
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000489

Length: 2,060

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Homo sapiens]. 2603e-69O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Homo sapiens]. 2081e-53

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Mus musculus]. 2658e-71O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Mus musculus]. 2559e-74

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Canis lupus familiaris]. 2981e-80O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Canis lupus familiaris]. 2548e-74

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Bos taurus]. 2803e-75O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Bos taurus]. 2671e-76

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP6ATP synthase F0 subunit 6 [Sus scrofa]. 3132e-85O
Contig/Assembly ProteinCOX2cytochrome c oxidase subunit II [Sus scrofa]. 2794e-81
Contig/Assembly ProteinATP8ATP synthase F0 subunit 8 [Sus scrofa]. 63.93e-10O

Assembly Members: 150      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
DCI010023B01DCI01_0023_B01.bDB792321 AK391268
HTMT10019D05HTMT1_0019_D05.bFS665596 AK391736
HTMT10032C04HTMT1_0032_C04.b  AK391907
HTMT10034F03HTMT1_0034_F03.bFS666682 AK391931
HTMT10086F06HTMT1_0086_F06.bFS670276 AK392564
HTMT10087B06HTMT1_0087_B06.bFS670315 AK392573


SNPs: 6      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0032_C04.b : tttggacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
DCI01_0059_D07.b : aatgatxxxxxxxxxxxxx
DCI01_0106_C05.b : nnnaaatgatacta
DCI01_0034_A04.b : nnnnccatacta
DCI01_0081_H05.b : nnnaatcgtaact
DCI01_0108_E05.b : nnnnnnnnnnnnnnnnnnnn
DCI01_0023_B01.b : nttaagtaac
DCI01_0089_G07.b : nnnnaaacatatcta
DCI01_0021_D02.b : ttaaactaaca
DCI01_0093_F03.b : nnaaaaccatact
DCI01_0069_B05.b : nnaaaaccatacta
DCI01_0068_D06.b : nnnnttcgaatcata
DCI01_0101_D08.b : nnnaaacgtaactaa
MLTL1_0057_C10.b : nnnnnnnnnnnnnnnnnnnnnn
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 59
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_A04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H05.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B01.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_G07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_F03.b : atagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B05.b : tagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D06.b : angggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_C10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 119
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0106_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0108_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0023_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0089_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0069_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0068_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0057_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_B07.b : nnggtatctatagggctgctcgcgcgccgxxxxxxxxxxxxxxxxxxxxxx
DCI01_0047_B05.b : nnaaacgatactaaxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 179
DCI01_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0106_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0108_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0023_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0089_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0021_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0093_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0069_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0068_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTGACACACACTAGCACAATGGATGCCCAAGAAG
MLTL1_0057_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACACACTAGCACAATGGATGCCCAAGAAG
DCI01_0029_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0047_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxx
BKFL1_0057_D11.b : nnnnnnnnnnnnnnnnnn
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 239
DCI01_0029_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTGCCCTTCCATCAT
DCI01_0047_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0094_H09.b : nn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 299
MLTL1_0079_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0057_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0094_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxx
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 359
BKFL1_0057_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTATGAAGACCTCACCTTTGACTCAT
MLTL1_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 419
MLTL1_0094_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaACAATC
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 479
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 539
HTMT1_0087_B06.b : tttttggacagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 599
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 659
HTMT1_0106_H07.b : nnttacgagagaagacxxxxxxx
HTMT1_0017_C10.b : ttttacgacggtagaggxxxxxx
HTMT1_0129_E11.b : tttttcgacagtagaggxxxxxx
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 718
HTMT1_0106_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCAGCATTAACCTT**AA
HTMT1_0017_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCCCCTCTAACCTTTTAA
HTMT1_0129_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTAGTCAGCACTAACCTTTTAA
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b : nnnaaggcaggtagaxxxxxxxxxxx
SPLT1_0015_H11.b : nnnnttgcaggtagacxxxxxxxxx
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : ttttccgaggtacgaggccxxxxx
HTMT1_0090_E07.b : ttttccgagagtacgaggccgntax
HTMT1_0060_D07.b : tttccgagagtacgaxxxxxxxxx
HTMT1_0079_H09.b : nttttcgcaggaagaggxxxxxx
HTMT1_0092_G06.b : ttttgggacggtacgaggccxxxxxx
HTMT1_0079_E04.b : ttttccgcaggaagaggccgtaxx
HTMT1_0111_B12.b : nttttcgatggtaagaggxxxxxx
HTMT1_0102_D07.b : nnnnnggagagtacgaxxxxxxxxxx
HTMT1_0114_G09.b : tttttagatggtxxxxxxxxxxxxxx
HTMT1_0026_H08.b : ttttacgacggtagcggccgtxx
HTMT1_0018_A01.b : tttttacgacggtacgaggccxxxxx
HTMT1_0023_C11.b : ttttccgcggtacgaxxxxxxxxx
HTMT1_0041_F04.b : ttttccgacggtacgaggccxxxxx
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : ggagagtacgaxxxxxxxx
HTMT1_0105_F02.b : ttccatgattacgaxxxxxxxx
HTMT1_0067_A01.b : tttttagacgagaagaggxxxxx
HTMT1_0058_C09.b : nnnccgagagtacgaxxxxxxxx
HTMT1_0107_E08.b : nnnnccgagggtacgaxxxxxxxxx
HTMT1_0013_B09.b : ttttccgaggtacgaxxxxxxxx
SPLT1_0062_A04.b : nnnccgcgagtagaggccgnta
HTMT1_0014_G06.b : tttttacgcagtaagaxxxxxxxx
HTMT1_0073_E05.b : ttttccgacggtacgaxxxxxxxxx
HTMT1_0047_G10.b : ttttaggagggtacgaggccxxxx
HTMT1_0102_D10.b : tttttcgagagtacgaxxxxxxxx
HTMT1_0018_E12.b : nnaacgagagtacgaxxxxxxxx
HTMT1_0054_C11.b : tttttccgacggtacgaxxxxxxxxx
SPLT1_0071_A05.b : nncccgcgagtagaggxxxxx
HTMT1_0062_F03.b : tttttccgacgggtacgaxxxxxxxxx
HTMT1_0114_B08.b : nnnnnggacgggtacgaxxxxxxxxx
HTMT1_0061_A11.b : tttttacgacggtxxxxxxxxxxxx
HTMT1_0098_H12.b : ttttccgacggtxxxxxxxxxxx
HTMT1_0132_F06.b : tttttcgacggtacgaggcagnta
HTMT1_0020_D11.b : tttccgcaggtacgaggccxxxx
HTMT1_0062_C06.b : tttcgcaggtacgaxxxxxxxx
HTMT1_0133_H07.b : naaccatttnnttnntggacgggaacgaggxxxxx
HTMT1_0048_G04.b : tttttcgagagtacgaxxxxxxxx
HTMT1_0093_H08.b : ttttaggatggtacgaxxxxxxxx
HTMT1_0107_A03.b : nttccgagagtacgaxxxxxxxx
HTMT1_0034_C09.b : aatttatttagatatcttatattggcaggtaacacagccaax
HTMT1_0100_G08.b : tttggcgagagtacgaxxxxxxx
SPLT1_0063_B03.b : nnncgcgagtacgaggccgnt
ILNT1_0083_G05.b : nnnggcgcgagtagacgccgnt
HTMT1_0125_H09.b : nttttgatgagaa
HTMT1_0140_A09.b : ntttttttttttttttggacggtxxxxxxxxxxxx
HTMT1_0049_B03.b : tttttccgacggtacgaggccxxxx
HTMT1_0081_H04.b : tttttggacggtacgaxxxxxxx
HTMT1_0143_D02.b : tttttccgacggtagacxxxxxxx
HTMT1_0091_C02.b : nnnncgacggtacgaggccxxx
HTMT1_0137_D09.b : ttttttacgacggtxxxxxxxxxxx
HTMT1_0063_D10.b : nnccgatggtacgaxxxxxxx
HTMT1_0130_A01.b : ttttccgacggtacgaxxxxxxxx
HTMT1_0088_A10.b : ttttacgacggtacgaxxxxxxx
HTMT1_0131_D04.b : nnccgagagtacgaggccxxx
HTMT1_0045_C09.b : tttagagagtacgaggccxxx
HTMT1_0034_F03.b : gaaggtacgaxxxxxxx
HTMT1_0029_D02.b : ttttccgacggtacgaxxxxxxx
HTMT1_0143_C10.b : ttttttccgcagtxxxxxxxxxxxxx
HTMT1_0006_H08.b :
HTMT1_0070_C01.b : ttttncg
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 776
