
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000606

Length: 1,824

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO1alpha-enolase isoform 1 [Homo sapiens]. 8080.0O
Contig/Assembly ProteinENO2gamma-enolase [Homo sapiens]. 7230.0O
Contig/Assembly ProteinENO3beta-enolase isoform 1 [Homo sapiens]. 7130.0O
Contig/Assembly ProteinENO3beta-enolase isoform 1 [Homo sapiens]. 7130.0O
Contig/Assembly ProteinENO1c-myc promoter-binding protein-1 isoform MBP-1 [Homo sapiens]. 6350.0O
Contig/Assembly ProteinENO3beta-enolase isoform 2 [Homo sapiens]. 628e-180O
Contig/Assembly ProteinENO4enolase-like protein ENO4 [Homo sapiens]. 89.41e-17

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 7 [Mus musculus]. 8040.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 8 [Mus musculus]. 8040.0O
Contig/Assembly ProteinLOC100045967PREDICTED: alpha-enolase-like [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 4 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 5 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 2 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 1 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 6 [Mus musculus]. 8000.0O
Contig/Assembly ProteinGm5506hypothetical protein LOC433182 [Mus musculus]. 8000.0O
Contig/Assembly ProteinEno1alpha-enolase [Mus musculus]. 8000.0O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 2 [Canis familiaris]. 7230.0O
Contig/Assembly ProteinLOC479469PREDICTED: similar to Beta enolase (2-phospho-D-glycerate hydro-lyase) (Muscle-specific enolase) (MSE) (Skeletal muscle enolase) (Enolase 3) isoform 1 [Canis familiaris]. 7200.0O
Contig/Assembly ProteinLOC479469PREDICTED: similar to Beta enolase (2-phospho-D-glycerate hydro-lyase) (Muscle-specific enolase) (MSE) (Skeletal muscle enolase) (Enolase 3) isoform 2 [Canis familiaris]. 7140.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 4 [Canis familiaris]. 7020.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 5 [Canis familiaris]. 6920.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 3 [Canis familiaris]. 6860.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 1 [Canis familiaris]. 6750.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 9 [Canis familiaris]. 6730.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 10 [Canis familiaris]. 6730.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 5 [Canis familiaris]. 6690.0O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO1alpha-enolase [Bos taurus]. 8110.0O
Contig/Assembly ProteinENO3beta-enolase [Bos taurus]. 7210.0O
Contig/Assembly ProteinENO2gamma-enolase [Bos taurus]. 7210.0O
Contig/Assembly ProteinENO4enolase 4 [Bos taurus]. 85.12e-16

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO2PREDICTED: gamma-enolase isoform 1 [Sus scrofa]. 7210.0O
Contig/Assembly ProteinENO3beta-enolase [Sus scrofa]. 7170.0O
Contig/Assembly ProteinENO2PREDICTED: gamma-enolase isoform 2 [Sus scrofa]. 6360.0O
Contig/Assembly ProteinENO4PREDICTED: enolase-like protein ENO4 [Sus scrofa]. 87.42e-17

Assembly Members: 518      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVRM10042B09LVRM1_0042_B09.bCJ001973 AK232866
OVR010042F08OVR01_0042_F08.b  AK234314
PBL010036E07PBL01_0036_E07.bBP155914 AK396050
TCH010064D09TCH01_0064_D09.bCJ027009 AK398021


SNPs: 9      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000606 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ILNT1_0062_D07.b :
ILNT1_0065_C07.b :
SPLT1_0024_F08.b :
TCH01_0064_D09.b :
LVRM1_0125_D05.b :
PBL01_0036_E07.b :
OVR01_0042_F08.b :
SMG01_0018_B09.b :
SPL01_0069_G06.b :
PBL01_0059_F10.b :
PBL01_0024_A10.b :
ITT01_0067_A02.b :
OVRM1_0150_H07.b :
CBLT1_0066_H09.b :
HTMT1_0107_C05.b :
OVRT1_0068_C12.b :
LVRM1_0197_B10.b :
TES01_0095_C11.b :
TES01_0036_G04.b :
OVRT1_0009_C07.b :
SKNB1_0030_H01.b :
CLNT1_0071_C06.b :
OVRM1_0198_G03.b :
OVRM1_0089_B07.b :
SPL01_0029_G01.b :
OVR01_0101_G06.b :
LVR01_0098_C11.b :
TCH01_0042_A11.b :
ITT01_0044_G03.b :
ADR01_0077_G02.b :
BFLT1_0035_B01.b :
PST01_0032_E08.b :
TES01_0048_D06.b :
SKNB1_0057_D05.b :
TES01_0067_H04.b :
KDN01_0097_E10.b :
KDN01_0083_H11.b :
KDN01_0031_H09.b :
PST01_0098_C12.b :
OVR01_0080_F08.b :
LVR01_0029_A11.b :
OVR01_0028_H11.b :
OVRM1_0148_B02.b :
OVRM1_0085_G09.b :
HTMT1_0075_H10.b :
OVR01_0038_A04.b :
ITT01_0006_B08.b :
TES01_0074_A03.b :
TES01_0108_E08.b :
SMG01_0017_C10.b :
OVR01_0036_H02.b :
SPL01_0068_H08.b :
TES01_0009_A10.b :
DCI01_0024_H03.b : nntttctatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0076_G05.b :
OVRM1_0100_B12.b :
OVR01_0025_E07.b :
SPL01_0011_E12.b :
BFLT1_0085_G01.b :
THY01_0014_B08.b :
SMG01_0022_F10.b :
THY01_0060_H03.b :
BFLT1_0064_D11.b :
TCH01_0003_D04.b :
TCH01_0041_E01.b :
CLNT1_0006_C03.b :
LNG01_0080_H05.b :
ITT01_0091_E10.b :
OVRT1_0092_H06.b :
OVRM1_0118_C08.b :
DCI01_0011_B10.b : nnnnccgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_E11.b :
HTMT1_0127_B01.b :
TES01_0003_F11.b :
HTMT1_0099_F06.b :
BMWN1_0017_H07.b :
PST01_0021_D02.b :
HTMT1_0118_C01.b :
DCI01_0014_E11.b : nnaaagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0057_G08.b :
DCI01_0010_E05.b : ttctaggggatacttgggcgctgctcccacgccgxxxxxxxxxxxxxxx
HTMT1_0088_G03.b :
PST01_0063_E09.b :
DCI01_0047_A06.b : nnaatagtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F12.b : nngctacntaaaatcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_C06.b :
PTG01_0090_F06.b :
LVRM1_0098_C01.b :
OVRM1_0225_C08.b :
OVRM1_0218_A06.b :
OVRM1_0042_B11.b :
OVR01_0099_G06.b :
LVRM1_0175_C01.b :
OVR01_0074_C12.b :
OVR01_0074_D11.b :
OVRM1_0184_A04.b :
OVRM1_0217_E01.b :
ADR01_0014_C12.b :
OVRM1_0014_G04.b :
OVRM1_0015_H02.b :
OVRM1_0124_E12.b :
OVRM1_0087_B07.b :
OVRM1_0006_H07.b :
OVRM1_0068_E10.b :
OVRM1_0022_F03.b :
OVRM1_0103_C08.b :
PTG01_0056_B12.b :
OVRM1_0014_H09.b :
BFLT1_0117_F06.b :
PTG01_0063_A02.b :
OVR01_0102_C10.b :
THY01_0036_G05.b :
UTR01_0010_D08.b :
OVR01_0100_F03.b :
OVR01_0062_G12.b :
OVR01_0095_E11.b :
OVR01_0067_E11.b :
THY01_0036_E12.b :
OVRT1_0122_F07.b :
SPL01_0076_F10.b :
SPL01_0094_E10.b :
LVR01_0053_F03.b :
OVR01_0030_E08.b :
BFLT1_0113_C08.b :
OVR01_0077_B02.b :
CLNT1_0111_H05.b :
OVR01_0099_F04.b :
PTG01_0010_G11.b :
LNG01_0066_E08.b :
BFLT1_0151_E05.b :
OVRT1_0096_E10.b :
OVR01_0027_H01.b :
BFLT1_0004_D05.b :
OVRT1_0125_C07.b :
PBL01_0059_E06.b :
SPL01_0055_C09.b :
OVR01_0055_B04.b :
OVRT1_0093_C01.b :
UTR01_0066_B01.b :
BFLT1_0013_F07.b :
UTR01_0095_G08.b :
ITT01_0100_G12.b :
OVRT1_0043_E06.b :
OVR01_0001_E06.b :
LVR01_0043_D12.b :
ITT01_0086_C06.b :
OVR01_0049_D09.b :
CLNT1_0087_F02.b :
OVR01_0052_B02.b :
ITT01_0009_H10.b :
OVR01_0092_E05.b :
SPL01_0032_E07.b :
MLN01_0099_G05.b :
OVR01_0006_H06.b :
LNG01_0060_H06.b :
OVR01_0054_C05.b :
ITT01_0017_G12.b :
LVRM1_0042_B09.b :
DCI01_0031_H08.b : nnttaggatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_A08.b :
DCI01_0085_F04.b : tatttaccgatacttgggggctgctcgcgcgccgxxxxxxxxxxxxx
BKFL1_0024_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0003_C02.b : tctatagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A01.b : tcttatgcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0020_D04.b : nnnccgcatannnnnnccgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_F05.b :
BKFL1_0097_B08.b : nnnggctttnnnnnnnggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_G02.b : nnngggttannnnnnaacgaaccntaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0093_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
PST01_0068_B08.b :
DCI01_0082_D02.b : aaaanaacgtacctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_C12.b :
OVRM1_0073_B01.b :
OVRM1_0218_F03.b :
LVRM1_0134_F12.b :
LVRM1_0083_H10.b :
LVRM1_0011_A12.b :
LVRM1_0055_D01.b :
TES01_0053_H10.b :
OVRM1_0190_E05.b :
OVRM1_0003_H04.b :
LVRM1_0125_D10.b :
OVRM1_0011_E08.b :
OVRM1_0017_C08.b :
SPL01_0058_C02.b :
OVRM1_0029_G09.b :
SPL01_0026_C03.b :
MLN01_0040_A02.b :
ADR01_0074_D04.b :
UTR01_0035_E10.b :
OVRT1_0151_D02.b :
PTG01_0046_B04.b :
OVRT1_0099_E01.b :
BFLT1_0126_D05.b :
BFLT1_0029_H07.b :
PTG01_0004_B06.b :
SPL01_0051_B06.b :
PST01_0063_B06.b :
BFLT1_0027_C01.b :
PBL01_0035_E09.b :
SPL01_0008_G11.b :
BFLT1_0039_C03.b :
ADR01_0047_B05.b :
OVR01_0028_H10.b :
ITT01_0042_C03.b :
OVR01_0090_E04.b :
OVR01_0070_A01.b :
OVR01_0091_A01.b :
OVR01_0012_A04.b :
OVRM1_0022_E04.b :
OVRM1_0185_H09.b :
ILNT1_0074_G08.b :
OVR01_0088_G11.b :
HTMT1_0106_E01.b :
OVRT1_0121_F01.b :
CBLT1_0042_D05.b :
HTMT1_0132_F05.b :
OVR01_0046_C02.b :
SKNB1_0050_F01.b :
