[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000606

Length: 1,824

Sequence [FASTA format sequence]
GAGGAAGTCC AGGCCCGCGG CGCAGAGACT AGCTGGGGGG ACTCGGAGCG CCCGGACCTT
TTGGCTTAAC GCTCGCTCTC GGCGTCTGCA GCTCCCTCTG CTTATTCCTC GGGCGGCGAC
CTTCAGCGGC CGGAAATTCA CCATGTCTAT CCTCAAGATC CACGCCAGGG AGATCTTCGA
CTCTCGCGGG AACCCCACTG TTGAGGTCGA TCTGCACACC GCAAAAGGTC TCTTCCGAGC
TGCTGTGCCC AGTGGGGCCT CAACTGGGAT CTACGAGGCC CTCGAGCTCC GGGACAATGA
CAAGACGCGC TACATGGGGA AAGGTGTCTC AAAGGCTGTT GAGCACATCA ATAAAACTAT
TGCGCCTGCC CTGGTTAGCA AGAAACTGAA CGTCGTGGAG CAGGAGAAGA TCGACAAGCT
GATGATTGAG ATGGACGGCA CGGAGAACAA GTCCAAGTTT GGTGCCAACG CCATCCTGGG
CGTGTCCCTG GCCGTCTGCA AGGCTGGCGC TGTTGAGAAG GGGGTGCCCC TGTACCGCCA
CATCGCTGAC CTGGCTGGCA ATGCCGAGGT CATCCTGCCA GTCCCGGCTT TCAACGTCAT
CAACGGTGGC TCCCACGCCG GCAACAAGCT GGCCATGCAG GAGTTCATGA TCCTCCCCGT
CGGGGCCGAA ACCTTCCGGG AGGCCATGCG CATCGGGGCT GAGGTCTACC ACAACCTGAA
GAACGTCATC AAGGAGAAAT ACGGGAAGGA CGCCACCAAC GTGGGCGATG AGGGCGGGTT
TGCTCCCAAC ATCCTGGAGA ACAAAGAAGC CCTGGAGCTG CTGAAGAACG CCATCGGGAA
GGCCGGCTAC ACCGACAAGG TCGTCATCGG CATGGACGTG GCCGCCTCGG AGTTCTACAG
GTCGGGCAAG TACGACCTGG ACTTCAAGTC ACCCGACGAC CCCAGCAGGT ACATCTCACC
GGACCAGCTG GCCGATCTGT ACAAGTCCTT CATCAGGGAC TATCCAGTGG TGTCCATCGA
GGACCCCTTC GACCAGGATG ACTGGGAAGC CTGGCAAAAG TTCACTGGCA GCGCGGGAAT
CCAGGTGGTG GGCGACGACC TCACGGTGAC CAACCCCAAG AGGATTTCCA AGGCCGTGGC
TGAGAAATCG TGCAACTGCC TCCTGCTCAA AGTCAACCAG ATCGGCTCGG TGACCGAGTC
CCTGCAGGCG TGCAAGCTGG CGCAGTCCAA CGGCTGGGGC GTCATGGTGT CACATCGCTC
CGGGGAGACC GAAGACACCT TCATCGCTGA CCTGGTGGTG GGGCTCTGCA CCGGGCAGAT
CAAGACTGGC GCACCTTGCC GATCCGAGCG CTTGGCCAAG TACAACCAGA TCCTCAGAAT
CGAAGAGGAA CTGGGCAGCA AGGCCAAGTT TGCCGGCAGG AACTTCAGAA ACCCCCTCGC
CAAGTAAGCT CTGGGCGGCC GGCCCTGAGC CCCGTGGTCA CTCGTCGGCT CATCAGACCT
GCGCTCCATG TCGCTCGGCA GCTCGAGGCC CCGCCAGTGC TTGTGGGGCC TCCAGTAGTC
GACGACCCTC CCCTCCCTGT GATGTCTCAC TGCTTCCTTA GACCTGCTGC CGAAGCCGAG
CTCCACCATC TGGAACCTGC TGGAAGCCCT AGCTCAGTAA TCATGTGATT GGCCCAAATC
ATTGTTCTTC TCACCTCGCT TCCACCAAGT GTCTGGAGCC ATGTGTGCCC ACATTGCGGT
CTCCGAGGTG GCCTGGGGCA AGATCCCCAG CGGTTTTGTG TGCAAAATAA AAAAGGCCTC
AGTGACCCGG AAAAAAAAAA AAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO1alpha-enolase isoform 1 [Homo sapiens]. 8080.0O
Contig/Assembly ProteinENO2gamma-enolase [Homo sapiens]. 7230.0O
Contig/Assembly ProteinENO3beta-enolase isoform 1 [Homo sapiens]. 7130.0O
Contig/Assembly ProteinENO3beta-enolase isoform 1 [Homo sapiens]. 7130.0O
Contig/Assembly ProteinENO1c-myc promoter-binding protein-1 isoform MBP-1 [Homo sapiens]. 6350.0O
Contig/Assembly ProteinENO3beta-enolase isoform 2 [Homo sapiens]. 628e-180O
Contig/Assembly ProteinENO4enolase-like protein ENO4 [Homo sapiens]. 89.41e-17


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 7 [Mus musculus]. 8040.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 8 [Mus musculus]. 8040.0O
Contig/Assembly ProteinLOC100045967PREDICTED: alpha-enolase-like [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 4 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 5 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 2 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 1 [Mus musculus]. 8000.0O
Contig/Assembly ProteinLOC100503183PREDICTED: alpha-enolase-like isoform 6 [Mus musculus]. 8000.0O
Contig/Assembly ProteinGm5506hypothetical protein LOC433182 [Mus musculus]. 8000.0O
Contig/Assembly ProteinEno1alpha-enolase [Mus musculus]. 8000.0O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 2 [Canis familiaris]. 7230.0O
Contig/Assembly ProteinLOC479469PREDICTED: similar to Beta enolase (2-phospho-D-glycerate hydro-lyase) (Muscle-specific enolase) (MSE) (Skeletal muscle enolase) (Enolase 3) isoform 1 [Canis familiaris]. 7200.0O
Contig/Assembly ProteinLOC479469PREDICTED: similar to Beta enolase (2-phospho-D-glycerate hydro-lyase) (Muscle-specific enolase) (MSE) (Skeletal muscle enolase) (Enolase 3) isoform 2 [Canis familiaris]. 7140.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 4 [Canis familiaris]. 7020.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 5 [Canis familiaris]. 6920.0O
Contig/Assembly ProteinLOC477709PREDICTED: similar to Gamma enolase (2-phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) isoform 3 [Canis familiaris]. 6860.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 1 [Canis familiaris]. 6750.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 9 [Canis familiaris]. 6730.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 10 [Canis familiaris]. 6730.0O
Contig/Assembly ProteinLOC479597PREDICTED: similar to Alpha enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein) isoform 5 [Canis familiaris]. 6690.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO1alpha-enolase [Bos taurus]. 8110.0O
Contig/Assembly ProteinENO3beta-enolase [Bos taurus]. 7210.0O
Contig/Assembly ProteinENO2gamma-enolase [Bos taurus]. 7210.0O
Contig/Assembly ProteinENO4enolase 4 [Bos taurus]. 85.12e-16


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinENO2PREDICTED: gamma-enolase isoform 1 [Sus scrofa]. 7210.0O
Contig/Assembly ProteinENO3beta-enolase [Sus scrofa]. 7170.0O
Contig/Assembly ProteinENO2PREDICTED: gamma-enolase isoform 2 [Sus scrofa]. 6360.0O
Contig/Assembly ProteinENO4PREDICTED: enolase-like protein ENO4 [Sus scrofa]. 87.42e-17


Assembly Members: 518      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010014C12ADR01_0014_C12.bDB782763 
ADR010018C12ADR01_0018_C12.bDB783087 
ADR010047B05ADR01_0047_B05.bDB785651 
ADR010047D11ADR01_0047_D11.bDB785679 
ADR010052A05ADR01_0052_A05.bDB786089 
ADR010054C01ADR01_0054_C01.bDB786289 
ADR010063D02ADR01_0063_D02.bDB787109 
ADR010069C02ADR01_0069_C02.bDB787613 
ADR010074D04ADR01_0074_D04.bDB788063 
ADR010077G02ADR01_0077_G02.bDB788372 
ADR010077G04ADR01_0077_G04.bDB788374 
BFLT10004D05BFLT1_0004_D05.bFS640284 
BFLT10006B01BFLT1_0006_B01.bFS640420 
BFLT10013F07BFLT1_0013_F07.bFS641060 
BFLT10027C01BFLT1_0027_C01.bFS642180 
BFLT10029H07BFLT1_0029_H07.bFS642401 
BFLT10035B01BFLT1_0035_B01.bFS642834 
BFLT10039C03BFLT1_0039_C03.bFS643164 
BFLT10064D11BFLT1_0064_D11.bFS645090 
BFLT10064G07BFLT1_0064_G07.bFS645122 
BFLT10085G01BFLT1_0085_G01.bFS646751 
BFLT10113C08BFLT1_0113_C08.bHX202801 
BFLT10117F06BFLT1_0117_F06.bHX203164 
BFLT10120A08BFLT1_0120_A08.bHX203367 
BFLT10126D05BFLT1_0126_D05.bHX203879 
BFLT10140H08BFLT1_0140_H08.bHX204947 
BFLT10151E05BFLT1_0151_E05.bHX205543 
BKFL10020D04BKFL1_0020_D04.bFS649077 
BKFL10024C04BKFL1_0024_C04.bFS649365 
BKFL10028G02BKFL1_0028_G02.bFS649767 
BKFL10085G02BKFL1_0085_G02.b  
BKFL10093C09BKFL1_0093_C09.bFS654633 
BKFL10097B08BKFL1_0097_B08.bFS654971 
BKFL10103A12BKFL1_0103_A12.bFS655488 
BMWN10017H07BMWN1_0017_H07.bHX206609 
CBLT10033G06CBLT1_0033_G06.bHX214142 
CBLT10042D05CBLT1_0042_D05.bHX214661 
CBLT10066H09CBLT1_0066_H09.bHX216432 
CLNT10006C03CLNT1_0006_C03.bFS657501 
CLNT10029E06CLNT1_0029_E06.bFS659334 
CLNT10037B11CLNT1_0037_B11.bFS659925 
CLNT10038B04CLNT1_0038_B04.bFS660004 
CLNT10071C06CLNT1_0071_C06.bFS662661 
CLNT10087F02CLNT1_0087_F02.bFS663343 
CLNT10111H05CLNT1_0111_H05.bHX220034 
CLNT10114G04CLNT1_0114_G04.bHX220256 
CLNT10144A03CLNT1_0144_A03.bHX222498 
DCI010003C02DCI01_0003_C02.bDB790762 
DCI010010A01DCI01_0010_A01.bDB791157 
DCI010010E05DCI01_0010_E05.bDB791206 
DCI010011B10DCI01_0011_B10.bDB791267 
DCI010014E11DCI01_0014_E11.bDB791553 
DCI010023C07DCI01_0023_C07.bDB792339 
DCI010024H03DCI01_0024_H03.bDB792479 
DCI010031H08DCI01_0031_H08.bDB793093 
DCI010047A06DCI01_0047_A06.bDB794335 
DCI010082D02DCI01_0082_D02.bDB796839 
DCI010085F04DCI01_0085_F04.bDB797127 
DCI010088F12DCI01_0088_F12.bDB797401 
HTMT10074D08HTMT1_0074_D08.bFS669473 
HTMT10075H10HTMT1_0075_H10.bFS669588 
HTMT10088G03HTMT1_0088_G03.bFS670435 
HTMT10099F06HTMT1_0099_F06.bFS671244 
HTMT10106E01HTMT1_0106_E01.bHX223638 
HTMT10107C05HTMT1_0107_C05.bHX223698 
HTMT10118C01HTMT1_0118_C01.bHX224430 
HTMT10127B01HTMT1_0127_B01.bHX224958 
HTMT10132F05HTMT1_0132_F05.bHX225259 
HTMT10144D08HTMT1_0144_D08.bHX226149 
ILNT10058E07ILNT1_0058_E07.bHX231341 
ILNT10062D07ILNT1_0062_D07.bHX231665 
ILNT10065C07ILNT1_0065_C07.bHX231902 
ILNT10074G08ILNT1_0074_G08.bHX232682 
ILNT10080B10ILNT1_0080_B10.bHX233110 
ITT010006B08ITT01_0006_B08.bBW976510 
ITT010009H10ITT01_0009_H10.bBW976856 
ITT010017G12ITT01_0017_G12.bBW977568 
ITT010018D03ITT01_0018_D03.bBW977612 
ITT010040C05ITT01_0040_C05.bBW979589 
ITT010042C03ITT01_0042_C03.bBW979766 
ITT010044G03ITT01_0044_G03.bBW979993 
ITT010056C11ITT01_0056_C11.bBW980969 
ITT010061A02ITT01_0061_A02.bBW981388 
ITT010065F02ITT01_0065_F02.bBW981797 
ITT010067A02ITT01_0067_A02.bBW981925 
ITT010086C06ITT01_0086_C06.bBW983616 
ITT010088H04ITT01_0088_H04.bBW983852 
ITT010091E10ITT01_0091_E10.bBW984096 
ITT010100G12ITT01_0100_G12.bBW984934 
KDN010007F07KDN01_0007_F07.bFS671734 
KDN010031H09KDN01_0031_H09.bFS673600 
KDN010057G08KDN01_0057_G08.bFS674998 
KDN010068B08KDN01_0068_B08.bFS675838 
KDN010068B12KDN01_0068_B12.bFS675841 
KDN010080C06KDN01_0080_C06.bFS676786 
KDN010083H11KDN01_0083_H11.bFS677066 
KDN010097E10KDN01_0097_E10.bFS678163 
LNG010056F05LNG01_0056_F05.bBP438323 
LNG010060H06LNG01_0060_H06.bBP440409 
LNG010065A06LNG01_0065_A06.bBP433457 
LNG010066E08LNG01_0066_E08.bBP437554 
LNG010069C09LNG01_0069_C09.bBP435661 
LNG010080H05LNG01_0080_H05.bBP440345 
LNG010090B06LNG01_0090_B06.bBP434450 
LVR010029A11LVR01_0029_A11.bBP441735 
LVR010043D12LVR01_0043_D12.bBP444522 
LVR010053F03LVR01_0053_F03.bBP445619 
LVR010082H08LVR01_0082_H08.bBP447819 
LVR010098C11LVR01_0098_C11.bBP443592 
LVRM10003C08LVRM1_0003_C08.bCJ001017 
LVRM10011A12LVRM1_0011_A12.bBP448861 
LVRM10042B09LVRM1_0042_B09.bCJ001973 AK232866
LVRM10043F01LVRM1_0043_F01.bCJ002098 
LVRM10050A03LVRM1_0050_A03.bBP448263 
LVRM10055D01LVRM1_0055_D01.bBP138916 
LVRM10055F08LVRM1_0055_F08.bBP140101 
LVRM10083H10LVRM1_0083_H10.bCJ002674 
LVRM10098C01LVRM1_0098_C01.bCJ003835 
LVRM10125D05LVRM1_0125_D05.bBP450856 
LVRM10125D10LVRM1_0125_D10.bBP451218 
LVRM10134F12LVRM1_0134_F12.bBP452953 
LVRM10169C08LVRM1_0169_C08.bCJ004560 
LVRM10175C01LVRM1_0175_C01.bCJ005035 
LVRM10197B10LVRM1_0197_B10.bCJ006740 
MLN010013C05MLN01_0013_C05.bCJ008704 
MLN010040A02MLN01_0040_A02.bCJ010749 
MLN010040G09MLN01_0040_G09.bCJ010818 
MLN010042D11MLN01_0042_D11.bBW963552 
MLN010064A01MLN01_0064_A01.bCJ012648 
MLN010097G01MLN01_0097_G01.bCJ015466 
MLN010099G05MLN01_0099_G05.bCJ015650 
OVR010001C12OVR01_0001_C12.bBP142548 
OVR010001E06OVR01_0001_E06.bBP143221 
OVR010003H12OVR01_0003_H12.bBP144807 
OVR010004D09OVR01_0004_D09.bBP142888 
OVR010006H06OVR01_0006_H06.bBP144585 
OVR010008E12OVR01_0008_E12.bBP143442 
OVR010009C06OVR01_0009_C06.bBP142328 
OVR010009F10OVR01_0009_F10.bBP143826 
OVR010010F01OVR01_0010_F01.b  
OVR010011C09OVR01_0011_C09.bBP142442 
OVR010012A04OVR01_0012_A04.bBP141364 
OVR010013A07OVR01_0013_A07.bBP141479 
OVR010017C06OVR01_0017_C06.bBP142333 
OVR010017G03OVR01_0017_G03.bBP144030 
OVR010018G04OVR01_0018_G04.bBP144069 
OVR010020B08OVR01_0020_B08.bBP141956 
OVR010021H12OVR01_0021_H12.bBP144823 
OVR010022D06OVR01_0022_D06.bBP142791 
OVR010025D06OVR01_0025_D06.bBP142792 
OVR010025E07OVR01_0025_E07.bBP143276 
OVR010026F05OVR01_0026_F05.bBP143648 
OVR010027A07OVR01_0027_A07.bBP141488 
OVR010027A11OVR01_0027_A11.bBP141638 
OVR010027H01OVR01_0027_H01.bBP144412 
OVR010028D07OVR01_0028_D07.bBP142832 
OVR010028H10OVR01_0028_H10.bBP144753 
OVR010028H11OVR01_0028_H11.bBP144788 
OVR010029B05OVR01_0029_B05.bBP141853 
OVR010029G05OVR01_0029_G05.bBP144116 
OVR010030E08OVR01_0030_E08.bBP143318 
OVR010034C03OVR01_0034_C03.bBP142230 
OVR010036H02OVR01_0036_H02.bBP144458 
OVR010038A04OVR01_0038_A04.bBP141386 
OVR010039D09OVR01_0039_D09.bBP142912 
OVR010040A08OVR01_0040_A08.bBP141533 
OVR010042F08OVR01_0042_F08.b  AK234314
OVR010046C02OVR01_0046_C02.bBP142200 
OVR010047F12OVR01_0047_F12.bBP143933 
OVR010049D09OVR01_0049_D09.bBW963973 
OVR010052B02OVR01_0052_B02.bBW964222 
OVR010052H06OVR01_0052_H06.bBW964293 
OVR010053C04OVR01_0053_C04.bBW964325 
OVR010053D02OVR01_0053_D02.bBW964334 
OVR010054A04OVR01_0054_A04.bBW964392 
OVR010054C05OVR01_0054_C05.bBW964416 
OVR010055B04OVR01_0055_B04.bBW964490 
OVR010055H07OVR01_0055_H07.bBW964561 
OVR010056A09OVR01_0056_A09.bBW964575 
OVR010056D10OVR01_0056_D10.bBW964607 
OVR010059E03OVR01_0059_E03.bBW964881 
OVR010062G12OVR01_0062_G12.bBW965179 
OVR010063D07OVR01_0063_D07.bBW965227 
OVR010064E05OVR01_0064_E05.bBW965327 
OVR010064F09OVR01_0064_F09.bBW965343 
OVR010064G11OVR01_0064_G11.bBW965356 
OVR010064H08OVR01_0064_H08.bBW965363 
OVR010066A01OVR01_0066_A01.bBW965454 
OVR010067E11OVR01_0067_E11.bBW965597 
OVR010070A01OVR01_0070_A01.bBW965812 
OVR010072H01OVR01_0072_H01.bBW966075 
OVR010073F06OVR01_0073_F06.bBW966132 
OVR010074C12OVR01_0074_C12.bBW966193 
OVR010074D11OVR01_0074_D11.bBW966204 
OVR010077B02OVR01_0077_B02.bBW966442 
OVR010077C11OVR01_0077_C11.bBW966460 
OVR010077D12OVR01_0077_D12.bBW966470 
OVR010078A05OVR01_0078_A05.bBW966509 
OVR010080F08OVR01_0080_F08.bBW966699 
OVR010081C12OVR01_0081_C12.bBW966754 
OVR010085G05OVR01_0085_G05.bBW967029 
OVR010088G11OVR01_0088_G11.bBW967262 
OVR010088H04OVR01_0088_H04.bBW967266 
OVR010090D10OVR01_0090_D10.bBW967380 
OVR010090E04OVR01_0090_E04.bBW967384 
OVR010091A01OVR01_0091_A01.bBW967421 
OVR010092E05OVR01_0092_E05.bBW967545 
OVR010092G05OVR01_0092_G05.bBW967562 
OVR010095E11OVR01_0095_E11.bBW967770 
OVR010099F04OVR01_0099_F04.bBW968084 
OVR010099G04OVR01_0099_G04.bBW968093 
OVR010099G06OVR01_0099_G06.bBW968095 
OVR010100F03OVR01_0100_F03.bBW968159 
OVR010101B06OVR01_0101_B06.bBW968200 
OVR010101E08OVR01_0101_E08.bBW968236 
OVR010101G06OVR01_0101_G06.bBW968256 
OVR010101H01OVR01_0101_H01.bBW968262 
OVR010102C10OVR01_0102_C10.bBW968302 
OVR010103G07OVR01_0103_G07.bBW968436 
OVRM10003H04OVRM1_0003_H04.bBP153994 
OVRM10006H07OVRM1_0006_H07.bBP154330 
OVRM10011E08OVRM1_0011_E08.bBP150613 
OVRM10014G04OVRM1_0014_G04.bBP152678 
OVRM10014H09OVRM1_0014_H09.bBP154563 
OVRM10015H02OVRM1_0015_H02.bBP153780 
OVRM10017C08OVRM1_0017_C08.bBP148115 
OVRM10019H05OVRM1_0019_H05.bBP461676 
OVRM10020D01OVRM1_0020_D01.bBP148665 
OVRM10022E04OVRM1_0022_E04.bBP150224 
OVRM10022F03OVRM1_0022_F03.bBP151352 
OVRM10029G09OVRM1_0029_G09.bBP153228 
OVRM10034H10OVRM1_0034_H10.bBP154685 
OVRM10039E09OVRM1_0039_E09.bBP459103 
OVRM10042B11OVRM1_0042_B11.bBP456381 
OVRM10044E01OVRM1_0044_E01.bBP458463 
OVRM10047D04OVRM1_0047_D04.bBP148987 
OVRM10049H01OVRM1_0049_H01.bBP153695 
OVRM10050B02OVRM1_0050_B02.bBP146262 
OVRM10050C11OVRM1_0050_C11.bBP148456 
OVRM10052A02OVRM1_0052_A02.bBP144964 
OVRM10055A11OVRM1_0055_A11.bBP145945 
OVRM10058G03OVRM1_0058_G03.bBP152598 
OVRM10059G08OVRM1_0059_G08.bBP153135 
OVRM10068C10OVRM1_0068_C10.bBP148363 
OVRM10068E10OVRM1_0068_E10.bBP150854 
OVRM10069C05OVRM1_0069_C05.bBP147831 
OVRM10073B01OVRM1_0073_B01.bBP146178 
OVRM10077H08OVRM1_0077_H08.bBP154497 
OVRM10079B02OVRM1_0079_B02.bBP146290 
OVRM10085G09OVRM1_0085_G09.bBP153272 
OVRM10086A06OVRM1_0086_A06.bBP145422 
OVRM10087B07OVRM1_0087_B07.bBP146820 
OVRM10089B07OVRM1_0089_B07.bBP146822 
OVRM10089F07OVRM1_0089_F07.bBP151811 
OVRM10092B05OVRM1_0092_B05.bBP146615 
OVRM10099A04OVRM1_0099_A04.bBP145220 
OVRM10100A04OVRM1_0100_A04.bBP145221 
OVRM10100B12OVRM1_0100_B12.bBP147373 
OVRM10101H10OVRM1_0101_H10.bBP154737 
OVRM10103C08OVRM1_0103_C08.bBP148179 
OVRM10107B02OVRM1_0107_B02.bBP146309 
OVRM10111F09OVRM1_0111_F09.bBP152044 
OVRM10113F03OVRM1_0113_F03.bBP151422 
OVRM10114H06OVRM1_0114_H06.bBP154302 
OVRM10117B04OVRM1_0117_B04.bBP146533 
OVRM10118C08OVRM1_0118_C08.bBP148193 
OVRM10119B04OVRM1_0119_B04.bBP146535 
OVRM10119E10OVRM1_0119_E10.bBP150904 
OVRM10124E12OVRM1_0124_E12.bBP151131 
OVRM10128F02OVRM1_0128_F02.bBP151332 
OVRM10129E11OVRM1_0129_E11.bBP151029 
OVRM10129G08OVRM1_0129_G08.bBP153200 
OVRM10131B11OVRM1_0131_B11.bBP147293 
OVRM10138G10OVRM1_0138_G10.bBP153437 
OVRM10148B02OVRM1_0148_B02.bBP455645 
OVRM10150H07OVRM1_0150_H07.bBP461835 
OVRM10153C01OVRM1_0153_C01.bBP456543 
OVRM10168G04OVRM1_0168_G04.bBP460678 
OVRM10170A04OVRM1_0170_A04.bBP454915 
OVRM10184A04OVRM1_0184_A04.bBP454920 
OVRM10185B08OVRM1_0185_B08.bBP456178 
OVRM10185H09OVRM1_0185_H09.bBP462025 
OVRM10189B03OVRM1_0189_B03.bBP455758 
OVRM10190E05OVRM1_0190_E05.bBP458815 
OVRM10195C01OVRM1_0195_C01.bBP456575 
OVRM10198G03OVRM1_0198_G03.bBP460617 
OVRM10201B09OVRM1_0201_B09.bBP456270 
OVRM10206E10OVRM1_0206_E10.bBP459220 
OVRM10211E08OVRM1_0211_E08.bBP459080 
OVRM10214C06OVRM1_0214_C06.bBP456998 
OVRM10217B10OVRM1_0217_B10.bBP456364 
OVRM10217D12OVRM1_0217_D12.bBP458441 
OVRM10217E01OVRM1_0217_E01.bBP458524 
OVRM10218A06OVRM1_0218_A06.bBP455105 
OVRM10218F03OVRM1_0218_F03.bBP459635 
OVRM10220A06OVRM1_0220_A06.bBP455107 
OVRM10225C08OVRM1_0225_C08.bBP457165 
OVRM10225H08OVRM1_0225_H08.bBP461981 
OVRT10009C07OVRT1_0009_C07.bFS687115 
OVRT10022D06OVRT1_0022_D06.bFS688192 
OVRT10038C05OVRT1_0038_C05.bFS689487 
OVRT10043E06OVRT1_0043_E06.bFS689920 
OVRT10044B01OVRT1_0044_B01.bFS689969 
OVRT10061B03OVRT1_0061_B03.bFS691368 
OVRT10068C12OVRT1_0068_C12.bFS691964 
OVRT10089G12OVRT1_0089_G12.bFS693693 
OVRT10092H06OVRT1_0092_H06.bFS693938 
OVRT10093C01OVRT1_0093_C01.bFS693966 
OVRT10094A10OVRT1_0094_A10.bFS694039 
OVRT10095D02OVRT1_0095_D02.bFS694147 
OVRT10096E10OVRT1_0096_E10.bFS694247 
OVRT10099E01OVRT1_0099_E01.bFS694490 
OVRT10104C07OVRT1_0104_C07.bHX235098 
OVRT10121F01OVRT1_0121_F01.bHX236521 
OVRT10122F07OVRT1_0122_F07.bHX236607 
OVRT10125C07OVRT1_0125_C07.bHX236804 
OVRT10140E08OVRT1_0140_E08.b  
OVRT10150D09OVRT1_0150_D09.bHX238862 
OVRT10151D02OVRT1_0151_D02.bHX238934 
PBL010009A11PBL01_0009_A11.bBW969009 
PBL010024A10PBL01_0024_A10.bBP155191 
PBL010035E09PBL01_0035_E09.bBW970167 
PBL010036E07PBL01_0036_E07.bBP155914 AK396050
PBL010037C03PBL01_0037_C03.bBW970225 
PBL010040B04PBL01_0040_B04.bBW970410 
PBL010045D09PBL01_0045_D09.bBW970761 
PBL010053G04PBL01_0053_G04.bBW971231 
PBL010055G10PBL01_0055_G10.bBW971386 
PBL010058G12PBL01_0058_G12.bBW971527 
PBL010059E06PBL01_0059_E06.bBW971565 
PBL010059F10PBL01_0059_F10.bBP156148 
PBL010060G09PBL01_0060_G09.bBW971632 
PBL010079E03PBL01_0079_E03.bBW973190 
PBL010105C08PBL01_0105_C08.bBW975410 
PCT010001D03PCT01_0001_D03.bFS694652 
PCT010002H04PCT01_0002_H04.bFS694762 
PCT010019E07PCT01_0019_E07.b  
PCT010021B05PCT01_0021_B05.b  
PCT010021G11PCT01_0021_G11.bFS696053 
PCT010028C04PCT01_0028_C04.bFS696493 
PCT010031E10PCT01_0031_E10.bFS696696 
PCT010033E07PCT01_0033_E07.bFS696816 
PST010001E01PST01_0001_E01.bFS697105 
PST010003B04PST01_0003_B04.bFS697212 
PST010008H04PST01_0008_H04.bFS697654 
PST010020E11PST01_0020_E11.bFS698564 
PST010021D02PST01_0021_D02.bFS698623 
PST010029D09PST01_0029_D09.b  
PST010032E08PST01_0032_E08.b  
PST010037C07PST01_0037_C07.bFS699722 
PST010044D02PST01_0044_D02.bFS700293 
PST010045A08PST01_0045_A08.bFS700346 
PST010048B10PST01_0048_B10.bFS700592 
PST010051H05PST01_0051_H05.bFS700899 
PST010051H11PST01_0051_H11.bFS700904 
PST010057D06PST01_0057_D06.bFS701334 
PST010057G12PST01_0057_G12.bFS701371 
PST010058B10PST01_0058_B10.bFS701401 
PST010060G09PST01_0060_G09.b  
PST010063B06PST01_0063_B06.b  
PST010063E09PST01_0063_E09.bFS701830 
PST010065F06PST01_0065_F06.bFS701991 
PST010068B08PST01_0068_B08.b  
PST010091H08PST01_0091_H08.bFS704082 
PST010095D09PST01_0095_D09.bFS704349 
PST010098C12PST01_0098_C12.bFS704550 
PTG010004B06PTG01_0004_B06.bFS705004 
PTG010010G11PTG01_0010_G11.bFS705320 
PTG010021D05PTG01_0021_D05.bFS706249 
PTG010046B04PTG01_0046_B04.bFS708450 
PTG010056B12PTG01_0056_B12.bFS709311 
PTG010063A02PTG01_0063_A02.bFS709884 
PTG010090F06PTG01_0090_F06.b  
SKNB10008D11SKNB1_0008_D11.b  
SKNB10016A03SKNB1_0016_A03.bDB800841 
SKNB10016A04SKNB1_0016_A04.bDB800842 
SKNB10022G12SKNB1_0022_G12.b  
SKNB10023E10SKNB1_0023_E10.bDB801235 
SKNB10029F05SKNB1_0029_F05.bDB801585 
SKNB10030H01SKNB1_0030_H01.bDB801653 
SKNB10050F01SKNB1_0050_F01.bDB802915 
SKNB10054A10SKNB1_0054_A10.bDB803173 
SKNB10057D05SKNB1_0057_D05.bDB803402 
SKNB10060C02SKNB1_0060_C02.bDB803590 
SKNB10075H11SKNB1_0075_H11.bDB804611 
SKNB10087E06SKNB1_0087_E06.b  
SKNB10089D12SKNB1_0089_D12.bDB805380 
SMG010017C10SMG01_0017_C10.bFS714721 
SMG010018B09SMG01_0018_B09.bFS714798 
SMG010022F10SMG01_0022_F10.bFS715208 
SMG010067F03SMG01_0067_F03.bFS719077 
SMG010070H05SMG01_0070_H05.bFS719356 
SMG010097E02SMG01_0097_E02.bFS721633 
SPL010008G11SPL01_0008_G11.bBP158991 
SPL010011E12SPL01_0011_E12.bBP158338 
SPL010013G03SPL01_0013_G03.bBP158770 
SPL010026C03SPL01_0026_C03.bBP157401 
SPL010029G01SPL01_0029_G01.bCJ016269 
SPL010032E07SPL01_0032_E07.bCJ016523 
SPL010036H06SPL01_0036_H06.bBP159204 
SPL010038F05SPL01_0038_F05.bBP158508 
SPL010042C11SPL01_0042_C11.bCJ016782 
SPL010047G11SPL01_0047_G11.bCJ017285 
SPL010051B06SPL01_0051_B06.bCJ017579 
SPL010055C09SPL01_0055_C09.bCJ017954 
SPL010056H07SPL01_0056_H07.bCJ018097 
SPL010058C02SPL01_0058_C02.bCJ018218 
SPL010062A06SPL01_0062_A06.bCJ018557 
SPL010068H08SPL01_0068_H08.bCJ019180 
SPL010069G06SPL01_0069_G06.bCJ019258 
SPL010071G01SPL01_0071_G01.bCJ019433 
SPL010073G05SPL01_0073_G05.bCJ019616 
SPL010076F10SPL01_0076_F10.bCJ019883 
SPL010088F02SPL01_0088_F02.bCJ020960 
SPL010092H01SPL01_0092_H01.bCJ021336 
SPL010094E10SPL01_0094_E10.bCJ021491 
SPL010100D06SPL01_0100_D06.b  
SPL010102H05SPL01_0102_H05.bCJ022217 
SPLT10024F08SPLT1_0024_F08.bHX241084 
SPLT10072G07SPLT1_0072_G07.bHX244827 
SPLT10089G10SPLT1_0089_G10.bHX246160 
TCH010003D04TCH01_0003_D04.bBW975668 
TCH010041E01TCH01_0041_E01.bCJ025504 
TCH010042A11TCH01_0042_A11.bCJ025553 
TCH010060H08TCH01_0060_H08.bCJ026739 
TCH010064D09TCH01_0064_D09.bCJ027009 AK398021
TCH010091D08TCH01_0091_D08.bCJ029069 
TES010001G02TES01_0001_G02.bCJ030073 
TES010002G01TES01_0002_G01.bFS722153 
TES010003E11TES01_0003_E11.b  
TES010003F11TES01_0003_F11.bCJ030201 
TES010004B06TES01_0004_B06.bCJ030235 
TES010006H01TES01_0006_H01.bCJ030422 
TES010008F12TES01_0008_F12.bCJ030545 
TES010009A10TES01_0009_A10.bCJ030571 
TES010009D10TES01_0009_D10.bCJ030600 
TES010020F09TES01_0020_F09.b  
TES010022F11TES01_0022_F11.bCJ031494 
TES010023B02TES01_0023_B02.bCJ031522 
TES010026E10TES01_0026_E10.bCJ031738 
TES010032D02TES01_0032_D02.bCJ032120 
TES010034E06TES01_0034_E06.bCJ032249 
TES010034E12TES01_0034_E12.bCJ032253 
TES010036G04TES01_0036_G04.bCJ032399 
TES010041C07TES01_0041_C07.bFS722200 
TES010041E04TES01_0041_E04.bCJ032665 
TES010044E12TES01_0044_E12.bCJ032844 
TES010048D06TES01_0048_D06.b  
TES010048G03TES01_0048_G03.bCJ033084 
TES010049C10TES01_0049_C10.bCJ033116 
TES010051G07TES01_0051_G07.bFS722222 
TES010052F04TES01_0052_F04.bCJ033344 
TES010053H10TES01_0053_H10.bCJ033411 
TES010055H05TES01_0055_H05.bCJ033526 
TES010058E09TES01_0058_E09.bCJ033720 
TES010061C12TES01_0061_C12.bCJ033905 
TES010062E06TES01_0062_E06.bCJ033990 
TES010063C02TES01_0063_C02.bCJ034042 
TES010067B07TES01_0067_B07.bCJ034298 
TES010067H04TES01_0067_H04.bCJ034350 
TES010068C05TES01_0068_C05.bCJ034377 
TES010068F08TES01_0068_F08.bCJ034407 
TES010074A03TES01_0074_A03.bCJ034746 
TES010077C11TES01_0077_C11.bCJ034953 
TES010077H11TES01_0077_H11.b  
TES010079H04TES01_0079_H04.bCJ035119 
TES010083D09TES01_0083_D09.bCJ035356 
TES010088H08TES01_0088_H08.bCJ035729 
TES010090F12TES01_0090_F12.bCJ035845 
TES010091C07TES01_0091_C07.bCJ035878 
TES010091E06TES01_0091_E06.bCJ035898 
TES010092C02TES01_0092_C02.bCJ035951 
TES010095C11TES01_0095_C11.bCJ036177 
TES010096E02TES01_0096_E02.bCJ036265 
TES010096E09TES01_0096_E09.bCJ036272 
TES010098E02TES01_0098_E02.bCJ036412 
TES010102H06TES01_0102_H06.bCJ036740 
TES010103D06TES01_0103_D06.bCJ036776 
TES010103E05TES01_0103_E05.bCJ036783 
TES010103G04TES01_0103_G04.bCJ036800 
TES010103G12TES01_0103_G12.bCJ036808 
TES010104D10TES01_0104_D10.bFS722277 
TES010107F05TES01_0107_F05.bCJ037077 
TES010108E08TES01_0108_E08.bCJ037136 
TES010110B03TES01_0110_B03.bCJ037249 
THY010001F04THY01_0001_F04.bBP165902 
THY010014B08THY01_0014_B08.bBP161315 
THY010020C07THY01_0020_C07.bBP162468 
THY010030D10THY01_0030_D10.bBP164022 
THY010032E09THY01_0032_E09.bBP165182 
THY010036E12THY01_0036_E12.bBP165494 
THY010036G05THY01_0036_G05.bBP167279 
THY010044G08THY01_0044_G08.bBP167600 
THY010048B01THY01_0048_B01.bBP160614 
THY010056A07THY01_0056_A07.bBP160017 
THY010058G05THY01_0058_G05.bBP167300 
THY010058H07THY01_0058_H07.bBP168789 
THY010060H03THY01_0060_H03.bBP168362 
THY010061E05THY01_0061_E05.bBP164800 
THY010061H01THY01_0061_H01.bBP168145 
THY010066H06THY01_0066_H06.bBP168691 
THY010069D02THY01_0069_D02.bBP163245 
THY010076G05THY01_0076_G05.b  
THY010079B06THY01_0079_B06.bBP161157 
THY010081H10THY01_0081_H10.b  
THY010094A07THY01_0094_A07.bBP160041 
THY010109H04THY01_0109_H04.bBP168504 
THY010119B11THY01_0119_B11.bBP161716 
THY010122F11THY01_0122_F11.bBP166709 
THY010202C01THY01_0202_C01.bBP161932 
THY010207A06THY01_0207_A06.bBP462493 
UTR010010D08UTR01_0010_D08.bBP171287 
UTR010035E10UTR01_0035_E10.bBP171925 
UTR010059E12UTR01_0059_E12.bBP464096 
UTR010061G11UTR01_0061_G11.bBP464652 
UTR010066B01UTR01_0066_B01.bBP462972 
UTR010084H05UTR01_0084_H05.bCJ037792 
UTR010095G08UTR01_0095_G08.bCJ038798 

  

SNPs: 9      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
77C0380.134B-
T24500.866
208C336800.908WSGTC/V
T4200.092GTT/V
292A2300.050WSCGA/R
G357800.950CGG/R
595C330710.891WSAAC/N
T4900.109AAT/N
903C47100.851WNTCG/S
T1000.149TTG/L
931A2400.615WSTCA/S
G690.385TCG/S
961A300.081WSCCA/P
G2590.919CCG/P
976C1860.686WSGAC/D
T1100.314GAT/D
1030C2370.882WSTTC/F
T400.118TTT/F


Alignment:      TOP

20110601C-000606 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ILNT1_0062_D07.b :
ILNT1_0065_C07.b :
SPLT1_0024_F08.b :
TCH01_0064_D09.b :
LVRM1_0125_D05.b :
PBL01_0036_E07.b :
OVR01_0042_F08.b :
SMG01_0018_B09.b :
SPL01_0069_G06.b :
PBL01_0059_F10.b :
PBL01_0024_A10.b :
ITT01_0067_A02.b :
OVRM1_0150_H07.b :
CBLT1_0066_H09.b :
HTMT1_0107_C05.b :
OVRT1_0068_C12.b :
LVRM1_0197_B10.b :
TES01_0095_C11.b :
TES01_0036_G04.b :
OVRT1_0009_C07.b :
SKNB1_0030_H01.b :
CLNT1_0071_C06.b :
OVRM1_0198_G03.b :
OVRM1_0089_B07.b :
SPL01_0029_G01.b :
OVR01_0101_G06.b :
LVR01_0098_C11.b :
TCH01_0042_A11.b :
ITT01_0044_G03.b :
ADR01_0077_G02.b :
BFLT1_0035_B01.b :
PST01_0032_E08.b :
TES01_0048_D06.b :
SKNB1_0057_D05.b :
TES01_0067_H04.b :
KDN01_0097_E10.b :
KDN01_0083_H11.b :
KDN01_0031_H09.b :
PST01_0098_C12.b :
OVR01_0080_F08.b :
LVR01_0029_A11.b :
OVR01_0028_H11.b :
OVRM1_0148_B02.b :
OVRM1_0085_G09.b :
HTMT1_0075_H10.b :
OVR01_0038_A04.b :
ITT01_0006_B08.b :
TES01_0074_A03.b :
TES01_0108_E08.b :
SMG01_0017_C10.b :
OVR01_0036_H02.b :
SPL01_0068_H08.b :
TES01_0009_A10.b :
DCI01_0024_H03.b : nntttctatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0076_G05.b :
OVRM1_0100_B12.b :
OVR01_0025_E07.b :
SPL01_0011_E12.b :
BFLT1_0085_G01.b :
THY01_0014_B08.b :
SMG01_0022_F10.b :
THY01_0060_H03.b :
BFLT1_0064_D11.b :
TCH01_0003_D04.b :
TCH01_0041_E01.b :
CLNT1_0006_C03.b :
LNG01_0080_H05.b :
ITT01_0091_E10.b :
OVRT1_0092_H06.b :
OVRM1_0118_C08.b :
DCI01_0011_B10.b : nnnnccgatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_E11.b :
HTMT1_0127_B01.b :
TES01_0003_F11.b :
HTMT1_0099_F06.b :
BMWN1_0017_H07.b :
PST01_0021_D02.b :
HTMT1_0118_C01.b :
DCI01_0014_E11.b : nnaaagatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0057_G08.b :
DCI01_0010_E05.b : ttctaggggatacttgggcgctgctcccacgccgxxxxxxxxxxxxxxx
HTMT1_0088_G03.b :
PST01_0063_E09.b :
DCI01_0047_A06.b : nnaatagtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F12.b : nngctacntaaaatcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_C06.b :
PTG01_0090_F06.b :
LVRM1_0098_C01.b :
OVRM1_0225_C08.b :
OVRM1_0218_A06.b :
OVRM1_0042_B11.b :
OVR01_0099_G06.b :
LVRM1_0175_C01.b :
OVR01_0074_C12.b :
OVR01_0074_D11.b :
OVRM1_0184_A04.b :
OVRM1_0217_E01.b :
ADR01_0014_C12.b :
OVRM1_0014_G04.b :
OVRM1_0015_H02.b :
OVRM1_0124_E12.b :
OVRM1_0087_B07.b :
OVRM1_0006_H07.b :
OVRM1_0068_E10.b :
OVRM1_0022_F03.b :
OVRM1_0103_C08.b :
PTG01_0056_B12.b :
OVRM1_0014_H09.b :
BFLT1_0117_F06.b :
PTG01_0063_A02.b :
OVR01_0102_C10.b :
THY01_0036_G05.b :
UTR01_0010_D08.b :
OVR01_0100_F03.b :
OVR01_0062_G12.b :
OVR01_0095_E11.b :
OVR01_0067_E11.b :
THY01_0036_E12.b :
OVRT1_0122_F07.b :
SPL01_0076_F10.b :
SPL01_0094_E10.b :
LVR01_0053_F03.b :
OVR01_0030_E08.b :
BFLT1_0113_C08.b :
OVR01_0077_B02.b :
CLNT1_0111_H05.b :
OVR01_0099_F04.b :
PTG01_0010_G11.b :
LNG01_0066_E08.b :
BFLT1_0151_E05.b :
OVRT1_0096_E10.b :
OVR01_0027_H01.b :
BFLT1_0004_D05.b :
OVRT1_0125_C07.b :
PBL01_0059_E06.b :
SPL01_0055_C09.b :
OVR01_0055_B04.b :
OVRT1_0093_C01.b :
UTR01_0066_B01.b :
BFLT1_0013_F07.b :
UTR01_0095_G08.b :
ITT01_0100_G12.b :
OVRT1_0043_E06.b :
OVR01_0001_E06.b :
LVR01_0043_D12.b :
ITT01_0086_C06.b :
OVR01_0049_D09.b :
CLNT1_0087_F02.b :
OVR01_0052_B02.b :
ITT01_0009_H10.b :
OVR01_0092_E05.b :
SPL01_0032_E07.b :
MLN01_0099_G05.b :
OVR01_0006_H06.b :
LNG01_0060_H06.b :
OVR01_0054_C05.b :
ITT01_0017_G12.b :
LVRM1_0042_B09.b :
DCI01_0031_H08.b : nnttaggatactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_A08.b :
DCI01_0085_F04.b : tatttaccgatacttgggggctgctcgcgcgccgxxxxxxxxxxxxx
BKFL1_0024_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
DCI01_0003_C02.b : tctatagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A01.b : tcttatgcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0020_D04.b : nnnccgcatannnnnnccgatatctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_F05.b :
BKFL1_0097_B08.b : nnnggctttnnnnnnnggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_G02.b : nnngggttannnnnnaacgaaccntaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0093_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
PST01_0068_B08.b :
DCI01_0082_D02.b : aaaanaacgtacctatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_C12.b :
OVRM1_0073_B01.b :
OVRM1_0218_F03.b :
LVRM1_0134_F12.b :
LVRM1_0083_H10.b :
LVRM1_0011_A12.b :
LVRM1_0055_D01.b :
TES01_0053_H10.b :
OVRM1_0190_E05.b :
OVRM1_0003_H04.b :
LVRM1_0125_D10.b :
OVRM1_0011_E08.b :
OVRM1_0017_C08.b :
SPL01_0058_C02.b :
OVRM1_0029_G09.b :
SPL01_0026_C03.b :
MLN01_0040_A02.b :
ADR01_0074_D04.b :
UTR01_0035_E10.b :
OVRT1_0151_D02.b :
PTG01_0046_B04.b :
OVRT1_0099_E01.b :
BFLT1_0126_D05.b :
BFLT1_0029_H07.b :
PTG01_0004_B06.b :
SPL01_0051_B06.b :
PST01_0063_B06.b :
BFLT1_0027_C01.b :
PBL01_0035_E09.b :
SPL01_0008_G11.b :
BFLT1_0039_C03.b :
ADR01_0047_B05.b :
OVR01_0028_H10.b :
ITT01_0042_C03.b :
OVR01_0090_E04.b :
OVR01_0070_A01.b :
OVR01_0091_A01.b :
OVR01_0012_A04.b :
OVRM1_0022_E04.b :
OVRM1_0185_H09.b :
ILNT1_0074_G08.b :
OVR01_0088_G11.b :
HTMT1_0106_E01.b :
OVRT1_0121_F01.b :
CBLT1_0042_D05.b :
HTMT1_0132_F05.b :
OVR01_0046_C02.b :
SKNB1_0050_F01.b :
CBLT1_0033_G06.b :
TES01_0079_H04.b :
TES01_0102_H06.b :
PCT01_0031_E10.b :
TES01_0023_B02.b :
TES01_0107_F05.b :
PST01_0001_E01.b :
TES01_0049_C10.b :
TES01_0001_G02.b :
SKNB1_0089_D12.b :
TES01_0110_B03.b :
PST01_0044_D02.b :
PCT01_0002_H04.b :
SKNB1_0075_H11.b :
SKNB1_0016_A03.b :
PST01_0045_A08.b :
PST01_0048_B10.b :
PST01_0058_B10.b :
UTR01_0084_H05.b :
PST01_0008_H04.b :
ADR01_0018_C12.b :
OVR01_0021_H12.b :
LVRM1_0050_A03.b :
TES01_0032_D02.b :
TES01_0096_E02.b :
TES01_0048_G03.b :
TES01_0051_G07.b :
TES01_0058_E09.b :
TES01_0022_F11.b :
TES01_0088_H08.b :
BFLT1_0140_H08.b :
TES01_0103_E05.b :
TES01_0103_G04.b :
OVR01_0064_F09.b :
CLNT1_0038_B04.b :
BFLT1_0006_B01.b :
TES01_0096_E09.b :
ADR01_0054_C01.b :
PST01_0003_B04.b :
PST01_0051_H05.b :
TES01_0044_E12.b :
PST01_0065_F06.b :
TES01_0041_C07.b :
CLNT1_0037_B11.b :
TES01_0067_B07.b :
PST01_0095_D09.b :
TES01_0004_B06.b :
SKNB1_0023_E10.b :
ADR01_0052_A05.b :
OVR01_0017_G03.b :
TES01_0091_C07.b :
TES01_0091_E06.b :
TES01_0020_F09.b :
TES01_0063_C02.b :
TES01_0103_G12.b :
PCT01_0028_C04.b :
TES01_0068_C05.b :
TES01_0006_H01.b :
KDN01_0007_F07.b :
TES01_0034_E12.b :
PST01_0051_H11.b :
PBL01_0079_E03.b :
KDN01_0068_B08.b :
TES01_0098_E02.b :
SMG01_0097_E02.b :
PST01_0060_G09.b :
TES01_0052_F04.b :
SKNB1_0022_G12.b :
PST01_0029_D09.b :
DCI01_0023_C07.b : nnnncctatcttxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b :
OVR01_0103_G07.b :
TES01_0083_D09.b :
THY01_0056_A07.b :
PBL01_0009_A11.b :
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b :
OVRM1_0100_A04.b :
OVRM1_0117_B04.b :
OVRM1_0089_F07.b :
OVRM1_0079_B02.b :
OVRM1_0217_B10.b :
THY01_0020_C07.b :
THY01_0069_D02.b :
OVR01_0059_E03.b :
OVR01_0053_C04.b :
OVR01_0053_D02.b :
ITT01_0040_C05.b :
PST01_0020_E11.b :
OVR01_0018_G04.b :
OVR01_0009_C06.b :
OVRM1_0129_E11.b :
UTR01_0059_E12.b :
SKNB1_0054_A10.b :
OVR01_0003_H12.b :
OVR01_0004_D09.b :
OVR01_0009_F10.b :
OVR01_0010_F01.b :
OVR01_0034_C03.b :
LVRM1_0043_F01.b :
TES01_0077_C11.b :
OVRM1_0214_C06.b :
TES01_0068_F08.b :
OVRM1_0119_B04.b :
OVRM1_0153_C01.b :
ILNT1_0080_B10.b :
OVR01_0077_C11.b :
OVRM1_0201_B09.b :
OVRM1_0114_H06.b :
SPL01_0013_G03.b :
CLNT1_0114_G04.b :
OVRT1_0089_G12.b :
THY01_0094_A07.b :
THY01_0081_H10.b :
SPL01_0038_F05.b :
OVR01_0011_C09.b :
OVRT1_0094_A10.b :
SKNB1_0016_A04.b :
THY01_0030_D10.b :
THY01_0061_E05.b :
OVR01_0040_A08.b :
THY01_0032_E09.b :
OVR01_0027_A11.b :
KDN01_0068_B12.b :
OVRM1_0220_A06.b :
TES01_0077_H11.b :
OVRM1_0225_H08.b :
THY01_0119_B11.b :
OVRM1_0052_A02.b :
OVRT1_0061_B03.b :
OVRM1_0068_C10.b :
OVRM1_0113_F03.b :
OVR01_0077_D12.b :
OVRM1_0189_B03.b :
OVRM1_0217_D12.b :
OVR01_0056_A09.b :
TES01_0092_C02.b :
OVRM1_0099_A04.b :
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b :
OVRM1_0211_E08.b :
OVRM1_0129_G08.b :
OVRM1_0168_G04.b :
LVRM1_0055_F08.b :
OVRM1_0101_H10.b :
OVRM1_0185_B08.b :
OVRM1_0034_H10.b :
OVRM1_0092_B05.b :
OVRM1_0050_C11.b :
OVRM1_0206_E10.b :
OVR01_0099_G04.b :
OVRM1_0111_F09.b :
MLN01_0042_D11.b :
TCH01_0060_H08.b :
OVRM1_0049_H01.b :
OVR01_0064_G11.b :
OVR01_0056_D10.b :
OVR01_0088_H04.b :
OVR01_0078_A05.b :
THY01_0048_B01.b :
OVR01_0025_D06.b :
SMG01_0070_H05.b :
SPL01_0088_F02.b :
SPL01_0047_G11.b :
OVR01_0052_H06.b :
SKNB1_0029_F05.b :
BFLT1_0064_G07.b :
THY01_0044_G08.b :
OVR01_0022_D06.b :
PCT01_0021_G11.b :
SPL01_0062_A06.b :
LNG01_0090_B06.b :
OVR01_0090_D10.b :
SPL01_0073_G05.b :
TES01_0055_H05.b :
OVR01_0001_C12.b :
THY01_0079_B06.b :
CLNT1_0144_A03.b :
PBL01_0037_C03.b :
MLN01_0013_C05.b :
OVR01_0039_D09.b :
LVR01_0082_H08.b :
OVR01_0029_G05.b :
OVRT1_0104_C07.b :
OVR01_0064_H08.b :
OVR01_0008_E12.b :
OVR01_0064_E05.b :
PBL01_0058_G12.b :
OVR01_0028_D07.b :
MLN01_0040_G09.b :
TES01_0104_D10.b :
OVR01_0063_D07.b :
OVR01_0020_B08.b :
UTR01_0061_G11.b :
PST01_0057_G12.b :
ITT01_0088_H04.b :
SPL01_0102_H05.b :
MLN01_0097_G01.b :
PBL01_0053_G04.b :
OVRT1_0095_D02.b :
ITT01_0061_A02.b :
ITT01_0056_C11.b :
OVR01_0092_G05.b :
OVR01_0029_B05.b :
OVR01_0054_A04.b :
ADR01_0077_G04.b :
OVR01_0017_C06.b :
OVRT1_0038_C05.b :
THY01_0066_H06.b :
SPL01_0036_H06.b :
THY01_0207_A06.b :
OVRT1_0044_B01.b :
MLN01_0064_A01.b :
PBL01_0105_C08.b :
OVR01_0013_A07.b :
THY01_0058_G05.b :
OVR01_0055_H07.b :
TES01_0103_D06.b :
OVRM1_0069_C05.b :
OVRT1_0150_D09.b :
LNG01_0065_A06.b :
OVRM1_0086_A06.b :
PBL01_0040_B04.b :
OVR01_0027_A07.b :
PBL01_0055_G10.b :
OVR01_0085_G05.b :
OVRT1_0140_E08.b :
LVRM1_0003_C08.b :
SKNB1_0087_E06.b :
SPL01_0092_H01.b :
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b :
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b :
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b :
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
ILNT1_0062_D07.b : nnnnccgacagtagaggcagtagtattaaxxxx
ILNT1_0065_C07.b : nnggcgcgagtagaggxxxxxxxxxxxxxxxxx
SPLT1_0024_F08.b : nnnggggagagtagaggxxxxxxxxxxxxxxxx
TCH01_0064_D09.b : nnnngggtaggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_E07.b : nnngggtaacaxxxxxxxxxxxxxxxxx
OVR01_0042_F08.b : gaggactttggcggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0018_B09.b : ggttcccnnnnggataaagcagcggtaxxxxxxxxx
SPL01_0069_G06.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0059_F10.b : naaagatxxxxxxxxxxxxxxxxxxxxxx
PBL01_0024_A10.b : nggtgaaacaxxxxxxxxxxxxxxxxx
ITT01_0067_A02.b : nttggatgaacaxxxxxxxxxxxxxxxxx
OVRM1_0150_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0066_H09.b : nngggtttnnnnnnccgacggtagaggccgtcgtattt
HTMT1_0107_C05.b : nggatattacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_C12.b : nnggtttnnnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_B10.b : xxxxxxxxxxxxxxxxxxxxxxx
TES01_0095_C11.b :
TES01_0036_G04.b :
OVRT1_0009_C07.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0030_H01.b :
CLNT1_0071_C06.b : ngggccctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_G03.b : nagttgtcatxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_B07.b : xxxxxxxxxxxxxxxxxxxx
SPL01_0029_G01.b : nggggggatggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_G06.b : tttggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_C11.b : cgcctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0042_A11.b : tttttggcttgtgacttnacagtttgtacxxxxxxxxxxxxxxxxxxxxx