HTMT1_0032_C04.b : aaaaaaaatcccccctcaattcaaagggggaaaaacccaangggtttgggccgggcccgc
HTMT1_0005_B12.b : nnnccgcatactaaggatttaatgaaT**TATGCCACAACTAGATACATCT
HTMT1_0010_A12.b : ccctaactaaggatttaatgA*TTATGCC*CAACTAGATACATCT
SPLT1_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
SPLT1_0015_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0005_A01.b : nncccattcatacaagggtatttaatgATTTTGCCCAACTAGATACATCT
HTMT1_0008_B08.b : ngggataccatgggattaatgaATTTTGCCCAACTAGATACATCT
HTMT1_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0060_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACACCTAGATACATCT
HTMT1_0079_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAATTAGATACATCT
HTMT1_0092_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0079_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0111_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0102_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0114_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0026_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACCACTAGATACATCT
HTMT1_0018_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0023_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0041_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATGCCACAACTAGATACATCT
HTMT1_0005_G02.b : nnnccactaacatataggattaatgaattTATGCCACAACTAGATACATCT
HTMT1_0036_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACATTTAGATACATCT
HTMT1_0105_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0058_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0107_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0013_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
SPLT1_0062_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0014_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0073_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0047_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0102_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0018_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0054_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
SPLT1_0071_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0062_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0114_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0061_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0098_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0132_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACACCTATATACATCT
HTMT1_0020_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0062_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0133_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0048_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACCACTAGATACATCT
HTMT1_0093_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0107_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCCACAACTAGATACATCT
HTMT1_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACCCTTAGATACATCT
HTMT1_0100_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
SPLT1_0063_B03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
ILNT1_0083_G05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0125_H09.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgATGCCACAACTAGATACATCT
HTMT1_0140_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0049_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0081_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0143_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0091_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0137_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0063_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0130_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0088_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0131_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACCATTTACATCT
HTMT1_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0034_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0143_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGCCACAACTAGATACATCT
HTMT1_0006_H08.b : ntcaggatatcataaggattaatgaattaAACTAGATACATCT
HTMT1_0070_C01.b : acggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCT
ILNT1_0009_G02.b : nnnnncgcgagtagaxxxxxxxxxxxxxx
HTMT1_0072_A06.b : taaagcaagaagaggccgtattattaaxxxxxxxxxxxxx
BFLT1_0124_E05.b : nnnccgtcagcgnacgxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 836
HTMT1_0032_C04.b : gggtttccccttgggggggccttatgggcccccaagttaaaaacacttgtttaagttaga
DCI01_0059_D07.b :
HTMT1_0008_D06.b : ACATGATTCATTACAATTCCtttaataattataacattatttattttattCCAACTAAAA
ILNT1_0009_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACATTATTTATTTTATTCCAACTAAAA
HTMT1_0072_A06.b : xxxxxxxxxxxxxxxxxtttactccctataagggacattatnATTTAATTCCAACTAAAA
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTTATTCCAACTAAAA
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b : nnccgataatt
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 894
HTMT1_0032_C04.b : caaacccccctttcaacgtttggaaaaaagggcctttttttaaaaattcgggggggtttt
DCI01_0059_D07.b :
CBLT1_0098_E04.b : tttcgcgagacgaggxxxxxxxxxxxxxxxxxx
HTMT1_0133_G03.b : nnccatatttnntnnnnggacgagtagacgccantagtatttatac
HTMT1_0059_B04.b : ttttacga
HTMT1_0065_F09.b : tt
SPLT1_0038_B10.b : nnaaaataatttttnn
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b : taagggatatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 954
HTMT1_0032_C04.b : ctttatttgggaaaaattaaccccccaaaaaaggttaaagaacaaatccctctttttttt
DCI01_0059_D07.b :
DCI01_0106_C05.b : cacccttgagaataaaatgacgaaatctatttgctcttttatgccccacgatatagacta
DCI01_0034_A04.b : gccacccctgagaaataaaatgaacgaaatctatttgcttctttaattgccccccgaaaa
DCI01_0081_H05.b : ATAGCACCCCCTGAGAA*ATAAATGAACGAAAtccatttgcctctttnatgccccccacg
DCI01_0108_E05.b : AA***CACCCCTGAGAA*ATAAATGAACGAAAtctattgccccttttatgccccacgatn
DCI01_0029_B07.b : TACACCCCttgaaaaataaaagaccaaaatccattgccccctttattgccccccaaaaaa
HTMT1_0133_G03.b : gactcctatagggaatttaatgaattACGAAAATCTATTTGCCTCTTTCATTGCCCCTAC
HTMT1_0059_B04.b : cggaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCCTAC
HTMT1_0065_F09.b : ttccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
SPLT1_0038_B10.b : nnnagctagtagacgcantaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
CLNT1_0030_H07.b : ntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : nnnnaacgagagtxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b : ttttggagagtacg
HTMT1_0134_A12.b : tttttcgctattac
MLTL1_0049_C06.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1014
HTMT1_0032_C04.b : tttctcggtccgggggaagggagaaagttttttacccaaaagaaaaaccaacaccgggga
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctatgtcaccctatataaatccaagctactatccnacaccaacgatcataataccgccat
DCI01_0034_A04.b : tagactactaatgccacctaaatataaattcccaagttactttcccaaacccaacgaatc
DCI01_0081_H05.b : atatagactacctattgtcacctnnaatatatattccnagcttactattccaacaccaaa
DCI01_0108_E05.b : atagactactatgtcaccntattataaatcccaactactatcccacaccaacgactcata
DCI01_0023_B01.b : aaataagactacctattgtccccttaattataaaatcccaagcttacaattcccaacaac
DCI01_0089_G07.b : atataggactacctatgtcaccnttaatatatattcccnnagctactatccnacaccnaa
DCI01_0021_D02.b : GAaataagactaaccaattgtcacctaattataaatttccaaagctaatattcccaaccc
DCI01_0093_F03.b : GATAtangactaccctatgtcaccttaatnnatatatcccaagctactatttccaacacc
DCI01_0069_B05.b : GATA*TAGGACTACCTATTGTC*ACCTAAnnntatatatcccnagctactattccnacac
DCI01_0029_B07.b : aggataccatggccccctaatttataattcccagcttaatatttccaaccccaaagaact
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTAATTATTATATTCCCAAGCTTACTATTCCCAAC
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCCCAAGCTTACTATTCCCAAC
HTMT1_0101_B11.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaTATTCCCCCC
HTMT1_0134_A12.b : gacgcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcttactaccctatc
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b : nnnnccgacggtacgaxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0092_G08.b : ttttccgacagtacgaxxxxxxxxxxxxxxxxxxx
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : atatgtatax
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1074
HTMT1_0032_C04.b : gagggggtttcgcattggaccctttttcctccccgcataaaacccgggccctgggtttgt
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctcatcacatgatatccactacatccacataatactatccacaaaaggcaactgaccaaa
DCI01_0034_A04.b : attaaaacccccaatccccttccacatggttactcaactaactccaacaaaaaagctttc