CBLT1_0033_G06.b :
TES01_0079_H04.b :
TES01_0102_H06.b :
PCT01_0031_E10.b :
TES01_0023_B02.b :
TES01_0107_F05.b :
PST01_0001_E01.b :
TES01_0049_C10.b :
TES01_0001_G02.b :
SKNB1_0089_D12.b :
TES01_0110_B03.b :
PST01_0044_D02.b :
PCT01_0002_H04.b :
SKNB1_0075_H11.b :
SKNB1_0016_A03.b :
PST01_0045_A08.b :
PST01_0048_B10.b :
PST01_0058_B10.b :
UTR01_0084_H05.b :
PST01_0008_H04.b :
ADR01_0018_C12.b :
OVR01_0021_H12.b :
LVRM1_0050_A03.b :
TES01_0032_D02.b :
TES01_0096_E02.b :
TES01_0048_G03.b :
TES01_0051_G07.b :
TES01_0058_E09.b :
TES01_0022_F11.b :
TES01_0088_H08.b :
BFLT1_0140_H08.b :
TES01_0103_E05.b :
TES01_0103_G04.b :
OVR01_0064_F09.b :
CLNT1_0038_B04.b :
BFLT1_0006_B01.b :
TES01_0096_E09.b :
ADR01_0054_C01.b :
PST01_0003_B04.b :
PST01_0051_H05.b :
TES01_0044_E12.b :
PST01_0065_F06.b :
TES01_0041_C07.b :
CLNT1_0037_B11.b :
TES01_0067_B07.b :
PST01_0095_D09.b :
TES01_0004_B06.b :
SKNB1_0023_E10.b :
ADR01_0052_A05.b :
OVR01_0017_G03.b :
TES01_0091_C07.b :
TES01_0091_E06.b :
TES01_0020_F09.b :
TES01_0063_C02.b :
TES01_0103_G12.b :
PCT01_0028_C04.b :
TES01_0068_C05.b :
TES01_0006_H01.b :
KDN01_0007_F07.b :
TES01_0034_E12.b :
PST01_0051_H11.b :
PBL01_0079_E03.b :
KDN01_0068_B08.b :
TES01_0098_E02.b :
SMG01_0097_E02.b :
PST01_0060_G09.b :
TES01_0052_F04.b :
SKNB1_0022_G12.b :
PST01_0029_D09.b :
DCI01_0023_C07.b : nnnncctatcttxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b :
OVR01_0103_G07.b :
TES01_0083_D09.b :
THY01_0056_A07.b :
PBL01_0009_A11.b :
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b :
OVRM1_0100_A04.b :
OVRM1_0117_B04.b :
OVRM1_0089_F07.b :
OVRM1_0079_B02.b :
OVRM1_0217_B10.b :
THY01_0020_C07.b :
THY01_0069_D02.b :
OVR01_0059_E03.b :
OVR01_0053_C04.b :
OVR01_0053_D02.b :
ITT01_0040_C05.b :
PST01_0020_E11.b :
OVR01_0018_G04.b :
OVR01_0009_C06.b :
OVRM1_0129_E11.b :
UTR01_0059_E12.b :
SKNB1_0054_A10.b :
OVR01_0003_H12.b :
OVR01_0004_D09.b :
OVR01_0009_F10.b :
OVR01_0010_F01.b :
OVR01_0034_C03.b :
LVRM1_0043_F01.b :
TES01_0077_C11.b :
OVRM1_0214_C06.b :
TES01_0068_F08.b :
OVRM1_0119_B04.b :
OVRM1_0153_C01.b :
ILNT1_0080_B10.b :
OVR01_0077_C11.b :
OVRM1_0201_B09.b :
OVRM1_0114_H06.b :
SPL01_0013_G03.b :
CLNT1_0114_G04.b :
OVRT1_0089_G12.b :
THY01_0094_A07.b :
THY01_0081_H10.b :
SPL01_0038_F05.b :
OVR01_0011_C09.b :
OVRT1_0094_A10.b :
SKNB1_0016_A04.b :
THY01_0030_D10.b :
THY01_0061_E05.b :
OVR01_0040_A08.b :
THY01_0032_E09.b :
OVR01_0027_A11.b :
KDN01_0068_B12.b :
OVRM1_0220_A06.b :
TES01_0077_H11.b :
OVRM1_0225_H08.b :
THY01_0119_B11.b :
OVRM1_0052_A02.b :
OVRT1_0061_B03.b :
OVRM1_0068_C10.b :
OVRM1_0113_F03.b :
OVR01_0077_D12.b :
OVRM1_0189_B03.b :
OVRM1_0217_D12.b :
OVR01_0056_A09.b :
TES01_0092_C02.b :
OVRM1_0099_A04.b :
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b :
OVRM1_0211_E08.b :
OVRM1_0129_G08.b :
OVRM1_0168_G04.b :
LVRM1_0055_F08.b :
OVRM1_0101_H10.b :
OVRM1_0185_B08.b :
OVRM1_0034_H10.b :
OVRM1_0092_B05.b :
OVRM1_0050_C11.b :
OVRM1_0206_E10.b :
OVR01_0099_G04.b :
OVRM1_0111_F09.b :
MLN01_0042_D11.b :
TCH01_0060_H08.b :
OVRM1_0049_H01.b :
OVR01_0064_G11.b :
OVR01_0056_D10.b :
OVR01_0088_H04.b :
OVR01_0078_A05.b :
THY01_0048_B01.b :
OVR01_0025_D06.b :
SMG01_0070_H05.b :
SPL01_0088_F02.b :
SPL01_0047_G11.b :
OVR01_0052_H06.b :
SKNB1_0029_F05.b :
BFLT1_0064_G07.b :
THY01_0044_G08.b :
OVR01_0022_D06.b :
PCT01_0021_G11.b :
SPL01_0062_A06.b :
LNG01_0090_B06.b :
OVR01_0090_D10.b :
SPL01_0073_G05.b :
TES01_0055_H05.b :
OVR01_0001_C12.b :
THY01_0079_B06.b :
CLNT1_0144_A03.b :
PBL01_0037_C03.b :
MLN01_0013_C05.b :
OVR01_0039_D09.b :
LVR01_0082_H08.b :
OVR01_0029_G05.b :
OVRT1_0104_C07.b :
OVR01_0064_H08.b :
OVR01_0008_E12.b :
OVR01_0064_E05.b :
PBL01_0058_G12.b :
OVR01_0028_D07.b :
MLN01_0040_G09.b :
TES01_0104_D10.b :
OVR01_0063_D07.b :
OVR01_0020_B08.b :
UTR01_0061_G11.b :
PST01_0057_G12.b :
ITT01_0088_H04.b :
SPL01_0102_H05.b :
MLN01_0097_G01.b :
PBL01_0053_G04.b :
OVRT1_0095_D02.b :
ITT01_0061_A02.b :
ITT01_0056_C11.b :
OVR01_0092_G05.b :
OVR01_0029_B05.b :
OVR01_0054_A04.b :
ADR01_0077_G04.b :
OVR01_0017_C06.b :
OVRT1_0038_C05.b :
THY01_0066_H06.b :
SPL01_0036_H06.b :
THY01_0207_A06.b :
OVRT1_0044_B01.b :
MLN01_0064_A01.b :
PBL01_0105_C08.b :
OVR01_0013_A07.b :
THY01_0058_G05.b :
OVR01_0055_H07.b :
TES01_0103_D06.b :
OVRM1_0069_C05.b :
OVRT1_0150_D09.b :
LNG01_0065_A06.b :
OVRM1_0086_A06.b :
PBL01_0040_B04.b :
OVR01_0027_A07.b :
PBL01_0055_G10.b :
OVR01_0085_G05.b :
OVRT1_0140_E08.b :
LVRM1_0003_C08.b :
SKNB1_0087_E06.b :
SPL01_0092_H01.b :
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b :
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b :
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b :
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ILNT1_0062_D07.b : nnnnccgacagtagaggcagtagtattaaxxxx
ILNT1_0065_C07.b : nnggcgcgagtagaggxxxxxxxxxxxxxxxxx
SPLT1_0024_F08.b : nnnggggagagtagaggxxxxxxxxxxxxxxxx
TCH01_0064_D09.b : nnnngggtaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_E07.b : nnngggtaacaxxxxxxxxxxxxxxxxx
OVR01_0042_F08.b : gaggactttggcggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0018_B09.b : ggttcccnnnnggataaagcagcggtaxxxxxxxxx
SPL01_0069_G06.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0059_F10.b : naaagatxxxxxxxxxxxxxxxxxxxxxx
PBL01_0024_A10.b : nggtgaaacaxxxxxxxxxxxxxxxxx
ITT01_0067_A02.b : nttggatgaacaxxxxxxxxxxxxxxxxx
OVRM1_0150_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0066_H09.b : nngggtttnnnnnnccgacggtagaggccgtcgtattt
HTMT1_0107_C05.b : nggatattacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_C12.b : nnggtttnnnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_B10.b : xxxxxxxxxxxxxxxxxxxxxxx
TES01_0095_C11.b :
TES01_0036_G04.b :
OVRT1_0009_C07.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0030_H01.b :
CLNT1_0071_C06.b : ngggccctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_G03.b : nagttgtcatxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_B07.b : xxxxxxxxxxxxxxxxxxxx
SPL01_0029_G01.b : nggggggatggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_G06.b : tttggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_C11.b : cgcctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0042_A11.b : tttttggcttgtgacttnacagtttgtacxxxxxxxxxxxxxxxxxxxxx
ITT01_0044_G03.b : nnggatgaacaxxxxxxxxxxxxx
ADR01_0077_G02.b : nnnnaatgactaacaxxxxxxxxxxxx
BFLT1_0035_B01.b : nnccccnnnnngggaacccgtagcgnacgxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0032_E08.b :
TES01_0048_D06.b : tatgcatatagtt
SKNB1_0057_D05.b : n
TES01_0067_H04.b :
KDN01_0097_E10.b :
KDN01_0083_H11.b :
KDN01_0031_H09.b :
PST01_0098_C12.b :
OVR01_0080_F08.b :
LVR01_0029_A11.b : attagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_H11.b : gggccttaatgxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_B02.b : caattgtcxxxx
OVRM1_0085_G09.b : nagttgtcxxxx
HTMT1_0075_H10.b : tttttagacggtac
OVR01_0038_A04.b : aagggatataggtgxxxxxxxxxxxxxxxxxxx
ITT01_0006_B08.b : nnn
TES01_0074_A03.b :
TES01_0108_E08.b :
SMG01_0017_C10.b : a
OVR01_0036_H02.b : aagacatttcxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_H08.b : nggggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxx
TES01_0009_A10.b :
DCI01_0024_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0076_G05.b : tgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_B12.b : nagtt
OVR01_0025_E07.b : agaggactttagggtgxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_E12.b : catttagggtgxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0085_G01.b : ggattccgttagcgnacgxxx
THY01_0014_B08.b : ctagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0022_F10.b : ngggagttnnnnng
THY01_0060_H03.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_D11.b : atccgttagcgnacgnatg
TCH01_0003_D04.b : nnggctaggacttgacxxxx
TCH01_0041_E01.b : nnnnggctaggactatnacxxxxxxxxxx
CLNT1_0006_C03.b : nccgttttnnnggggccgttcgcgnacgxxxx
LNG01_0080_H05.b : nnntttgatggacatgacagxxxxxxx
ITT01_0091_E10.b : nnnaat
OVRT1_0092_H06.b : nnnggggttnnnnngnnnccgttagcgnacgxxxx
OVRM1_0118_C08.b : nagttgt
DCI01_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_E11.b :
HTMT1_0127_B01.b : nnngggcatttttnntccg
TES01_0003_F11.b :
HTMT1_0099_F06.b : tttttaga
BMWN1_0017_H07.b : nnaaga
PST01_0021_D02.b :
HTMT1_0118_C01.b : ttttgg
DCI01_0014_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0057_G08.b :
DCI01_0010_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0088_G03.b : tttttggac
PST01_0063_E09.b :
DCI01_0047_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_C06.b :