ITT01_0044_G03.b : nnggatgaacaxxxxxxxxxxxxx
ADR01_0077_G02.b : nnnnaatgactaacaxxxxxxxxxxxx
BFLT1_0035_B01.b : nnccccnnnnngggaacccgtagcgnacgxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0032_E08.b :
TES01_0048_D06.b : tatgcatatagtt
SKNB1_0057_D05.b : n
TES01_0067_H04.b :
KDN01_0097_E10.b :
KDN01_0083_H11.b :
KDN01_0031_H09.b :
PST01_0098_C12.b :
OVR01_0080_F08.b :
LVR01_0029_A11.b : attagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_H11.b : gggccttaatgxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_B02.b : caattgtcxxxx
OVRM1_0085_G09.b : nagttgtcxxxx
HTMT1_0075_H10.b : tttttagacggtac
OVR01_0038_A04.b : aagggatataggtgxxxxxxxxxxxxxxxxxxx
ITT01_0006_B08.b : nnn
TES01_0074_A03.b :
TES01_0108_E08.b :
SMG01_0017_C10.b : a
OVR01_0036_H02.b : aagacatttcxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_H08.b : nggggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxx
TES01_0009_A10.b :
DCI01_0024_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0076_G05.b : tgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_B12.b : nagtt
OVR01_0025_E07.b : agaggactttagggtgxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_E12.b : catttagggtgxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0085_G01.b : ggattccgttagcgnacgxxx
THY01_0014_B08.b : ctagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0022_F10.b : ngggagttnnnnng
THY01_0060_H03.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0064_D11.b : atccgttagcgnacgnatg
TCH01_0003_D04.b : nnggctaggacttgacxxxx
TCH01_0041_E01.b : nnnnggctaggactatnacxxxxxxxxxx
CLNT1_0006_C03.b : nccgttttnnnggggccgttcgcgnacgxxxx
LNG01_0080_H05.b : nnntttgatggacatgacagxxxxxxx
ITT01_0091_E10.b : nnnaat
OVRT1_0092_H06.b : nnnggggttnnnnngnnnccgttagcgnacgxxxx
OVRM1_0118_C08.b : nagttgt
DCI01_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0003_E11.b :
HTMT1_0127_B01.b : nnngggcatttttnntccg
TES01_0003_F11.b :
HTMT1_0099_F06.b : tttttaga
BMWN1_0017_H07.b : nnaaga
PST01_0021_D02.b :
HTMT1_0118_C01.b : ttttgg
DCI01_0014_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0057_G08.b :
DCI01_0010_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0088_G03.b : tttttggac
PST01_0063_E09.b :
DCI01_0047_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0088_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_C06.b :
PTG01_0090_F06.b : nnnggcttattttnn
LVRM1_0098_C01.b : nagttgta
OVRM1_0225_C08.b : ttgt
OVRM1_0218_A06.b : gagttga
OVRM1_0042_B11.b : gt
OVR01_0099_G06.b : ggcttggactatgacagtttgtxxxxxxxxxxxxx
LVRM1_0175_C01.b :
OVR01_0074_C12.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_D11.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_A04.b : gagtttgtc
OVRM1_0217_E01.b : caattgt
ADR01_0014_C12.b :
OVRM1_0014_G04.b : xxxxxxxxxx
OVRM1_0015_H02.b : xxxxxxxxxx
OVRM1_0124_E12.b : nagttgt
OVRM1_0087_B07.b : agttgt
OVRM1_0006_H07.b : cxxxxxxxxx
OVRM1_0068_E10.b : tagttgtc
OVRM1_0022_F03.b : xxxxxxxxxxxx
OVRM1_0103_C08.b : nagttgtc
PTG01_0056_B12.b : ncgcatctctatat
OVRM1_0014_H09.b : xxxxxxxxxx
BFLT1_0117_F06.b : ncccttcgcgcacgx
PTG01_0063_A02.b : nnnnnnnnnnnnnn
OVR01_0102_C10.b : ngcttgggacttgacxxxxxxxxx
THY01_0036_G05.b : gatgcxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_D08.b : tttttgggggcgxxxxxxxxxxxxxx
OVR01_0100_F03.b : cttgtgacttgacxxxxxxxx
OVR01_0062_G12.b : ttttggcatggactataacagtttgt
OVR01_0095_E11.b : tgtgatatagacxxxxxxxx
OVR01_0067_E11.b : nnagcttgtgatatgacxxxxxxxx
THY01_0036_E12.b : gtgcaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_F07.b : nccccgttcagcgnacgx
SPL01_0076_F10.b : ttggctaggacttaaacagtttgtc
SPL01_0094_E10.b : nnnggcttggactatgacxxxxxxxxx
LVR01_0053_F03.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_E08.b : ggagcttatxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0113_C08.b : nnnnccgtcagc
OVR01_0077_B02.b : nnnnnnagcttggactatnacxxxxxxxxx
CLNT1_0111_H05.b : nnntttcgttagcgnacg
OVR01_0099_F04.b : nnnnggctaggactatgacagtttgt
PTG01_0010_G11.b : nnnnnnnnnnnnn
LNG01_0066_E08.b : nnnaagtaggacttgacag
BFLT1_0151_E05.b : nnnnccgttagcgnacgxxx
OVRT1_0096_E10.b : nntttccgatagcggacgx
OVR01_0027_H01.b : gggacactatxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0004_D05.b : nggactcgttagcgnacgx
OVRT1_0125_C07.b : ccccttcagcgnacg
PBL01_0059_E06.b : nn
SPL01_0055_C09.b : nnnggcttggactatgacxxxxxxxx
OVR01_0055_B04.b : nnnnggctaggactatgacxxxxxxxx
OVRT1_0093_C01.b : nnnnnccgttagctgacgxx
UTR01_0066_B01.b : ttttttttagcataggtgxxxxxxxxxxxxxxxxxxx
BFLT1_0013_F07.b : nggattcgttagcgnacgx
UTR01_0095_G08.b : nnnggcttggactataacxxxxxxxx
ITT01_0100_G12.b :
OVRT1_0043_E06.b : nnntttcgttagcgnacgx
OVR01_0001_E06.b : ggaccaatggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_D12.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_C06.b : na
OVR01_0049_D09.b : nnnnggcatggactatgacxxxxxxxx
CLNT1_0087_F02.b : nnttgtctnnngggcnccgtcagcgnacg
OVR01_0052_B02.b : nnnnnggctaggactatgacxxxxxxxx
ITT01_0009_H10.b : nn
OVR01_0092_E05.b : nnnggctaggactatgacxxxxxxxx
SPL01_0032_E07.b : nnnnnggctaggaatatnacxxxxxxxx
MLN01_0099_G05.b : nnnggcttggactataacxxxxxxxx
OVR01_0006_H06.b : tggacccatttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0060_H06.b : tttttagggcttggatatgacxxxx
OVR01_0054_C05.b : nnnccgctaggactatgacxxxxxxxx
ITT01_0017_G12.b :
LVRM1_0042_B09.b : nagttgtc
DCI01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0120_A08.b : ncgctcagcgct
DCI01_0085_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0024_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0003_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0020_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_F05.b : nnttccggctggacatgacxxxxx
BKFL1_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0068_B08.b :
DCI01_0082_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_C12.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0073_B01.b : xxxxxxxxx
OVRM1_0218_F03.b : nagtttg
LVRM1_0134_F12.b : ncgttgt
LVRM1_0083_H10.b :
LVRM1_0011_A12.b : agttg
LVRM1_0055_D01.b : nagttg
TES01_0053_H10.b :
OVRM1_0190_E05.b :
OVRM1_0003_H04.b : xxxxxxxx
LVRM1_0125_D10.b : nagttg
OVRM1_0011_E08.b : cxxxxxxx
OVRM1_0017_C08.b : cxxxxxxxx
SPL01_0058_C02.b : nnnggcttggactataacxxxxxxx
OVRM1_0029_G09.b : xxxxxxxxx
SPL01_0026_C03.b : cttttgggtggcctactagxxxxxxxxxxxx
MLN01_0040_A02.b : nnnnngcatagtactaanacxxxxxxxxx
ADR01_0074_D04.b : nttaanggacttaa
UTR01_0035_E10.b : gtgggacctxxxxxxxxxxxxxxxxxx
OVRT1_0151_D02.b : nnnnnccgttagcgnacgx
PTG01_0046_B04.b : nccgatcttn
OVRT1_0099_E01.b : tttttccttcagcgnac
BFLT1_0126_D05.b : nnncctcgtcagcgtagg
BFLT1_0029_H07.b : ggattccgttagcgnacg
PTG01_0004_B06.b : nngggcatcannnn
SPL01_0051_B06.b : nnnngtgcttggactatgacxxxxxxx
PST01_0063_B06.b :
BFLT1_0027_C01.b : gggatccgttcagcgnacgx
PBL01_0035_E09.b :
SPL01_0008_G11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0039_C03.b : ggatccgtcagcgnacg
ADR01_0047_B05.b : nnc
OVR01_0028_H10.b : gggggcttcatggtgxxxxxxxxxxxxxxxxxxx
ITT01_0042_C03.b : nn
OVR01_0090_E04.b : nnggctaggactaaaacxxxxxxx
OVR01_0070_A01.b : nnnnggataggactaagacxxxxxxx
OVR01_0091_A01.b : nnnnttgcttggactatgacxxxxxxx
OVR01_0012_A04.b : cgaaaattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_E04.b :
OVRM1_0185_H09.b : gagtt
ILNT1_0074_G08.b : nnng
OVR01_0088_G11.b : ccgcttgtgattagacxxxxxxx
HTMT1_0106_E01.b : tttt
OVRT1_0121_F01.b : cccgtcagcgna
CBLT1_0042_D05.b : n
HTMT1_0132_F05.b : tt
OVR01_0046_C02.b : aggcattagcxxxxxxxxxxxxxxxxxxxx
SKNB1_0050_F01.b :
CBLT1_0033_G06.b : t
TES01_0079_H04.b :
TES01_0102_H06.b :
PCT01_0031_E10.b :
TES01_0023_B02.b :
TES01_0107_F05.b :
PST01_0001_E01.b :
TES01_0049_C10.b :
TES01_0001_G02.b :
SKNB1_0089_D12.b :
TES01_0110_B03.b :
PST01_0044_D02.b :
PCT01_0002_H04.b :
SKNB1_0075_H11.b :
SKNB1_0016_A03.b :
PST01_0045_A08.b :
PST01_0048_B10.b :
PST01_0058_B10.b :
UTR01_0084_H05.b : nnnttgataggactaagacx
PST01_0008_H04.b :
ADR01_0018_C12.b :
OVR01_0021_H12.b : ttatggggggaaataaaaaxxxxxxxxxx
LVRM1_0050_A03.b : nag
TES01_0032_D02.b :
TES01_0096_E02.b :
TES01_0048_G03.b :
TES01_0051_G07.b :
TES01_0058_E09.b :
TES01_0022_F11.b :
TES01_0088_H08.b :
BFLT1_0140_H08.b : tttttcccttagcgna
TES01_0103_E05.b :
TES01_0103_G04.b :
OVR01_0064_F09.b : nnggcttggactataacxxxx
CLNT1_0038_B04.b : nnccgtctttnngggnnggtatagcgn
BFLT1_0006_B01.b : nggatccgttagcg
TES01_0096_E09.b :
ADR01_0054_C01.b :
PST01_0003_B04.b :
PST01_0051_H05.b :
TES01_0044_E12.b :
PST01_0065_F06.b :
TES01_0041_C07.b :
CLNT1_0037_B11.b : ngttccgttagc
TES01_0067_B07.b :
PST01_0095_D09.b :
TES01_0004_B06.b :
SKNB1_0023_E10.b :
ADR01_0052_A05.b : nnnnttcg
OVR01_0017_G03.b : ggggxxxxxxxxxxxxxxxxxxxxxxx
TES01_0091_C07.b :
TES01_0091_E06.b :
TES01_0020_F09.b :
TES01_0063_C02.b :
TES01_0103_G12.b :
PCT01_0028_C04.b :
TES01_0068_C05.b :
TES01_0006_H01.b :
KDN01_0007_F07.b :
TES01_0034_E12.b :
PST01_0051_H11.b :
PBL01_0079_E03.b :
KDN01_0068_B08.b :
TES01_0098_E02.b :
SMG01_0097_E02.b :
PST01_0060_G09.b :
TES01_0052_F04.b :
SKNB1_0022_G12.b :
PST01_0029_D09.b :
DCI01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b :
OVR01_0103_G07.b :
TES01_0083_D09.b :
THY01_0056_A07.b : ctxx
PBL01_0009_A11.b :
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b :
OVRM1_0100_A04.b :
OVRM1_0117_B04.b :
OVRM1_0089_F07.b :
OVRM1_0079_B02.b :
OVRM1_0217_B10.b :
THY01_0020_C07.b :
THY01_0069_D02.b : cxx
OVR01_0059_E03.b :
OVR01_0053_C04.b : nn
OVR01_0053_D02.b :
ITT01_0040_C05.b :
PST01_0020_E11.b :
OVR01_0018_G04.b :
OVR01_0009_C06.b : cgaaattatggaxxxxxxxxxxxxxxx
OVRM1_0129_E11.b :
UTR01_0059_E12.b :
SKNB1_0054_A10.b :
OVR01_0003_H12.b : ttgggcacatctaxxxxx
OVR01_0004_D09.b : gaaaacttttxxxxxxxxxxxxxxx
OVR01_0009_F10.b : cgagagtagxxxxxxxxxxxxxxxxx
OVR01_0010_F01.b : agacgccccttttgaccgtgcttgaccatccggcac
OVR01_0034_C03.b : agg
LVRM1_0043_F01.b :
TES01_0077_C11.b :
OVRM1_0214_C06.b :
TES01_0068_F08.b :
OVRM1_0119_B04.b :
OVRM1_0153_C01.b :
ILNT1_0080_B10.b :
OVR01_0077_C11.b :
OVRM1_0201_B09.b :
OVRM1_0114_H06.b :
SPL01_0013_G03.b : a
CLNT1_0114_G04.b :
OVRT1_0089_G12.b :
THY01_0094_A07.b : tcttggggcccctc
THY01_0081_H10.b : nnnnnnnnnnn
SPL01_0038_F05.b : aagx
OVR01_0011_C09.b : aaaacaatggaxxxxxxxxxxxx
OVRT1_0094_A10.b :
SKNB1_0016_A04.b :
THY01_0030_D10.b : t
THY01_0061_E05.b :
OVR01_0040_A08.b : ggggg
THY01_0032_E09.b :
OVR01_0027_A11.b : gggggac
KDN01_0068_B12.b :
OVRM1_0220_A06.b :
TES01_0077_H11.b :
OVRM1_0225_H08.b :
THY01_0119_B11.b :
OVRM1_0052_A02.b :
OVRT1_0061_B03.b :
OVRM1_0068_C10.b :
OVRM1_0113_F03.b :
OVR01_0077_D12.b :
OVRM1_0189_B03.b :
OVRM1_0217_D12.b :
OVR01_0056_A09.b :
TES01_0092_C02.b :
OVRM1_0099_A04.b :
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b :
OVRM1_0211_E08.b :
OVRM1_0129_G08.b :
OVRM1_0168_G04.b :
LVRM1_0055_F08.b :
OVRM1_0101_H10.b :
OVRM1_0185_B08.b :
OVRM1_0034_H10.b :
OVRM1_0092_B05.b :
OVRM1_0050_C11.b :
OVRM1_0206_E10.b :
OVR01_0099_G04.b :
OVRM1_0111_F09.b :
MLN01_0042_D11.b :
TCH01_0060_H08.b :
OVRM1_0049_H01.b : aaatataagctctaaacaaaanaaaatatttttcccacacnta
OVR01_0064_G11.b :
OVR01_0056_D10.b :
OVR01_0088_H04.b :
OVR01_0078_A05.b :
THY01_0048_B01.b :
OVR01_0025_D06.b : cgagg
SMG01_0070_H05.b :
SPL01_0088_F02.b :
SPL01_0047_G11.b :
OVR01_0052_H06.b :
SKNB1_0029_F05.b :
BFLT1_0064_G07.b :
THY01_0044_G08.b :
OVR01_0022_D06.b : gcg
PCT01_0021_G11.b :
SPL01_0062_A06.b :
LNG01_0090_B06.b :
OVR01_0090_D10.b :
SPL01_0073_G05.b :
TES01_0055_H05.b :
OVR01_0001_C12.b : aaaaaattxxxxxxxxxxxxxxxx
THY01_0079_B06.b : gccattttgcgtgxxxxxxxxxxxxxxxxx
CLNT1_0144_A03.b :
PBL01_0037_C03.b :
MLN01_0013_C05.b :
OVR01_0039_D09.b : ggg
LVR01_0082_H08.b : g
OVR01_0029_G05.b : tggg
OVRT1_0104_C07.b :
OVR01_0064_H08.b :
OVR01_0008_E12.b : aggggggccctattttacxxxxxxxxxxxxxxx
OVR01_0064_E05.b :
PBL01_0058_G12.b :
OVR01_0028_D07.b : gggx
MLN01_0040_G09.b :
TES01_0104_D10.b :
OVR01_0063_D07.b :
OVR01_0020_B08.b :
UTR01_0061_G11.b : g
PST01_0057_G12.b :
ITT01_0088_H04.b :
SPL01_0102_H05.b :
MLN01_0097_G01.b :
PBL01_0053_G04.b :
OVRT1_0095_D02.b :
ITT01_0061_A02.b :
ITT01_0056_C11.b :
OVR01_0092_G05.b :
OVR01_0029_B05.b : gg
OVR01_0054_A04.b :
ADR01_0077_G04.b :
OVR01_0017_C06.b :
OVRT1_0038_C05.b :
THY01_0066_H06.b :
SPL01_0036_H06.b : caa
THY01_0207_A06.b : gc
OVRT1_0044_B01.b :
MLN01_0064_A01.b :
PBL01_0105_C08.b :
OVR01_0013_A07.b :
THY01_0058_G05.b :
OVR01_0055_H07.b :
TES01_0103_D06.b :
OVRM1_0069_C05.b :
OVRT1_0150_D09.b :
LNG01_0065_A06.b :
OVRM1_0086_A06.b :
PBL01_0040_B04.b :
OVR01_0027_A07.b :
PBL01_0055_G10.b :
OVR01_0085_G05.b :
OVRT1_0140_E08.b :
LVRM1_0003_C08.b :
SKNB1_0087_E06.b :
SPL01_0092_H01.b :
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b :
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b :
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b :
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : ..........................GAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
---------+---------+---------+---------+---------+---------+ 33
ILNT1_0062_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
ILNT1_0065_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPLT1_0024_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TCH01_0064_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxAGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVRM1_0125_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0036_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVR01_0042_F08.b : xxxxxxxxxxxxxxxxxxccgttcaactGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SMG01_0018_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPL01_0069_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0059_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
PBL01_0024_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
ITT01_0067_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0150_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
CBLT1_0066_H09.b : atcgactcctatagggaatttaatgaattGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
HTMT1_0107_C05.b : xxxxxxxgggggtccctttagcagggcagGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRT1_0068_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVRM1_0197_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0095_C11.b : ttttttggctgtggctctggaggAGTCCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0036_G04.b : ttttcctgctgtggctctggctcagGAGTCAGGCCCGCGGCG*CAGAGACTAGC
OVRT1_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxggtAGTCCAGGCCCGCGGCG*CAGAGACTAGC
SKNB1_0030_H01.b : nnnnnactggctgtggctactggaggAGTCCAGGCCCGCGGCG*CAGAGACTAGC
CLNT1_0071_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxttAGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0198_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
OVRM1_0089_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxggacGTCCAGGCCCGCGGCG*CAGAGACTAGC
SPL01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGTG*CAGAGACTAGC
OVR01_0101_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
LVR01_0098_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
TCH01_0042_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
ITT01_0044_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
ADR01_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
BFLT1_0035_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCAGGCCCGCGGCG*CAGAGACTAGC
PST01_0032_E08.b : ccacgttggctctggaggagTCAGGCCCGCGGCG*CAGA*ACTAGC
TES01_0048_D06.b : taaaatacaaattatttnttacgtttgctcgtgatCAGGCCCGCGGCG*CAGAGA*TAGC
SKNB1_0057_D05.b : nnccctannnnnnnccaacggtggctcggaggagtCAGGCCCGCGGCG*CAGAGACTAGC
TES01_0067_H04.b : ttttcctgcgtggctatgagtcaGGCCGCGGCG*CAGAGACTAGC
KDN01_0097_E10.b : nnnnncctgctgtggctctgggagtcaGGCCGCGGCG*CAGAGACTAGC
KDN01_0083_H11.b : ttttcctgcggtggctatggagtccGGCCGCGGCG*CAGAGACTAGC
KDN01_0031_H09.b : nttcgcgttggcactggagtcaGGCCGCGGCG*CAGAGACTAGC
PST01_0098_C12.b : nnnnaactgcagtggctatggagtccGGCCGCGGCG*CAGAGACTAGC
OVR01_0080_F08.b : ttaggcCTACTGGGACTAGC
LVR01_0029_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcCTACTGGGACTAGC
OVR01_0028_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgttCTACTGGGACTAGC
OVRM1_0148_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGACTAGC
OVRM1_0085_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGACTAGC
HTMT1_0075_H10.b : gaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGAGACTAGC
OVR01_0038_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtcACTGGGACTAGC
ITT01_0006_B08.b : gatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTGGGACTAGC
TES01_0074_A03.b : ccgcgttggctCTGGGACTAGC
TES01_0108_E08.b : tcgctgttggctCTGGGGATAGC
SMG01_0017_C10.b : aattgataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACTAGC
OVR01_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACTAGC
SPL01_0068_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttggcctaCTGGGACTAGC
TES01_0009_A10.b : ntaccgcgtggctCTGGAACTAGC
DCI01_0024_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGACTAGC
THY01_0076_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRM1_0100_B12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGACTAGC
OVR01_0025_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
SPL01_0011_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
BFLT1_0085_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttggGAGACTAGC
THY01_0014_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
SMG01_0022_F10.b : gataaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
THY01_0060_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
BFLT1_0064_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
TCH01_0003_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
TCH01_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
CLNT1_0006_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
LNG01_0080_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACTAGC
ITT01_0091_E10.b : gaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRT1_0092_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACTAGC
OVRM1_0118_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
DCI01_0011_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGACTAGC
TES01_0003_E11.b : gctgtggctctGGACTAGC
HTMT1_0127_B01.b : agagtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
TES01_0003_F11.b : ntcgcgttggctctGGACTAGC
HTMT1_0099_F06.b : cagtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
BMWN1_0017_H07.b : gacggtagaggcagtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
PST01_0021_D02.b : tttatggctgtggctctGGGACAGC
HTMT1_0118_C01.b : acagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
DCI01_0014_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
KDN01_0057_G08.b : ntttctgcggtggctatggaaaaaaaaaaAGACTAGC
DCI01_0010_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
HTMT1_0088_G03.b : agtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACTAGC
PST01_0063_E09.b : nncctgctgtggctctggaaaaaaaaaaaaaaaaaaAGACTAGC
DCI01_0047_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
DCI01_0088_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACTAGC
KDN01_0080_C06.b : nncctgctgtggctctGGGACAGC
PTG01_0090_F06.b : nggcgtaagcagcggnacggntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0098_C01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0225_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0218_A06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0042_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0099_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0175_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0074_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0074_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0184_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0217_E01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ADR01_0014_C12.b : aatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0014_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0015_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0124_E12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0087_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0006_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0068_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0022_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0103_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0056_B12.b : gagtatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRM1_0014_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0117_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0063_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGACTAGC
OVR01_0102_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGACTAGC
THY01_0036_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0010_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0100_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0062_G12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0095_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
THY01_0036_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0122_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0076_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0094_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVR01_0053_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0030_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0113_C08.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0077_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
CLNT1_0111_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0099_F04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PTG01_0010_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LNG01_0066_E08.b : tttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0151_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0096_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0027_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0004_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0125_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
PBL01_0059_E06.b : naatgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0055_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0055_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0093_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0066_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
BFLT1_0013_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
UTR01_0095_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0100_G12.b : naaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVRT1_0043_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0001_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVR01_0043_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0086_C06.b : aagatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0049_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
CLNT1_0087_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0052_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0009_H10.b : aagtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0092_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
SPL01_0032_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
MLN01_0099_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0006_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LNG01_0060_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
OVR01_0054_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
ITT01_0017_G12.b : nnaaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTAGC
LVRM1_0042_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcACTAGC
DCI01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BFLT1_0120_A08.b : acgaggttcttctgcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtACTAGC
DCI01_0085_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0024_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
DCI01_0003_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
DCI01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0020_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
LNG01_0056_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactACTAGC
BKFL1_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0028_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
BKFL1_0093_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
PST01_0068_B08.b : nttttgctgctgtggctctggagaACTAGC
DCI01_0082_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTAGC
OVR01_0081_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0073_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0218_F03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0134_F12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0083_H10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0011_A12.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0055_D01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
TES01_0053_H10.b : ctgtggctcCTAGC
OVRM1_0190_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0003_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
LVRM1_0125_D10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0011_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0017_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0058_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0029_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0026_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
MLN01_0040_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ADR01_0074_D04.b : aanngggctaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
UTR01_0035_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRT1_0151_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PTG01_0046_B04.b : nnntgagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRT1_0099_E01.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0126_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0029_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PTG01_0004_B06.b : nagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0051_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PST01_0063_B06.b : nnttggcgttggctctCTACC
BFLT1_0027_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
PBL01_0035_E09.b : nngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
SPL01_0008_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
BFLT1_0039_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ADR01_0047_B05.b : caaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0028_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
ITT01_0042_C03.b : nggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0070_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0091_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVR01_0012_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAGC
OVRM1_0022_E04.b : gacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
OVRM1_0185_H09.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
ILNT1_0074_G08.b : gacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAGC
OVR01_0088_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
HTMT1_0106_E01.b : ggacggtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
OVRT1_0121_F01.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGC
CBLT1_0042_D05.b : nggcaggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
HTMT1_0132_F05.b : tccgagagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
OVR01_0046_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
SKNB1_0050_F01.b : nnnnnccagctgtggctatgggttggccctgGAGC
CBLT1_0033_G06.b : ttccgcagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGC
TES01_0079_H04.b : nntttcacgtggctctgaagacAGC
TES01_0102_H06.b : nttcgcgtggctctggacAGC
PCT01_0031_E10.b : nnnnngggtttnnnnnnnnccagcgggtgcanggacAGC
TES01_0023_B02.b : ttttcctgcgtggctctggacAGC
TES01_0107_F05.b : tttntttgcgtggctatgAGC
PST01_0001_E01.b : ccattttttntntcctgcggtggcacgggacAGC
TES01_0049_C10.b : ntacgctgtggctctgggacAGC
TES01_0001_G02.b : ttttcctgctgtggctctggacAGC
SKNB1_0089_D12.b : nncccacnnnnncctctgcgtttgctcggagacAGC
TES01_0110_B03.b : tttttcgcggtggctctgggacAGC
PST01_0044_D02.b : nnncctgctgtggctaggagcAGC
PCT01_0002_H04.b : nnnncggactannnnnncctgcgttggcacggacAGC
SKNB1_0075_H11.b : nngggttttnnnntcctgcgttggctcggacAGC
SKNB1_0016_A03.b : nngggatnnnnnnnactgcgttgcctcgggacAGC
PST01_0045_A08.b : nnnaactactgttgctctggagaacAGC
PST01_0048_B10.b : nnnttgctgctgtggctatggacAGC
PST01_0058_B10.b : nttttactgcggtggctctgggacAGC
UTR01_0084_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGC
PST01_0008_H04.b : nnttgttttnnnnnnactgcagtgtgcacggacAGC
ADR01_0018_C12.b : gctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
OVR01_0021_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
LVRM1_0050_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0032_D02.b : ctgcgttggctctggactGC
TES01_0096_E02.b : tttttcgcgttggctctgggactGC
TES01_0048_G03.b : gtggctctggggGC
TES01_0051_G07.b : ttagcgttggctctgaggAC
TES01_0058_E09.b : gtggctaaaTA
TES01_0022_F11.b : gcgttggctatggAC
TES01_0088_H08.b : tttcctactgtggctctggtAC
BFLT1_0140_H08.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0103_E05.b : nnnncccacgttgctctggatGC
TES01_0103_G04.b : nnnnnttcgcgtggctctggctGC
OVR01_0064_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
CLNT1_0038_B04.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
BFLT1_0006_B01.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0096_E09.b : tttttcctgctgtggctctgggactGC
ADR01_0054_C01.b : ccccnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
PST01_0003_B04.b : tttacctgacgttggcacgggactGC
PST01_0051_H05.b : nnnttcgctgtggctctgggactGC
TES01_0044_E12.b : tttttcgcgttggctctggactGC
PST01_0065_F06.b : tcgacgtggctctggactGC
TES01_0041_C07.b : gttggctctggAC
CLNT1_0037_B11.b : tgacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0067_B07.b : ttttcctgctgttgctctggactGC
PST01_0095_D09.b : nnnncctgctgttgctatgggactGC
TES01_0004_B06.b : nttcgctgtggctctggtAC
SKNB1_0023_E10.b : nnnnggatnnnnnnnaatgcgttggctatgatGC
ADR01_0052_A05.b : aannnggcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
OVR01_0017_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
TES01_0091_C07.b : ttttcctactgtggctctggA
TES01_0091_E06.b : ttttncctgctgtggctctggaC
TES01_0020_F09.b : ttggctatgggataaC
TES01_0063_C02.b : ttttcctgcgtggcgatG
TES01_0103_G12.b : nttttttggctgtggctctggA
PCT01_0028_C04.b : nnnnttctttnnnnnnncctgcgtttgcactggactaC
TES01_0068_C05.b : ntttctgcgttggctctggA
TES01_0006_H01.b : nttatcgctgtggctatggaC
KDN01_0007_F07.b : nnccctcnnnnnnccctgcgttggctcgggactG
TES01_0034_E12.b : ttctgctgtggctctggA
PST01_0051_H11.b : ntttatcgctgtggctatggactG
PBL01_0079_E03.b : nnggatgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
KDN01_0068_B08.b : nnnnngctgctgtggctatggtaC
TES01_0098_E02.b : nttttctgcgtggctctggag
SMG01_0097_E02.b : ttttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0060_G09.b : nnnnttgctgctgtggctctggag
TES01_0052_F04.b : ttttncctagcgttggctctga
SKNB1_0022_G12.b : nnttgctttaaataccctacgttgtgcatgga
PST01_0029_D09.b :
DCI01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0103_G07.b : nggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0083_D09.b :
THY01_0056_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0009_A11.b : naaaggtgaagagctggaxxxxxxxxxxx
PST01_0091_H08.b :
PST01_0037_C07.b :
TES01_0008_F12.b :
OVRM1_0195_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_A04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_B02.b : gttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_B10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxx
THY01_0069_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_E03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_C04.b : nnnggcttggcctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_D02.b : aannnnggctaggantatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_C05.b : nnngatgaacaxxxxxxxxxxxxxxxxx
PST01_0020_E11.b :
OVR01_0018_G04.b : gggggtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_E12.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0054_A10.b :
OVR01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0010_F01.b : tctcggtgcctcacgaacatgtttggacaaaaagctgggccagtaccgagtccggaattt
OVR01_0034_C03.b : ctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_C11.b :
OVRM1_0214_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0068_F08.b :
OVRM1_0119_B04.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0080_B10.b : nncgacggtacgaggxxxxxxxxxxxxxxxxxxxx
OVR01_0077_C11.b : ntttagcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_H06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0013_G03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0114_G04.b : nnnncctttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_G12.b : ttccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_A07.b : gcattaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0081_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0038_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_A10.b : nttttactatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0016_A04.b : nngggatnnn
THY01_0030_D10.b : tttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_E05.b : ggggggacctactagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_A08.b : cttatgggccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_E09.b : tgggggaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0027_A11.b : attttggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0068_B12.b :
OVRM1_0220_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_H11.b :
OVRM1_0225_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0119_B11.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_A02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_B03.b : nncccttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_F03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0077_D12.b : ntttgcttgtgattanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_B03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0217_D12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_A09.b : tttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0092_C02.b :
OVRM1_0099_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_E06.b :
TES01_0061_C12.b :
OVR01_0101_B06.b : ttggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0211_E08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_G04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_B08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0034_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0050_C11.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_G04.b : ttgcattggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_F09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_D11.b : cttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_H08.b : ttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_H01.b : tattaatcccctttttcagagnacttcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_G11.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_D10.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0088_H04.b : cgtgactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_A05.b : nngggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_B01.b : tggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_D06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0070_H05.b : nnggcgtttnnnnnggagtaagcagcggtacggntcc
SPL01_0088_F02.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0047_G11.b : nntttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_H06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0029_F05.b : nnnngga
BFLT1_0064_G07.b : gactacgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0044_G08.b : tggggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0022_D06.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0021_G11.b : nnggcgg
SPL01_0062_A06.b : tttggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_B06.b : tttgggggatggagaagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0090_D10.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_G05.b : nggcgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0055_H05.b :
OVR01_0001_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0144_A03.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0037_C03.b : ngctaacaxxxxxxxxxxxxxxxxxxx
MLN01_0013_C05.b : nnnnnggttggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_D09.b : atattatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H08.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_G05.b : gctttaggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0104_C07.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_H08.b : nttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_E05.b : nnnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0058_G12.b : naaaagataaacaxxxxxxxxxxxxxxxxxxx
OVR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_G09.b : nnnncggctggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0104_D10.b :