DCI01_0081_H05.b : cgactcatttataccgcacatctcgatccacaatgattattcaactaacatcaaacaaat
DCI01_0108_E05.b : taaccgccatcccatccacatgatatccactacatccacaatatagcattccnacaaaag
DCI01_0023_B01.b : caaacgctcctttaaaaccgcacaatccgatccaacatgataattcacctaactccaaac
DCI01_0089_G07.b : cgactcattataaccgcaaatctcgatccaacatgattatcccactacatcaacaaatat
DCI01_0021_D02.b : ccaacaatcctttaataaccccacaatcccattccacatgattaactccactaccttcaa
DCI01_0093_F03.b : caacgactcattataaccgcacatctcgatccaacatgattaatccactaacatcaaaca
DCI01_0069_B05.b : cnaacgactcattaataccgcacatctcgatccanncatgatnatccnactacatccaac
DCI01_0068_D06.b : CACCaacgactcataataaccgcacatctcgatcaacatgattatccactaacatcaaac
DCI01_0101_D08.b : ACCCAAcgactcataataaccgcacatctcgatcccacatgatttatcaactaacatcaa
MLTL1_0057_C10.b : CACCaaacgactcattattaccgccaaatctcatccacaatgattatcaactaactccaa
DCI01_0029_B07.b : tttaataaccgcaattcccttccacagggtaatccccctaaccccaaccaaaaaaccctt
MLTL1_0079_G09.b : ACCCA*ACGACTCATTAATAccgcacatctcgatccacatgattaatccnactacatcca
HTMT1_0092_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAATCTCGATCCAACAATGATTAATCCAACTAAC
ILNT1_0001_D01.b : ttagaaagtacacgccanxxxxxxxxxxxxxxx
HTMT1_0147_G03.b : ttttttggcaagtacgaxxxxxxxxxxxxxxxxxx
HTMT1_0020_C08.b : tttttcgacggtacgaxxx
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : tatttaggatatcaaxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b :
MLTL1_0041_H03.b : nccgttcatnnnncctcgatactaaxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1134
HTMT1_0032_C04.b : gagggggggactaatcctcccccaaagaaaatttttttttcccactcgggagacccaaaa
DCI01_0059_D07.b :
DCI01_0106_C05.b : actaatcctataatctcgctcacaaatctagctataccctcttcaccccaaaattaataa
DCI01_0034_A04.b : caacccaaagccaacccgaacccaaactaaatcccattattcatcggtcaaaaatctagg
DCI01_0081_H05.b : atagctattcccaccaaaagggcaaacctgatccaaaaactaatcccaaataattcatcg
DCI01_0108_E05.b : gcaactgatccaaacttaacctaataatctcgctcaaaattctagctatacacctcttcc
DCI01_0023_B01.b : aaaaaagactttcccaccaaaaggccaacccgatccccaaacttaatcccaattaatcca
DCI01_0089_G07.b : agctatcacaccnaaaggcaaactgatcacaatactaatctctataaatcatcgctcaac
DCI01_0021_D02.b : acaaaaaatacttttccaaaccaaagaggcaaaccggatcccaaaacttaaaccccaaat
DCI01_0093_F03.b : atatagctatcccaccaaaaaggcaacctgatcctaaacttaatcccaattaatcatcgg
DCI01_0069_B05.b : aaatatagctatcccaacaaaagggcaanctgatcccatacttaatcccaattaatcatc
DCI01_0068_D06.b : aatatagctatccacacaaaaaggcaaactgatcctatacttaatccccataaatcatcg
DCI01_0101_D08.b : ncaaatatagctattcccaccaaaaaggcaaaccgatacacaaacttaaccccaaataaa
MLTL1_0057_C10.b : ccaataaacctatctcaccaaaaggccaaccgaccacaaacttaatcccaattaatcatg
DCI01_0029_B07.b : tcaacccaaaggccaccgggaccaaaactaattccaaataaatccggggccaaaaatcct
DCI01_0047_B05.b : tccaaacaataatagctattcacaccnaaaggccaaactgatcactaatactatatctct
MLTL1_0079_G09.b : aacnataatagctattcacacaaaagggccaactgatcactatactatatctctaatata
HTMT1_0147_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAAGGCCAAACCTGATCACTAATACTTAT
HTMT1_0020_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGATCACTAATACTTAT
HTMT1_0088_E04.b : tttttccgacagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0101_E12.b : nttac
HTMT1_0086_G07.b : ttttacgatagtacgaxxxxxxxxxxxxxxxxx
HTMT1_0086_F06.b : tttttacgacagtxxxxxxxxxxxxxxxxxxx
HTMT1_0085_F07.b : tttttcgacggtacgaxxxxxxxxx
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0078_D05.b : tttttncgagagtacgaxx
CLNT1_0012_B10.b : nnnnccgttagcgnacgxxxxxxx
HTMT1_0061_F04.b : tttttn
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b :
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1194
HTMT1_0032_C04.b : aaaaaaagaaaaaggccttaaacgcaaaaaaaagcggggttgggttttttttcgccccct
DCI01_0059_D07.b :
DCI01_0106_C05.b : ctggtagcatcccagatccacgatcggatcccttaacaaatctgcccttccagaaccgca
DCI01_0034_A04.b : ctataccattctttaacccccaaaattataaaactggtaagcaccccctgatcgaacctt
DCI01_0081_H05.b : ctcaaaaaattctagcctatacccattctttcacccccacaactttaaaaaactgggtag
DCI01_0108_E05.b : ccccacaatttaaaactgtatacatccctgatccacgcatcggatccttaacaaaatcta
DCI01_0023_B01.b : cgggctaaaaaatcctagccttatccaatttttcaccccccaaaaaattaaaaacgggtt
DCI01_0089_G07.b : acaatctagctatacacatcattcaaccacacacatttaatacctggntagcaacccttt
DCI01_0021_D02.b : taattcccggggcaaaaaaattcttaggcctataccaacttttttccccccccaacaaaa
DCI01_0093_F03.b : ctcacaaaatcctagctatacaactccttccacccccacaatataaaaactgggaaacat
DCI01_0069_B05.b : gctcaacaaatctaggctactacccctcattcactccccacaatataataaccgggataa
DCI01_0068_D06.b : ctcacaaaatctaggctataccactcttccaccccccaaaatatataactggatacaatc
DCI01_0101_D08.b : ttcacgctcacaaaatctagggctatacaaattctttccccccccacaaattttaaaaac
MLTL1_0057_C10.b : gctcaaaaattctaggctaaacccattattcacccccaaaatttaaaaccgggaaacacc
DCI01_0029_B07.b : agggcttataacaatttttcaccccccacaaatataaaaacggggaaaaaacccttttat
DCI01_0047_B05.b : aatatatcatcggctcacaaacatcctaggctactacaaactcatcaaacccacaaacac
MLTL1_0079_G09.b : tcatcggctcacaaaatcctagctactacaactcatcacaccacacacacttcataaact
BKFL1_0057_D11.b : ATCTCTAATTATATTCATCGGCTCAcaacatccctagcctactacacactcattcacacc
TES01_0101_E12.b : tacgttggctatggttcatcggctcACAAACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0086_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxACATCCTAGGCCTACTACCACACTCATTCAC
HTMT1_0086_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCTACGCCTACTACCACACTCATTCAC
HTMT1_0085_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTACTACCACACTCATTCAC
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTACTACCACACTCATTCAC
HTMT1_0078_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCACACTCATTCAC
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCACACTCATTCAC
HTMT1_0061_F04.b : cgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAC
ILNT1_0064_G01.b : nccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : tttccgagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnggcgataannnnatgagatacttggg
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1254
HTMT1_0032_C04.b : caacaaacaaacaccaaaaagattgttctccgggaataaaaagggtccccgaggcttggt
DCI01_0059_D07.b :
DCI01_0106_C05.b : tattcgcctatgagatacttttcgaccccgaaagccaataggccttattttgggcctccc
DCI01_0034_A04.b : ttccgatctcctaaaccaaatccttccttttcacaggaaacccccatattctggccgaat
DCI01_0081_H05.b : aatcccctgaacgcacgattcccggattccctataaccaaatccttgccttttccacaga
DCI01_0108_E05.b : cccttctcaggaaccccatatctggccatattaaatacttttccggccgcgaaggcacat
DCI01_0023_B01.b : aacaaccccttgattcaaccctatccagattcccttaaaaaaaatctctccctttttccc
DCI01_0089_G07.b : gacaccaccaatcaggatccgttaaaccaaatcctgccattcaccaagaaacccccctaa
DCI01_0021_D02.b : taaaaaaccggggtaaaaactccctagaatcaaccgttttccggattcctttaaacaaaa
DCI01_0093_F03.b : cccctagaatacacgtatccggatcctttaaacaaattctagcccttctcaaagaaccgc
DCI01_0069_B05.b : catccctttataccaccgttccggaatccgttaaacaaaatctagccctttttacaagga
DCI01_0068_D06.b : ccttgaaccaccgattccggattccttaaaccaatctacccttttacaggacccccctat
DCI01_0101_D08.b : cgggtataaatccccataaagcaacgttttcaggatccgtataaaaaaaatctagcctct
MLTL1_0057_C10.b : cctattacaaccgtttcggtttccttaaacaaattctcccttttccagggaaccccctta
DCI01_0029_B07.b : accaaccttttccgggtcccctaaaacaaaaattttacccctttcttcaaggaacccccc
DCI01_0047_B05.b : tataataaactgggtatagcatcccctagatcagcaccgtatcccaggattcgctaaaac
MLTL1_0079_G09.b : ggtatgcatcccctagatcacacgtatcacggattcgcttaaacaaaatcctagcccctt
BKFL1_0057_D11.b : acccaccaactatcataaaactgggtaaagcaatcccctatgatcagcacccgtatccca
HTMT1_0124_H09.b : ACCCACCACACAACTATCAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
HTMT1_0144_H09.b : nnnttggggacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0094_C08.b : tttttgggacggtacgaggxxxxxxxxxxxxxxxxxx
HTMT1_0068_B02.b : ttttttcgacggtacgaxxxxxxxxxxxxxxxx
HTMT1_0150_H01.b : nttccgcaggaagaxxxxxxxxxxxxxxxx
SPLT1_0028_F04.b : nnnnacgacggtagaggxxxxxxxxxxx
HTMT1_0023_E04.b : ttttacgcaggtagaxxxxxxxxxxxx
CBLT1_0009_B06.b : nttttacgacggtagaggxxxxx
AMP01_0032_H03.b : ctgctcccgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1314
HTMT1_0032_C04.b : ctttcaaagatcaaaattcttattagaagagctataaacaataatattgtgtttcggggt
DCI01_0059_D07.b :
DCI01_0106_C05.b : caccaaatttttccttattgtggggcaggggggcaccaaaaaaaaaacccccttccnnnn
DCI01_0034_A04.b : tgaaataccctttttccgaagcccccgcaaaacaaataaagggccttatttttgggggct
DCI01_0081_H05.b : acccccttaatccaaccccaattgacaaagcctttttaccggccccgcccaagagacaaa
DCI01_0108_E05.b : tagggctatttttggggctacccaacaagtttttatcctattttggcgactgggcgaacc
DCI01_0023_B01.b : agaaacccccccatattcctggcgaaattagaatttccctttttacagagccccgcgaaa
DCI01_0089_G07.b : tctggccgaatggaacaaccattttccgagcctcgcgaagaccaattggggcccttttca
DCI01_0021_D02.b : atttataccctttttaaaaggaacacccccatatatcccggcgaaattaaaaataccctt
