCGCCATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
MLTL1_0041_H03.b : ATTCACAGGATTCCGCTATAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0144_H09.b : xxxxxxxxxxxxxxxxxxaAAAACCAAAACATCACTAGCCCACTTTCTACCACAAGGAAC
CBLT1_0094_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0150_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0028_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0023_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTAGCCCACTTTCTACCACAAGGAAC
CBLT1_0009_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACTTTCTACCACATGGAAC
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b : nnnng
HTMT1_0013_E09.b : tttttggcagagtagacgxxxxxxxxxxxxxxxxx
HTMT1_0063_A11.b : t
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
---------+---------+---------+---------+---------+---------+ 1373
HTMT1_0032_C04.b : gcaccctccccctctctttttnnnnnnntccgcgccaanangnnntattggaaaaatccc
DCI01_0059_D07.b :
DCI01_0106_C05.b : tntttttnggtcccggggcccactcagaaaaacnnnnnnnnnna
DCI01_0034_A04.b : tatttcacacaaaagttttaattcctctaatgttgggccgccaggttgcgggaacccaca
DCI01_0081_H05.b : tagggggccttt
DCI01_0108_E05.b : accaaaaaaatcccttttttttttgatttt
DCI01_0023_B01.b : gagacatttaggggttttatttcttggggcgcgttaccacaaaaagaattttattccccc
DCI01_0089_G07.b : ttggggccttc
DCI01_0021_D02.b : ttttacgggccccgccgagaagaaacaatttggggccttattatt
DCI01_0093_F03.b : ccttattcttggggggcctaccccccacaaaagtttaattccctttaatttgtgggcccc
DCI01_0069_B05.b : ttagggcctttttttttgggggcaccctccaacaaaattttttttctcttcttttttt
DCI01_0068_D06.b : gggggctacacccaccaaatttttttcccctatatgtgtaggccccgggtggtagattct
DCI01_0101_D08.b : agaacaaaaggggccatttttatttggggcttaccccaccataaatt
MLTL1_0057_C10.b : tggggggcgttcccaaaaaaaggtttttttccctctaatttttgccccccctgtgccggc
DCI01_0029_B07.b : gggggccttttttttttgggggcttattccccccccacaaatttttttttaccccctcaa
DCI01_0047_B05.b : attacccttttttcaccgaacctggcggggatgggagccatttggagaacctttattctc
MLTL1_0079_G09.b : tagaggacccattagggggcctttttttatggggccttaccccccacaacaaagccttca
BKFL1_0057_D11.b : tcccatgccgcaattttgaaacattagctttttttcacccgaaccctacccgtaaatgaa
MLTL1_0094_H09.b : tattccnatgcccgtattatgaactattaactattattctacataagcctagcgtagaag
HTMT1_0087_B06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0106_H07.b :
HTMT1_0017_C10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0129_E11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0003_B03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0008_D06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0005_B12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0010_A12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0026_D03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0015_H11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTATTTTATTCAAC
HTMT1_0005_A01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0008_B08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0026_D03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0090_E07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0060_D07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0079_H09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0092_G06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0079_E04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0111_B12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0102_D07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0114_G09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0026_H08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0018_A01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0023_C11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0041_F04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0005_G02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0036_D01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0105_F02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0067_A01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0058_C09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0107_E08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0013_B09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0062_A04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0014_G06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0073_E05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0047_G10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0102_D10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0018_E12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0054_C11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0071_A05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0062_F03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0114_B08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0061_A11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0098_H12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0132_F06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0020_D11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0062_C06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0133_H07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0048_G04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0093_H08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0107_A03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0034_C09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0100_G08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0063_B03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
ILNT1_0083_G05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0125_H09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0140_A09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0049_B03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0081_H04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0143_D02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0091_C02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0137_D09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0063_D10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0130_A01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0088_A10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0131_D04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0045_C09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0034_F03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTACTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0029_D02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0143_C10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0006_H08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0070_C01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
ILNT1_0009_G02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0072_A06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
BFLT1_0124_E05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
CBLT1_0098_E04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0133_G03.b : aaaaaaaaaaaaaaaaaaaaaa
HTMT1_0059_B04.b : ACCCCGCCCAT*AATTCCTATGCTCGTAATTATTG*AACTATTAGCCTA*TTTANTTCAC
HTMT1_0065_F09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0038_B10.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
CLNT1_0030_H07.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0101_B11.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0134_A12.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
MLTL1_0049_C06.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
ILNT1_0063_C04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0092_G08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
ILNT1_0001_D01.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0147_G03.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0020_C08.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0088_E04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
TES01_0101_E12.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0086_G07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0086_F06.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0085_F07.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
AMP01_0002_H05.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0078_D05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
CLNT1_0012_B10.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0061_F04.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
ILNT1_0064_G01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
AMP01_0024_G04.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0019_D05.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
MLTL1_0041_H03.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0144_H09.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
CBLT1_0094_C08.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0068_B02.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0150_H01.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
SPLT1_0028_F04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0023_E04.b : ACCCGCCCCATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
CBLT1_0009_B06.b : ACCCGCCCTATTAATTCCTATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxATGCTCGTAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0002_F08.b : atatctaaggatttaagaatTGCTCGTA*TTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0013_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxaAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0063_A11.b : ttttacgatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0006_D11.b : nnnnggctagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0058_F02.b : ttgggatggtacgaxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b : nnnncgacggtagaggcagtagtaxxxxxxxxxxx
HTMT1_0090_D04.b : tttgggacggtacgaggccg
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
---------+---------+---------+---------+---------+---------+ 1433
HTMT1_0032_C04.b : caagaaagctaacaccaata
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b : aaaaaaaagccccccacatttggcgaggaattt