PTG01_0090_F06.b : nnnggcttattttnn
LVRM1_0098_C01.b : nagttgta
OVRM1_0225_C08.b : ttgt
OVRM1_0218_A06.b : gagttga
OVRM1_0042_B11.b : gt
OVR01_0099_G06.b : ggcttggactatgacagtttgtxxxxxxxxxxxxx
LVRM1_0175_C01.b :
OVR01_0074_C12.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_D11.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_A04.b : gagtttgtc
OVRM1_0217_E01.b : caattgt
ADR01_0014_C12.b :
OVRM1_0014_G04.b : xxxxxxxxxx
OVRM1_0015_H02.b : xxxxxxxxxx
OVRM1_0124_E12.b : nagttgt
OVRM1_0087_B07.b : agttgt
OVRM1_0006_H07.b : cxxxxxxxxx
OVRM1_0068_E10.b : tagttgtc
OVRM1_0022_F03.b : xxxxxxxxxxxx
OVRM1_0103_C08.b : nagttgtc
PTG01_0056_B12.b : ncgcatctctatat
OVRM1_0014_H09.b : xxxxxxxxxx
BFLT1_0117_F06.b : ncccttcgcgcacgx
PTG01_0063_A02.b : nnnnnnnnnnnnnn
OVR01_0102_C10.b : ngcttgggacttgacxxxxxxxxx
THY01_0036_G05.b : gatgcxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_D08.b : tttttgggggcgxxxxxxxxxxxxxx
OVR01_0100_F03.b : cttgtgacttgacxxxxxxxx
OVR01_0062_G12.b : ttttggcatggactataacagtttgt
OVR01_0095_E11.b : tgtgatatagacxxxxxxxx
OVR01_0067_E11.b : nnagcttgtgatatgacxxxxxxxx
THY01_0036_E12.b : gtgcaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_F07.b : nccccgttcagcgnacgx
SPL01_0076_F10.b : ttggctaggacttaaacagtttgtc
SPL01_0094_E10.b : nnnggcttggactatgacxxxxxxxxx
LVR01_0053_F03.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_E08.b : ggagcttatxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0113_C08.b : nnnnccgtcagc
OVR01_0077_B02.b : nnnnnnagcttggactatnacxxxxxxxxx
CLNT1_0111_H05.b : nnntttcgttagcgnacg
OVR01_0099_F04.b : nnnnggctaggactatgacagtttgt
PTG01_0010_G11.b : nnnnnnnnnnnnn
LNG01_0066_E08.b : nnnaagtaggacttgacag
BFLT1_0151_E05.b : nnnnccgttagcgnacgxxx
OVRT1_0096_E10.b : nntttccgatagcggacgx
OVR01_0027_H01.b : gggacactatxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_D05.b : nggactcgttagcgnacgx
OVRT1_0125_C07.b : ccccttcagcgnacg
PBL01_0059_E06.b : nn
SPL01_0055_C09.b : nnnggcttggactatgacxxxxxxxx
OVR01_0055_B04.b : nnnnggctaggactatgacxxxxxxxx
OVRT1_0093_C01.b : nnnnnccgttagctgacgxx
UTR01_0066_B01.b : ttttttttagcataggtgxxxxxxxxxxxxxxxxxxx
BFLT1_0013_F07.b : nggattcgttagcgnacgx
UTR01_0095_G08.b : nnnggcttggactataacxxxxxxxx
ITT01_0100_G12.b :
OVRT1_0043_E06.b : nnntttcgttagcgnacgx
OVR01_0001_E06.b : ggaccaatggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_D12.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_C06.b : na
OVR01_0049_D09.b : nnnnggcatggactatgacxxxxxxxx
CLNT1_0087_F02.b : nnttgtctnnngggcnccgtcagcgnacg
OVR01_0052_B02.b : nnnnnggctaggactatgacxxxxxxxx
ITT01_0009_H10.b : nn
OVR01_0092_E05.b : nnnggctaggactatgacxxxxxxxx
SPL01_0032_E07.b : nnnnnggctaggaatatnacxxxxxxxx
MLN01_0099_G05.b : nnnggcttggactataacxxxxxxxx
OVR01_0006_H06.b : tggacccatttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0060_H06.b : tttttagggcttggatatgacxxxx
OVR01_0054_C05.b : nnnccgctaggactatgacxxxxxxxx
ITT01_0017_G12.b :
LVRM1_0042_B09.b : nagttgtc
DCI01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_A08.b : ncgctcagcgct
DCI01_0085_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0024_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0020_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_F05.b : nnttccggctggacatgacxxxxx
BKFL1_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0068_B08.b :
DCI01_0082_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_C12.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0073_B01.b : xxxxxxxxx
OVRM1_0218_F03.b : nagtttg
LVRM1_0134_F12.b : ncgttgt
LVRM1_0083_H10.b :
LVRM1_0011_A12.b : agttg
LVRM1_0055_D01.b : nagttg
TES01_0053_H10.b :
OVRM1_0190_E05.b :
OVRM1_0003_H04.b : xxxxxxxx
LVRM1_0125_D10.b : nagttg
OVRM1_0011_E08.b : cxxxxxxx
OVRM1_0017_C08.b : cxxxxxxxx
SPL01_0058_C02.b : nnnggcttggactataacxxxxxxx
OVRM1_0029_G09.b : xxxxxxxxx
SPL01_0026_C03.b : cttttgggtggcctactagxxxxxxxxxxxx
MLN01_0040_A02.b : nnnnngcatagtactaanacxxxxxxxxx
ADR01_0074_D04.b : nttaanggacttaa
UTR01_0035_E10.b : gtgggacctxxxxxxxxxxxxxxxxxx
OVRT1_0151_D02.b : nnnnnccgttagcgnacgx
PTG01_0046_B04.b : nccgatcttn
OVRT1_0099_E01.b : tttttccttcagcgnac
BFLT1_0126_D05.b : nnncctcgtcagcgtagg
BFLT1_0029_H07.b : ggattccgttagcgnacg
PTG01_0004_B06.b : nngggcatcannnn
SPL01_0051_B06.b : nnnngtgcttggactatgacxxxxxxx
PST01_0063_B06.b :
BFLT1_0027_C01.b : gggatccgttcagcgnacgx
PBL01_0035_E09.b :
SPL01_0008_G11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0039_C03.b : ggatccgtcagcgnacg
ADR01_0047_B05.b : nnc
OVR01_0028_H10.b : gggggcttcatggtgxxxxxxxxxxxxxxxxxxx
ITT01_0042_C03.b : nn
OVR01_0090_E04.b : nnggctaggactaaaacxxxxxxx
OVR01_0070_A01.b : nnnnggataggactaagacxxxxxxx
OVR01_0091_A01.b : nnnnttgcttggactatgacxxxxxxx
OVR01_0012_A04.b : cgaaaattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_E04.b :
OVRM1_0185_H09.b : gagtt
ILNT1_0074_G08.b : nnng
OVR01_0088_G11.b : ccgcttgtgattagacxxxxxxx
HTMT1_0106_E01.b : tttt
OVRT1_0121_F01.b : cccgtcagcgna
CBLT1_0042_D05.b : n
HTMT1_0132_F05.b : tt
OVR01_0046_C02.b : aggcattagcxxxxxxxxxxxxxxxxxxxx
SKNB1_0050_F01.b :
CBLT1_0033_G06.b : t
TES01_0079_H04.b :
TES01_0102_H06.b :
PCT01_0031_E10.b :
TES01_0023_B02.b :
TES01_0107_F05.b :
PST01_0001_E01.b :
TES01_0049_C10.b :
TES01_0001_G02.b :
SKNB1_0089_D12.b :
TES01_0110_B03.b :
PST01_0044_D02.b :
PCT01_0002_H04.b :
SKNB1_0075_H11.b :
SKNB1_0016_A03.b :
PST01_0045_A08.b :
PST01_0048_B10.b :
PST01_0058_B10.b :
UTR01_0084_H05.b : nnnttgataggactaagacx
PST01_0008_H04.b :
ADR01_0018_C12.b :
OVR01_0021_H12.b : ttatggggggaaataaaaaxxxxxxxxxx
LVRM1_0050_A03.b : nag
TES01_0032_D02.b :
TES01_0096_E02.b :
TES01_0048_G03.b :
TES01_0051_G07.b :
TES01_0058_E09.b :
TES01_0022_F11.b :
TES01_0088_H08.b :
BFLT1_0140_H08.b : tttttcccttagcgna
TES01_0103_E05.b :
TES01_0103_G04.b :
OVR01_0064_F09.b : nnggcttggactataacxxxx
CLNT1_0038_B04.b : nnccgtctttnngggnnggtatagcgn
BFLT1_0006_B01.b : nggatccgttagcg
TES01_0096_E09.b :
ADR01_0054_C01.b :
PST01_0003_B04.b :
PST01_0051_H05.b :
TES01_0044_E12.b :
PST01_0065_F06.b :
TES01_0041_C07.b :
CLNT1_0037_B11.b : ngttccgttagc
TES01_0067_B07.b :
PST01_0095_D09.b :
TES01_0004_B06.b :
SKNB1_0023_E10.b :
ADR01_0052_A05.b : nnnnttcg
OVR01_0017_G03.b : ggggxxxxxxxxxxxxxxxxxxxxxxx
TES01_0091_C07.b :
TES01_0091_E06.b :
TES01_0020_F09.b :
TES01_0063_C02.b :
TES01_0103_G12.b :
PCT01_0028_C04.b :
TES01_0068_C05.b :
TES01_0006_H01.b :
KDN01_0007_F07.b :
TES01_0034_E12.b :
PST01_0051_H11.b :
PBL01_0079_E03.b :
KDN01_0068_B08.b :
TES01_0098_E02.b :
SMG01_0097_E02.b :
PST01_0060_G09.b :
TES01_0052_F04.b :
SKNB1_0022_G12.b :
PST01_0029_D09.b :
DCI01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b :
OVR01_0103_G07.b :
TES01_0083_D09.b :
THY01_0056_A07.b : ctxx
PBL01_0009_A11.b :
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b :
OVRM1_0100_A04.b :
OVRM1_0117_B04.b :
OVRM1_0089_F07.b :
OVRM1_0079_B02.b :
OVRM1_0217_B10.b :
THY01_0020_C07.b :
THY01_0069_D02.b : cxx
OVR01_0059_E03.b :
OVR01_0053_C04.b : nn
OVR01_0053_D02.b :
ITT01_0040_C05.b :
PST01_0020_E11.b :
OVR01_0018_G04.b :
OVR01_0009_C06.b : cgaaattatggaxxxxxxxxxxxxxxx
OVRM1_0129_E11.b :
UTR01_0059_E12.b :
SKNB1_0054_A10.b :
OVR01_0003_H12.b : ttgggcacatctaxxxxx
OVR01_0004_D09.b : gaaaacttttxxxxxxxxxxxxxxx
OVR01_0009_F10.b : cgagagtagxxxxxxxxxxxxxxxxx
OVR01_0010_F01.b : agacgccccttttgaccgtgcttgaccatccggcac
OVR01_0034_C03.b : agg
LVRM1_0043_F01.b :
TES01_0077_C11.b :
OVRM1_0214_C06.b :
TES01_0068_F08.b :
OVRM1_0119_B04.b :
OVRM1_0153_C01.b :
ILNT1_0080_B10.b :
OVR01_0077_C11.b :
OVRM1_0201_B09.b :
OVRM1_0114_H06.b :
SPL01_0013_G03.b : a
CLNT1_0114_G04.b :
OVRT1_0089_G12.b :
THY01_0094_A07.b : tcttggggcccctc
THY01_0081_H10.b : nnnnnnnnnnn
SPL01_0038_F05.b : aagx
OVR01_0011_C09.b : aaaacaatggaxxxxxxxxxxxx
OVRT1_0094_A10.b :
SKNB1_0016_A04.b :
THY01_0030_D10.b : t
THY01_0061_E05.b :
OVR01_0040_A08.b : ggggg
THY01_0032_E09.b :
OVR01_0027_A11.b : gggggac
KDN01_0068_B12.b :
OVRM1_0220_A06.b :
TES01_0077_H11.b :
OVRM1_0225_H08.b :
THY01_0119_B11.b :
OVRM1_0052_A02.b :
OVRT1_0061_B03.b :
OVRM1_0068_C10.b :
OVRM1_0113_F03.b :
OVR01_0077_D12.b :
OVRM1_0189_B03.b :
OVRM1_0217_D12.b :
OVR01_0056_A09.b :
TES01_0092_C02.b :
OVRM1_0099_A04.b :
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b :
OVRM1_0211_E08.b :
OVRM1_0129_G08.b :
OVRM1_0168_G04.b :
LVRM1_0055_F08.b :
OVRM1_0101_H10.b :
OVRM1_0185_B08.b :
OVRM1_0034_H10.b :
OVRM1_0092_B05.b :
OVRM1_0050_C11.b :
OVRM1_0206_E10.b :
OVR01_0099_G04.b :
OVRM1_0111_F09.b :
MLN01_0042_D11.b :
TCH01_0060_H08.b :
OVRM1_0049_H01.b : aaatataagctctaaacaaaanaaaatatttttcccacacnta