DCI01_0093_F03.b : ccataatctggccgaattgaaataacattttaacaagcctgccaaaggacacattaaggc
DCI01_0069_B05.b : ccccccatattccgggcctatttgaaaattactatttaacagaccccccgaaggaaccat
DCI01_0068_D06.b : tctggcctatttgaaattacttttaaccgcccgccaaagaacaatagggcccatttttat
DCI01_0101_D08.b : ttaccaggaaccccctaattcaggccgaattgaaataccctttttccaagcccgcgagag
MLTL1_0057_C10.b : ttctgccgtatatgaattccttttaaccacccccccaaagagaacttaggggcttttttt
DCI01_0029_B07.b : aatttcctggcctatttaaaaaatcctttttttccgggccccccaaaaaagaacaataaa
DCI01_0047_B05.b : caaaaatcctagccactttcacccaaggaaaccgcctataaatcctgccgcaatatggaa
MLTL1_0079_G09.b : taccaaggacccgcccataatctaggccaattttaaattagcttttttccggaacctccg
BKFL1_0057_D11.b : ggatccgctttaaaccaaaacatcctaacccctttccaccacaagaaacccggccaataa
MLTL1_0094_H09.b : tcacaggattcgctatagagcaaacatactagcccacttctacacagggacaccagccta
HTMT1_0124_H09.b : aaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0094_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxAAACATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0068_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0150_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACTAGCCCACTTTCTACCACAAGGAAC
SPLT1_0028_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACTAGCCCACTTTCTACCACAAGGAAC
HTMT1_0023_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTAGCCCACTTTCTACCACAAGGAAC
CBLT1_0009_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACTTTCTACCACATGGAAC
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b : nnnng
HTMT1_0013_E09.b : tttttggcagagtagacgxxxxxxxxxxxxxxxxx
HTMT1_0063_A11.b : t
ILNT1_0006_D11.b :
BMWN1_0058_F02.b :
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1373
HTMT1_0032_C04.b : gcaccctccccctctctttttnnnnnnntccgcgccaanangnnntattggaaaaatccc
DCI01_0059_D07.b :
DCI01_0106_C05.b : tntttttnggtcccggggcccactcagaaaaacnnnnnnnnnna
DCI01_0034_A04.b : tatttcacacaaaagttttaattcctctaatgttgggccgccaggttgcgggaacccaca
DCI01_0081_H05.b : tagggggccttt
DCI01_0108_E05.b : accaaaaaaatcccttttttttttgatttt
DCI01_0023_B01.b : gagacatttaggggttttatttcttggggcgcgttaccacaaaaagaattttattccccc
DCI01_0089_G07.b : ttggggccttc
DCI01_0021_D02.b : ttttacgggccccgccgagaagaaacaatttggggccttattatt
DCI01_0093_F03.b : ccttattcttggggggcctaccccccacaaaagtttaattccctttaatttgtgggcccc
DCI01_0069_B05.b : ttagggcctttttttttgggggcaccctccaacaaaattttttttctcttcttttttt
DCI01_0068_D06.b : gggggctacacccaccaaatttttttcccctatatgtgtaggccccgggtggtagattct
DCI01_0101_D08.b : agaacaaaaggggccatttttatttggggcttaccccaccataaatt
MLTL1_0057_C10.b : tggggggcgttcccaaaaaaaggtttttttccctctaatttttgccccccctgtgccggc
DCI01_0029_B07.b : gggggccttttttttttgggggcttattccccccccacaaatttttttttaccccctcaa
DCI01_0047_B05.b : attacccttttttcaccgaacctggcggggatgggagccatttggagaacctttattctc
MLTL1_0079_G09.b : tagaggacccattagggggcctttttttatggggccttaccccccacaacaaagccttca
BKFL1_0057_D11.b : tcccatgccgcaattttgaaacattagctttttttcacccgaaccctacccgtaaatgaa
MLTL1_0094_H09.b : tattccnatgcccgtattatgaactattaactattattctacataagcctagcgtagaag
HTMT1_0106_H07.b :
HTMT1_0133_G03.b : aaaaaaaaaaaaaaaaaaaaaa
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0013_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxaAATTATTGAAACTATTAGCCTA*TTTATTCAAC
HTMT1_0063_A11.b : ttttacgatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0006_D11.b : nnnnggctagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0058_F02.b : ttgggatggtacgaxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b : nnnncgacggtagaggcagtagtaxxxxxxxxxxx
HTMT1_0090_D04.b : tttgggacggtacgaggccg
HTMT1_0128_F02.b :
HTMT1_0071_C05.b :
CBLT1_0072_E03.b :
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1433
HTMT1_0032_C04.b : caagaaagctaacaccaata
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b : aaaaaaaagccccccacatttggcgaggaattt
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b : taaatgtgtgggccgggcggttgt
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b : cgcgggt
DCI01_0069_B05.b :
DCI01_0068_D06.b : caacaaaaa
DCI01_0101_D08.b :
MLTL1_0057_C10.b : tccccaaaaaaaaaaaaaaaaaagccntnnnnngcgnnnnggtggtcccggggagacacc
DCI01_0029_B07.b : ttttttgaccccccctgtgtttggggttccccccaaaaaaaaaaaaaagagccgcccctt
DCI01_0047_B05.b : attggggcccattaccccccaccaccaaaccgtttacattaccccctctaaaatttaatt
MLTL1_0079_G09.b : ttacccccttaaattaattgacccacccctttttccggcttcccccacccnaaaaaaaaa
BKFL1_0057_D11.b : accaatttttcgggggccctttttttctttttgtgggggccttagcccttcacccaaccc
MLTL1_0094_H09.b : aagccaccttacgcgggcccttttattcttcattgggggccctttgccaacaaacaaact
HTMT1_0106_H07.b :
HTMT1_0133_G03.b :
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCAGGGCACCTATTAATTCATC
HTMT1_0090_D04.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCTATTAATTCATC
HTMT1_0128_F02.b : tttggatagtacgaggxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b : tttccgctggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0072_E03.b : nngga
HTMT1_0144_F05.b : ntttcgtttntnnn
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b :
CLNT1_0092_E02.b :
SKNB1_0031_E11.b :
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1493
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b : accaaccnnnnnnnnnnnnnnnnn
DCI01_0029_B07.b : tttt
DCI01_0047_B05.b : aaaccccacacttggttcccaaatat
MLTL1_0079_G09.b : aattttaaaaaaaagccccccatatttggcgaggtttttttgttaannnnnnntttttnn
BKFL1_0057_D11.b : aaaacctttccctttcaccccttcttaaaattaaattgaaacccgccacccttggttccg
MLTL1_0094_H09.b : aaaattttccatttcaacccctcttaaaattggatgggaaaccgacaacttaggttcccc
HTMT1_0106_H07.b :
HTMT1_0133_G03.b :
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCAACATCAGCACTATAACAGCTTTTATCACAT
CBLT1_0072_E03.b : caatgagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCACAT
HTMT1_0144_F05.b : nggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAT
HTMT1_0001_B04.b : nnaagatatctatggattaatgaattttttatcCAT
SPLT1_0059_H10.b : nnnccgcgattagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0082_A07.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b : nnaagg
CBLT1_0084_H08.b : ntaacgacaagtagaggcagtagtaxxxxxxxxxxxx
CLNT1_0092_E02.b : ggaaacgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : nn
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1552
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0057_D11.b : cgggtttttccccaatattggcaacatttgttttaacagcgagaaggggcccccttaagg
MLTL1_0094_H09.b : cggggcttcctccccaacccaaaaaaaaaaaaaaattgcccgccccaaattaaattttgc
HTMT1_0106_H07.b :
HTMT1_0034_C09.b : tttccaatcctcatcccaataaataattcttgaatttgcaaaaactcctgatccaaactt
HTMT1_0133_G03.b :
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : nccggttnnnnnnnnccaacgttgnccantgggatttCAGTAGCTCTGATCCA*GCTTAT
BMWN1_0027_E03.b : ttttggagcagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 1610
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b : gggaattctttctttcctgtt
MLTL1_0094_H09.b : cgccagaaaaggattttcaaatttattgtttctaaaccgcgcgaaaaaaaaaggtttaaa
HTMT1_0087_B06.b : GGGGTTACACTGCTAGTAgcctttatactaccgacaatacata
HTMT1_0106_H07.b :
HTMT1_0005_B12.b : GTGTaaaaaaaaaaa
SPLT1_0026_D03.b : GTGGTTtaccctgctagtaagccttatcctaccccgaacattcctaaaaaaaaaaa
SPLT1_0015_H11.b : GTGTTTACCCTGgctagtaaacttaaaccctccccgacaatacctaaaaaaaa
HTMT1_0034_C09.b : ttgtggtttaaccgggtatgaaactttttaccccccccagaaattcttttttgaaaaaat
HTMT1_0072_A06.b : GTGTTTACCCTGCCAGTAAGCCTtaaccctaccccgacattacttaaaacaaatctacaa
HTMT1_0133_G03.b :
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b : xxxxxxxxxxxxxxxxxxxxxTTATA*CCTACACGACA*ATACATaaaaaaaaaaaaaaa
---------+---------+---------+---------+---------+---------+ 1670
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b : cattcccccctttttnnnnnnnnnnccgtgggttaaaataattatattgtatnnnnnnnn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b : AAA
HTMT1_0008_D06.b : aaaaaaaaaaaaaaaaaaanattacccnagccnnnaatctccttttaaaaaaataaatgg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aaaaaaaanaannnanaaannnnnnannaaaaannnnnnaaaaannnnnngggtcccggg
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : taanattaataaaaaaaaaaattaaaatattttataaaatataaaaaaaaaananntngt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b : AA
HTMT1_0018_A01.b : aaaa
HTMT1_0023_C11.b : aaaaaaaaa
HTMT1_0041_F04.b : aaaaaaaaaaaanannaannnnaaaanaanaaaaaaaaaaaaaanaaaggacccgggccg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : aaaaaaagatgaaaaataacaataaatcgttactgagacgtactttataatctgcatgtt
HTMT1_0105_F02.b : agtctaaacaataagattaaaaagaatataaagaataataattataaatacttttgttgg