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b : taaatgtgtgggccgggcggttgt
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b : cgcgggt
DCI01_0069_B05.b :
DCI01_0068_D06.b : caacaaaaa
DCI01_0101_D08.b :
MLTL1_0057_C10.b : tccccaaaaaaaaaaaaaaaaaagccntnnnnngcgnnnnggtggtcccggggagacacc
DCI01_0029_B07.b : ttttttgaccccccctgtgtttggggttccccccaaaaaaaaaaaaaagagccgcccctt
DCI01_0047_B05.b : attggggcccattaccccccaccaccaaaccgtttacattaccccctctaaaatttaatt
MLTL1_0079_G09.b : ttacccccttaaattaattgacccacccctttttccggcttcccccacccnaaaaaaaaa
BKFL1_0057_D11.b : accaatttttcgggggccctttttttctttttgtgggggccttagcccttcacccaaccc
MLTL1_0094_H09.b : aagccaccttacgcgggcccttttattcttcattgggggccctttgccaacaaacaaact
HTMT1_0087_B06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0106_H07.b :
HTMT1_0017_C10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0129_E11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0003_B03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0008_D06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0005_B12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0010_A12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0026_D03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTTATTCATC
SPLT1_0015_H11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0005_A01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0008_B08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0026_D03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0090_E07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0060_D07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0079_H09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0092_G06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0079_E04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0111_B12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0102_D07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0114_G09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0026_H08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0018_A01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0023_C11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0041_F04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0005_G02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0036_D01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0105_F02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0067_A01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0058_C09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0107_E08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0013_B09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0062_A04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0014_G06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0073_E05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0047_G10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0102_D10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0018_E12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0054_C11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0071_A05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0062_F03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0114_B08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0061_A11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0098_H12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0132_F06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0020_D11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0062_C06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0133_H07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0048_G04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0093_H08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0107_A03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0034_C09.b : CAGTAGCCCTAGCCGTACGACTGAAGGCCAAAATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0100_G08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0063_B03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0083_G05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0125_H09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0140_A09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0049_B03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0081_H04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0143_D02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0091_C02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0137_D09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0063_D10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0130_A01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0088_A10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0131_D04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0045_C09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0034_F03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0029_D02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0143_C10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0006_H08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0070_C01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0009_G02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0072_A06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
BFLT1_0124_E05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CBLT1_0098_E04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0133_G03.b :
HTMT1_0059_B04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCNACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0065_F09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0038_B10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CLNT1_0030_H07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0101_B11.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0134_A12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
MLTL1_0049_C06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0063_C04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0092_G08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0001_D01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0147_G03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0020_C08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0088_E04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
TES01_0101_E12.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0086_G07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0086_F06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0085_F07.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATT
AMP01_0002_H05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0078_D05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CLNT1_0012_B10.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0061_F04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0064_G01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
AMP01_0024_G04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0019_D05.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
MLTL1_0041_H03.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0144_H09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CBLT1_0094_C08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0068_B02.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0150_H01.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
SPLT1_0028_F04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0023_E04.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CBLT1_0009_B06.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
AMP01_0032_H03.b : CAGTAGTCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0002_F08.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0013_E09.b : CAGTAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
HTMT1_0063_A11.b : xxacAGCCCTAGCCGTACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
ILNT1_0006_D11.b : xxxxxxxxxxxxxxxxACGACTGACAGCCAACATTACAGCAGGGCACCTATTAATTCATC
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGCCAACATTACAGCAGGGCACCTATTAATTCATC
CBLT1_0051_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCAGGGCACCTATTAATTCATC
HTMT1_0090_D04.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCTATTAATTCATC
HTMT1_0128_F02.b : tttggatagtacgaggxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b : tttccgctggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0072_E03.b : nngga
HTMT1_0144_F05.b : ntttcgtttntnnn
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
20110601C-000489 : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
---------+---------+---------+---------+---------+---------+ 1493
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b : accaaccnnnnnnnnnnnnnnnnn
DCI01_0029_B07.b : tttt
DCI01_0047_B05.b : aaaccccacacttggttcccaaatat
MLTL1_0079_G09.b : aattttaaaaaaaagccccccatatttggcgaggtttttttgttaannnnnnntttttnn
BKFL1_0057_D11.b : aaaacctttccctttcaccccttcttaaaattaaattgaaacccgccacccttggttccg
MLTL1_0094_H09.b : aaaattttccatttcaacccctcttaaaattggatgggaaaccgacaacttaggttcccc
HTMT1_0087_B06.b : TAATTGGAG*GGCCACATTAGCACTACTCAACATCAGCACTAATACAGCTTTTATCACAT
HTMT1_0106_H07.b :
HTMT1_0017_C10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0129_E11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0003_B03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0008_D06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0005_B12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0010_A12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0026_D03.b : TAATTGGAGGGGGCACAT*AGCACTACTCAACATCAGCACTANTACAGCTTTTATCACAT