OVR01_0063_D07.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_B08.b : gtggggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_G11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0057_G12.b :
ITT01_0088_H04.b : nnggatgaacagctggaxxxxxxxxxxxx
SPL01_0102_H05.b : nnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_G01.b : tttttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_G04.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0095_D02.b : ngggttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_A02.b : nnnnggatgaacagcxxxxxxxxxxxxxxx
ITT01_0056_C11.b : nnnnggagaacagctggacggccggat
OVR01_0092_G05.b : nnttgttaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_B05.b : ggcttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0054_A04.b : nnnaaggcatggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_G04.b : nnntttgatgaacagctgnxxxxxxxxxxxxx
OVR01_0017_C06.b : tggggtgaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_C05.b : nnnttccgtttgctgtacgaggttxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_H06.b : cttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0036_H06.b : ggattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0207_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_B01.b : nnnccccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0064_A01.b : tttttggcatggatatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_C08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
OVR01_0013_A07.b : ttgggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0058_G05.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0055_H07.b : nntggctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0103_D06.b :
OVRM1_0069_C05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_D09.b : nnnccacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_A06.b : tttttnggctggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0086_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0040_B04.b : naatgaacaxxxxxxxxxxxxxxxxxx
OVR01_0027_A07.b : gggccatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0055_G10.b : atgxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_G05.b : nnnnagctaggactatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0140_E08.b : gcctcacnnnnnnnccgttagcgttacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_C08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0087_E06.b :
SPL01_0092_H01.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0026_E10.b :
TES01_0034_E06.b :
OVRT1_0022_D06.b : nnaaacctatagctgacgxxxxxxxxxxxxxxxxxxx
TES01_0041_E04.b :
OVRM1_0138_G10.b :
THY01_0109_H04.b :
CLNT1_0029_E06.b : ntttccg
PTG01_0021_D05.b :
OVRM1_0020_D01.b :
OVRM1_0019_H05.b :
ITT01_0065_F02.b :
SPL01_0056_H07.b : nnggggc
SKNB1_0008_D11.b :
OVR01_0047_F12.b :
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
---------+---------+---------+---------+---------+---------+ 89
ILNT1_0062_D07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ILNT1_0065_C07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPLT1_0024_F08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0064_D09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0125_D05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
PBL01_0036_E07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0042_F08.b : TGCGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0018_B09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0069_G06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0059_F10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0024_A10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0067_A02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0150_H07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
CBLT1_0066_H09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0107_C05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0068_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0197_B10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0095_C11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0036_G04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0009_C07.b : TGGGGGGACTCGTAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0030_H01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0071_C06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0198_G03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0089_B07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SPL01_0029_G01.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0101_G06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0098_C11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0042_A11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0044_G03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0077_G02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0035_B01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0032_E08.b : TGGGGGGACTCGGAGCGCCCGTTAATTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0048_D06.b : TGGGGGGACTCGGAGCGCCCCCACTTTTATGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0057_D05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0067_H04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0097_E10.b : TGGGGGGACTCAGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0083_H11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0031_H09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0098_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0080_F08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0029_A11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0028_H11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0148_B02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0085_G09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
HTMT1_0075_H10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0038_A04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0006_B08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0074_A03.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0108_E08.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0017_C10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0036_H02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0068_H08.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0009_A10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0024_H03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0076_G05.b : TGGGGGGACTCAGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0100_B12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0025_E07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0011_E12.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0085_G01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0014_B08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0022_F10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0060_H03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0064_D11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0003_D04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0041_E01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0006_C03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0080_H05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0091_E10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0092_H06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0118_C08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
DCI01_0011_B10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0003_E11.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0127_B01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0003_F11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0099_F06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BMWN1_0017_H07.b : CGGTGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0021_D02.b : TGGGGGGACTCGGA*CGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0118_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0014_E11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0057_G08.b : TGGGGGGACTCAGAGCGCCCGGACCTTT*TGGCTTAGCGCTC*GCTCTC*GGCGTCT*GC
DCI01_0010_E05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0088_G03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0063_E09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0047_A06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0088_F12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0080_C06.b : TGGGGGGACTC*GAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PTG01_0090_F06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0098_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0225_C08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0218_A06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0042_B11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0099_G06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0175_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GGCCTC*GGCGTCT*GC
OVR01_0074_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0074_D11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0184_A04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0217_E01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
ADR01_0014_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0014_G04.b : TGGGGGGTCTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0015_H02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0124_E12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0087_B07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0006_H07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0068_E10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0022_F03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0103_C08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
PTG01_0056_B12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0014_H09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
BFLT1_0117_F06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PTG01_0063_A02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0102_C10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0036_G05.b : TGGGGGGACTCAGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0010_D08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0100_F03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0062_G12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0095_E11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0067_E11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0036_E12.b : TGGGGGGACTCAGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0122_F07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0076_F10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0094_E10.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0053_F03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0030_E08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0113_C08.b : TGGGGGGACTCGGAGCGCCCGGGCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0077_B02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0111_H05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0099_F04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PTG01_0010_G11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0066_E08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0151_E05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0096_E10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0027_H01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0004_D05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0125_C07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0059_E06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0055_C09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0055_B04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0093_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0066_B01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0013_F07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0095_G08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0100_G12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0043_E06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0001_E06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0043_D12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0086_C06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0049_D09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0087_F02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0052_B02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0009_H10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0092_E05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0032_E07.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0099_G05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0006_H06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0060_H06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0054_C05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0017_G12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0042_B09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
DCI01_0031_H08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0120_A08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0085_F04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BKFL1_0024_C04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0003_C02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0010_A01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTGACGCTC*GCTCTC*GGCGTCT*GC
BKFL1_0020_D04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0056_F05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BKFL1_0097_B08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BKFL1_0028_G02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BKFL1_0093_C09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0068_B08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
DCI01_0082_D02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0081_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0073_B01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0218_F03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0134_F12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0083_H10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0011_A12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0055_D01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0053_H10.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*CGCGTCT*GC
OVRM1_0190_E05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0003_H04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0125_D10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0011_E08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0017_C08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SPL01_0058_C02.b : AGGGGGGGCTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0029_G09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SPL01_0026_C03.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0040_A02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0074_D04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0035_E10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0151_D02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PTG01_0046_B04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0099_E01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0126_D05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0029_H07.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PTG01_0004_B06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0051_B06.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0063_B06.b : TGGGGGGACTCGGA*CGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0027_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0035_E09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0008_G11.b : TGGGGG*ACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0039_C03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0047_B05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0028_H10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0042_C03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0090_E04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0070_A01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0091_A01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0012_A04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0022_E04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0185_H09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
ILNT1_0074_G08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0088_G11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0106_E01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0121_F01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CBLT1_0042_D05.b : TGGGGGGACTCCGATCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
HTMT1_0132_F05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0046_C02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0050_F01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CBLT1_0033_G06.b : TGGGGGGACTCGGATCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0079_H04.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0102_H06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
PCT01_0031_E10.b : TGGGGGGAC*CGGAGCGCCCGAACCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
TES01_0023_B02.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
TES01_0107_F05.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0001_E01.b : TGGGGGGAC*CGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0049_C10.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0001_G02.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0089_D12.b : TGGGGGGACTCCGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0110_B03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0044_D02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTA*CGCTC*GCTCTC*TGCGTCT*GC
PCT01_0002_H04.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0075_H11.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0016_A03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0045_A08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTCTGCTCTC*GGCGTCT*GC
PST01_0048_B10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0058_B10.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0084_H05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0008_H04.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0018_C12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0021_H12.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0050_A03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0032_D02.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0096_E02.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0048_G03.b : TGGGGGA**TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*CGCGTCT*GC
TES01_0051_G07.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0058_E09.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0022_F11.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0088_H08.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0140_H08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0103_E05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0103_G04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0064_F09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0038_B04.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0006_B01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0096_E09.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0054_C01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0003_B04.b : TGGGGGGAC*CGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
PST01_0051_H05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0044_E12.b : TGGGGGGAC*CGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0065_F06.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0041_C07.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0037_B11.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTCAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0067_B07.b : TGGGGGGAC*CGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0095_D09.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0004_B06.b : TGGGGGGA*TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0023_E10.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0052_A05.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0017_G03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0091_C07.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0091_E06.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
TES01_0020_F09.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0063_C02.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0103_G12.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PCT01_0028_C04.b : TGGGGGGACTCGGA*CGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0068_C05.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0006_H01.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0007_F07.b : CTGGGGGGATCGGAGGGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0034_E12.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0051_H11.b : CTGGGGGGATCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0079_E03.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0068_B08.b : TGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0098_E02.b : cGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0097_E02.b : xGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0060_G09.b : cGGGGGGACTCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0052_F04.b : gcGGGGGGACCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0022_G12.b : gcGGGGGGATCGGAGCGCCCGGACCTTT*TGGCT*AACGCTC*GCTCTC*TACGTCT*GC
PST01_0029_D09.b : TCGGAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCCT*TTTAATG*GC
DCI01_0023_C07.b : xxxxxxxxxxxxxAGCGCCCGGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0107_B02.b : xxxxxxxxxxxxxxxxxxCTGG**CTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0103_G07.b : xxxxxxxxxxxxxxxxxxCTGG**CTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0083_D09.b : ttttcctgctgtgGCTCTGGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
THY01_0056_A07.b : xxxxxxxxxxxxxxxxxaCTGG**CTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0009_A11.b : xxxxxxxxxxxxxxxxxxctCTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0091_H08.b : nnnaactgctgtggctCTGGCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
PST01_0037_C07.b : tagcgttggctCTGGCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
TES01_0008_F12.b : tttggctCTGGCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0195_C01.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0100_A04.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0117_B04.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0089_F07.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0079_B02.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0217_B10.b : xxxxxxxxxxxxxxxxxxxxcTTTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
THY01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0069_D02.b : xxxxxxxxxxxxxxxxxxxxcTTTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0059_E03.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0053_C04.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0053_D02.b : xxxxxxxxxxxxxxxxxxxxxCTTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0040_C05.b : xxxxxxxxxxxxxxxxxxxxxTTTTTTT*TGGCT*AACGCTC*GCTCTC*GGCGTCT*GC
PST01_0020_E11.b : taTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0018_G04.b : xxxxxxxxxxxxxxxxxxxxxTGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0009_C06.b : xxxxxxxxxxxxxxxxxxxxxGACCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0129_E11.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
UTR01_0059_E12.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0054_A10.b : nnnnnccacgcgttggctatggTTTTTTTTGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxcGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0004_D09.b : xxxxxxxxxxxxxxxxxxxxxxGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxaGGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0010_F01.b : cctcgtgcacactaggcctcccGGCTTT*CGGCTTAACGCTC*GCTCTC*GGCGTCA*GC
OVR01_0034_C03.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTTTTGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0043_F01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0077_C11.b : actccgtggctactggcTTTTT*TGGCTT*ACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0214_C06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0068_F08.b : ntctgcggtggctatGGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0119_B04.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0153_C01.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
ILNT1_0080_B10.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0077_C11.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0201_B09.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0114_H06.b : xxxxxxxxxxxxxxxxxxxxggcTTTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SPL01_0013_G03.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
CLNT1_0114_G04.b : xxxxxxxxxxxxxxxxxxxxxxtGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0089_G12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0094_A07.b : xxxxxxxxxxxxxxxxxxxxtggCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0081_H10.b : nnnnnnnnnnnnnnnnnnacaggCTTTTTTGGCTTAACGCTC*GCTCTC*GGCGTCTGGC
SPL01_0038_F05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0094_A10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0016_A04.b : nnnnggtcgcgttggctatggatCCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
THY01_0030_D10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0061_E05.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0040_A08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0032_E09.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0027_A11.b : xxxxxxxxxxxxxxxxxxxxxxxCTTTT*TGGCCTAACGCTC*GCTCTC*GGCGTCT*GC
KDN01_0068_B12.b : nnntttggctgcggtggctatgGCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0220_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0077_H11.b : cccgctgtggctctggtgGCTT*TGGCTT*ACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0225_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
THY01_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0052_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRT1_0061_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0068_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0113_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0077_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0189_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0217_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0092_C02.b : nnnnnttagctgtggctctGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0099_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
TES01_0062_E06.b : tttcccgctgtggctctgggaTTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
TES01_0061_C12.b : tttttcctgctgtggctctggaCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0101_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0211_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0129_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0168_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
LVRM1_0055_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0101_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0185_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0034_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0092_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0050_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRM1_0206_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTCT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0099_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0111_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
MLN01_0042_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*AGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TCH01_0060_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0049_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVR01_0064_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0056_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0088_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0078_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0048_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0025_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SMG01_0070_H05.b : ggattctcgagcacggttggcctgCTTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
SPL01_0088_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0047_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SKNB1_0029_F05.b : atnnnnnnnaatgcgttggctatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
BFLT1_0064_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PCT01_0021_G11.b : annnnnnnncctgacgtgtgcatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
SPL01_0062_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0090_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0090_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0073_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0055_H05.b : nntttactgctgtggctctGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0001_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GTTCTC*GGCGTCT*GC
THY01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTTTGGGCTTAACGCTC*GCTCTCGGGCGTCT*GC
CLNT1_0144_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0037_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0013_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0039_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVR01_0082_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0029_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0104_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0064_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxgaaCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0064_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0058_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0040_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0104_D10.b : ntttnttcgctgtggctctgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
OVR01_0063_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0020_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
UTR01_0061_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PST01_0057_G12.b : nnnnccccctgcggtggctatgGCTT*TGGCTTA*CGCTC*GCTCTC*GGCGTCT*GC
ITT01_0088_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTGACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0053_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0095_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0061_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ITT01_0056_C11.b : txxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0092_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0029_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0054_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
ADR01_0077_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0017_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
SPL01_0036_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0207_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0044_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
MLN01_0064_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0105_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0013_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
THY01_0058_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0055_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0103_D06.b : tttcccgctgtggctatGCT*TTGGCTTACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0069_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxTTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
OVRT1_0150_D09.b : xxxxxxxxxxxxxxxxxxcctttaaTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LNG01_0065_A06.b : xxxxxxxxxxxxxxxxxxxxtgaggTTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRM1_0086_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
PBL01_0040_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxgTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0027_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
PBL01_0055_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVR01_0085_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxtcTT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0140_E08.b : xxxxxxxxxxxxxxxxxxccctttaaaT*TGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
LVRM1_0003_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxctcT*TGGCTTAACGCTC*GCCCTC*GGCGTCT*GC
SKNB1_0087_E06.b : nnnncctagcgtggctatggaT*TTGGCTTAGGCTC*GCTCTC*GGCGTCT*GC
SPL01_0092_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTAACGCTC*GCTCTC*GGCGTCT*GC
TES01_0026_E10.b : aggTTACGCTC*GCTCTC*GGCGTCT*GC
TES01_0034_E06.b : cggcgttggctctggTTACGCTC*GCTCTC*GGCGTCT*GC
OVRT1_0022_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCTC*GCTCTC*GGCGTCT*GC
TES01_0041_E04.b : ggctttggctctggC*GCTCTC*GGCGTCT*GC
OVRM1_0138_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_H04.b : gtgtcaaaacagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0029_E06.b : tcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0021_D05.b : ngggcttttnnnnggctatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0020_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_H05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0065_F02.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_H07.b : taggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0008_D11.b : nggattc
OVR01_0047_F12.b : taaaagctttggtgxxxxxxxxxxxx
SKNB1_0060_C02.b :
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
---------+---------+---------+---------+---------+---------+ 145
ILNT1_0062_D07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ILNT1_0065_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPLT1_0024_F08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TCH01_0064_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0125_D05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0036_E07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0042_F08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SMG01_0018_B09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0069_G06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0059_F10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0024_A10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0067_A02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0150_H07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CBLT1_0066_H09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0107_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0068_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0197_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0095_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0036_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCGGCGGC*CGGAAATTCACCATG*
OVRT1_0009_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0030_H01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0071_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0198_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0089_B07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0029_G01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0101_G06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVR01_0098_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TCH01_0042_A11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0044_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0077_G02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0035_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0032_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0048_D06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0057_D05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0067_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0097_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0083_H11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0031_H09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0098_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0080_F08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVR01_0029_A11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0028_H11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0148_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0085_G09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0075_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0038_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0006_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0074_A03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0108_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SMG01_0017_C10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0036_H02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATC*