HTMT1_0067_A01.b : nnnnnnnnnnnnnnnnaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C09.b : taatatatggacccacaaaccaaaaaaatttttttactttttgttatataaaaaaaaata
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b : AAn
HTMT1_0020_D11.b : AAAn
HTMT1_0062_C06.b : ataaatattttattataattactattccctgattcccgtntagtgggggctcccctggag
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : aaaaaaacannnaaaannttnnaaaaaaanaaaaanaaaaaaaaaannnggggtccgggg
HTMT1_0093_H08.b : aaaaaaaaa
HTMT1_0107_A03.b : aaaaaaanaaaaaaaaaaaaaaaaaaaaaaaaaanaanaggggtcccggggcgcggattc
HTMT1_0034_C09.b : aataataaagctattaaataatattggaccgcgggccccggaatatccctttttgggggg
HTMT1_0100_G08.b : aataaaatttaaaaaaaatagaaaaaaatatataaaatataatataattataaaaatant
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngtccggcggcgcggatctcctttgtgagg
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b : AA
HTMT1_0130_A01.b : A
HTMT1_0088_A10.b : aaaaaaa
HTMT1_0131_D04.b : ataaataaatttatattattnttaatttttttnnnntttttctatgccggcgggcccctt
HTMT1_0045_C09.b : atagaaataaaatataataaaaatagtaccggggccgcggaacttccttttgggggggta
HTMT1_0034_F03.b : antaaaaaaaanaaaaaaaaaataaaataaatagnnttttttntttttttttattttaat
HTMT1_0029_D02.b : aaaaaaaaaaaanaaaaaaaaaaaannnnnannnnnnnannnanannnannnnnananaa
HTMT1_0143_C10.b : canaaaaanaaanaaaaaaaaaaaaaaaaatgggtccgcggccggggtatcccctttggt
HTMT1_0006_H08.b : aaaaaaaaaaaaaaanaaagaaannnnntaaaaanaaaaaaataanaaaaaaaaaaangg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : atgtatcatacacacacatattatgaccaactataatatttagctcagaaaactcggctc
BFLT1_0124_E05.b : Axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b : aaaan
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : aaaaaaaaaaaaaaaccccannaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : aaaaaaaaaaaaaannnnnnccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0101_B11.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaannggttcc
HTMT1_0134_A12.b : acagaccaaaacaatatcaaactttgccattatataataaatctcacatcttctattatg
MLTL1_0049_C06.b : aaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagttxxxxxxx
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : aaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : aaaaaannnnnnnnnggcccaanaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxx
HTMT1_0078_D05.b : AA
CLNT1_0012_B10.b : aaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : aaaaaaaaaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxx
MLTL1_0041_H03.b : aaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b : AA
HTMT1_0150_H01.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : aaaaaaaaaaaaaaancgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b : AA
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : aaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b : AAA
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : aaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b : aaaa
CBLT1_0084_H08.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxx
CLNT1_0092_E02.b : AAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : aaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b : aaaaaa
---------+---------+---------+---------+---------+---------+ 1730
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gcccgggcccggaatcccctttgggggggttattgggcccacacgaaaaaaaatttgatg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : ccccggaattcctttttgggggggttattgggctccaaaagggaaaaaaaactgtgggga
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : ggcccggggcgcccgaatcctcttttgggggggtttttgcgcccccaaaagaaaaaaatc
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ggaatcccctttggggggggtaatgggaccccaacagaaaaaataattggtgggtttgga
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gcgtcctaatcgaccaaacatatattgaaaatttggcgtgcttccgcgccttaattcctt
HTMT1_0105_F02.b : tgccggggccccgcttccccctgggggggggtttttggcccccaacataaaaaataattg
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0058_C09.b : aatatggtgggaccgggggcggggaatcctcttttgggggggtttttgtggaccaaaaat
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : tcgagcggtaatggaaccctttgggaaatagggaaatggagaattgggaagccccacaaa
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gcggggaattcctttttgggggggttattggggcccaaactgaaaaaaaaacttgggggg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccttttgggggggttatttggtcccaactggaaaaaaactttggggggtgggaaaccccc
HTMT1_0034_C09.b : ggtattggtgacccaaatagaaaaaaaaaacatggagaaaattgggagaaaacccaacct
HTMT1_0100_G08.b : atnnntggggccccggggcgcgacttctctttggggggttattggaccccaacaaaaaaa
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : gtnattgaatcaagactgatagatacttgatgatttgaacnaccaaactagatgcgtgaa
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : ttccgcgggtggggggatcctatcgcacaagaaattagaggctgggcgactccacaacac
HTMT1_0045_C09.b : atgggaaccaaaatggaaaaaaacttggggagttggaaaaaccccactagaaggcgggga
HTMT1_0034_F03.b : aatantantttggggagggggggggggaggatctttttttgtggggggggggtgtccccc
HTMT1_0029_D02.b : aaaaannnnnccggacccggcccccacttccccgggggggggttaactggacacaaagaa
HTMT1_0143_C10.b : ggggttaatgggatccaaactggaaagaactttggggggttgggaaaacccaacctagag
HTMT1_0006_H08.b : gcccggggccgcgaatcctctttgggggggtaattggttccaaaagaaaaaaatcttgtg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : acaatccaaaacctttcgaaaatcttaactaaatataagtatgcgcgaggggtccttctc
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnn
HTMT1_0101_B11.b : cgcggccccggaatccccctttggggggggttattgggtcccaaacttaaaaaaaccctt
HTMT1_0134_A12.b : ttgtccccgggcgctaaaattcccatatgtttgggttataatcgatccccaccacataat
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1790
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gttttggcaccccccccgggaggcagggaaaaaaggcttctttggaaattggagactttg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : tttggaaaaacccccacttaaagggccggaaaaaataggttttttttggaaaaattggga
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tggtggggtggggaacacccccccaagggggcgagaaaaagtgtttttttggaaattggg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : caacccccccttgagggggggaaaaaaggtttatttggaaattgtgggagctttggtttt
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gtgagggagggttgatcgctacacaaaatttaaaataacttttgtattagtcaccaacac
HTMT1_0105_F02.b : tgtggtgggggacaccccccaattaagggggggaaaaaaagctttttttgtgaaaattgg
HTMT1_0067_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
HTMT1_0058_C09.b : aaaaaaacattgggtgggggggggcacccccccacttgaagtggggaaaaaaaagcgttt
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : aaagggctaaaggagaaaacgtgaaaactaaagatttgtaagacaaccttttaattggaa
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtggggacaccctacccttgaggggggggaaaaaagggttttttgtgaaaatttgggagg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccctgagggggggaaaaatggctttattgggaaattgggggcgcttgcttttttgaaacc
HTMT1_0034_C09.b : ataaagggtgggaaaaaaaatcgtttttttgtggaaaaattgtggaagaaaattgtttat
HTMT1_0100_G08.b : aaacttgggagggtgcgcacccccccaagagggggggaaaaaaggctttttggggaattg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : aaaagccttattggaatttgggaggcttgcttaattgaacctttaagcggcaaaaaagta
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : atgaggggaagaaagacttttgggtaattggaaggggggctttttgttttctttcaagcg
HTMT1_0045_C09.b : aaaaagggtttttttggaaaatttgggaggctttggcttttttgaaccattttaagctgg
HTMT1_0034_F03.b : ccaaacaataaaaaaaatgggggtggggggggacacacccccatggaggagggaaaaaaa
HTMT1_0029_D02.b : aaaaaattgtgtggttgggcacacccccgcgaggggggaaaaaaatttttgtgggaaatg
HTMT1_0143_C10.b : ggagggaaaaaaggctttatgtgaaattgggggctttgctttattgaaccttatagccgc
HTMT1_0006_H08.b : gggtgggaaccaccccacacaagggggaaaaaaaggctttttgtgaaaattgggaagttt
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tttttaaagaaaagtcttcattatcacacatagctatcaaaataaattaggagccgccca
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : gggtgggttgggaaaacccccacctgaatggggxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : caatatctcttagtgaactagaaaccaccccatcaataattgtgggaataaaaatcgctt
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1850
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : ttttatttaaaccctaaaccgcgaataaaagtaaaaacaacgttgttttttttttttcag
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aggcctttgtttttttttgaaaccttttagacccgaaaaaaaaagttttaaccacccact
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : gaggctttttttttgtaacacataaggcggaaaaaaaattaaacaccattttttcttttt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ttgaaacctttaaagcgggaaaaaaagttaaaaaaccatgtgtttttttttttttttcgg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : cccgagaagaggggaaaaaaagaccttcttttcaccgaatagggggaccagtatctagta
HTMT1_0105_F02.b : acccgctttcttttttttacacctaatggcggcgaaaaatatttaacaaccccccttttt
HTMT1_0067_A01.b : acaatgcttctttagtttcagtcaggagggggggggaggtttttccttaaaaacgcaccc
HTMT1_0058_C09.b : ttttggaaaaatggggatgcttttttttttttccacctttatgccgggaaaaaagattca
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : aaaatatgagttaaaaaaaataatgaaacacctttatagtctcatataacgagaaacacc
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtttgtttttttgaaaccttataaggggcaaaaaaaagtacaccacaacattggtttttt
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : tttagcgccggcaaaaaagttacaaacacttgttttttttttttttggggtggggggggt
HTMT1_0034_C09.b : tattttaacactttaatgggggcgaaaataaagttataacaacacattgggatctcttct
HTMT1_0100_G08.b : ggaggccatgttttttttcacccataagggcgaaaaaaaaaaacaccatttttttttttt
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : acacacaatgtttttttagttcagtcgggaggggggggaggttttccgaaataaccccaa
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : aaaacaaaaaaaaataaatgtatttttttgttttgttcggggggggggggggggtttttt
HTMT1_0045_C09.b : aaaaaaaaattaaaaacacaaatgtgttttctttttgtttcgggtgcggggggggggggg
HTMT1_0034_F03.b : attctttttataaagaaagaggggagagctttttttttataccccaccagaagggccaaa
HTMT1_0029_D02.b : ggggagctttttttttttaaccttaacccccgaaaaaagataacacactttttttttttt
HTMT1_0143_C10.b : agaaaaagttaccaaacattgctttttttttgttcggttcgggggggtgtgggatttatc
HTMT1_0006_H08.b : tttttttttaaacctataacgcgcaaaaaaatttaaacaaaatttcttttttttttttcg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : aaaattcataaaaaaatctggaaccaatcctcttttaaatgaaataaacgaccattcata
BFLT1_0124_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxggaataaaaaaatcgggggtttcccccggaaacc
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : taacatagaaaaatttgaaaacttctgtcctttatttataaactcctaaatccgcccata
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b : nnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1910
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : ggaggggaggggtgggggtttttttttaaagaacccccaccccggaaaggggtttttatg
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : tttctttcttttttttttccaggttccgggggaaggggtgggaaagtttttttcgcaaaa
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tttttgcggcgggggagggggggggtttttttaaaaaaacacacccccagggagagggtg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ggcgggggaggtggggaggtttttctcaaataaaaacgccaccccggggaaagggggttg
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : caacacacgaagagttaactaaaataaaataacaccacagttctctttttattcctttgc
HTMT1_0105_F02.b : tttttttttttctggggcgggggggggtggggattcttttctccaaaaaacaccccccac
HTMT1_0067_A01.b : ccgggaaaggttttggattggggctttcctttcccaaaaaaacaagcccggggttggtgg
HTMT1_0058_C09.b : acaccattttcttttttttttttttccgggcgagggaggaggggggaagttttttttcaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ggaagggttttgggggtataatatctcacgaaacaaaggaaacgcgtttgggaatagggg
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : ttatttttcagtggggggaggagggggggaggtttttctcttaaaaaaaccccacccccg
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : gggaggttttttctcataaaaacccccccccggggggaggggttgtattgggcgtttctc
HTMT1_0034_C09.b : atgtttccaagtcccgggggggagggggggagggtatttttgcgtataataaaaatgcac
HTMT1_0100_G08.b : tattttggggggggggggggggagttttctccaaaaaaaaccccaccgcggggggggggg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : ccgggggaggggttgcattgggccttccttccccaaaaaaccggcgggttgtgggggggg
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : tgagaagaacccccgaggggggggggttgggatcggccttcctccagaataatcgggaag
HTMT1_0045_C09.b : ggaggtttttctcacaaaagaaccgccaacccccggggaaaggggtttgcaatgggggct
HTMT1_0034_F03.b : aaaaaagaaaaactatctttttctttttttttttgttcggcggggggggggggggggttt
HTMT1_0029_D02.b : ttattgggggggggggggggggggttttttaaaaaaaaccccccggggggaagggtgtgt
HTMT1_0143_C10.b : tccttcgacatgaaacgatgaagcatacagaccttaaacacttaatcggtcaataatata
HTMT1_0006_H08.b : gggggggggggggggaggatttttcttaaaagaacccccccggggaaggggctttaattg
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tattttttctcaaaggaattttataaaagaaaacaacacgctacttcctactataacaga
BFLT1_0124_E05.b : xxxxxaacccaatttattctcttccgttcccccacaaaaaccccgggcccggtgtttggg
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : tccccggggcctctccggattcaaaccgcccctaaacgaaaacggtccccctttccccct
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : aacaaattaaaacaccctctttcaattttttttttctttcaaactcatagacaagggttg
MLTL1_0049_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgac
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 1970
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : gccctttcccctcccaaagaaccggcctgggggggggggggggctattcctccgagggta
HTMT1_0005_B12.b :
HTMT1_0010_A12.b : aaaaaccccccacccccccccggaaaagagggttttgctatttggcc
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : tttttgggcttttcctcctcaaaaaaagcgcggggttgggggggggtttcctcctggggg
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : ttattggccccttccctcttccacacaacactcccccggggttgtggggggagaggttcc
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gcgggaggaggagggaggaatattttctttacagaaagtcaccccctcacgtggaggaaa
HTMT1_0105_F02.b : cgcgagaaggggtgttttattgggccccttctctctctcaaaaaaaactatccggttgtt
HTMT1_0067_A01.b : ggggggttttcctccgggggtggtttcctcccggtaaccggaaaaatggaagggcaaggg
HTMT1_0058_C09.b : aaaaacaccccccccccgcgggaagaggggtttgttttgtccttcttcccctccccccaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ctctagaagtgtgcctcaagtacttatgcatcaggccccacacggcgagaggggcagagc
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : ggggaaaggcgttttcatatgggcccttctcctctcccccaaaaaatacaggcccgagga
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : tctcccaaaaaacccgcccgggtttggggggggggtgttctctcaagggggtatggtttc
HTMT1_0034_C09.b : cccccccgagagagaagagggtctttattttgggaggtgcttactcatctctcctcacat
HTMT1_0100_G08.b : ttgtagggccccttcctcccccaaaacacgcgcggggtgggggggggggggttcctctcg
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : gttcccccaggggtaaggtcccaacgggaaccgaaaatgaaaagccagcgaataaagggt
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gtggggggggagtttcctggggaggtttcctctcgatagaaaaaatataaggaaatgaag
HTMT1_0045_C09.b : cttccttctccctcaaaaaaacaggcccggggttgtgggtgggggggggtttactcccca
HTMT1_0034_F03.b : tttcttaataaaaacccccccacccgggggagggcgttttgaaatgcgctcccctccccc
HTMT1_0029_D02.b : gttggtccttccctccaaaaaaacgggagggggagggggggggggttttcctccggggga
HTMT1_0143_C10.b : ccagatattgaatagaacctgatctcaacaataatcctgatttgaacaaaaccaagttaa
HTMT1_0006_H08.b : ggcatttctttccttaagagatcgagcgagtggggcggggaggtttttaccggggggtaa
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : gcgatgaagggatgagaggtgaaaattttcttgataaaaaacgctacctcaccgcacggg
BFLT1_0124_E05.b : gggggaggggttctccccctaagggggaatcggttcccacaaactgggaaaccggaaaaa
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ggggaaggggggccttttccaaacccagcggaagtaccccatttggggtggggcgtcccc
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0134_A12.b : ttatatttttttttctatcataaaaaacccaacaactccaccgaaaaaatattatctttc
MLTL1_0049_C06.b : tggagcatccaacgcatgatgactgaatcgcacgnatcacacttgtccttgcgaaaaatt
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
---------+---------+---------+---------+---------+---------+ 2030
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : tagtttcccaaacggaaaggaaaaattggaaagccagaggcaaaaaagccgttggttata
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : atttttccaaaggggaacgaaaattttaaggcgaaggaataaaggcgtgtttttatcccc
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : tcccaggggggatttgtttcccaatgggggacacgaaaaaatggtaaaggcgaaagggac
HTMT1_0005_G02.b :
HTMT1_0036_D01.b : gatgtggtgaaatgtccacctctccttcatacgatatatatagagagagg
HTMT1_0105_F02.b : gtgggggcgaggggtcccctctaggggggttttgtttctcacaaggggaaactgagaatt
HTMT1_0067_A01.b : gaccaaggggggtggtttttttcccccccccaaaccccaagggacgggaaaagcccaaaa
HTMT1_0058_C09.b : atatactcgggcccagtttctggggtggggggggtttcttcccccggggggtgtggtttt
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ataaatggttttacgggtccgaaatcgctgtaatcagggggaaacagtgggaaagatgga
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : gtggggggggagagtatcttcttctctgagggggattgtttctctcaaaaggggaaaaca
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : ccatggggaaacggaaaaattgtaaggcgaagaggcacaaaaggcggtgtgtgtttctgc
HTMT1_0034_C09.b : atacattatatagcagctgatattcacagagagcaggagaaattaacattctcaccaagg
HTMT1_0100_G08.b : agggggttgttcccacatggagtaaaaaaatatttaaaaggagagggcaaaaagggcggt
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : tgggtttttggccccccaccaaaccttagggcccgaaaaagtccgcccgcctaccccaat
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gtaagggggttgtttttcccctccccaaacacactagggaaaaaataaatccccgccgcc
HTMT1_0045_C09.b : caagggggagaaggttttcccaaannngggttnnnnnngaaaaannngngaaaaggcgca
HTMT1_0034_F03.b : accaaaaacaaccccgccgggtttgggggagggagggttttctctcggaggggagattcc
HTMT1_0029_D02.b : tgtctcccaaggggaaaaaaaaaattggagggaaaggaaacaaagggggtgttttttgcc
HTMT1_0143_C10.b : taagacacaacaatataatcaactgtaatgaacataagacacaaaagctgaaaaacgatg
HTMT1_0006_H08.b : tttccaaatgggaaaccaaaaaattaaaagcccaggcgaagaaagcggggtttttttccc
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : agaagatacaattcgggactccttatcataccaaattaacatagaacctattttctggtg
BFLT1_0124_E05.b : attggacaggggcccaaggcggaaactaaagggggtttgtggttttatggcccccccgga
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ccaggggggtggggaacaaaccccgtttagccaaaaggggggctttaagggtaatttttg
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : xcccccaaaagatatccctcccccctggtttttgggcggggggggaggttttccccccac
HTMT1_0134_A12.b : tattggtgaccatcacatccttatctatataaataacaactcaacatccataatctatta
MLTL1_0049_C06.b : gcatgggaacggggcaaatttgctattgccctttatcaacggggaacccccggatggtga
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : CTCCCCCGGGGGGGGGTGAATCGGTTTCCC..............................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : taccccccgaacaaaaccttaagggcccgactaaagtccccacccgccctcacccgaagc
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : cggaaaaaacttaggggacaagaaaaagcctcaccgccccccactaaccttcgggttctt
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b : acaaaagggcggtggttttttgtgcccccgcgaaaaaaaatctgaaggggccacac
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b : tgtgagagggaggaggaagaaaaggcgggtgttttcttctccctccgcaacatataccta
HTMT1_0067_A01.b : ggcgcccccaagcctgggtcacacatatattgnnagattatttatgac
HTMT1_0058_C09.b : cccaaagggggaatccagaaaatatttccacggcctcaa
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : agaaaacaaaanaagagggacgtgaggcgttctggttgtctctgtggcttccagaatcta
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : agaaaatttggtgaaggcgcnaaggcggccaacaaaagggctgtggtggtttctatgcct
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : cccccgcaaaaaatactctgtggggacaaagaaaaagcctccagacccgcgcctccgccg
HTMT1_0034_C09.b : gcgggagaatgtctatcactcaaaataagtggtatatgtcgagatataattgagtactan
HTMT1_0100_G08.b : ggtttctccccccccagaaataaccgaagggggccgaaaaaacccctcgaccgcgcctcc
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : tccagttaatttgttggccccntnnnnnnnnncggnnnnnccccccaacagctagtaaat
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : cccacgcaagctcctgagttattttttttnngngnnaaccccnnnnccccgcggggggtg
HTMT1_0045_C09.b : agagcggatactaagaggcggctcgggggtttat
HTMT1_0034_F03.b : tcccccggaggggagaccaaaaaaatgattgaagcgccccgccgccctca
HTMT1_0029_D02.b : ccccaaaaaaacccgggggggccaaaaaaaccccccccacccttccacaagatttctaga
HTMT1_0143_C10.b : aaaactacagtacgcaaagctcatcctctcacgcccgtatctataacaacaatagacacg
HTMT1_0006_H08.b : cccccaacaactgtctatgaggacaagaaaaaactctcactctcctcttcagcaaaatgc
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : gtagaaaaacatctcacaaaaagatatattctcatatcccttacagtaaacaaatataaa
BFLT1_0124_E05.b : aacaaaaaaacccctttggggggaacaccggaaaaaaaagggtcccgaaacccgggcctt
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ttgggcccaccgggaaaaacatttttcccccgggccccccctggtaaaagaataaaaaag
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : ctagggggggaaatattgtttccccacaaatacgggggaaaacccgggaaaaatttgttg
HTMT1_0134_A12.b : tttagactcggacgacttctcctcctacattaagggagctatattgcctctccacaacaa
MLTL1_0049_C06.b : aaaaaatttccaaaacctttgaaaagcggtttccgaacccccttgaaatattgaaacgcg
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : CTCCCCCGGGGGGGGGTGAATCGGTTTCCCcccagaggggggggaaacccgaggaaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : tcctcgggctcccnnannngggatgggccccncctgtcccccgcgaggggacgacacaat
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b : agtatggcgcggccccaccctctaaa
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b : tgaggggccgaagaaaagtgtcttcctctcccgtctactacctttattttg
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b : ttatagaggagag
HTMT1_0133_H07.b :
HTMT1_0048_G04.b : cccctcgagcaacaataccttcggggaggggaccc
HTMT1_0093_H08.b :
HTMT1_0107_A03.b : agatttcgcgggggcttcggagaggggtgcggccacaccc
HTMT1_0034_C09.b : cgcgtgctcaagtgggcgctaccatagaaacgaagctgtga
HTMT1_0100_G08.b : acaccatagaatctagagggtaaaac
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b : aannnnnnnnnnnnnnnnngccgcnnnnnnnnt
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : gggagagagatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b : gtag
HTMT1_0143_C10.b : agcgagacggtcgctcctgnnnncacnnnnnnnnnnnnnnnttntncaannaacattatc
HTMT1_0006_H08.b : tctaaggactaaaaatatgatatggagggcgccccctataccacacccaaaatagctcat
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : tctgtatacttaagaaataatatatactggtttattcttatcatcctcgccacaccaaan
BFLT1_0124_E05.b : ttacaccataaaaactctttccaggagggtttaccaaattattggagtgcgcgggggacc
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : ggggggggggggggcaacaattttggggggggcccacccccccaccaaaaaaaattttgg
AMP01_0036_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0101_B11.b : acaagaggccccaaagggccgaaaacataaaaggccgctttggttggtttttttcaaggc
HTMT1_0134_A12.b : ttgaggaaaaaccctagctaatacactacatacatataaccaataattatatctctaatc
MLTL1_0049_C06.b : accctggttcccaagaaaattttttcggaaaggaaggaaaccaacccccttttctaatgg
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0041_H03.b : xxxxxxxxxxxxxxxccctaaggaaaaaggcagttttccccaaaacccccattctgcaaa
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : atttgtgaacaaagggcccccaaaaggcccggaaccctaaaaggggccgggtggggggtt
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : atannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b : acaacgacgaggccgatccccatagttgcactgnaatnnnnnngtggtaatgttgntntn
HTMT1_0006_H08.b : acccaattaataacnnnn
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b : ataaatnctcgtggacgacaagaagaaaatctctgagaaagtgatatctacc
BFLT1_0124_E05.b : ccccccctccattttccaaaacaccgcaaagagagt
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0124_H09.b : tctcccccccgacaccctcccccaaaaagtggtcttctgccaaaacaacccgggggtggt
AMP01_0036_E10.b :
HTMT1_0101_B11.b : gccccccccggaagaaataaaaaaatcccccctaatgagaggggggaaccccaggagaat
HTMT1_0134_A12.b : tcctaagcgcggctctttctcattatttctccacctcccctccccctatagaatattata
MLTL1_0049_C06.b : aaacgggaaagaaggaagtttttttagaaaaggggaggagaaaaaaggaggnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : xxxxxxxxxxxxxxxgaaaaaatccaaaaatcccccctcaaataaagaggggaaaccccc
MLTL1_0041_H03.b : aattggaaaactgccggattcccctggtttcccccaaaccatgaaagttccatttcccag
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : tttttccaaaacgccccccccccgggaaaaaaaaaaaaaaatatcccctctgaggggagg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b : nn
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b : ng
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b : nnnnnnn
HTMT1_0124_H09.b : tttttttcacaaaaccccaaaaaaaaaacaaaatttttttttgcggcccgaagaaccaac
AMP01_0036_E10.b :
HTMT1_0101_B11.b : ataaataaggtgttttccccgagaacccctcgggccttcctgttaaccccgcgatagaag
HTMT1_0134_A12.b : aaatatccctcattattcatgagttatatatcaccagatgtatactacttacttgtattc
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : xxgctaacgaaactggtcgctttctccttcggagggggggcttcccaagtcacctgagga
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : aaggaaataaaaaacccgggggtttcccccagaaaaccccccggggcccctctgattcaa
MLTL1_0041_H03.b : ggaagggttaaaggggaaacattccaataacccgtcccctttttttggcaaaaattcgga
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gggggaaacccggcgggaaaaaaaaaaaacggggttttcccccgggaaaccccccggggg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : xxxxxaaaataaaaaaccgggctttctcccggaaacccccctcggggggctcccggttcc
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b : ggggggtgaaaaaaaacctccctaaaaataaaaaataaaaaaaaggaggggggggntttt
AMP01_0036_E10.b :
HTMT1_0101_B11.b : aatgtcccctcttcctgggggggggccttctcatacccaggtaatctctctggggagtct
HTMT1_0134_A12.b : tcccatatgaatcatccatagatcctcatcatcctcactcctatctaatatataatctcc
MLTL1_0049_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : accaattcgggaggcgtcccccaacggggtgggtgaaacccccttaccaaaggtccctta
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0019_D05.b : cccggcccttaaagaaaacggtcccctttcccctagggaaaggggtcttttccaaaacca
MLTL1_0041_H03.b : aacttctcggggcaaaagttaaaaggcgaaaaattggtttttctttggtttttaggggca