SPLT1_0015_H11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0005_A01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0008_B08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0026_D03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0090_E07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0060_D07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0079_H09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0092_G06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0079_E04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0111_B12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0102_D07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0114_G09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0026_H08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0018_A01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0023_C11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0041_F04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0005_G02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0036_D01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0105_F02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0067_A01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0058_C09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0107_E08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0013_B09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0062_A04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0014_G06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0073_E05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0047_G10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0102_D10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0018_E12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0054_C11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0071_A05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0062_F03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0114_B08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0061_A11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0098_H12.b : TAATTGGAGGGGGCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0132_F06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0020_D11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0062_C06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0133_H07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0048_G04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0093_H08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0107_A03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0034_C09.b : TAATTGGAGGGGGCACATTAGCACTACTCAACATCCGCACTATAACAGCTTTTtatcaca
HTMT1_0100_G08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0063_B03.b : TAATTGGAGGGGGCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
ILNT1_0083_G05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0125_H09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0140_A09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0049_B03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0081_H04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0143_D02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0091_C02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0137_D09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0063_D10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0130_A01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0088_A10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0131_D04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0045_C09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0034_F03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0029_D02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0143_C10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0006_H08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0070_C01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
ILNT1_0009_G02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0072_A06.b : TAATTGGAGGGGCCACATTAGCACTTCTCAACATCAGCACTATAACAGCTTTTATCACAT
BFLT1_0124_E05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
CBLT1_0098_E04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0133_G03.b :
HTMT1_0059_B04.b : TAATTGGAGGGGCCACATTAGCACTACTNCACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0065_F09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0038_B10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
CLNT1_0030_H07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0101_B11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0134_A12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
MLTL1_0049_C06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
ILNT1_0063_C04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0092_G08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
ILNT1_0001_D01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0147_G03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0020_C08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0088_E04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
TES01_0101_E12.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0086_G07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0086_F06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0085_F07.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
AMP01_0002_H05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0078_D05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
CLNT1_0012_B10.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0061_F04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
ILNT1_0064_G01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
AMP01_0024_G04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0019_D05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
MLTL1_0041_H03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0144_H09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
CBLT1_0094_C08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0068_B02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0150_H01.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
SPLT1_0028_F04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0023_E04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
CBLT1_0009_B06.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
AMP01_0032_H03.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0002_F08.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0013_E09.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0063_A11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
ILNT1_0006_D11.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
BMWN1_0058_F02.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
CBLT1_0051_G05.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAACACTATAACAGCTTTTATCACAT
HTMT1_0090_D04.b : TAATTGGAGGGGCCACATTAGCACTACTCAACATCAGCACTATAACAGCTTTTATCACAT
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxTACTCAACCCCTTTACTATAACAGCTTTTATCACAT
HTMT1_0071_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCAACATCAGCACTATAACAGCTTTTATCACAT
CBLT1_0072_E03.b : caatgagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACAT
HTMT1_0144_F05.b : nggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAT
HTMT1_0001_B04.b : nnaagatatctatggattaatgaattttttatcCAT
SPLT1_0059_H10.b : nnnccgcgattagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0082_A07.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b : nnaagg
CBLT1_0084_H08.b : ntaacgacaagtagaggcagtagtaxxxxxxxxxxxx
CLNT1_0092_E02.b : ggaaacgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : nn
BMWN1_0027_E03.b :
20110601C-000489 : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
---------+---------+---------+---------+---------+---------+ 1552
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0057_D11.b : cgggtttttccccaatattggcaacatttgttttaacagcgagaaggggcccccttaagg
MLTL1_0094_H09.b : cggggcttcctccccaacccaaaaaaaaaaaaaaattgcccgccccaaattaaattttgc
HTMT1_0087_B06.b : TTACTATCCTCATCCAATTAACTATTCT**GAAATTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0106_H07.b :
HTMT1_0017_C10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0129_E11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0003_B03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0008_D06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0005_B12.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0010_A12.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SPLT1_0026_D03.b : TTACAATCCTCATCCTATTAACTATTCTT*GAATTGGCAGTAGCTCTGATTCCAGCTTAA
SPLT1_0015_H11.b : TTACAATCCCCCATCTAATAACTATTCCT*GAATTTGCAGTAGCTCTGATCAAAGCCTAA
HTMT1_0005_A01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0008_B08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0026_D03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0090_E07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0060_D07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0079_H09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0092_G06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCCAGCTTAT
HTMT1_0079_E04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0111_B12.b : TTACTATCCTCATCCTATTAACTATTCNT*GAATTTGCAGTAGCTCTGATCCNNAGCTAT
HTMT1_0102_D07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0114_G09.b : TTACTATCCTCATCCTATTAACTANTTCT*GAATTNGCAGTAGCTCTGATCCNAGCTNAT
HTMT1_0026_H08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0018_A01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAAGCTAT
HTMT1_0023_C11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0041_F04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0005_G02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0036_D01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0105_F02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTACCTCTGATCCAAGCTTAT
HTMT1_0067_A01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0058_C09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0107_E08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCA*GCTTAT
HTMT1_0013_B09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCCAGCTTAT
SPLT1_0062_A04.b : TTACTATCCTCATCCCTATAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0014_G06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0073_E05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0047_G10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0102_D10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0018_E12.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0054_C11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SPLT1_0071_A05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0062_F03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0114_B08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0061_A11.b : TTACTATCCTCATCCTATTAACTATTNCT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0098_H12.b : TTACTATCCTCATCCCTATAAACTATCNT*GAATTNGCAGTAGCTCTGATCCNAGCTTAT
HTMT1_0132_F06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0020_D11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0062_C06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0133_H07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0048_G04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0093_H08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0107_A03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0034_C09.b : tttccaatcctcatcccaataaataattcttgaatttgcaaaaactcctgatccaaactt
HTMT1_0100_G08.b : TTACTATCCTCATCCTATAAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAA
SPLT1_0063_B03.b : TTACTATCCTCATCCTATTAACTNNATCT*GAATTNGCAGTAGCTCTGATCCCAAGCTAT
ILNT1_0083_G05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0125_H09.b : TTACTATCCTCATCCTATTAACTATTCTTTGAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0140_A09.b : TTACTATCCTCATCCTATTAACTATTNCT*GAATTTGCAGTAGCTCTGATCCNAAGCTAT
HTMT1_0049_B03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0081_H04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0143_D02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0091_C02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0137_D09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0063_D10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0130_A01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0088_A10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0131_D04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAANTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0045_C09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0034_F03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0029_D02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0143_C10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0006_H08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0070_C01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
ILNT1_0009_G02.b : TTACTATCCTCATCCTATTAACTATTNCT*GAAATTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0072_A06.b : TTACTATCCTCATCCTATTAACTATTCTT*GCATTAGCAATAGCTCTGATCACAGCTTAT
BFLT1_0124_E05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0098_E04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0133_G03.b :
HTMT1_0059_B04.b : TTACTATCCTCATCCTATTAACTANTTCT*GAANTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0065_F09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SPLT1_0038_B10.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CLNT1_0030_H07.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0101_B11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0134_A12.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
MLTL1_0049_C06.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
ILNT1_0063_C04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0092_G08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
ILNT1_0001_D01.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0147_G03.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0020_C08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0088_E04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
TES01_0101_E12.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0086_G07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0086_F06.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0085_F07.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
AMP01_0002_H05.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0078_D05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CLNT1_0012_B10.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0061_F04.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
ILNT1_0064_G01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
AMP01_0024_G04.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0019_D05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
MLTL1_0041_H03.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0144_H09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0094_C08.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0068_B02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0150_H01.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SPLT1_0028_F04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0023_E04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0009_B06.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
AMP01_0032_H03.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0002_F08.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0013_E09.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0063_A11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
ILNT1_0006_D11.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
BMWN1_0058_F02.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0051_G05.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0090_D04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0128_F02.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0071_C05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0072_E03.b : TTACTATCCTCATTCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0144_F05.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0001_B04.b : TTACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SPLT1_0059_H10.b : xxACTATCCTCATCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
OVRM1_0082_A07.b : xxxxxxxxxxxxTCCTATTAACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
HTMT1_0003_F03.b : atactatggattaatgAATTACTATTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxATTCTT*GAATCTGTTATAGCTCTGATCCAAGCTTAT
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTT*GAATTTGCAGTAGCTCTGATCCAAGCTTAT
SKNB1_0031_E11.b : nccggttnnnnnnnnccaacgttgnccantgggatttCAGTAGCTCTGATCCA*GCTTAT
BMWN1_0027_E03.b : ttttggagcagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000489 : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 1610
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b : gggaattctttctttcctgtt
MLTL1_0094_H09.b : cgccagaaaaggattttcaaatttattgtttctaaaccgcgcgaaaaaaaaaggtttaaa
HTMT1_0087_B06.b : GGGGTTACACTGCTAGTAgcctttatactaccgacaatacata
HTMT1_0106_H07.b :
HTMT1_0017_C10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAA
HTMT1_0129_E11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNCGAC*ATACTTAAAAAAAAAAAAAA
HTMT1_0003_B03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
HTMT1_0008_D06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGAAC*ATACCTNNNaaaaaaaaaaaa
HTMT1_0005_B12.b : GTGTaaaaaaaaaaa
HTMT1_0010_A12.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACCATACCTannnnananaananna
SPLT1_0026_D03.b : GTGGTTtaccctgctagtaagccttatcctaccccgaacattcctaaaaaaaaaaa
SPLT1_0015_H11.b : GTGTTTACCCTGgctagtaaacttaaaccctccccgacaatacctaaaaaaaa
HTMT1_0005_A01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAn
HTMT1_0008_B08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAAAAAA
HTMT1_0026_D03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATTctnnnnnnnannaannan
HTMT1_0090_E07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATA
HTMT1_0060_D07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACCCGACA*ATACATAAA
HTMT1_0079_H09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAA
HTMT1_0092_G06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACANCCGACATACATAAAAAAAA
HTMT1_0079_E04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGAAC*ATACATAAAAAAAAAA
HTMT1_0111_B12.b : GTNGTTACACTGCTAGTAAGCTTATA*CCTNCNNCGAC*ATACTTAAAAAAAAAAAA
HTMT1_0102_D07.b : GTGGTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAA
HTMT1_0114_G09.b : GTNGTTACACTGCTAGTAAGCTTATA*CCTACNNCGAC*ATACNTAAAAAAAAAAAAA
HTMT1_0026_H08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNC*GACATACATAAAAAAAAAAAAAAA
HTMT1_0018_A01.b : GTGTTTACACTGCTAGTAAGCTTATACCCTACACGAC**ATACataaaaaaaaaaaaaaa
HTMT1_0023_C11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGA*ACATACATaaaaaaaaaaaaaaa
HTMT1_0041_F04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNC*GACATACATaaaaaaaaaaaaaaa
HTMT1_0005_G02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAA
HTMT1_0036_D01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATccttttnagagaataaaat
HTMT1_0105_F02.b : GTGTTTACACTGCTAGTAAGCTTATT*CCTACCCGACATtcccttatgaaaaaatgattt
HTMT1_0067_A01.b : GTNGTTACACTGCTAGTAAGCTTATA*CCTACNNCGAC*ATACntnnnnnnnnnnnnnnn
HTMT1_0058_C09.b : GTGTTTACACTGGCTGTAAGCTTATA*CCTTCCCGACNATTCTTtntanaaaattttaga
HTMT1_0107_E08.b : GTGTTTACACTGCTAGGTAGCTTATA*CCTACACGACA*ATACATAA
HTMT1_0013_B09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAA
SPLT1_0062_A04.b : GTGTTTACACTGCTAGTAAGCTTATA**CTACACGAAC*ATACATAAAAAA
HTMT1_0014_G06.b : GTGTTTACACTGCTAGTTAGCTTATA*CCTACNCGACA*ATACATAAAAA
HTMT1_0073_E05.b : GTGTTTACACTGCTAGTAAGCTTATACCCTACACGACATACANTAAAAAAAn
HTMT1_0047_G10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAA
HTMT1_0102_D10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAA
HTMT1_0018_E12.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAA
HTMT1_0054_C11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAA
SPLT1_0071_A05.b : GTGGTTACACTGCTAGTAAGCTTATA*CCTACNNC*GACATACATAAAAAAAAAAAAA