SPL01_0068_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0009_A10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0024_H03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0076_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0100_B12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0025_E07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0011_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0085_G01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0014_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SMG01_0022_F10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0060_H03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0064_D11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TCH01_0003_D04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TCH01_0041_E01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0006_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0080_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0091_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0092_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0118_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0011_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0003_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0127_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0003_F11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0099_F06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BMWN1_0017_H07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0021_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0118_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0014_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0057_G08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0010_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0088_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0063_E09.b : AGCTCCCTCTG*CTTATTCCCCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0047_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0088_F12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0080_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0090_F06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0098_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0225_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0218_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0042_B11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0099_G06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0175_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0074_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0074_D11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0184_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0217_E01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0014_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0014_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0015_H02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0124_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0087_B07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0006_H07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0068_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0022_F03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0103_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0056_B12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0014_H09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0117_F06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0063_A02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0102_C10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0036_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0010_D08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0100_F03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0062_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0095_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0067_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0036_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0122_F07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0076_F10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0094_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVR01_0053_F03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0030_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0113_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0077_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0111_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0099_F04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0010_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0066_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0151_E05.b : AGCTCCCTCTG*CTTATTCCCCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0096_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0027_H01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0004_D05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0125_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0059_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0055_C09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0055_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0093_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0066_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGGAATTCACCATG*
BFLT1_0013_F07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0095_G08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0100_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0043_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0001_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVR01_0043_D12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0086_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0049_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0087_F02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0052_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0009_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0092_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0032_E07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCAGC*CGGAAATTCACCATG*
MLN01_0099_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0006_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0060_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0054_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0017_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0042_B09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0031_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0120_A08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0085_F04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BKFL1_0024_C04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0003_C02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0010_A01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BKFL1_0020_D04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0056_F05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BKFL1_0097_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BKFL1_0028_G02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BKFL1_0093_C09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0068_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0082_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0081_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0073_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0218_F03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0134_F12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0083_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0011_A12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0055_D01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0053_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0190_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0003_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0125_D10.b : AGCTC**TCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0011_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0017_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0058_C02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0029_G09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0026_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0040_A02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0074_D04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0035_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0151_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0046_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0099_E01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0126_D05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0029_H07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0004_B06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0051_B06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0063_B06.b : AGATCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0027_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0035_E09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0008_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCCTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0039_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0047_B05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0028_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0042_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0090_E04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0070_A01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0091_A01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0012_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0022_E04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0185_H09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ILNT1_0074_G08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0088_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0106_E01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0121_F01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CBLT1_0042_D05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
HTMT1_0132_F05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0046_C02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0050_F01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CBLT1_0033_G06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0079_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAACGGC*CGGAAATTCACCATG*
TES01_0102_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PCT01_0031_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0023_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0107_F05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0001_E01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0049_C10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0001_G02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0089_D12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0110_B03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0044_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PCT01_0002_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0075_H11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0016_A03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0045_A08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0048_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0058_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0084_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0008_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0018_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0021_H12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0050_A03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0032_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0096_E02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0048_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0051_G07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0058_E09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0022_F11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0088_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0140_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0103_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0103_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0064_F09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0038_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0006_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0096_E09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0054_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0003_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0051_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0044_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0065_F06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0041_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0037_B11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0067_B07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0095_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0004_B06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0023_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0052_A05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0017_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATCCACCATG*
TES01_0091_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0091_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0020_F09.b : AGCTCCCTCTG*CTTATTCCTCGG*GTGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0063_C02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0103_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PCT01_0028_C04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0068_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0006_H01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0007_F07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0034_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0051_H11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0079_E03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0068_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0098_E02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SMG01_0097_E02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0060_G09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0052_F04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0022_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0029_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
DCI01_0023_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0107_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0103_G07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0083_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0056_A07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0009_A11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0091_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0037_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0008_F12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0195_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0100_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0117_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0089_F07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0079_B02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0217_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0020_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0069_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0059_E03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0053_C04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0053_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0040_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0020_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0018_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0009_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0129_E11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0059_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0054_A10.b : AGCTCCCTCTG*CCTTATCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0003_H12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0004_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0009_F10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0010_F01.b : AGCTCCCTCCGCTTATCTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCACG*
OVR01_0034_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0043_F01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0077_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0214_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0068_F08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0119_B04.b : AGCTCCCTCTG*CTTACTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0153_C01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ILNT1_0080_B10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0077_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0201_B09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0114_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0013_G03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
CLNT1_0114_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0089_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0094_A07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0081_H10.b : AGCTCCCTCTTGCTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATGG
SPL01_0038_F05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0011_C09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0094_A10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0016_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0030_D10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0061_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0040_A08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0032_E09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0027_A11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
KDN01_0068_B12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0220_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAGTTCACCATG*
TES01_0077_H11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCATCGGC*CGGAAATTCACCATG*
OVRM1_0225_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0119_B11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0052_A02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0061_B03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0068_C10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0113_F03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0077_D12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0189_B03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0217_D12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0056_A09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0092_C02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0099_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0062_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0061_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0101_B06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0211_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0129_G08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0168_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0055_F08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0101_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0185_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0034_H10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0092_B05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0050_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0206_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0099_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0111_F09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0042_D11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TCH01_0060_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0049_H01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0064_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0056_D10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0088_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0078_A05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0048_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0025_D06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SMG01_0070_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0088_F02.b : AGCTCCCTCCG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0047_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0052_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0029_F05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
BFLT1_0064_G07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0044_G08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGA*CTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0022_D06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PCT01_0021_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0062_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0090_B06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0090_D10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0073_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0055_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0001_C12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0079_B06.b : AGCTCCCTCTGGCTTATTCCTCGGNGCGGCGACCTTCAGCGGCNCGGAAATTCACCATG*
CLNT1_0144_A03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0037_C03.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0013_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0039_D09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVR01_0082_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0029_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0104_C07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0064_H08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0008_E12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0064_E05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0058_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0028_D07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0040_G09.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0104_D10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGGAATTCACCATG*
OVR01_0063_D07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0020_B08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
UTR01_0061_G11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PST01_0057_G12.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0088_H04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0102_H05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0097_G01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0053_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0095_D02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0061_A02.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0056_C11.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0092_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0029_B05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCCTCAGCGGC*CGGGAATTCACCATG*
OVR01_0054_A04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ADR01_0077_G04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0017_C06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0038_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0066_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0036_H06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0207_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0044_B01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
MLN01_0064_A01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0105_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0013_A07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0058_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0055_H07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0103_D06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0069_C05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0150_D09.b : AGCTCTTTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LNG01_0065_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0086_A06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0040_B04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVR01_0027_A07.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PBL01_0055_G10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGA*CGGAAATTCACCATG*
OVR01_0085_G05.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0140_E08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
LVRM1_0003_C08.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0087_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GGGGCGACCTTCAGCGGC*CGGAAGTTCACCATG*
SPL01_0092_H01.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0026_E10.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0034_E06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRT1_0022_D06.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
TES01_0041_E04.b : AGCTCCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0138_G10.b : xctggCCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
THY01_0109_H04.b : xxxxxxCTCTG*CTTAT*CCTCGG*GCGGCGACTT**AGCGGC*CGGAAAT*CACCATG*
CLNT1_0029_E06.b : xxxxctCTCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
PTG01_0021_D05.b : xxxxxxxxCTG*CTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0020_D01.b : xxxxxxxxxxxxxTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
OVRM1_0019_H05.b : xxxxxxxxxxxxxTTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
ITT01_0065_F02.b : xxxxxxxxxxxxggTATTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SPL01_0056_H07.b : xxxxxxxxxxxxxxtggTCCTCGG*GCGGCGACCTTCAGCGGC*CGGAAATTCACCATG*
SKNB1_0008_D11.b : nnnnncctgacgtggctcggattctcggggggaccttcGCGGC*CGGAAATTCACCATG*
OVR01_0047_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0060_C02.b : tttttgcctgac
SMG01_0067_F03.b :
THY01_0122_F11.b :
OVRM1_0044_E01.b :
SPL01_0071_G01.b :
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
---------+---------+---------+---------+---------+---------+ 202
ILNT1_0062_D07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ILNT1_0065_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPLT1_0024_F08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TCH01_0064_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0125_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0036_E07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0042_F08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0018_B09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0069_G06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0059_F10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0024_A10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0067_A02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0150_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CBLT1_0066_H09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0107_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0068_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0197_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0095_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0036_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0009_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0030_H01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0071_C06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0198_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0089_B07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0029_G01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0101_G06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVR01_0098_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TCH01_0042_A11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0044_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0077_G02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0035_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0032_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0048_D06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0057_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0067_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0097_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0083_H11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0031_H09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0098_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0080_F08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVR01_0029_A11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0028_H11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0148_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0085_G09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0075_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0038_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0006_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0074_A03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0108_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0017_C10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0036_H02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0068_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0009_A10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0024_H03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0076_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0100_B12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0025_E07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0011_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0085_G01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0014_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0022_F10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0060_H03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0064_D11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TCH01_0003_D04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TCH01_0041_E01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0006_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0080_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0091_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CCTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0092_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0118_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0011_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0003_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0127_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0003_F11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0099_F06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BMWN1_0017_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0021_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0118_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0014_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0057_G08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0010_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0088_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0063_E09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0047_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0088_F12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0080_C06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0090_F06.b : TCTATCCCTCAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*GT
LVRM1_0098_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0225_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0218_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TC
OVRM1_0042_B11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0099_G06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0175_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0074_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0074_D11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0184_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0217_E01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0014_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0014_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0015_H02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0124_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0087_B07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0006_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0068_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0022_F03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0103_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0056_B12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0014_H09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0117_F06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0063_A02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0102_C10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0036_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0010_D08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0100_F03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0062_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0095_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0067_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0036_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0122_F07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0076_F10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0094_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVR01_0053_F03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0030_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCCCGCGGGAACCCCACTG*TT
BFLT1_0113_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0077_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0111_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0099_F04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0010_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0066_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0151_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0096_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0027_H01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0004_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0125_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0059_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCCACTCTCGCGGGAACCCCACTG*TT
SPL01_0055_C09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0055_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0093_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0066_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0013_F07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0095_G08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0100_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0043_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0001_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVR01_0043_D12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0086_C06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0049_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0087_F02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0052_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0009_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0092_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0032_E07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0099_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0006_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0060_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0054_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0017_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0042_B09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0031_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0120_A08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0085_F04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BKFL1_0024_C04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0003_C02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0010_A01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BKFL1_0020_D04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0056_F05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BKFL1_0097_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BKFL1_0028_G02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BKFL1_0093_C09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0068_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0082_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0081_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0073_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0218_F03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0134_F12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0083_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0011_A12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0055_D01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0053_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0190_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0003_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0125_D10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0011_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0017_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0058_C02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0029_G09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0026_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0040_A02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0074_D04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGGGGGAACCCCACTG*TT
UTR01_0035_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0151_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0046_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0099_E01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0126_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0029_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PTG01_0004_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0051_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0063_B06.b : TCTATCCTCGAGATCCACGGC*AGGGAGAT*CTTCGACTCTCGCGGGAGCCCCGCTG*TT
BFLT1_0027_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0035_E09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0008_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0039_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0047_B05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0028_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0042_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0090_E04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0070_A01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0091_A01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0012_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0022_E04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0185_H09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ILNT1_0074_G08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0088_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0106_E01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0121_F01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CBLT1_0042_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
HTMT1_0132_F05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0046_C02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0050_F01.b : TCTATCCTCAAGACCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CBLT1_0033_G06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0079_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0102_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PCT01_0031_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0023_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0107_F05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0001_E01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0049_C10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0001_G02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0089_D12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0110_B03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0044_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PCT01_0002_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0075_H11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0016_A03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0045_A08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGTGGGAACCCCACTG*TT
PST01_0048_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0058_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0084_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0008_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0018_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0021_H12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0050_A03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0032_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0096_E02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0048_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0051_G07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0058_E09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0022_F11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0088_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0140_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0103_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0103_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0064_F09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0038_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0006_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0096_E09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0054_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0003_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0051_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGCACCCCACTG*TT
TES01_0044_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0065_F06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0041_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0037_B11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0067_B07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0095_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0004_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0023_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0052_A05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0017_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0091_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0091_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0020_F09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0063_C02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0103_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PCT01_0028_C04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0068_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0006_H01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0007_F07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0034_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0051_H11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0079_E03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0068_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGGCTCTCGCGGGAACCCCACTG*TT
TES01_0098_E02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0097_E02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0060_G09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0052_F04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0022_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0029_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
DCI01_0023_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0107_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0103_G07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0083_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0056_A07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0009_A11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0091_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0037_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0008_F12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0195_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0100_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0117_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0089_F07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0079_B02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0217_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0020_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0069_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0059_E03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0053_C04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0053_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0040_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0020_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0018_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0009_C06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0129_E11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0059_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0054_A10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0003_H12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0004_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0009_F10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0010_F01.b : TCTATCCTCAAGTTCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACCG*TT
OVR01_0034_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0043_F01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0077_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0214_C06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0068_F08.b : TCTATCCTCAAGGTCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0119_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0153_C01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ILNT1_0080_B10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0077_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0201_B09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0114_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0013_G03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0114_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0089_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0094_A07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0081_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGATTCTTCGACTCTCGCGGGAACCCCACTGGTT
SPL01_0038_F05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0011_C09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0094_A10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0016_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0030_D10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0061_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0040_A08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0032_E09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0027_A11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
KDN01_0068_B12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0220_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0077_H11.b : TCTATCCTCAAGATCCACGCC*GGGGAGAT*CTTCAACTCTCGCGGGAACCCCACTG*TT
OVRM1_0225_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0119_B11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0052_A02.b : TCTATCCTCAAGATCCACGCC*NGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0061_B03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0068_C10.b : TCTATCCTCAAGATCCACGCCTAGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0113_F03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0077_D12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCAGTG*TT
OVRM1_0189_B03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0217_D12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0056_A09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0092_C02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0099_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0062_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0061_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0101_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0211_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0129_G08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0168_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0055_F08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0101_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0185_B08.b : TCTATCCTCAGGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0034_H10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0092_B05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0050_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0206_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0099_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0111_F09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0042_D11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TCH01_0060_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0049_H01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0064_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0056_D10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0088_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0078_A05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*GT
THY01_0048_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0025_D06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0070_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0088_F02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0047_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0052_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0029_F05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
BFLT1_0064_G07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0044_G08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0022_D06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PCT01_0021_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0062_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0090_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0090_D10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0073_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0055_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0001_C12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0079_B06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0144_A03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0037_C03.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0013_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0039_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVR01_0082_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0029_G05.b : TCTATCCTCAAGATCCACACC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0104_C07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0064_H08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0008_E12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0064_E05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0058_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0028_D07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0040_G09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0104_D10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0063_D07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0020_B08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
UTR01_0061_G11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PST01_0057_G12.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0088_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0102_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0097_G01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0053_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0095_D02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0061_A02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0056_C11.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0092_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0029_B05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0054_A04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ADR01_0077_G04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0017_C06.b : TCTATCCTCAAGATCCACGCC*AGGAAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0038_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0066_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0036_H06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0207_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0044_B01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
MLN01_0064_A01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0105_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0013_A07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0058_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0055_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0103_D06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0069_C05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0150_D09.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LNG01_0065_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0086_A06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0040_B04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0027_A07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
PBL01_0055_G10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVR01_0085_G05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0140_E08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
LVRM1_0003_C08.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0087_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0092_H01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0026_E10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0034_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRT1_0022_D06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
TES01_0041_E04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0138_G10.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
THY01_0109_H04.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
CLNT1_0029_E06.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGAAACCCCACTG*TT
PTG01_0021_D05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0020_D01.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
OVRM1_0019_H05.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
ITT01_0065_F02.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SPL01_0056_H07.b : TCTATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0008_D11.b : TCTATCCTTA*GATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACTTCACTG*TT
OVR01_0047_F12.b : xggATCCTCAAGATCCACGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SKNB1_0060_C02.b : tgttgctacggagatccCGCC*AGGGAGAT*CTTCGACTCTCGCGGGAACCCCACTG*TT
SMG01_0067_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
THY01_0122_F11.b : attgtcaaacagtggxxx
OVRM1_0044_E01.b : xxxx
SPL01_0071_G01.b : nnnnggctaggacttaaacxxxxxxxxxxxxx
OVRM1_0058_G03.b :
OVRM1_0047_D04.b :
OVRM1_0077_H08.b :
OVRM1_0170_A04.b :
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b :
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
---------+---------+---------+---------+---------+---------+ 260
ILNT1_0062_D07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ILNT1_0065_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPLT1_0024_F08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TCH01_0064_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0125_D05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0036_E07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0042_F08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0018_B09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0069_G06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0059_F10.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0024_A10.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0067_A02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0150_H07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CBLT1_0066_H09.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0107_C05.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0068_C12.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0197_B10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0095_C11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0036_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0009_C07.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0030_H01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0071_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0198_G03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0089_B07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0029_G01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0101_G06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVR01_0098_C11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TCH01_0042_A11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0044_G03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0077_G02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0035_B01.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0032_E08.b : GAGGTCGGGCTGCGCACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0048_D06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0057_D05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0067_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0097_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0083_H11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0031_H09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0098_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0080_F08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGG*GGGGCCT
LVR01_0029_A11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0028_H11.b : GAGGTCGATCTGCACACCGCANAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0148_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0085_G09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0075_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0038_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0006_B08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0074_A03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0108_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0017_C10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0036_H02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0068_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0009_A10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0024_H03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0076_G05.b : GAGGGTCATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCCTGTGCCAGT*GGGGGCT
OVRM1_0100_B12.b : GAGGTCGATCTGCACACCGCAAAGG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0025_E07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0011_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0085_G01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0014_B08.b : GAGGACGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0022_F10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0060_H03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0064_D11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TCH01_0003_D04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TCH01_0041_E01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0006_C03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0080_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0091_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0092_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0118_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0011_B10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0003_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0127_B01.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0003_F11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0099_F06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BMWN1_0017_H07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0021_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0118_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0014_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0057_G08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0010_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0088_G03.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0063_E09.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0047_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0088_F12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCAAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0080_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0090_F06.b : GAGGTCGATCTGCACACCGCAAANG*GTCTCTTCCGAGCTGCTGTGCC*AGT*GGGGCCC
LVRM1_0098_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0225_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0218_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0042_B11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0099_G06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0175_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0074_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0074_D11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0184_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0217_E01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0014_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0014_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0015_H02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0124_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0087_B07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0006_H07.b : GAGGTCGATCTGCACACCGCACAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0068_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0022_F03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0103_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0056_B12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0014_H09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0117_F06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0063_A02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0102_C10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0036_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0010_D08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0100_F03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0062_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0095_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0067_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0036_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0122_F07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0076_F10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0094_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVR01_0053_F03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0030_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0113_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0077_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0111_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0099_F04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0010_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0066_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0151_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0096_E10.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0027_H01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0004_D05.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0125_C07.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0059_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0055_C09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0055_B04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0093_C01.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0066_B01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0013_F07.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0095_G08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0100_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0043_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0001_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVR01_0043_D12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0086_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0049_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0087_F02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0052_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0009_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0092_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0032_E07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0099_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0006_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0060_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0054_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0017_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0042_B09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCa
DCI01_0031_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0120_A08.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0085_F04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BKFL1_0024_C04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0003_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0010_A01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BKFL1_0020_D04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0056_F05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BKFL1_0097_B08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BKFL1_0028_G02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BKFL1_0093_C09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0068_B08.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0082_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCTGT*GGGGCCT
OVR01_0081_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGAGGGGGCCT
OVRM1_0073_B01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0218_F03.b : GAGGTCAATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0134_F12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0083_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0011_A12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0055_D01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0053_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0190_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0003_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0125_D10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0011_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0017_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0058_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0029_G09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0026_C03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0040_A02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0074_D04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0035_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0151_D02.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0046_B04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0099_E01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0126_D05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0029_H07.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0004_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0051_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0063_B06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0027_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0035_E09.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0008_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0039_C03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0047_B05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0028_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0042_C03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0090_E04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCC
OVR01_0070_A01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0091_A01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCCTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0012_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0022_E04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0185_H09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCCTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ILNT1_0074_G08.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0088_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0106_E01.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0121_F01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CBLT1_0042_D05.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
HTMT1_0132_F05.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0046_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0050_F01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CBLT1_0033_G06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0079_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0102_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PCT01_0031_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0023_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0107_F05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0001_E01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0049_C10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0001_G02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0089_D12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0110_B03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0044_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PCT01_0002_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0075_H11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0016_A03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0045_A08.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0048_B10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0058_B10.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0084_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0008_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0018_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0021_H12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0050_A03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0032_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0096_E02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0048_G03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0051_G07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0058_E09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0022_F11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0088_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0140_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0103_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0103_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0064_F09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0038_B04.b : GGGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0006_B01.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0096_E09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0054_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0003_B04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0051_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0044_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0065_F06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0041_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0037_B11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0067_B07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0095_D09.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0004_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0023_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0052_A05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0017_G03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0091_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0091_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0020_F09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0063_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0103_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PCT01_0028_C04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0068_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0006_H01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0007_F07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0034_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0051_H11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0079_E03.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0068_B08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0098_E02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0097_E02.b : GAGGTCGATCTGCACACCGCAGAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0060_G09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0052_F04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0022_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0029_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