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gcctcttgttcccaacacgggcaataagaaaaaccgtccccctttttcccgggggagagg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : caacccgccctttaaggagaaacgggcctccttttccccttaggggaaggggggcctttc
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggggaagggggggcctttcca
CLNT1_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b : tttccttccccga
AMP01_0036_E10.b :
HTMT1_0101_B11.b : cccacccagtgtgttaaacccc
HTMT1_0134_A12.b : tctatatttaccaggtgagtcaatctattc
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : cggaaaaaggtttgaacacccggaaaaaaattacccggggaaccggttaagtataaaaag
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : ccgggaagaatccattgggggaagggcccccacaaaggggggggggaaaaacccctttac
MLTL1_0041_H03.b : ataccccaaaggggtgttgatttcacaccgaaccccaatttttaaaccggagatacgggt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : gggggctttcccaaacccacgggggagtattccagtgggggggagggcccccccacgggg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ccaaaccccccccggagggatataggtggggggaggggctccccccccaggggggggggg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : aaaaccaagcggggagggtaccacagttggggggagggggtctccccccaagctgggcgt
CLNT1_0092_E02.b : xxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : gaaagggggccaaatttaggggccacaccccccaaaaaattgtggccccgccaccctcca
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : acaaaagctcccttaagggaaaatttcttgaaccccgcaaaaaatatatttccgggagca
MLTL1_0041_H03.b : aaccgttttttcttttctccgaaaaaatcttaatataaaaaggcgccaaaaaaagctttt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : ggggggaacaaaacccccttatacgcagcgggggcctttaaggaaatatgtttgttcccc
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggaaaaacccccgtttaacccaaagggggcccctttgtggggaatatttttttggaccca
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : xxxxxxxxgattccaaccggaaaaacaacttatcccccggcaacacccgtgtaaggatta
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : gggggaaaaaaaccccccgttaagccgaaacggtgggcccttaaccgggaaaaaattgtt
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : xxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b : aaag
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : cccgggaaataaaaacagaggaagagggcgcacaatttatagggggccacacccccccaa
MLTL1_0041_H03.b : ttttatattccgggtcaaatttttaagaattgttt
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : cggggaaaaatttttcccccgggcccccttggaaaagataaaaaagggggtggggggctc
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : cccggaaaaaatattttttcctcccgggcacggcccgtgggagaggtaaaaaagacggga
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : caaaaggggttgtggcgggccacaattctagaggggggccatctcggccaccaaaaaact
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : ctggagtccaacccggggaagaaacaaattttctcccccgtgggaagaaccccggggaaa
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b : aaaatattgtgggcgcgtgaactcctaaaaaatattctctcccca
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : acattttgtgggggcccccacccaaaaaaaaatttgtgtccccgccgacccctccaaaaa
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : gggggggcgggcccaaattcttgaggggggcccaccagggccccaaaaaaaaattttgtt
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ttttggttcgcccctgcaaaccatttccttcaaaaaatttggactttttcggaaaaaaac
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctacccaaaaaaaaatta
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : agggaataacaaaaacgagggttgtggggcgggcgccaaaaaaatcttgggagggggggc
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : atgttcctgcccaaacccccgggggggtttttgaacaaatcaaaaaaactataattttgt
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : tttggccctgggaaacatttccctgaaaaaaagtgggtttgttgtgagaaaaccccgggg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : acggtggaagtgtttttgttggcacatattcccgaaaaaagggactaaaaatttactttc
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : tattggactcgcctcttcccaaaccacattccctcagaaaacaattttggaccttttttc
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : ctaacaacgggaacaccaaagaaaaaaagttttgggtaatcgcgccccgggggaaacgca
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b : tggccgg
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggaggggtttttttgtggcccccaacccccaaagagagagggagaactttttttctggcg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : tgggggaaccccggagaaaacattaggatgtgggatataagagtccccactttttaaagg
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : gggaaacaaccacaccttggaacggggtatttatgttttcatcacaaaattcctcaaaaa
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : gttatcttatggaaaaaaaatgtgtgttttctgtgttacggaaaaaaaaacgaggggggg
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : ggcgcgcgggagaaaaacaagggggtggcgtaaaaaaaccccccctccttaataagaaaa
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ttttactaaaatggaagtgtggataacataggagcataaatattctattggctcctaata
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : aagcttcaacaaattttttattcctttcgtggtctcaaccatggaaagaaacatttcaat
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : tgaggggtggttttttgggtggcgcaccaaaaatttgccggaaaaagaaggaccnaaaaa
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :
HTMT1_0102_D10.b :
HTMT1_0018_E12.b :
HTMT1_0054_C11.b :
SPLT1_0071_A05.b :
HTMT1_0062_F03.b :
HTMT1_0114_B08.b :
HTMT1_0061_A11.b :
HTMT1_0098_H12.b :
HTMT1_0132_F06.b :
HTMT1_0020_D11.b :
HTMT1_0062_C06.b :
HTMT1_0133_H07.b :
HTMT1_0048_G04.b :
HTMT1_0093_H08.b :
HTMT1_0107_A03.b :
HTMT1_0034_C09.b :
HTMT1_0100_G08.b :
SPLT1_0063_B03.b :
ILNT1_0083_G05.b :
HTMT1_0125_H09.b :
HTMT1_0140_A09.b :
HTMT1_0049_B03.b :
HTMT1_0081_H04.b :
HTMT1_0143_D02.b :
HTMT1_0091_C02.b :
HTMT1_0137_D09.b :
HTMT1_0063_D10.b :
HTMT1_0130_A01.b :
HTMT1_0088_A10.b :
HTMT1_0131_D04.b :
HTMT1_0045_C09.b :
HTMT1_0034_F03.b :
HTMT1_0029_D02.b :
HTMT1_0143_C10.b :
HTMT1_0006_H08.b :
HTMT1_0070_C01.b :
ILNT1_0009_G02.b :
HTMT1_0072_A06.b :
BFLT1_0124_E05.b :
CBLT1_0098_E04.b :
HTMT1_0133_G03.b :
HTMT1_0059_B04.b :
HTMT1_0065_F09.b :
SPLT1_0038_B10.b :
CLNT1_0030_H07.b :
HTMT1_0124_H09.b :
AMP01_0036_E10.b :
HTMT1_0101_B11.b :
HTMT1_0134_A12.b :
MLTL1_0049_C06.b :
ILNT1_0063_C04.b :
HTMT1_0092_G08.b :
ILNT1_0001_D01.b :
HTMT1_0147_G03.b :
HTMT1_0020_C08.b :
HTMT1_0088_E04.b :
TES01_0101_E12.b :
HTMT1_0086_G07.b :
HTMT1_0086_F06.b :
HTMT1_0085_F07.b :
AMP01_0002_H05.b :
HTMT1_0078_D05.b :
CLNT1_0012_B10.b :
HTMT1_0061_F04.b :
ILNT1_0064_G01.b :
AMP01_0024_G04.b :
HTMT1_0019_D05.b :
MLTL1_0041_H03.b :
HTMT1_0144_H09.b :
CBLT1_0094_C08.b :
HTMT1_0068_B02.b :
HTMT1_0150_H01.b :
SPLT1_0028_F04.b :
HTMT1_0023_E04.b :
CBLT1_0009_B06.b :
AMP01_0032_H03.b :
HTMT1_0002_F08.b :
HTMT1_0013_E09.b :
HTMT1_0063_A11.b :
ILNT1_0006_D11.b :
BMWN1_0058_F02.b : acacagaaaagaggggggcacaccggagcgccctcttttctcctcg
CBLT1_0051_G05.b :
HTMT1_0090_D04.b :
HTMT1_0128_F02.b : ataggggtatctgtaacggcccccttattaacgaggagaccacctttgaaaaataataaa
HTMT1_0071_C05.b :
CBLT1_0072_E03.b : ggaatttgtacaaatataaagagttctccatacctcttaaaataaatagatttacancca
HTMT1_0144_F05.b :
HTMT1_0001_B04.b :
SPLT1_0059_H10.b :
OVRM1_0082_A07.b :
HTMT1_0003_F03.b :
CBLT1_0084_H08.b : attttgtttattcttttggggggggggcccgagggagaaagaaacctcggtgtgagggtt
CLNT1_0092_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0031_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0027_E03.b :
20110601C-000489 : ............................................................
---------+---------+---------+---------+---------+---------+ 2060
HTMT1_0032_C04.b :
DCI01_0059_D07.b :
DCI01_0106_C05.b :
DCI01_0034_A04.b :
DCI01_0081_H05.b :
DCI01_0108_E05.b :
DCI01_0023_B01.b :
DCI01_0089_G07.b :
DCI01_0021_D02.b :
DCI01_0093_F03.b :
DCI01_0069_B05.b :
DCI01_0068_D06.b :
DCI01_0101_D08.b :
MLTL1_0057_C10.b :
DCI01_0029_B07.b :
DCI01_0047_B05.b :
MLTL1_0079_G09.b :
BKFL1_0057_D11.b :
MLTL1_0094_H09.b :
HTMT1_0087_B06.b :
HTMT1_0106_H07.b :
HTMT1_0017_C10.b :
HTMT1_0129_E11.b :
HTMT1_0003_B03.b :
HTMT1_0008_D06.b :
HTMT1_0005_B12.b :
HTMT1_0010_A12.b :
SPLT1_0026_D03.b :
SPLT1_0015_H11.b :
HTMT1_0005_A01.b :
HTMT1_0008_B08.b :
HTMT1_0026_D03.b :
HTMT1_0090_E07.b :
HTMT1_0060_D07.b :
HTMT1_0079_H09.b :
HTMT1_0092_G06.b :
HTMT1_0079_E04.b :
HTMT1_0111_B12.b :
HTMT1_0102_D07.b :
HTMT1_0114_G09.b :
HTMT1_0026_H08.b :
HTMT1_0018_A01.b :
HTMT1_0023_C11.b :
HTMT1_0041_F04.b :
HTMT1_0005_G02.b :
HTMT1_0036_D01.b :
HTMT1_0105_F02.b :
HTMT1_0067_A01.b :
HTMT1_0058_C09.b :
HTMT1_0107_E08.b :
HTMT1_0013_B09.b :
SPLT1_0062_A04.b :
HTMT1_0014_G06.b :
HTMT1_0073_E05.b :
HTMT1_0047_G10.b :