HTMT1_0062_F03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGAAC*ATACATAAAAAAAA
HTMT1_0114_B08.b : GTGTTTACACTGCTAGTAAGCTTATACCCTACACGACA**TACATAAAAAAAAA
HTMT1_0061_A11.b : GTGTTNACACTGCTAGTAAGCTTATACCCTACACGAC**ATACATAAAAAAAAAAA
HTMT1_0098_H12.b : GTGTTTACACTGCTAGTAAGCTTATACCTACNNCGACATACNNTAAAAAAAAAAAAAA
HTMT1_0132_F06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACNNTAAAAAAAGAAAAAA
HTMT1_0020_D11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAAAAAAA
HTMT1_0062_C06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACAATTACttaaaaaaaaaaaaaaa
HTMT1_0133_H07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGAAC*ATACATAAAAAAAAAAA
HTMT1_0048_G04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACCCGACAATACNTTaaaaaaaaaaaaaaa
HTMT1_0093_H08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACN*ATACATaaaaaaaaaaaaaaa
HTMT1_0107_A03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACAATTACTTNNaaaaaaaaaaaaa
HTMT1_0034_C09.b : ttgtggtttaaccgggtatgaaactttttaccccccccagaaattcttttttgaaaaaat
HTMT1_0100_G08.b : GTGTTTACACTGCTAGTAGGCTTATA*CCTTCNCGACAtttccttnnnataaanaataaa
SPLT1_0063_B03.b : GTGTTTACACTGCTAGTAAGCTTAAT*ACTACACGACA*ATACATA
ILNT1_0083_G05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGAAC*ATACATAAA
HTMT1_0125_H09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGGAC*ATACTTAAAAAAAAAAAAn
HTMT1_0140_A09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNCGAC*ATncntnnnnnnnnnnnnnnn
HTMT1_0049_B03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAA
HTMT1_0081_H04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAA
HTMT1_0143_D02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACN*ATACATAAAAAAAAAAAA
HTMT1_0091_C02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAAAAAA
HTMT1_0137_D09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNCGAC*ATACATAAAAAAAAAAAA
HTMT1_0063_D10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNC*GACATACATAAAAAAAAAAAAAAA
HTMT1_0130_A01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNNCGACATACATAAAAAAAAAAAAAAA
HTMT1_0088_A10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNNNCGACATACATaaaaaaaaaaaaaaa
HTMT1_0131_D04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACttaaaataaaaaaaata
HTMT1_0045_C09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACAATTCttttataaaaaaaaaaaa
HTMT1_0034_F03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACATTCCNTaanannnaaananana
HTMT1_0029_D02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACAATACCTNNNNNNaaaaaaaaaa
HTMT1_0143_C10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACCATCCNTNNNanaannaaanaaa
HTMT1_0006_H08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATannannaaaaaaaaa
HTMT1_0070_C01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAAAA
ILNT1_0009_G02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAA
HTMT1_0072_A06.b : GTGTTTACCCTGCCAGTAAGCCTtaaccctaccccgacattacttaaaacaaatctacaa
BFLT1_0124_E05.b : GTGTTTACACTGCTAGTTAGCTTATA*CCTACNCGACA*ATACATAAAAAAAAAAAAAAA
CBLT1_0098_E04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACataaaaaaaaaaaaaaa
HTMT1_0133_G03.b :
HTMT1_0059_B04.b : GTGTTNACACTGCTAGTAAGCTTATA*CCTACNNC*GACATACATAAAAAAAAAAAAAAA
HTMT1_0065_F09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAA
SPLT1_0038_B10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAA
CLNT1_0030_H07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACNTaanaaaaaaaaaaaa
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACNCGACA*ATACATaaaanaaagaaaaaa
HTMT1_0101_B11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACNTaaaaaaaaaaaaaaa
HTMT1_0134_A12.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACTTAAtataattataaat
MLTL1_0049_C06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATannanananaaaaaa
ILNT1_0063_C04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAA
HTMT1_0092_G08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAA
ILNT1_0001_D01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
HTMT1_0147_G03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
HTMT1_0020_C08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAn
HTMT1_0088_E04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAA
TES01_0101_E12.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACNTaaaaaaaaaaaaaaa
HTMT1_0086_G07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAA
HTMT1_0086_F06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAA
HTMT1_0085_F07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAA
AMP01_0002_H05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaananaaaaaaaaaa
HTMT1_0078_D05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
CLNT1_0012_B10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaat
HTMT1_0061_F04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAA
ILNT1_0064_G01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAA
AMP01_0024_G04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACNaaaaaaaaaaaaaaaa
HTMT1_0019_D05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
MLTL1_0041_H03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACNGTaaaaaaaaaaaaaa
HTMT1_0144_H09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAA
CBLT1_0094_C08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAA
HTMT1_0068_B02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
HTMT1_0150_H01.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
SPLT1_0028_F04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAA
HTMT1_0023_E04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAA
CBLT1_0009_B06.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAA
AMP01_0032_H03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATCaaaaaaaaaaaaaa
HTMT1_0002_F08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAA
HTMT1_0013_E09.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
HTMT1_0063_A11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAA
ILNT1_0006_D11.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAA
BMWN1_0058_F02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
CBLT1_0051_G05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAA
HTMT1_0090_D04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAA
HTMT1_0128_F02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
HTMT1_0071_C05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAA
CBLT1_0072_E03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
HTMT1_0144_F05.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAA
HTMT1_0001_B04.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
SPLT1_0059_H10.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAA
OVRM1_0082_A07.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaanaaaaaaaaaaaa
HTMT1_0003_F03.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACataaaaaaaaaaaaaaa
CBLT1_0084_H08.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
CLNT1_0092_E02.b : GTGTTTACACTGCTAGTAAGCTTATA*CCTACACGACA*ATACATAAAAAAAAAAAAAAA
SKNB1_0031_E11.b : GTGTTTAC*CTGCTAGTAAGCTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
BMWN1_0027_E03.b : xxxxxxxxxxxxxxxxxxxxxTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
20110601C-000489 : AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 1670
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b : cattcccccctttttnnnnnnnnnnccgtgggttaaaataattatattgtatnnnnnnnn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b : AAA
HTMT1_0008_D06.b : aaaaaaaaaaaaaaaaaaanattacccnagccnnnaatctccttttaaaaaaataaatgg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aaaaaaaanaannnanaaannnnnnannaaaaannnnnnaaaaannnnnngggtcccggg
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : taanattaataaaaaaaaaaattaaaatattttataaaatataaaaaaaaaananntngt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b : AA
HTMT1_0018_A01.b : aaaa
HTMT1_0023_C11.b : aaaaaaaaa
HTMT1_0041_F04.b : aaaaaaaaaaaanannaannnnaaaanaanaaaaaaaaaaaaaanaaaggacccgggccg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : aaaaaaagatgaaaaataacaataaatcgttactgagacgtactttataatctgcatgtt
HTMT1_0105_F02.b : agtctaaacaataagattaaaaagaatataaagaataataattataaatacttttgttgg
HTMT1_0067_A01.b : nnnnnnnnnnnnnnnnaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C09.b : taatatatggacccacaaaccaaaaaaatttttttactttttgttatataaaaaaaaata
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b : AAn
HTMT1_0020_D11.b : AAAn
HTMT1_0062_C06.b : ataaatattttattataattactattccctgattcccgtntagtgggggctcccctggag
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : aaaaaaacannnaaaannttnnaaaaaaanaaaaanaaaaaaaaaannnggggtccgggg
HTMT1_0093_H08.b : aaaaaaaaa
HTMT1_0107_A03.b : aaaaaaanaaaaaaaaaaaaaaaaaaaaaaaaaanaanaggggtcccggggcgcggattc
HTMT1_0034_C09.b : aataataaagctattaaataatattggaccgcgggccccggaatatccctttttgggggg
HTMT1_0100_G08.b : aataaaatttaaaaaaaatagaaaaaaatatataaaatataatataattataaaaatant
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtccggcggcgcggatctcctttgtgagg
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b : AA
HTMT1_0130_A01.b : A
HTMT1_0088_A10.b : aaaaaaa
HTMT1_0131_D04.b : ataaataaatttatattattnttaatttttttnnnntttttctatgccggcgggcccctt
HTMT1_0045_C09.b : atagaaataaaatataataaaaatagtaccggggccgcggaacttccttttgggggggta
HTMT1_0034_F03.b : antaaaaaaaanaaaaaaaaaataaaataaatagnnttttttntttttttttattttaat
HTMT1_0029_D02.b : aaaaaaaaaaaanaaaaaaaaaaaannnnnannnnnnnannnanannnannnnnananaa
HTMT1_0143_C10.b : canaaaaanaaanaaaaaaaaaaaaaaaaatgggtccgcggccggggtatcccctttggt
HTMT1_0006_H08.b : aaaaaaaaaaaaaaanaaagaaannnnntaaaaanaaaaaaataanaaaaaaaaaaangg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : atgtatcatacacacacatattatgaccaactataatatttagctcagaaaactcggctc
BFLT1_0124_E05.b : Axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b : aaaan
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : aaaaaaaaaaaaaaaccccannaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : aaaaaaaaaaaaaannnnnnccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaannggttcc
HTMT1_0134_A12.b : acagaccaaaacaatatcaaactttgccattatataataaatctcacatcttctattatg
MLTL1_0049_C06.b : aaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagttxxxxxxx
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : aaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : aaaaaannnnnnnnnggcccaanaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxx
HTMT1_0078_D05.b : AA
CLNT1_0012_B10.b : aaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : aaaaaaaaaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxx
MLTL1_0041_H03.b : aaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b : AA
HTMT1_0150_H01.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : aaaaaaaaaaaaaaancgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b : AA
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : aaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b : AAA
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : aaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b : aaaa
CBLT1_0084_H08.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxx
CLNT1_0092_E02.b : AAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : aaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b : aaaaaa
20110601C-000489 : AAAAANNGGCCCCGGGCCCCCGATTCCCCTTTGGGGGGGGGTTTTTGGACCCCAAAAAAA
---------+---------+---------+---------+---------+---------+ 1730
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gcccgggcccggaatcccctttgggggggttattgggcccacacgaaaaaaaatttgatg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : ccccggaattcctttttgggggggttattgggctccaaaagggaaaaaaaactgtgggga
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : ggcccggggcgcccgaatcctcttttgggggggtttttgcgcccccaaaagaaaaaaatc
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ggaatcccctttggggggggtaatgggaccccaacagaaaaaataattggtgggtttgga
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gcgtcctaatcgaccaaacatatattgaaaatttggcgtgcttccgcgccttaattcctt
HTMT1_0105_F02.b : tgccggggccccgcttccccctgggggggggtttttggcccccaacataaaaaataattg
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C09.b : aatatggtgggaccgggggcggggaatcctcttttgggggggtttttgtggaccaaaaat
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : tcgagcggtaatggaaccctttgggaaatagggaaatggagaattgggaagccccacaaa
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gcggggaattcctttttgggggggttattggggcccaaactgaaaaaaaaacttgggggg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccttttgggggggttatttggtcccaactggaaaaaaactttggggggtgggaaaccccc
HTMT1_0034_C09.b : ggtattggtgacccaaatagaaaaaaaaaacatggagaaaattgggagaaaacccaacct
HTMT1_0100_G08.b : atnnntggggccccggggcgcgacttctctttggggggttattggaccccaacaaaaaaa
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : gtnattgaatcaagactgatagatacttgatgatttgaacnaccaaactagatgcgtgaa
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : ttccgcgggtggggggatcctatcgcacaagaaattagaggctgggcgactccacaacac
HTMT1_0045_C09.b : atgggaaccaaaatggaaaaaaacttggggagttggaaaaaccccactagaaggcgggga
HTMT1_0034_F03.b : aatantantttggggagggggggggggaggatctttttttgtggggggggggtgtccccc
HTMT1_0029_D02.b : aaaaannnnnccggacccggcccccacttccccgggggggggttaactggacacaaagaa
HTMT1_0143_C10.b : ggggttaatgggatccaaactggaaagaactttggggggttgggaaaacccaacctagag
HTMT1_0006_H08.b : gcccggggccgcgaatcctctttgggggggtaattggttccaaaagaaaaaaatcttgtg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : acaatccaaaacctttcgaaaatcttaactaaatataagtatgcgcgaggggtccttctc
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnn
HTMT1_0101_B11.b : cgcggccccggaatccccctttggggggggttattgggtcccaaacttaaaaaaaccctt
HTMT1_0134_A12.b : ttgtccccgggcgctaaaattcccatatgtttgggttataatcgatccccaccacataat
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : aaaaaNNGGCCCCGGGCCCCCGATTCCCCTTTGGGGGGGGGTTTTTGGACCCCAAAAAAA
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : AAAAAAACTTGGGGGGGTTGGGGCCACCCCCCCCCGGAGGGGGGGGAAAAAATGGTTTTT
---------+---------+---------+---------+---------+---------+ 1790
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gttttggcaccccccccgggaggcagggaaaaaaggcttctttggaaattggagactttg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : tttggaaaaacccccacttaaagggccggaaaaaataggttttttttggaaaaattggga
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tggtggggtggggaacacccccccaagggggcgagaaaaagtgtttttttggaaattggg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : caacccccccttgagggggggaaaaaaggtttatttggaaattgtgggagctttggtttt
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gtgagggagggttgatcgctacacaaaatttaaaataacttttgtattagtcaccaacac
HTMT1_0105_F02.b : tgtggtgggggacaccccccaattaagggggggaaaaaaagctttttttgtgaaaattgg
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
HTMT1_0058_C09.b : aaaaaaacattgggtgggggggggcacccccccacttgaagtggggaaaaaaaagcgttt
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : aaagggctaaaggagaaaacgtgaaaactaaagatttgtaagacaaccttttaattggaa
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtggggacaccctacccttgaggggggggaaaaaagggttttttgtgaaaatttgggagg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccctgagggggggaaaaatggctttattgggaaattgggggcgcttgcttttttgaaacc
HTMT1_0034_C09.b : ataaagggtgggaaaaaaaatcgtttttttgtggaaaaattgtggaagaaaattgtttat
HTMT1_0100_G08.b : aaacttgggagggtgcgcacccccccaagagggggggaaaaaaggctttttggggaattg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : aaaagccttattggaatttgggaggcttgcttaattgaacctttaagcggcaaaaaagta
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : atgaggggaagaaagacttttgggtaattggaaggggggctttttgttttctttcaagcg
HTMT1_0045_C09.b : aaaaagggtttttttggaaaatttgggaggctttggcttttttgaaccattttaagctgg
HTMT1_0034_F03.b : ccaaacaataaaaaaaatgggggtggggggggacacacccccatggaggagggaaaaaaa
HTMT1_0029_D02.b : aaaaaattgtgtggttgggcacacccccgcgaggggggaaaaaaatttttgtgggaaatg
HTMT1_0143_C10.b : ggagggaaaaaaggctttatgtgaaattgggggctttgctttattgaaccttatagccgc
HTMT1_0006_H08.b : gggtgggaaccaccccacacaagggggaaaaaaaggctttttgtgaaaattgggaagttt
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tttttaaagaaaagtcttcattatcacacatagctatcaaaataaattaggagccgccca
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : gggtgggttgggaaaacccccacctgaatggggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : caatatctcttagtgaactagaaaccaccccatcaataattgtgggaataaaaatcgctt
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : AAAAAAACTTGGGGGGGTTGGGGCCACCCCCCCCCGGAGGGGGGGGAAAAAATGGTTTTT
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : TTTGGAAAATTTGGGGGGCCTTTGTTTTTTTTGGAACCCTTTAAGGGGGGAAAAAAAAAT
---------+---------+---------+---------+---------+---------+ 1850
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : ttttatttaaaccctaaaccgcgaataaaagtaaaaacaacgttgttttttttttttcag
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aggcctttgtttttttttgaaaccttttagacccgaaaaaaaaagttttaaccacccact
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : gaggctttttttttgtaacacataaggcggaaaaaaaattaaacaccattttttcttttt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ttgaaacctttaaagcgggaaaaaaagttaaaaaaccatgtgtttttttttttttttcgg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : cccgagaagaggggaaaaaaagaccttcttttcaccgaatagggggaccagtatctagta
HTMT1_0105_F02.b : acccgctttcttttttttacacctaatggcggcgaaaaatatttaacaaccccccttttt
HTMT1_0067_A01.b : acaatgcttctttagtttcagtcaggagggggggggaggtttttccttaaaaacgcaccc
HTMT1_0058_C09.b : ttttggaaaaatggggatgcttttttttttttccacctttatgccgggaaaaaagattca
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : aaaatatgagttaaaaaaaataatgaaacacctttatagtctcatataacgagaaacacc
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtttgtttttttgaaaccttataaggggcaaaaaaaagtacaccacaacattggtttttt
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : tttagcgccggcaaaaaagttacaaacacttgttttttttttttttggggtggggggggt
HTMT1_0034_C09.b : tattttaacactttaatgggggcgaaaataaagttataacaacacattgggatctcttct
HTMT1_0100_G08.b : ggaggccatgttttttttcacccataagggcgaaaaaaaaaaacaccatttttttttttt
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : acacacaatgtttttttagttcagtcgggaggggggggaggttttccgaaataaccccaa
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : aaaacaaaaaaaaataaatgtatttttttgttttgttcggggggggggggggggtttttt
HTMT1_0045_C09.b : aaaaaaaaattaaaaacacaaatgtgttttctttttgtttcgggtgcggggggggggggg
HTMT1_0034_F03.b : attctttttataaagaaagaggggagagctttttttttataccccaccagaagggccaaa
HTMT1_0029_D02.b : ggggagctttttttttttaaccttaacccccgaaaaaagataacacactttttttttttt
HTMT1_0143_C10.b : agaaaaagttaccaaacattgctttttttttgttcggttcgggggggtgtgggatttatc
HTMT1_0006_H08.b : tttttttttaaacctataacgcgcaaaaaaatttaaacaaaatttcttttttttttttcg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : aaaattcataaaaaaatctggaaccaatcctcttttaaatgaaataaacgaccattcata
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxggaataaaaaaatcgggggtttcccccggaaacc
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : taacatagaaaaatttgaaaacttctgtcctttatttataaactcctaaatccgcccata
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : nnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : TTTGGAAAATTTGGGGGGCCTTTGTTTTTTTTGGAACCCTTTAAGGGGGGAAAAAAAAAT
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : TTAAACACCACAATTTTTTTTTTTTTTTTTTTCCGGGTCGGGGGGGGGGGGGGAAATTTT
---------+---------+---------+---------+---------+---------+ 1910
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : ggaggggaggggtgggggtttttttttaaagaacccccaccccggaaaggggtttttatg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : tttctttcttttttttttccaggttccgggggaaggggtgggaaagtttttttcgcaaaa
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tttttgcggcgggggagggggggggtttttttaaaaaaacacacccccagggagagggtg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ggcgggggaggtggggaggtttttctcaaataaaaacgccaccccggggaaagggggttg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : caacacacgaagagttaactaaaataaaataacaccacagttctctttttattcctttgc
HTMT1_0105_F02.b : tttttttttttctggggcgggggggggtggggattcttttctccaaaaaacaccccccac
HTMT1_0067_A01.b : ccgggaaaggttttggattggggctttcctttcccaaaaaaacaagcccggggttggtgg