OVR01_0064_G11.b :
OVR01_0056_D10.b :
OVR01_0088_H04.b :
OVR01_0078_A05.b :
THY01_0048_B01.b :
OVR01_0025_D06.b : cgagg
SMG01_0070_H05.b :
SPL01_0088_F02.b :
SPL01_0047_G11.b :
OVR01_0052_H06.b :
SKNB1_0029_F05.b :
BFLT1_0064_G07.b :
THY01_0044_G08.b :
OVR01_0022_D06.b : gcg
PCT01_0021_G11.b :
SPL01_0062_A06.b :
LNG01_0090_B06.b :
OVR01_0090_D10.b :
SPL01_0073_G05.b :
TES01_0055_H05.b :
OVR01_0001_C12.b : aaaaaattxxxxxxxxxxxxxxxx
THY01_0079_B06.b : gccattttgcgtgxxxxxxxxxxxxxxxxx
CLNT1_0144_A03.b :
PBL01_0037_C03.b :
MLN01_0013_C05.b :
OVR01_0039_D09.b : ggg
LVR01_0082_H08.b : g
OVR01_0029_G05.b : tggg
OVRT1_0104_C07.b :
OVR01_0064_H08.b :
OVR01_0008_E12.b : aggggggccctattttacxxxxxxxxxxxxxxx
OVR01_0064_E05.b :
PBL01_0058_G12.b :
OVR01_0028_D07.b : gggx
MLN01_0040_G09.b :
TES01_0104_D10.b :
OVR01_0063_D07.b :
OVR01_0020_B08.b :
UTR01_0061_G11.b : g
PST01_0057_G12.b :
ITT01_0088_H04.b :
SPL01_0102_H05.b :
MLN01_0097_G01.b :
PBL01_0053_G04.b :
OVRT1_0095_D02.b :
ITT01_0061_A02.b :
ITT01_0056_C11.b :
OVR01_0092_G05.b :
OVR01_0029_B05.b : gg
OVR01_0054_A04.b :
ADR01_0077_G04.b :
OVR01_0017_C06.b :
OVRT1_0038_C05.b :
THY01_0066_H06.b :
SPL01_0036_H06.b : caa
THY01_0207_A06.b : gc
OVRT1_0044_B01.b :
MLN01_0064_A01.b :
PBL01_0105_C08.b :
OVR01_0013_A07.b :
THY01_0058_G05.b :
OVR01_0055_H07.b :
TES01_0103_D06.b :
OVRM1_0069_C05.b :
OVRT1_0150_D09.b :
LNG01_0065_A06.b :
OVRM1_0086_A06.b :
PBL01_0040_B04.b :
OVR01_0027_A07.b :
PBL01_0055_G10.b :
OVR01_0085_G05.b :
OVRT1_0140_E08.b :
LVRM1_0003_C08.b :
SKNB1_0087_E06.b :
SPL01_0092_H01.b :
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b :
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b :
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b :
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : ..........................GAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
---------+---------+---------+---------+---------+---------+ 33
ILNT1_0062_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
ILNT1_0065_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPLT1_0024_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TCH01_0064_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVRM1_0125_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0036_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVR01_0042_F08.b : xxxxxxxxxxxxxxxxxxccgttcaactGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SMG01_0018_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPL01_0069_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0059_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0024_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
ITT01_0067_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0150_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
CBLT1_0066_H09.b : atcgactcctatagggaatttaatgaattGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
HTMT1_0107_C05.b : xxxxxxxgggggtccctttagcagggcagGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRT1_0068_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVRM1_0197_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0095_C11.b : ttttttggctgtggctctggaggAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0036_G04.b : ttttcctgctgtggctctggctcagGAGTCAGGCCCGCGGCG*CAGAGACTAGC
OVRT1_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxggtAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SKNB1_0030_H01.b : nnnnnactggctgtggctactggaggAGTCCAGGCCCGCGGCG*CAGAGACTAGC
CLNT1_0071_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxttAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0198_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0089_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxggacGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPL01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGTG*CAGAGACTAGC
OVR01_0101_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVR01_0098_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
TCH01_0042_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
ITT01_0044_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
ADR01_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
BFLT1_0035_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
PST01_0032_E08.b : ccacgttggctctggaggagTCAGGCCCGCGGCG*CAGA*ACTAGC
TES01_0048_D06.b : taaaatacaaattatttnttacgtttgctcgtgatCAGGCCCGCGGCG*CAGAGA*TAGC
SKNB1_0057_D05.b : nnccctannnnnnnccaacggtggctcggaggagtCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0067_H04.b : ttttcctgcgtggctatgagtcaGGCCGCGGCG*CAGAGACTAGC
KDN01_0097_E10.b : nnnnncctgctgtggctctgggagtcaGGCCGCGGCG*CAGAGACTAGC
KDN01_0083_H11.b : ttttcctgcggtggctatggagtccGGCCGCGGCG*CAGAGACTAGC
KDN01_0031_H09.b : nttcgcgttggcactggagtcaGGCCGCGGCG*CAGAGACTAGC
PST01_0098_C12.b : nnnnaactgcagtggctatggagtccGGCCGCGGCG*CAGAGACTAGC
OVR01_0080_F08.b : ttaggcCTACTGGGACTAGC
LVR01_0029_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcCTACTGGGACTAGC
OVR01_0028_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgttCTACTGGGACTAGC
OVRM1_0148_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGACTAGC
OVRM1_0085_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGACTAGC
HTMT1_0075_H10.b : gaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGAGACTAGC
OVR01_0038_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtcACTGGGACTAGC
ITT01_0006_B08.b : gatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTGGGACTAGC
TES01_0074_A03.b : ccgcgttggctCTGGGACTAGC
TES01_0108_E08.b : tcgctgttggctCTGGGGATAGC
SMG01_0017_C10.b : aattgataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACTAGC
OVR01_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACTAGC
SPL01_0068_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttggcctaCTGGGACTAGC
TES01_0009_A10.b : ntaccgcgtggctCTGGAACTAGC
DCI01_0024_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGACTAGC
THY01_0076_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRM1_0100_B12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGACTAGC
OVR01_0025_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
SPL01_0011_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
BFLT1_0085_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttggGAGACTAGC
THY01_0014_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
SMG01_0022_F10.b : gataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
THY01_0060_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
BFLT1_0064_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
TCH01_0003_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
TCH01_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
CLNT1_0006_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
LNG01_0080_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
ITT01_0091_E10.b : gaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRT1_0092_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRM1_0118_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
DCI01_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGACTAGC
TES01_0003_E11.b : gctgtggctctGGACTAGC
HTMT1_0127_B01.b : agagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
TES01_0003_F11.b : ntcgcgttggctctGGACTAGC
HTMT1_0099_F06.b : cagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
BMWN1_0017_H07.b : gacggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
PST01_0021_D02.b : tttatggctgtggctctGGGACAGC
HTMT1_0118_C01.b : acagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
DCI01_0014_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
KDN01_0057_G08.b : ntttctgcggtggctatggaaaaaaaaaaAGACTAGC
DCI01_0010_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
HTMT1_0088_G03.b : agtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
PST01_0063_E09.b : nncctgctgtggctctggaaaaaaaaaaaaaaaaaaAGACTAGC
DCI01_0047_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
DCI01_0088_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
KDN01_0080_C06.b : nncctgctgtggctctGGGACAGC