DCI01_0023_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0107_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0103_G07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0083_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0056_A07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0009_A11.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0091_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0037_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0008_F12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0195_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0100_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0117_B04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0089_F07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0079_B02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0217_B10.b : GAGGTCGACCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0020_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0069_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0059_E03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0053_C04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0053_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0040_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0020_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0018_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0009_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0129_E11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0059_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0054_A10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0003_H12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0004_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0009_F10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGA*GGGGCCT
OVR01_0010_F01.b : GAGGTCGATCTGCACACCGCAAAAGAGTCTCTTCCGAGCTGCCGTGCCCAGT*GGGGCCT
OVR01_0034_C03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0043_F01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0077_C11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0214_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0068_F08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0119_B04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0153_C01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ILNT1_0080_B10.b : GAGGTCGATCTGCACACCGCAGAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0077_C11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGG*GGGGCCT
OVRM1_0201_B09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0114_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0013_G03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0114_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0089_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0094_A07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0081_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGTGGGGGCCT
SPL01_0038_F05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0011_C09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0094_A10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0016_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0030_D10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0061_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0040_A08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0032_E09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0027_A11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
KDN01_0068_B12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0220_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0077_H11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCTAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0225_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0119_B11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0052_A02.b : GAGGTCGATCTGCACACCGCANAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0061_B03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0068_C10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0113_F03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0077_D12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0189_B03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0217_D12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0056_A09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0092_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0099_A04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0062_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0061_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0101_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0211_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0129_G08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0168_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0055_F08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0101_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0185_B08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0034_H10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0092_B05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0050_C11.b : GAGGTCGATCTGCGCACCGCAAAAG*GTCTCTTCCGGGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0206_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0099_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0111_F09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGTCT
MLN01_0042_D11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TCH01_0060_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0049_H01.b : GAGGTCGATCTGCACACCGCATAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0064_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0056_D10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0088_H04.b : GAGGTCGATCTGCACACCGCAAAAT*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0078_A05.b : GAGGTCTATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGG*GGGGCCT
THY01_0048_B01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0025_D06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0070_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0088_F02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0047_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0052_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0029_F05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
BFLT1_0064_G07.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0044_G08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0022_D06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PCT01_0021_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0062_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0090_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0090_D10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0073_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0055_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0001_C12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0079_B06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0144_A03.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0037_C03.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0013_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0039_D09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVR01_0082_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0029_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0104_C07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0064_H08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0008_E12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0064_E05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0058_G12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0028_D07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0040_G09.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0104_D10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0063_D07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0020_B08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
UTR01_0061_G11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PST01_0057_G12.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0088_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0102_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0097_G01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0053_G04.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0095_D02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0061_A02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0056_C11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0092_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCCGTGCCCAGT*GGGGCCT
OVR01_0029_B05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0054_A04.b : AAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ADR01_0077_G04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0017_C06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0038_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0066_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0036_H06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0207_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0044_B01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
MLN01_0064_A01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0105_C08.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0013_A07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0058_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0055_H07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0103_D06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0069_C05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0150_D09.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LNG01_0065_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0086_A06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0040_B04.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0027_A07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PBL01_0055_G10.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0085_G05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0140_E08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
LVRM1_0003_C08.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0087_E06.b : GAGGTCGATCTGCACACCGCATAAG*GTCTCTTCCGAGGTGCTGTGCCCAGT*GGGGCCT
SPL01_0092_H01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0026_E10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0034_E06.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRT1_0022_D06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
TES01_0041_E04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0138_G10.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCTT
THY01_0109_H04.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
CLNT1_0029_E06.b : GAGGTTGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
PTG01_0021_D05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0020_D01.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0019_H05.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
ITT01_0065_F02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SPL01_0056_H07.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0008_D11.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVR01_0047_F12.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SKNB1_0060_C02.b : GAGGTCGATCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
SMG01_0067_F03.b : xxxxxxxxxCTGCACACCGCAAAAG*GTCTCTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
THY01_0122_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCGAGCTGCTGTGCCCAGT*GGGGCCT
OVRM1_0044_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCCCAGT*GGGGCCT
SPL01_0071_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT*GGGGCCT
OVRM1_0058_G03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_D04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_H08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0170_A04.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_E09.b :
PBL01_0045_D09.b :
OVR01_0101_E08.b :
ADR01_0069_C02.b :
ADR01_0047_D11.b :
TES01_0002_G01.b :
OVR01_0072_H01.b :
TES01_0090_F12.b :
OVR01_0066_A01.b :
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b :
THY01_0061_H01.b :
TCH01_0091_D08.b :
SPL01_0100_D06.b :
BKFL1_0103_A12.b : nnncc
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
---------+---------+---------+---------+---------+---------+ 318
ILNT1_0062_D07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ILNT1_0065_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPLT1_0024_F08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TCH01_0064_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0125_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0036_E07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
OVR01_0042_F08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0018_B09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACGATGACAAGACGCGCTACATGG*G
SPL01_0069_G06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0059_F10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0024_A10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0067_A02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0150_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CBLT1_0066_H09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0107_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0068_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0197_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0095_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0036_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0009_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0030_H01.b : CAACTGGGGTCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0071_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0198_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0089_B07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0029_G01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
OVR01_0101_G06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVR01_0098_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TCH01_0042_A11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0044_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0077_G02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0035_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0032_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0048_D06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0057_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0067_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0097_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0083_H11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0031_H09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0098_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0080_F08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVR01_0029_A11.b : CAACTGGGATCTGCGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0028_H11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0148_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0085_G09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0075_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0038_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0006_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0074_A03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0108_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0017_C10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0036_H02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0068_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
TES01_0009_A10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0024_H03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0076_G05.b : CAACTGGGATCTACCAGG*CCCCTCAGCCTCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0100_B12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0025_E07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0011_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
BFLT1_0085_G01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0014_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0022_F10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0060_H03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0064_D11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TCH01_0003_D04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TCH01_0041_E01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0006_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAGTGACAAGACGCGCTACATGG*G
LNG01_0080_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0091_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0092_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0118_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0011_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0003_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0127_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0003_F11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0099_F06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BMWN1_0017_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
PST01_0021_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0118_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0014_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0057_G08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0010_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0088_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0063_E09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0047_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
DCI01_0088_F12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
KDN01_0080_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0090_F06.b : TCACTGGGATCTACGAGG*CCCTCGACCTCCGGGACAtgaccagacccgctactggggaa
LVRM1_0098_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0225_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0218_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0042_B11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0099_G06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0175_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0074_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0074_D11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0184_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0217_E01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0014_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0014_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0015_H02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0124_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0087_B07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0006_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0068_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0022_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0103_C08.b : CAACTGGGATCTACGAGG*CCCTCGGGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0056_B12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0014_H09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0117_F06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0063_A02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0102_C10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0036_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0010_D08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0100_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0062_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0095_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0067_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0036_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0122_F07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0076_F10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0094_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
LVR01_0053_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0030_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0113_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0077_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0111_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0099_F04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0010_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LNG01_0066_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0151_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0096_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0027_H01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0004_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0125_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0059_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
SPL01_0055_C09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCCACATGG*G
OVR01_0055_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0093_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0066_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0013_F07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0095_G08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0100_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAGGACGCGCTACATGG*G
OVRT1_0043_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0001_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVR01_0043_D12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0086_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0049_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0087_F02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0052_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0009_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0092_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0032_E07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
MLN01_0099_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0006_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LNG01_0060_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0054_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0017_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0042_B09.b : caactcgaaatctacggagctcccaagcagcaggagctcaagaatacacgcttaaatggt
DCI01_0031_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0120_A08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0085_F04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAACGACAAGACGCGCTACATGG*G
BKFL1_0024_C04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0003_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
DCI01_0010_A01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
BKFL1_0020_D04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LNG01_0056_F05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BKFL1_0097_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BKFL1_0028_G02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BKFL1_0093_C09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0068_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0082_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
OVR01_0081_C12.b : CAACTGGGATCTACGAGG*CCCTCAAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0073_B01.b : CAACTGGGATCTACGACT*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0218_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0134_F12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0083_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0011_A12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0055_D01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0053_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0190_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0003_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0125_D10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0011_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0017_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0058_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0029_G09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0026_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
MLN01_0040_A02.b : CAACTGGGATCTACGAGG*CCCTCGGGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0074_D04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0035_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0151_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0046_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0099_E01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0126_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTTCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0029_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0004_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACGATGACAAGACGCGCTACATGG*G
SPL01_0051_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
PST01_0063_B06.b : CAACTGGGATCTACGAGGACCCTCGAGCTCCGGGACAATGACGAGACTCGCTACATGGGA
BFLT1_0027_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0035_E09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0008_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
BFLT1_0039_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0047_B05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0028_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0042_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0090_E04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0070_A01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0091_A01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0012_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0022_E04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0185_H09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ILNT1_0074_G08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0088_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0106_E01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0121_F01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CBLT1_0042_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
HTMT1_0132_F05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0046_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0050_F01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CBLT1_0033_G06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0079_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0102_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PCT01_0031_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0023_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0107_F05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0001_E01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0049_C10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0001_G02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0089_D12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0110_B03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0044_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PCT01_0002_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0075_H11.b : CAACTGGGATCTACGAGG*CCCTTGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0016_A03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0045_A08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0048_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0058_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0084_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0008_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0018_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0021_H12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0050_A03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0032_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0096_E02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0048_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0051_G07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0058_E09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0022_F11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0088_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0140_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0103_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0103_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0064_F09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0038_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0006_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0096_E09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0054_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0003_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0051_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0044_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0065_F06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0041_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0037_B11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0067_B07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0095_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0004_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0023_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0052_A05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0017_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0091_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0091_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0020_F09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0063_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0103_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PCT01_0028_C04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0068_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0006_H01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTGCATGG*G
KDN01_0007_F07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0034_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0051_H11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0079_E03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0068_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0098_E02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0097_E02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0060_G09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0052_F04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0022_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0029_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
DCI01_0023_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0107_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0103_G07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0083_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0056_A07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0009_A11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0091_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0037_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0008_F12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0195_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0100_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0117_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0089_F07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0079_B02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0217_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0020_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0069_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0059_E03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0053_C04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0053_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0040_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0020_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0018_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0009_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0129_E11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0059_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0054_A10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0003_H12.b : CAACTAGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0004_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0009_F10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0010_F01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0034_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCCCTACATGG*G
LVRM1_0043_F01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0077_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0214_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0068_F08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0119_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0153_C01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ILNT1_0080_B10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0077_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0201_B09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0114_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACACGCTACATGG*G
SPL01_0013_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
CLNT1_0114_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0089_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0094_A07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0081_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0038_F05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0011_C09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0094_A10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0016_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0030_D10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0061_E05.b : CAACTGGGATCTACGAGG*CCCTCAAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0040_A08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0032_E09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0027_A11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
KDN01_0068_B12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0220_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0077_H11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0225_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0119_B11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0052_A02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACNAGACGCGCTACATGG*G
OVRT1_0061_B03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACAGGG*G
OVRM1_0068_C10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0113_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0077_D12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0189_B03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0217_D12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0056_A09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0092_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0099_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0062_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0061_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0101_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0211_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0129_G08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0168_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVRM1_0055_F08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0101_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0185_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0034_H10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0092_B05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0050_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0206_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0099_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0111_F09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
MLN01_0042_D11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TCH01_0060_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0049_H01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACCAGACGCGCTACATGG*G
OVR01_0064_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0056_D10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0088_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0078_A05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0048_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0025_D06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0070_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0088_F02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
SPL01_0047_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