HTMT1_0058_C09.b : acaccattttcttttttttttttttccgggcgagggaggaggggggaagttttttttcaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ggaagggttttgggggtataatatctcacgaaacaaaggaaacgcgtttgggaatagggg
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : ttatttttcagtggggggaggagggggggaggtttttctcttaaaaaaaccccacccccg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : gggaggttttttctcataaaaacccccccccggggggaggggttgtattgggcgtttctc
HTMT1_0034_C09.b : atgtttccaagtcccgggggggagggggggagggtatttttgcgtataataaaaatgcac
HTMT1_0100_G08.b : tattttggggggggggggggggagttttctccaaaaaaaaccccaccgcggggggggggg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : ccgggggaggggttgcattgggccttccttccccaaaaaaccggcgggttgtgggggggg
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : tgagaagaacccccgaggggggggggttgggatcggccttcctccagaataatcgggaag
HTMT1_0045_C09.b : ggaggtttttctcacaaaagaaccgccaacccccggggaaaggggtttgcaatgggggct
HTMT1_0034_F03.b : aaaaaagaaaaactatctttttctttttttttttgttcggcggggggggggggggggttt
HTMT1_0029_D02.b : ttattgggggggggggggggggggttttttaaaaaaaaccccccggggggaagggtgtgt
HTMT1_0143_C10.b : tccttcgacatgaaacgatgaagcatacagaccttaaacacttaatcggtcaataatata
HTMT1_0006_H08.b : gggggggggggggggaggatttttcttaaaagaacccccccggggaaggggctttaattg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tattttttctcaaaggaattttataaaagaaaacaacacgctacttcctactataacaga
BFLT1_0124_E05.b : xxxxxaacccaatttattctcttccgttcccccacaaaaaccccgggcccggtgtttggg
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : tccccggggcctctccggattcaaaccgcccctaaacgaaaacggtccccctttccccct
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : aacaaattaaaacaccctctttcaattttttttttctttcaaactcatagacaagggttg
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgac
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : TTAAACACCACaatttttttttttttttttttCCGGGTCGGGGGGGGGGGGGGAAATTTT
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : TTTTCCAAAAAAAAAACCCCCCCACCGGGGGGGGAAGGGGGTTTTGCATTTGGGCCCCCC
---------+---------+---------+---------+---------+---------+ 1970
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gccctttcccctcccaaagaaccggcctgggggggggggggggctattcctccgagggta
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aaaaaccccccacccccccccggaaaagagggttttgctatttggcc
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tttttgggcttttcctcctcaaaaaaagcgcggggttgggggggggtttcctcctggggg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ttattggccccttccctcttccacacaacactcccccggggttgtggggggagaggttcc
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gcgggaggaggagggaggaatattttctttacagaaagtcaccccctcacgtggaggaaa
HTMT1_0105_F02.b : cgcgagaaggggtgttttattgggccccttctctctctcaaaaaaaactatccggttgtt
HTMT1_0067_A01.b : ggggggttttcctccgggggtggtttcctcccggtaaccggaaaaatggaagggcaaggg
HTMT1_0058_C09.b : aaaaacaccccccccccgcgggaagaggggtttgttttgtccttcttcccctccccccaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ctctagaagtgtgcctcaagtacttatgcatcaggccccacacggcgagaggggcagagc
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : ggggaaaggcgttttcatatgggcccttctcctctcccccaaaaaatacaggcccgagga
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : tctcccaaaaaacccgcccgggtttggggggggggtgttctctcaagggggtatggtttc
HTMT1_0034_C09.b : cccccccgagagagaagagggtctttattttgggaggtgcttactcatctctcctcacat
HTMT1_0100_G08.b : ttgtagggccccttcctcccccaaaacacgcgcggggtgggggggggggggttcctctcg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : gttcccccaggggtaaggtcccaacgggaaccgaaaatgaaaagccagcgaataaagggt
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gtggggggggagtttcctggggaggtttcctctcgatagaaaaaatataaggaaatgaag
HTMT1_0045_C09.b : cttccttctccctcaaaaaaacaggcccggggttgtgggtgggggggggtttactcccca
HTMT1_0034_F03.b : tttcttaataaaaacccccccacccgggggagggcgttttgaaatgcgctcccctccccc
HTMT1_0029_D02.b : gttggtccttccctccaaaaaaacgggagggggagggggggggggttttcctccggggga
HTMT1_0143_C10.b : ccagatattgaatagaacctgatctcaacaataatcctgatttgaacaaaaccaagttaa
HTMT1_0006_H08.b : ggcatttctttccttaagagatcgagcgagtggggcggggaggtttttaccggggggtaa
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : gcgatgaagggatgagaggtgaaaattttcttgataaaaaacgctacctcaccgcacggg
BFLT1_0124_E05.b : gggggaggggttctccccctaagggggaatcggttcccacaaactgggaaaccggaaaaa
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ggggaaggggggccttttccaaacccagcggaagtaccccatttggggtggggcgtcccc
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : ttatatttttttttctatcataaaaaacccaacaactccaccgaaaaaatattatctttc
MLTL1_0049_C06.b : tggagcatccaacgcatgatgactgaatcgcacgnatcacacttgtccttgcgaaaaatt
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : TTTTCCAAAAAAAAAACCCCCCCACCGGGGGGGGAAGGGGGTTTTGCATTTGGGCCCCCC
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : TCCCCTTCCCCCAAAAAAAAACCCCTCGCCCGGGGTTTTTGGGGGGGGGAAACGTTTTTC
---------+---------+---------+---------+---------+---------+ 2030
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : tagtttcccaaacggaaaggaaaaattggaaagccagaggcaaaaaagccgttggttata
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : atttttccaaaggggaacgaaaattttaaggcgaaggaataaaggcgtgtttttatcccc
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : tcccaggggggatttgtttcccaatgggggacacgaaaaaatggtaaaggcgaaagggac
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gatgtggtgaaatgtccacctctccttcatacgatatatatagagagagg
HTMT1_0105_F02.b : gtgggggcgaggggtcccctctaggggggttttgtttctcacaaggggaaactgagaatt
HTMT1_0067_A01.b : gaccaaggggggtggtttttttcccccccccaaaccccaagggacgggaaaagcccaaaa
HTMT1_0058_C09.b : atatactcgggcccagtttctggggtggggggggtttcttcccccggggggtgtggtttt
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ataaatggttttacgggtccgaaatcgctgtaatcagggggaaacagtgggaaagatgga
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtggggggggagagtatcttcttctctgagggggattgtttctctcaaaaggggaaaaca
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccatggggaaacggaaaaattgtaaggcgaagaggcacaaaaggcggtgtgtgtttctgc
HTMT1_0034_C09.b : atacattatatagcagctgatattcacagagagcaggagaaattaacattctcaccaagg
HTMT1_0100_G08.b : agggggttgttcccacatggagtaaaaaaatatttaaaaggagagggcaaaaagggcggt
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : tgggtttttggccccccaccaaaccttagggcccgaaaaagtccgcccgcctaccccaat
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gtaagggggttgtttttcccctccccaaacacactagggaaaaaataaatccccgccgcc
HTMT1_0045_C09.b : caagggggagaaggttttcccaaannngggttnnnnnngaaaaannngngaaaaggcgca
HTMT1_0034_F03.b : accaaaaacaaccccgccgggtttgggggagggagggttttctctcggaggggagattcc
HTMT1_0029_D02.b : tgtctcccaaggggaaaaaaaaaattggagggaaaggaaacaaagggggtgttttttgcc
HTMT1_0143_C10.b : taagacacaacaatataatcaactgtaatgaacataagacacaaaagctgaaaaacgatg
HTMT1_0006_H08.b : tttccaaatgggaaaccaaaaaattaaaagcccaggcgaagaaagcggggtttttttccc
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : agaagatacaattcgggactccttatcataccaaattaacatagaacctattttctggtg
BFLT1_0124_E05.b : attggacaggggcccaaggcggaaactaaagggggtttgtggttttatggcccccccgga
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ccaggggggtggggaacaaaccccgtttagccaaaaggggggctttaagggtaatttttg
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xcccccaaaagatatccctcccccctggtttttgggcggggggggaggttttccccccac
HTMT1_0134_A12.b : tattggtgaccatcacatccttatctatataaataacaactcaacatccataatctatta
MLTL1_0049_C06.b : gcatgggaacggggcaaatttgctattgccctttatcaacggggaacccccggatggtga
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : TCCCCTTCCCCCAAAAAAAAACCCCTCGCCCGGGGTTTTTGGGGGGGGGAAACGTTTTTC
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : CTCCCCCGGGGGGGGGTGAATCGGTTTCCC..............................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : taccccccgaacaaaaccttaagggcccgactaaagtccccacccgccctcacccgaagc
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : cggaaaaaacttaggggacaagaaaaagcctcaccgccccccactaaccttcgggttctt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : acaaaagggcggtggttttttgtgcccccgcgaaaaaaaatctgaaggggccacac
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b : tgtgagagggaggaggaagaaaaggcgggtgttttcttctccctccgcaacatataccta
HTMT1_0067_A01.b : ggcgcccccaagcctgggtcacacatatattgnnagattatttatgac
HTMT1_0058_C09.b : cccaaagggggaatccagaaaatatttccacggcctcaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : agaaaacaaaanaagagggacgtgaggcgttctggttgtctctgtggcttccagaatcta
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : agaaaatttggtgaaggcgcnaaggcggccaacaaaagggctgtggtggtttctatgcct
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : cccccgcaaaaaatactctgtggggacaaagaaaaagcctccagacccgcgcctccgccg
HTMT1_0034_C09.b : gcgggagaatgtctatcactcaaaataagtggtatatgtcgagatataattgagtactan
HTMT1_0100_G08.b : ggtttctccccccccagaaataaccgaagggggccgaaaaaacccctcgaccgcgcctcc
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : tccagttaatttgttggccccntnnnnnnnnncggnnnnnccccccaacagctagtaaat
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : cccacgcaagctcctgagttattttttttnngngnnaaccccnnnnccccgcggggggtg
HTMT1_0045_C09.b : agagcggatactaagaggcggctcgggggtttat
HTMT1_0034_F03.b : tcccccggaggggagaccaaaaaaatgattgaagcgccccgccgccctca
HTMT1_0029_D02.b : ccccaaaaaaacccgggggggccaaaaaaaccccccccacccttccacaagatttctaga
HTMT1_0143_C10.b : aaaactacagtacgcaaagctcatcctctcacgcccgtatctataacaacaatagacacg
HTMT1_0006_H08.b : cccccaacaactgtctatgaggacaagaaaaaactctcactctcctcttcagcaaaatgc
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : gtagaaaaacatctcacaaaaagatatattctcatatcccttacagtaaacaaatataaa
BFLT1_0124_E05.b : aacaaaaaaacccctttggggggaacaccggaaaaaaaagggtcccgaaacccgggcctt
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ttgggcccaccgggaaaaacatttttcccccgggccccccctggtaaaagaataaaaaag
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : ctagggggggaaatattgtttccccacaaatacgggggaaaacccgggaaaaatttgttg
HTMT1_0134_A12.b : tttagactcggacgacttctcctcctacattaagggagctatattgcctctccacaacaa
MLTL1_0049_C06.b : aaaaaatttccaaaacctttgaaaagcggtttccgaacccccttgaaatattgaaacgcg
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : CTCCCCCGGGGGGGGGTGAATCGGTTTCCCcccagaggggggggaaacccgaggaaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : tcctcgggctcccnnannngggatgggccccncctgtcccccgcgaggggacgacacaat