PTG01_0090_F06.b : nggcgtaagcagcggnacggntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0098_C01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0225_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0218_A06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0042_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0099_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0175_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0074_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0074_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0184_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0217_E01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ADR01_0014_C12.b : aatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0014_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0015_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0124_E12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0087_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0006_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0068_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0022_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0103_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0056_B12.b : gagtatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0014_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0117_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0063_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGACTAGC
OVR01_0102_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGACTAGC
THY01_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0010_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0100_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0062_G12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0095_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
THY01_0036_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0122_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0076_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVR01_0053_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0030_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0113_C08.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0077_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
CLNT1_0111_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0099_F04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0010_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LNG01_0066_E08.b : tttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0151_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0096_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0027_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0004_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0125_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PBL01_0059_E06.b : naatgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0055_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0055_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0093_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0066_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0013_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0095_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0100_G12.b : naaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0043_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0001_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVR01_0043_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0086_C06.b : aagatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0049_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
CLNT1_0087_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0052_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0009_H10.b : aagtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0092_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0032_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
MLN01_0099_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0006_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LNG01_0060_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0054_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0017_G12.b : nnaaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0042_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcACTAGC
DCI01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BFLT1_0120_A08.b : acgaggttcttctgcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtACTAGC
DCI01_0085_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0024_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
DCI01_0003_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
DCI01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0020_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
LNG01_0056_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactACTAGC
BKFL1_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0028_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
PST01_0068_B08.b : nttttgctgctgtggctctggagaACTAGC
DCI01_0082_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
OVR01_0081_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0073_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0218_F03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0134_F12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0083_H10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0011_A12.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0055_D01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
TES01_0053_H10.b : ctgtggctcCTAGC
OVRM1_0190_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0003_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0125_D10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0011_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0058_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0029_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0026_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
MLN01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ADR01_0074_D04.b : aanngggctaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
UTR01_0035_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRT1_0151_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PTG01_0046_B04.b : nnntgagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRT1_0099_E01.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0126_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0029_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PTG01_0004_B06.b : nagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0051_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PST01_0063_B06.b : nnttggcgttggctctCTACC
BFLT1_0027_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PBL01_0035_E09.b : nngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0008_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0039_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ADR01_0047_B05.b : caaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0028_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ITT01_0042_C03.b : nggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0070_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0091_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0012_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0022_E04.b : gacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
OVRM1_0185_H09.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
ILNT1_0074_G08.b : gacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAGC
OVR01_0088_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
HTMT1_0106_E01.b : ggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
OVRT1_0121_F01.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
CBLT1_0042_D05.b : nggcaggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
HTMT1_0132_F05.b : tccgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
OVR01_0046_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
SKNB1_0050_F01.b : nnnnnccagctgtggctatgggttggccctgGAGC
CBLT1_0033_G06.b : ttccgcagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
TES01_0079_H04.b : nntttcacgtggctctgaagacAGC
TES01_0102_H06.b : nttcgcgtggctctggacAGC
PCT01_0031_E10.b : nnnnngggtttnnnnnnnnccagcgggtgcanggacAGC
TES01_0023_B02.b : ttttcctgcgtggctctggacAGC
TES01_0107_F05.b : tttntttgcgtggctatgAGC
PST01_0001_E01.b : ccattttttntntcctgcggtggcacgggacAGC
TES01_0049_C10.b : ntacgctgtggctctgggacAGC
TES01_0001_G02.b : ttttcctgctgtggctctggacAGC
SKNB1_0089_D12.b : nncccacnnnnncctctgcgtttgctcggagacAGC
TES01_0110_B03.b : tttttcgcggtggctctgggacAGC
PST01_0044_D02.b : nnncctgctgtggctaggagcAGC
PCT01_0002_H04.b : nnnncggactannnnnncctgcgttggcacggacAGC
SKNB1_0075_H11.b : nngggttttnnnntcctgcgttggctcggacAGC
SKNB1_0016_A03.b : nngggatnnnnnnnactgcgttgcctcgggacAGC
PST01_0045_A08.b : nnnaactactgttgctctggagaacAGC
PST01_0048_B10.b : nnnttgctgctgtggctatggacAGC
PST01_0058_B10.b : nttttactgcggtggctctgggacAGC
UTR01_0084_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGC
PST01_0008_H04.b : nnttgttttnnnnnnactgcagtgtgcacggacAGC
ADR01_0018_C12.b : gctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
OVR01_0021_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
LVRM1_0050_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0032_D02.b : ctgcgttggctctggactGC
TES01_0096_E02.b : tttttcgcgttggctctgggactGC
TES01_0048_G03.b : gtggctctggggGC
TES01_0051_G07.b : ttagcgttggctctgaggAC
TES01_0058_E09.b : gtggctaaaTA
TES01_0022_F11.b : gcgttggctatggAC
TES01_0088_H08.b : tttcctactgtggctctggtAC
BFLT1_0140_H08.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0103_E05.b : nnnncccacgttgctctggatGC
TES01_0103_G04.b : nnnnnttcgcgtggctctggctGC
OVR01_0064_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
CLNT1_0038_B04.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
BFLT1_0006_B01.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0096_E09.b : tttttcctgctgtggctctgggactGC
ADR01_0054_C01.b : ccccnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
PST01_0003_B04.b : tttacctgacgttggcacgggactGC
PST01_0051_H05.b : nnnttcgctgtggctctgggactGC
TES01_0044_E12.b : tttttcgcgttggctctggactGC
PST01_0065_F06.b : tcgacgtggctctggactGC
TES01_0041_C07.b : gttggctctggAC
CLNT1_0037_B11.b : tgacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0067_B07.b : ttttcctgctgttgctctggactGC
PST01_0095_D09.b : nnnncctgctgttgctatgggactGC
TES01_0004_B06.b : nttcgctgtggctctggtAC
SKNB1_0023_E10.b : nnnnggatnnnnnnnaatgcgttggctatgatGC
ADR01_0052_A05.b : aannnggcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
OVR01_0017_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0091_C07.b : ttttcctactgtggctctggA
TES01_0091_E06.b : ttttncctgctgtggctctggaC
TES01_0020_F09.b : ttggctatgggataaC
TES01_0063_C02.b : ttttcctgcgtggcgatG
TES01_0103_G12.b : nttttttggctgtggctctggA
PCT01_0028_C04.b : nnnnttctttnnnnnnncctgcgtttgcactggactaC
TES01_0068_C05.b : ntttctgcgttggctctggA
TES01_0006_H01.b : nttatcgctgtggctatggaC
KDN01_0007_F07.b : nnccctcnnnnnnccctgcgttggctcgggactG
TES01_0034_E12.b : ttctgctgtggctctggA
PST01_0051_H11.b : ntttatcgctgtggctatggactG
PBL01_0079_E03.b : nnggatgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
KDN01_0068_B08.b : nnnnngctgctgtggctatggtaC
TES01_0098_E02.b : nttttctgcgtggctctggag
SMG01_0097_E02.b : ttttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0060_G09.b : nnnnttgctgctgtggctctggag
TES01_0052_F04.b : ttttncctagcgttggctctga
SKNB1_0022_G12.b : nnttgctttaaataccctacgttgtgcatgga
PST01_0029_D09.b :
DCI01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0103_G07.b : nggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0083_D09.b :
THY01_0056_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0009_A11.b : naaaggtgaagagctggaxxxxxxxxxxx
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_A04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_B02.b : gttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_B10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxx
THY01_0069_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_E03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_C04.b : nnnggcttggcctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_D02.b : aannnnggctaggantatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_C05.b : nnngatgaacaxxxxxxxxxxxxxxxxx
PST01_0020_E11.b :
OVR01_0018_G04.b : gggggtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_E12.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0054_A10.b :
OVR01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0010_F01.b : tctcggtgcctcacgaacatgtttggacaaaaagctgggccagtaccgagtccggaattt
OVR01_0034_C03.b : ctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_C11.b :
OVRM1_0214_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0068_F08.b :
OVRM1_0119_B04.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0080_B10.b : nncgacggtacgaggxxxxxxxxxxxxxxxxxxxx
OVR01_0077_C11.b : ntttagcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_H06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0013_G03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0114_G04.b : nnnncctttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_G12.b : ttccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_A07.b : gcattaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0081_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0038_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_A10.b : nttttactatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0016_A04.b : nngggatnnn
THY01_0030_D10.b : tttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_E05.b : ggggggacctactagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_A08.b : cttatgggccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_E09.b : tgggggaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0027_A11.b : attttggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0068_B12.b :
OVRM1_0220_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_H11.b :
OVRM1_0225_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0119_B11.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_A02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_B03.b : nncccttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_F03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0077_D12.b : ntttgcttgtgattanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_B03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_D12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_A09.b : tttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0092_C02.b :
OVRM1_0099_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b : ttggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0211_E08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_G04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_B08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0034_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0050_C11.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_G04.b : ttgcattggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_F09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_D11.b : cttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_H08.b : ttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_H01.b : tattaatcccctttttcagagnacttcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_G11.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_D10.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0088_H04.b : cgtgactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_A05.b : nngggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_B01.b : tggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_D06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0070_H05.b : nnggcgtttnnnnnggagtaagcagcggtacggntcc
SPL01_0088_F02.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0047_G11.b : nntttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_H06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0029_F05.b : nnnngga
BFLT1_0064_G07.b : gactacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0044_G08.b : tggggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0022_D06.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0021_G11.b : nnggcgg
SPL01_0062_A06.b : tttggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_B06.b : tttgggggatggagaagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0090_D10.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_G05.b : nggcgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0055_H05.b :
OVR01_0001_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0144_A03.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0037_C03.b : ngctaacaxxxxxxxxxxxxxxxxxxx
MLN01_0013_C05.b : nnnnnggttggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_D09.b : atattatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H08.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_G05.b : gctttaggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0104_C07.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_H08.b : nttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_E05.b : nnnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0058_G12.b : naaaagataaacaxxxxxxxxxxxxxxxxxxx
OVR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_G09.b : nnnncggctggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0104_D10.b :
OVR01_0063_D07.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_B08.b : gtggggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_G11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0057_G12.b :
ITT01_0088_H04.b : nnggatgaacagctggaxxxxxxxxxxxx
SPL01_0102_H05.b : nnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_G01.b : tttttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_G04.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0095_D02.b : ngggttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_A02.b : nnnnggatgaacagcxxxxxxxxxxxxxxx
ITT01_0056_C11.b : nnnnggagaacagctggacggccggat
OVR01_0092_G05.b : nnttgttaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_B05.b : ggcttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0054_A04.b : nnnaaggcatggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_G04.b : nnntttgatgaacagctgnxxxxxxxxxxxxx
OVR01_0017_C06.b : tggggtgaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_C05.b : nnnttccgtttgctgtacgaggttxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_H06.b : cttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0036_H06.b : ggattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0207_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_B01.b : nnnccccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0064_A01.b : tttttggcatggatatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_C08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
OVR01_0013_A07.b : ttgggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0058_G05.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0055_H07.b : nntggctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0103_D06.b :
OVRM1_0069_C05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_D09.b : nnnccacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_A06.b : tttttnggctggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0086_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0040_B04.b : naatgaacaxxxxxxxxxxxxxxxxxx
OVR01_0027_A07.b : gggccatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0055_G10.b : atgxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_G05.b : nnnnagctaggactatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0140_E08.b : gcctcacnnnnnnnccgttagcgttacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_C08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0087_E06.b :
SPL01_0092_H01.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b : nnaaacctatagctgacgxxxxxxxxxxxxxxxxxxx
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b : ntttccg
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b : nnggggc
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 89
THY01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0069_D02.b : xxxxxxxxxxxxxxxxxxxxcTTTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0059_E03.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0053_C04.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0053_D02.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0040_C05.b : xxxxxxxxxxxxxxxxxxxxxTTTTTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0018_G04.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0009_C06.b : xxxxxxxxxxxxxxxxxxxxxGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0129_E11.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
UTR01_0059_E12.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0054_A10.b : nnnnnccacgcgttggctatggTTTTTTTTGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxcGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0004_D09.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxaGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0010_F01.b : cctcgtgcacactaggcctcccGGCTTT*CGGCTTAACGCTC*GCTCTC*GGCGTCA*GC
OVR01_0034_C03.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTTTTGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0043_F01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0077_C11.b : actccgtggctactggcTTTTT*TGGCTT*ACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0214_C06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0119_B04.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0153_C01.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
ILNT1_0080_B10.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0077_C11.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0201_B09.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0114_H06.b : xxxxxxxxxxxxxxxxxxxxggcTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SPL01_0013_G03.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0114_G04.b : xxxxxxxxxxxxxxxxxxxxxxtGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0089_G12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0094_A07.b : xxxxxxxxxxxxxxxxxxxxtggCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0081_H10.b : nnnnnnnnnnnnnnnnnnacaggCTTTTTTGGCTTAACGCTC*GCTCTC*GGCGTCTGGC
SPL01_0038_F05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0094_A10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0016_A04.b : nnnnggtcgcgttggctatggatCCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
THY01_0030_D10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0061_E05.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0032_E09.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0027_A11.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCCTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0068_B12.b : nnntttggctgcggtggctatgGCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0220_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0077_H11.b : cccgctgtggctctggtgGCTT*TGGCTT*ACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0225_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
THY01_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0052_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRT1_0061_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0068_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0113_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0077_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0189_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0217_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0092_C02.b : nnnnnttagctgtggctctGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0099_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0062_E06.b : tttcccgctgtggctctgggaTTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
TES01_0061_C12.b : tttttcctgctgtggctctggaCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0101_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0211_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0129_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0168_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0055_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0101_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0185_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0034_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0092_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0050_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0206_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0099_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0111_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
MLN01_0042_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*AGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0060_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0049_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0064_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0056_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0088_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0078_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0048_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0025_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0070_H05.b : ggattctcgagcacggttggcctgCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
SPL01_0088_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0047_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0029_F05.b : atnnnnnnnaatgcgttggctatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0064_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PCT01_0021_G11.b : annnnnnnncctgacgtgtgcatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
SPL01_0062_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0090_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0090_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0073_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0055_H05.b : nntttactgctgtggctctGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0001_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GTTCTC*GGCGTCT*GC
THY01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTGGGCTTAACGCTC*GCTCTCGGGCGTCT*GC
CLNT1_0144_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0037_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0013_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0039_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0082_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0029_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0104_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0064_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxgaaCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0064_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0058_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0040_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0104_D10.b : ntttnttcgctgtggctctgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0063_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0020_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0061_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0057_G12.b : nnnnccccctgcggtggctatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
ITT01_0088_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTGACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0053_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0095_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0061_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0056_C11.b : txxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0092_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0029_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0054_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0077_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0017_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0036_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0207_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0044_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0064_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0105_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0013_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0058_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0055_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0103_D06.b : tttcccgctgtggctatGCT*TTGGCTTACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0069_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRT1_0150_D09.b : xxxxxxxxxxxxxxxxxxcctttaaTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0065_A06.b : xxxxxxxxxxxxxxxxxxxxtgaggTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0086_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
PBL01_0040_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxgTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0027_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0055_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0085_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxtcTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0140_E08.b : xxxxxxxxxxxxxxxxxxccctttaaaT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0003_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxctcT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SKNB1_0087_E06.b : nnnncctagcgtggctatggaT*TTGGCTTAGGCTC*GCTCTC*GGCGTCT*GC
SPL01_0092_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0034_E06.b : cggcgttggctctggTTACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCTC*GCTCTC*GGCGTCT*GC
TES01_0041_E04.b : ggctttggctctggC*GCTCTC*GGCGTCT*GC
OVRM1_0138_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_H04.b : gtgtcaaaacagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0029_E06.b : tcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0021_D05.b : ngggcttttnnnnggctatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0020_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_H05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0065_F02.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_H07.b : taggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0008_D11.b : nggattc
OVR01_0047_F12.b : taaaagctttggtgxxxxxxxxxxxx
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 145
SKNB1_0008_D11.b : nnnnncctgacgtggctcggattctcggggggaccttcGCGGC*CGGAAATTCACCATG*
OVR01_0047_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0060_C02.b : tttttgcctgac
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 202
SMG01_0067_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
THY01_0122_F11.b : attgtcaaacagtggxxx
OVRM1_0044_E01.b : xxxx
SPL01_0071_G01.b : nnnnggctaggacttaaacxxxxxxxxxxxxx
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 260
THY01_0122_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0044_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCCCAGT*GGGGCCT
SPL01_0071_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT*GGGGCCT
OVRM1_0058_G03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_D04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_H08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0170_A04.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b : nnncc
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 318
LVRM1_0042_B09.b : caactcgaaatctacggagctcccaagcagcaggagctcaagaatacacgcttaaatggt
OVRM1_0039_E09.b : xxxxxxxx
PBL01_0045_D09.b : nggtgaaacaxxxxxx
OVR01_0101_E08.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0069_C02.b : nnnnaagctttnannggagtaagcagcxxxx
ADR01_0047_D11.b : nttaaaaatgaaca
TES01_0002_G01.b :
OVR01_0072_H01.b : nnnnccgcttggactatnacxxxxxxxxxxxxxxxxxxx
TES01_0090_F12.b :
OVR01_0066_A01.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxx
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b : agggcxxxxxxxxxxxxx
THY01_0061_H01.b : txxxxxxxxxxxxxxxxxx
TCH01_0091_D08.b : nnnggcta
SPL01_0100_D06.b : ctttttnn
BKFL1_0103_A12.b : cgattnnataagcgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 375
PTG01_0090_F06.b : aagggtcctcaagggtgttgacccacatcataaaaacaattgcgccccgcctggtttaac
LVRM1_0042_B09.b : gaatgagagccgagcacctcatagcagcgcagtgaagagacaccacgtgacatcacgatg
OVRT1_0140_E08.b : GAAAG*GTGTCTCGAAG*Gggaggggggtcatcagtggggctctagaacctgccctggtt
OVRM1_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggAACTATT*GCGCCTGCCCTGGT
PBL01_0045_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATT*GCGCCTGCCCTGGT
OVR01_0101_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATT*GCGCCTGCCCTGGT
ADR01_0069_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggTATT*GCGCCTGCCCTGGT
ADR01_0047_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATT*GCGCCTGCCCTGGT
TES01_0002_G01.b : ttttccttacgttggctatggcATT*GCGCCTGCCCTGGT
OVR01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GCGCCTGCCCTGGT
TES01_0090_F12.b : tttttttcactgttgcttatggctTT*GCGCCTGCCCTGGT
OVR01_0066_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GCGCCTGCCCTGGT
OVRM1_0131_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0019_E07.b : nnnccagatttaaannnncctacgttgtgcacggctatgcgcctgccctg
OVR01_0026_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0091_D08.b : ggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_D06.b : ggcatgtgatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0103_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_C01.b : ggcattangtgxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0033_E07.b :
SPL01_0042_C11.b : nntttgctaggacttanacagtttgta
THY01_0058_H07.b : tgggtgcactattagxxxxxxxx
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 435
PTG01_0090_F06.b : aaaaaaactaaacctcgggggacccgggaaaaaatccccccaccttttaattttgaaagg
LVRM1_0042_B09.b : ggattttagcgcccacaggagcgtgagacaaagaaaaaggcgagaaaaaaataaaacaac
OVR01_0081_C12.b : TAGCAAGAAACTGAACagccggggaacagggagaagatcgaacaaactgatgattggaaa
OVR01_0034_C03.b : tacccacaacctgacactctcggagcttgacaacatctctcatccgatgcccgcgatgga
OVRT1_0140_E08.b : ggcaagaaaaaaaaagtcctgtaaaataatttggcaaaaaatttttttttcccccccccc
BKFL1_0103_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGATTGAGATGGA
THY01_0202_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTGAGATGGA
PCT01_0033_E07.b : nnncccccttcagannncctgcgttgtgcacgtgcgatgaTGAGATGGA
SPL01_0042_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGATGGA
THY01_0058_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
PCT01_0001_D03.b : nnggcaatannnnnncctacg
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
---------+---------+---------+---------+---------+---------+ 492