OVR01_0052_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0029_F05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
BFLT1_0064_G07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0044_G08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0022_D06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PCT01_0021_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0062_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
LNG01_0090_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0090_D10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0073_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
TES01_0055_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0001_C12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0079_B06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0144_A03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0037_C03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
MLN01_0013_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0039_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LVR01_0082_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0029_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0104_C07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0064_H08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0008_E12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0064_E05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0058_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
OVR01_0028_D07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
MLN01_0040_G09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0104_D10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0063_D07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0020_B08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
UTR01_0061_G11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PST01_0057_G12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0088_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0102_H05.b : CAACTGGAATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
MLN01_0097_G01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0053_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0095_D02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0061_A02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0056_C11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0092_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0029_B05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0054_A04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ADR01_0077_G04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0017_C06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0038_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0066_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0036_H06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
THY01_0207_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0044_B01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
MLN01_0064_A01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0105_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0013_A07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0058_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0055_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0103_D06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0069_C05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0150_D09.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
LNG01_0065_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0086_A06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0040_B04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0027_A07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PBL01_0055_G10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0085_G05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0140_E08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCAGGAGGGTGACAAGACGCGGGGGGTGGAG
LVRM1_0003_C08.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0087_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACTAGACGCGCTACATGG*G
SPL01_0092_H01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0026_E10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0034_E06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRT1_0022_D06.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
TES01_0041_E04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0138_G10.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0109_H04.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
CLNT1_0029_E06.b : CAACTGGGATCCACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
PTG01_0021_D05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0020_D01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0019_H05.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
ITT01_0065_F02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0056_H07.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGAGACAATGACAAGACGCGCTACATGG*G
SKNB1_0008_D11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVR01_0047_F12.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SKNB1_0060_C02.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SMG01_0067_F03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
THY01_0122_F11.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0044_E01.b : CAACTGGGATCTACGAGG*CCCTCGGGCTCCGGGACAATGACAAGACGCGCTACATGG*G
SPL01_0071_G01.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0058_G03.b : CAACTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0047_D04.b : xxxxTGGGATCTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0077_H08.b : xxxxxxxxxxxTACGAGG*CCCTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0170_A04.b : xxxxxxxxxxxxxxxxxxxxxxTCGAGCTCCGGGACAATGACAAGACGCGCTACATGG*G
OVRM1_0039_E09.b : xxxxxxxx
PBL01_0045_D09.b : nggtgaaacaxxxxxx
OVR01_0101_E08.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0069_C02.b : nnnnaagctttnannggagtaagcagcxxxx
ADR01_0047_D11.b : nttaaaaatgaaca
TES01_0002_G01.b :
OVR01_0072_H01.b : nnnnccgcttggactatnacxxxxxxxxxxxxxxxxxxx
TES01_0090_F12.b :
OVR01_0066_A01.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxx
OVRM1_0131_B11.b :
PCT01_0019_E07.b :
OVR01_0026_F05.b : agggcxxxxxxxxxxxxx
THY01_0061_H01.b : txxxxxxxxxxxxxxxxxx
TCH01_0091_D08.b : nnnggcta
SPL01_0100_D06.b : ctttttnn
BKFL1_0103_A12.b : cgattnnataagcgatatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_C01.b :
PCT01_0033_E07.b :
SPL01_0042_C11.b :
THY01_0058_H07.b :
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
---------+---------+---------+---------+---------+---------+ 375
ILNT1_0062_D07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ILNT1_0065_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPLT1_0024_F08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TCH01_0064_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0125_D05.b : GAAAG*GTGTCTCANAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0036_E07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0042_F08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0018_B09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0069_G06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0059_F10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0024_A10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0067_A02.b : GAAAG*GTGTCCCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0150_H07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CBLT1_0066_H09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0107_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0068_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0197_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0095_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0036_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0009_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0030_H01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0071_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0198_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0089_B07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0029_G01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0101_G06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVR01_0098_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TCH01_0042_A11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0044_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0077_G02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0035_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0032_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0048_D06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0057_D05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0067_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0097_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0083_H11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0031_H09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0098_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0080_F08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCCCCTGCCCTGGT
LVR01_0029_A11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0028_H11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0148_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0085_G09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0075_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0038_A04.b : GAAAG*GTGTCTCAAAG*GCTGCTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0006_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0074_A03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0108_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0017_C10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0036_H02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0068_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0009_A10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0024_H03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0076_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCCATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0100_B12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0025_E07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0011_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0085_G01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0014_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0022_F10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0060_H03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0064_D11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAGACTATT*GCGCCTGCCCTGGT
TCH01_0003_D04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TCH01_0041_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0006_C03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0080_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0091_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0092_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0118_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0011_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0003_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0127_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0003_F11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0099_F06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BMWN1_0017_H07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0021_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0118_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0014_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0057_G08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0010_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0088_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0063_E09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0047_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0088_F12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0080_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0090_F06.b : aagggtcctcaagggtgttgacccacatcataaaaacaattgcgccccgcctggtttaac
LVRM1_0098_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0225_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0218_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0042_B11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0099_G06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0175_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0074_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0074_D11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0184_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0217_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0014_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0014_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0015_H02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0124_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0087_B07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCGCATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0006_H07.b : GAAAG*GTGTCTCAGAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0068_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0022_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0103_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0056_B12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0014_H09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0117_F06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0063_A02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0102_C10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0036_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0010_D08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0100_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0062_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0095_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0067_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0036_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0122_F07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0076_F10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0094_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVR01_0053_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0030_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0113_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0077_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0111_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0099_F04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0010_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0066_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0151_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0096_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0027_H01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0004_D05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0125_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0059_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0055_C09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0055_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0093_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0066_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0013_F07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0095_G08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0100_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0043_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0001_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVR01_0043_D12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0086_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0049_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0087_F02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0052_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0009_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0092_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0032_E07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0099_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0006_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0060_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0054_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0017_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0042_B09.b : gaatgagagccgagcacctcatagcagcgcagtgaagagacaccacgtgacatcacgatg
DCI01_0031_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0120_A08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0085_F04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BKFL1_0024_C04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0003_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0010_A01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BKFL1_0020_D04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0056_F05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BKFL1_0097_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BKFL1_0028_G02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BKFL1_0093_C09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0068_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0082_D02.b : GAAAG*GTGTCTCAA*G*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0081_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTTGACACATCAATAAAACTATTAGCACCTGCCCTGGT
OVRM1_0073_B01.b : GAACG*GCGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0218_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0134_F12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0083_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0011_A12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0055_D01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0053_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0190_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0003_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0125_D10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0011_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGGGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0017_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0058_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0029_G09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0026_C03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0040_A02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0074_D04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0035_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0151_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0046_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0099_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0126_D05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0029_H07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0004_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0051_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0063_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCACTAAAACTATT*GCACCTGCCCTGGT
BFLT1_0027_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0035_E09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0008_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0039_C03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0047_B05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0028_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0042_C03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0090_E04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0070_A01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0091_A01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0012_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0022_E04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0185_H09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ILNT1_0074_G08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0088_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0106_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0121_F01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CBLT1_0042_D05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
HTMT1_0132_F05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0046_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0050_F01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CBLT1_0033_G06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0079_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0102_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PCT01_0031_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0023_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0107_F05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0001_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0049_C10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0001_G02.b : GAAAG*GTGTCCCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0089_D12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0110_B03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0044_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PCT01_0002_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0075_H11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0016_A03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0045_A08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0048_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0058_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0084_H05.b : AAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0008_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0018_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0021_H12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0050_A03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0032_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCATATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0096_E02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0048_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0051_G07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0058_E09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0022_F11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0088_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0140_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0103_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0103_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0064_F09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0038_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0006_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0096_E09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0054_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0003_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0051_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0044_E12.b : GAAAG*GTGTCCCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0065_F06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0041_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0037_B11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0067_B07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0095_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0004_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0023_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0052_A05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0017_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0091_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0091_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0020_F09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0063_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0103_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCGATAAAACTATT*GCGCCTGCCCTGGT
PCT01_0028_C04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0068_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0006_H01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0007_F07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0034_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0051_H11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0079_E03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0068_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0098_E02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0097_E02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0060_G09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0052_F04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0022_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAGTAAAACTATT*GCGCCTGCCCTGGT
PST01_0029_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
DCI01_0023_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0107_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0103_G07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0083_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0056_A07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0009_A11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0091_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0037_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0008_F12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0195_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0100_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0117_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0089_F07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0079_B02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0217_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0020_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0069_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0059_E03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0053_C04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0053_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0040_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0020_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0018_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTAAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0009_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0129_E11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0059_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0054_A10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0003_H12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0004_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0009_F10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0010_F01.b : GAAAGAGTGTCTCAAAGAGCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0034_C03.b : GAAAG*GCGTCCTCAAG*GCCGATGAGCACCTCACTACAACTATT*GCGCCTGCCCcgct
LVRM1_0043_F01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0077_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0214_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0068_F08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAATTATT*GCGCCTGCCCTGGT
OVRM1_0119_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0153_C01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCATATCAATAAAACTATT*GCGCCTGCCCTGGT
ILNT1_0080_B10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0077_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0201_B09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0114_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0013_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0114_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0089_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0094_A07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0081_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0038_F05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0011_C09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0094_A10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0016_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0030_D10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0061_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0040_A08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0032_E09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0027_A11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
KDN01_0068_B12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0220_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0077_H11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0225_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0119_B11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0052_A02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0061_B03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0068_C10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAGTAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0113_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0077_D12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0189_B03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0217_D12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0056_A09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0092_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0099_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0062_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0061_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0101_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0211_E08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0129_G08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0168_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVRM1_0055_F08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0101_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0185_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0034_H10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0092_B05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0050_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0206_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0099_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0111_F09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0042_D11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TCH01_0060_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0049_H01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0064_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0056_D10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0088_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0078_A05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0048_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0025_D06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0070_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0088_F02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0047_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0052_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0029_F05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
BFLT1_0064_G07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0044_G08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0022_D06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PCT01_0021_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0062_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0090_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0090_D10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0073_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0055_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0001_C12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0079_B06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0144_A03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0037_C03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0013_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0039_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LVR01_0082_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0029_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0104_C07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0064_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0008_E12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0064_E05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0058_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0028_D07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0040_G09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0104_D10.b : GAAAG*GTGTCTCAAAG*GCTGTTGGGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0063_D07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0020_B08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
UTR01_0061_G11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PST01_0057_G12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0088_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0102_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0097_G01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0053_G04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0095_D02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0061_A02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0056_C11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0092_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0029_B05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0054_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ADR01_0077_G04.b : GAAAG*GTGTCTCAAGG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0017_C06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0038_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0066_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0036_H06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0207_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0044_B01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
MLN01_0064_A01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0105_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0013_A07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0058_G05.b : GAAAG*GTGTCTCAAAG*GCTGTCGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0055_H07.b : GAAAG*GTGTCTTAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0103_D06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCGATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0069_C05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0150_D09.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
LNG01_0065_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0086_A06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0040_B04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0027_A07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PBL01_0055_G10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0085_G05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0140_E08.b : GAAAG*GTGTCTCGAAG*Gggaggggggtcatcagtggggctctagaacctgccctggtt
LVRM1_0003_C08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0087_E06.b : GAAAG*GTGTCTCAGAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0092_H01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0026_E10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0034_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRT1_0022_D06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
TES01_0041_E04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0138_G10.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0109_H04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
CLNT1_0029_E06.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
PTG01_0021_D05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0020_D01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0019_H05.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
ITT01_0065_F02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0056_H07.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0008_D11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVR01_0047_F12.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SKNB1_0060_C02.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SMG01_0067_F03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
THY01_0122_F11.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0044_E01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
SPL01_0071_G01.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0058_G03.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0047_D04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0077_H08.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0170_A04.b : GAAAG*GTGTCTCAAAG*GCTGTTGAGCACATCAATAAAACTATT*GCGCCTGCCCTGGT
OVRM1_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggAACTATT*GCGCCTGCCCTGGT
PBL01_0045_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATT*GCGCCTGCCCTGGT
OVR01_0101_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATT*GCGCCTGCCCTGGT
ADR01_0069_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggTATT*GCGCCTGCCCTGGT
ADR01_0047_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATT*GCGCCTGCCCTGGT
TES01_0002_G01.b : ttttccttacgttggctatggcATT*GCGCCTGCCCTGGT
OVR01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GCGCCTGCCCTGGT
TES01_0090_F12.b : tttttttcactgttgcttatggctTT*GCGCCTGCCCTGGT
OVR01_0066_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT*GCGCCTGCCCTGGT
OVRM1_0131_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0019_E07.b : nnnccagatttaaannnncctacgttgtgcacggctatgcgcctgccctg
OVR01_0026_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0091_D08.b : ggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_D06.b : ggcatgtgatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0103_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_C01.b : ggcattangtgxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0033_E07.b :
SPL01_0042_C11.b : nntttgctaggacttanacagtttgta
THY01_0058_H07.b : tgggtgcactattagxxxxxxxx
PCT01_0001_D03.b :
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
---------+---------+---------+---------+---------+---------+ 435
ILNT1_0062_D07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ILNT1_0065_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPLT1_0024_F08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0064_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0125_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0036_E07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0042_F08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0018_B09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0069_G06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0059_F10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0024_A10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0067_A02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0150_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CBLT1_0066_H09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0107_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0068_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0197_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0095_C11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0036_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0009_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0030_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0071_C06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0198_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0089_B07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0029_G01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0101_G06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVR01_0098_C11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0042_A11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0044_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0077_G02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0035_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0032_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0048_D06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0057_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0067_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0097_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0083_H11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0031_H09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0098_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0080_F08.b : TAGCAAGAAACTGAACGTCCTGGAGCAAGAGAAGATCTACAAGCTGATGATTGACATGGA
LVR01_0029_A11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0028_H11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0148_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0085_G09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0075_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0038_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0006_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0074_A03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0108_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0017_C10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0036_H02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0068_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0009_A10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0024_H03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0076_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAAATCGACAAGCTGATGATTGAAATGGA
OVRM1_0100_B12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0025_E07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0011_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0085_G01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0014_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0022_F10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0060_H03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0064_D11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0003_D04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0041_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0006_C03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0080_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0091_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0092_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0118_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0011_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0003_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0127_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0003_F11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0099_F06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BMWN1_0017_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0021_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0118_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0014_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0057_G08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0010_E05.b : TAGCAAGAAACTGAACATCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0088_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0063_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0047_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0088_F12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0080_C06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0090_F06.b : aaaaaaactaaacctcgggggacccgggaaaaaatccccccaccttttaattttgaaagg
LVRM1_0098_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0225_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0218_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0042_B11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0099_G06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0175_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0074_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0074_D11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0184_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0217_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0014_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0014_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0015_H02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0124_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0087_B07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0006_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0068_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0022_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0103_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGGGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0056_B12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0014_H09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0117_F06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0063_A02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0102_C10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0036_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0010_D08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0100_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0062_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0095_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0067_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0036_E12.b : TAGCAAGAAACTGAACGTCGTGGAGTAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0122_F07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0076_F10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0094_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVR01_0053_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0030_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0113_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0077_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0111_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0099_F04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0010_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0066_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0151_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0096_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0027_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0004_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0125_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0059_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0055_C09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0055_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0093_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0066_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0013_F07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0095_G08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0100_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0043_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0001_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGGTGGA
LVR01_0043_D12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0086_C06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0049_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0087_F02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0052_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0009_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0092_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0032_E07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0099_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0006_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0060_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0054_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0017_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0042_B09.b : ggattttagcgcccacaggagcgtgagacaaagaaaaaggcgagaaaaaaataaaacaac
DCI01_0031_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0120_A08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0085_F04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0024_C04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0003_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0010_A01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0020_D04.b : TAGCAAGAAACTGAACGTCGAGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0056_F05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0097_B08.b : CAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0028_G02.b : TAGCAAGAAACTGAACGTCGAGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0093_C09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0068_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0082_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGGGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0081_C12.b : TAGCAAGAAACTGAACagccggggaacagggagaagatcgaacaaactgatgattggaaa
OVRM1_0073_B01.b : TAGCACGAAACTGAACGTGGCGGAGCAGGAGAAGAACGACAAGCTGATGATAGAGATGCG
OVRM1_0218_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0134_F12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0083_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0011_A12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0055_D01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0053_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0190_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0003_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0125_D10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0011_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0017_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0058_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0029_G09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0026_C03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0040_A02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0074_D04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0035_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0151_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0046_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0099_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0126_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0029_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0004_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0051_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0063_B06.b : TAACATGAAACTGAACGTCCTGGAGCAGGACAAGATCGACAAGCTGATGATTGACATGGA
BFLT1_0027_C01.b : TAGCAAGAAGCTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGGGATGGA
PBL01_0035_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0008_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0039_C03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0047_B05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0028_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0042_C03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0090_E04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0070_A01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0091_A01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0012_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0022_E04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0185_H09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ILNT1_0074_G08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0088_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0106_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0121_F01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CBLT1_0042_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
HTMT1_0132_F05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0046_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0050_F01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CBLT1_0033_G06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0079_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0102_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PCT01_0031_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0023_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0107_F05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0001_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0049_C10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0001_G02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0089_D12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0110_B03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0044_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PCT01_0002_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0075_H11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0016_A03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0045_A08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0048_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0058_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0084_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0008_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0018_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0021_H12.b : CAGCAAGAAACTGAACGTCGTGGAGCACGAAAAGATCGACAAGCTAATGATTGAGATGGA
LVRM1_0050_A03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0032_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0096_E02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0048_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0051_G07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0058_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0022_F11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0088_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0140_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0103_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0103_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0064_F09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0038_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0006_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0096_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0054_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0003_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0051_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0044_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0065_F06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0041_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0037_B11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0067_B07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0095_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0004_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0023_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0052_A05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0017_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0091_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0091_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0020_F09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0063_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0103_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PCT01_0028_C04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0068_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0006_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0007_F07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0034_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0051_H11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0079_E03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0068_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0098_E02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0097_E02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0060_G09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0052_F04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0022_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0029_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
DCI01_0023_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0107_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0103_G07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0083_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0056_A07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0009_A11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0091_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0037_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0008_F12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0195_C01.b : TAGC*AGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0100_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0117_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0089_F07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0079_B02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0217_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0020_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0069_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0059_E03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0053_C04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0053_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0040_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0020_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0018_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0009_C06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0129_E11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
UTR01_0059_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0054_A10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0003_H12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGAA
OVR01_0004_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0009_F10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0010_F01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0034_C03.b : tacccacaacctgacactctcggagcttgacaacatctctcatccgatgcccgcgatgga
LVRM1_0043_F01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0077_C11.b : TAGCAAGAAACTGAACGTCTTGGAGCATGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0214_C06.b : TAGTAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0068_F08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0119_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0153_C01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ILNT1_0080_B10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0077_C11.b : TAGCAAGAAACTGAACGTCCTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0201_B09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0114_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0013_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0114_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0089_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0094_A07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0081_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0038_F05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0011_C09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0094_A10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0016_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0030_D10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0061_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATAGA
OVR01_0040_A08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0032_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0027_A11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
KDN01_0068_B12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0220_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0077_H11.b : TAGCAAGAAACTGAACGTCGTGGATCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0225_H08.b : TAGCAAGAAACTGAACGTCGTGGGGCGGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0119_B11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0052_A02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0061_B03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0068_C10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0113_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0077_D12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0189_B03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0217_D12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0056_A09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0092_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0099_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0062_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0061_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0101_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0211_E08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0129_G08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0168_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVRM1_0055_F08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0101_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0185_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0034_H10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0092_B05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0050_C11.b : TAGCAAGAAACCGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0206_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0099_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0111_F09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0042_D11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0060_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0049_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0064_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0056_D10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0088_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0078_A05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0048_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0025_D06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0070_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0088_F02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0047_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0052_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0029_F05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BFLT1_0064_G07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0044_G08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0022_D06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PCT01_0021_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0062_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0090_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0090_D10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0073_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0055_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0001_C12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0079_B06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0144_A03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0037_C03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0013_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0039_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LVR01_0082_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0029_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0104_C07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0064_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0008_E12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0064_E05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0058_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0028_D07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0040_G09.b : TAGTAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0104_D10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0063_D07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0020_B08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGGTTGAGATGGA
UTR01_0061_G11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PST01_0057_G12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0088_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0102_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0097_G01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0053_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0095_D02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0061_A02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0056_C11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0092_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0029_B05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0054_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0077_G04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0017_C06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0038_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0066_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0036_H06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0207_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0044_B01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
MLN01_0064_A01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0105_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0013_A07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0058_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0055_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0103_D06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0069_C05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0150_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
LNG01_0065_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0086_A06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0040_B04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0027_A07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0055_G10.b : TAGCAAGAAACTGAACGTCGTGGAGCATGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0085_G05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0140_E08.b : ggcaagaaaaaaaaagtcctgtaaaataatttggcaaaaaatttttttttcccccccccc
LVRM1_0003_C08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0087_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCACGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0092_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0026_E10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0034_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRT1_0022_D06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0041_E04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0138_G10.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0109_H04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
CLNT1_0029_E06.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PTG01_0021_D05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0020_D01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0019_H05.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ITT01_0065_F02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0056_H07.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0008_D11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0047_F12.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SKNB1_0060_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCACGAGAAGATCGACAAGCTGATGATTGAGATGGA
SMG01_0067_F03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0122_F11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0044_E01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0071_G01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0058_G03.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0047_D04.b : TAGCAAGAGACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0077_H08.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0170_A04.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0039_E09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PBL01_0045_D09.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0101_E08.b : TAACAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0069_C02.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
ADR01_0047_D11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0002_G01.b : TA*CAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0072_H01.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TES01_0090_F12.b : TA*CAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0066_A01.b : TAGCAAGAACCTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVRM1_0131_B11.b : TAGCAAGAAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
PCT01_0019_E07.b : gtagcaagAACTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
OVR01_0026_F05.b : xxxxxxxxxxCTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
THY01_0061_H01.b : xxxxxxxxxxCTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
TCH01_0091_D08.b : xxxxxxxxxxxTGAACGTCGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
SPL01_0100_D06.b : xxxxxxxxxxxxxxxxxggGTGGAGCAGGAGAAGATCGACAAGCTGATGATTGAGATGGA
BKFL1_0103_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGATTGAGATGGA
THY01_0202_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTGAGATGGA
PCT01_0033_E07.b : nnncccccttcagannncctgcgttgtgcacgtgcgatgaTGAGATGGA
SPL01_0042_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGATGGA
THY01_0058_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
PCT01_0001_D03.b : nnggcaatannnnnncctacg
PCT01_0021_B05.b :
OVRM1_0128_F02.b :
OVRM1_0055_A11.b :
OVRM1_0119_E10.b :
OVR01_0101_H01.b :
OVRM1_0050_B02.b :
PBL01_0060_G09.b :
LVRM1_0169_C08.b :
TES01_0009_D10.b :
ADR01_0063_D02.b :
THY01_0001_F04.b :
OVR01_0073_F06.b :
ITT01_0018_D03.b :
LNG01_0069_C09.b :
ILNT1_0058_E07.b :
OVRM1_0059_G08.b :
PST01_0057_D06.b :
SPLT1_0072_G07.b :
HTMT1_0144_D08.b :
SPLT1_0089_G10.b :
HTMT1_0074_D08.b :
BKFL1_0085_G02.b :
20110601C-000606 : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
---------+---------+---------+---------+---------+---------+ 492
ILNT1_0062_D07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
ILNT1_0065_C07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SPLT1_0024_F08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TCH01_0064_D09.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
LVRM1_0125_D05.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGTGCGTGTCCCTGGC
PBL01_0036_E07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0042_F08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGAC
SMG01_0018_B09.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SPL01_0069_G06.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
PBL01_0059_F10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
PBL01_0024_A10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
ITT01_0067_A02.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRM1_0150_H07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
CBLT1_0066_H09.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
HTMT1_0107_C05.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRT1_0068_C12.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
LVRM1_0197_B10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0095_C11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0036_G04.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRT1_0009_C07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SKNB1_0030_H01.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
CLNT1_0071_C06.b : CGGCGCGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRM1_0198_G03.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRM1_0089_B07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SPL01_0029_G01.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0101_G06.b : CGGCACGGAG*AACAAGTCC*AAGTTCGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
LVR01_0098_C11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TCH01_0042_A11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
ITT01_0044_G03.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
ADR01_0077_G02.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
BFLT1_0035_B01.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
PST01_0032_E08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0048_D06.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SKNB1_0057_D05.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0067_H04.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
KDN01_0097_E10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
KDN01_0083_H11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
KDN01_0031_H09.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
PST01_0098_C12.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0080_F08.b : CGGCACGGAA*AACAAGTCCCAAGTTTGGTGCCAACGCCATTCCTGGGCGTGTCCCTGGC
LVR01_0029_A11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0028_H11.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRM1_0148_B02.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVRM1_0085_G09.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
HTMT1_0075_H10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0038_A04.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
ITT01_0006_B08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0074_A03.b : CGGCACGGAG*GACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0108_E08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SMG01_0017_C10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0036_H02.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SPL01_0068_H08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
TES01_0009_A10.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
DCI01_0024_H03.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
THY01_0076_G05.b : CGGGACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCC*TCCTGGGCGTGTCCCTGGC
OVRM1_0100_B12.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
OVR01_0025_E07.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
SPL01_0011_E12.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
BFLT1_0085_G01.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC
THY01_0014_B08.b : CGGCACGGAG*AACAAGTCC*AAGTTTGGTGCCAACGCCA*TCCTGGGCGTGTCCCTGGC