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : agtatggcgcggccccaccctctaaa
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b : tgaggggccgaagaaaagtgtcttcctctcccgtctactacctttattttg
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ttatagaggagag
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : cccctcgagcaacaataccttcggggaggggaccc
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : agatttcgcgggggcttcggagaggggtgcggccacaccc
HTMT1_0034_C09.b : cgcgtgctcaagtgggcgctaccatagaaacgaagctgtga
HTMT1_0100_G08.b : acaccatagaatctagagggtaaaac
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : aannnnnnnnnnnnnnnnngccgcnnnnnnnnt
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gggagagagatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b : gtag
HTMT1_0143_C10.b : agcgagacggtcgctcctgnnnncacnnnnnnnnnnnnnnnttntncaannaacattatc
HTMT1_0006_H08.b : tctaaggactaaaaatatgatatggagggcgccccctataccacacccaaaatagctcat
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tctgtatacttaagaaataatatatactggtttattcttatcatcctcgccacaccaaan
BFLT1_0124_E05.b : ttacaccataaaaactctttccaggagggtttaccaaattattggagtgcgcgggggacc
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ggggggggggggggcaacaattttggggggggcccacccccccaccaaaaaaaattttgg
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : acaagaggccccaaagggccgaaaacataaaaggccgctttggttggtttttttcaaggc
HTMT1_0134_A12.b : ttgaggaaaaaccctagctaatacactacatacatataaccaataattatatctctaatc
MLTL1_0049_C06.b : accctggttcccaagaaaattttttcggaaaggaaggaaaccaacccccttttctaatgg
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxccctaaggaaaaaggcagttttccccaaaacccccattctgcaaa
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : atttgtgaacaaagggcccccaaaaggcccggaaccctaaaaggggccgggtggggggtt
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : atannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b : acaacgacgaggccgatccccatagttgcactgnaatnnnnnngtggtaatgttgntntn
HTMT1_0006_H08.b : acccaattaataacnnnn
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : ataaatnctcgtggacgacaagaagaaaatctctgagaaagtgatatctacc
BFLT1_0124_E05.b : ccccccctccattttccaaaacaccgcaaagagagt
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : tctcccccccgacaccctcccccaaaaagtggtcttctgccaaaacaacccgggggtggt
AMP01_0036_E10.b :
HTMT1_0101_B11.b : gccccccccggaagaaataaaaaaatcccccctaatgagaggggggaaccccaggagaat
HTMT1_0134_A12.b : tcctaagcgcggctctttctcattatttctccacctcccctccccctatagaatattata
MLTL1_0049_C06.b : aaacgggaaagaaggaagtttttttagaaaaggggaggagaaaaaaggaggnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxgaaaaaatccaaaaatcccccctcaaataaagaggggaaaccccc
MLTL1_0041_H03.b : aattggaaaactgccggattcccctggtttcccccaaaccatgaaagttccatttcccag
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : tttttccaaaacgccccccccccgggaaaaaaaaaaaaaaatatcccctctgaggggagg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : nn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b : ng
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnn
HTMT1_0124_H09.b : tttttttcacaaaaccccaaaaaaaaaacaaaatttttttttgcggcccgaagaaccaac
AMP01_0036_E10.b :
HTMT1_0101_B11.b : ataaataaggtgttttccccgagaacccctcgggccttcctgttaaccccgcgatagaag
HTMT1_0134_A12.b : aaatatccctcattattcatgagttatatatcaccagatgtatactacttacttgtattc
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxgctaacgaaactggtcgctttctccttcggagggggggcttcccaagtcacctgagga
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : aaggaaataaaaaacccgggggtttcccccagaaaaccccccggggcccctctgattcaa
MLTL1_0041_H03.b : ggaagggttaaaggggaaacattccaataacccgtcccctttttttggcaaaaattcgga
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gggggaaacccggcgggaaaaaaaaaaaacggggttttcccccgggaaaccccccggggg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxaaaataaaaaaccgggctttctcccggaaacccccctcggggggctcccggttcc
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b : ggggggtgaaaaaaaacctccctaaaaataaaaaataaaaaaaaggaggggggggntttt
AMP01_0036_E10.b :
HTMT1_0101_B11.b : aatgtcccctcttcctgggggggggccttctcatacccaggtaatctctctggggagtct
HTMT1_0134_A12.b : tcccatatgaatcatccatagatcctcatcatcctcactcctatctaatatataatctcc
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : accaattcgggaggcgtcccccaacggggtgggtgaaacccccttaccaaaggtccctta
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : cccggcccttaaagaaaacggtcccctttcccctagggaaaggggtcttttccaaaacca
MLTL1_0041_H03.b : aacttctcggggcaaaagttaaaaggcgaaaaattggtttttctttggtttttaggggca
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gcctcttgttcccaacacgggcaataagaaaaaccgtccccctttttcccgggggagagg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : caacccgccctttaaggagaaacgggcctccttttccccttaggggaaggggggcctttc
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggggaagggggggcctttcca
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b : tttccttccccga
AMP01_0036_E10.b :
HTMT1_0101_B11.b : cccacccagtgtgttaaacccc
HTMT1_0134_A12.b : tctatatttaccaggtgagtcaatctattc
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : cggaaaaaggtttgaacacccggaaaaaaattacccggggaaccggttaagtataaaaag
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : ccgggaagaatccattgggggaagggcccccacaaaggggggggggaaaaacccctttac
MLTL1_0041_H03.b : ataccccaaaggggtgttgatttcacaccgaaccccaatttttaaaccggagatacgggt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gggggctttcccaaacccacgggggagtattccagtgggggggagggcccccccacgggg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ccaaaccccccccggagggatataggtggggggaggggctccccccccaggggggggggg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : aaaaccaagcggggagggtaccacagttggggggagggggtctccccccaagctgggcgt
CLNT1_0092_E02.b : xxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : gaaagggggccaaatttaggggccacaccccccaaaaaattgtggccccgccaccctcca
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : acaaaagctcccttaagggaaaatttcttgaaccccgcaaaaaatatatttccgggagca
MLTL1_0041_H03.b : aaccgttttttcttttctccgaaaaaatcttaatataaaaaggcgccaaaaaaagctttt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : ggggggaacaaaacccccttatacgcagcgggggcctttaaggaaatatgtttgttcccc
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggaaaaacccccgtttaacccaaagggggcccctttgtggggaatatttttttggaccca
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxgattccaaccggaaaaacaacttatcccccggcaacacccgtgtaaggatta
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : gggggaaaaaaaccccccgttaagccgaaacggtgggcccttaaccgggaaaaaattgtt
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : xxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : aaag
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : cccgggaaataaaaacagaggaagagggcgcacaatttatagggggccacacccccccaa
MLTL1_0041_H03.b : ttttatattccgggtcaaatttttaagaattgttt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : cggggaaaaatttttcccccgggcccccttggaaaagataaaaaagggggtggggggctc
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : cccggaaaaaatattttttcctcccgggcacggcccgtgggagaggtaaaaaagacggga
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : caaaaggggttgtggcgggccacaattctagaggggggccatctcggccaccaaaaaact
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : ctggagtccaacccggggaagaaacaaattttctcccccgtgggaagaaccccggggaaa
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : aaaatattgtgggcgcgtgaactcctaaaaaatattctctcccca
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : acattttgtgggggcccccacccaaaaaaaaatttgtgtccccgccgacccctccaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : gggggggcgggcccaaattcttgaggggggcccaccagggccccaaaaaaaaattttgtt
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ttttggttcgcccctgcaaaccatttccttcaaaaaatttggactttttcggaaaaaaac
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctacccaaaaaaaaatta
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : agggaataacaaaaacgagggttgtggggcgggcgccaaaaaaatcttgggagggggggc
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : atgttcctgcccaaacccccgggggggtttttgaacaaatcaaaaaaactataattttgt
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : tttggccctgggaaacatttccctgaaaaaaagtgggtttgttgtgagaaaaccccgggg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : acggtggaagtgtttttgttggcacatattcccgaaaaaagggactaaaaatttactttc
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : tattggactcgcctcttcccaaaccacattccctcagaaaacaattttggaccttttttc
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : ctaacaacgggaacaccaaagaaaaaaagttttgggtaatcgcgccccgggggaaacgca
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : tggccgg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggaggggtttttttgtggcccccaacccccaaagagagagggagaactttttttctggcg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : tgggggaaccccggagaaaacattaggatgtgggatataagagtccccactttttaaagg
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : gggaaacaaccacaccttggaacggggtatttatgttttcatcacaaaattcctcaaaaa
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : gttatcttatggaaaaaaaatgtgtgttttctgtgttacggaaaaaaaaacgaggggggg
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggcgcgcgggagaaaaacaagggggtggcgtaaaaaaaccccccctccttaataagaaaa
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ttttactaaaatggaagtgtggataacataggagcataaatattctattggctcctaata
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : aagcttcaacaaattttttattcctttcgtggtctcaaccatggaaagaaacatttcaat
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : tgaggggtggttttttgggtggcgcaccaaaaatttgccggaaaaagaaggaccnaaaaa
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : acacagaaaagaggggggcacaccggagcgccctcttttctcctcg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ataggggtatctgtaacggcccccttattaacgaggagaccacctttgaaaaataataaa
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : ggaatttgtacaaatataaagagttctccatacctcttaaaataaatagatttacancca
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : attttgtttattcttttggggggggggcccgagggagaaagaaacctcggtgtgagggtt
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :