[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000678

Length: 1,292

Sequence [FASTA format sequence]
TACTTACCTG GCAGGGGAGA TACCATGATC ACGAAGGTGG TTTTCCCAGG GCGAGGCTCA
CCCATTGCAC TCCGGGTGTG CTGACCCCTG CGATTTCCCC AAATGTGGGA AACTCGACTG
CATAATTTGT GGTAGTGGGG GACTGCGTTC GCGCTTTGGC CTACTCTGGC TCTCGCCAGG
CGTCCTCGTG TGAGTGACAT CGTCTTTAAA CCCTGCGTGG CAATCCCTGA CGCACCGCCG
TGATGCCCAG GGAAGACAGG GCGACCTGGA AGTCCAACTA CTTCCTTAAG ATAATCCAAC
TTCTGGATGA TTATCCGAAA TGCTTCATTG TGGGAGCAGA CAATGTGGGC TCCAAGCAGA
TGCAGCAGAT CCGCATGTCT CTCCGCGGGA AAGCCGTGGT GCTGATGGGC AAGAACACCA
TGATGCGCAA GGCCATCCGA GGGCACCTGG AAAACAACCC AGCCCTGGAG AAACTGTTGC
CTCACATCCG GGGGAACGTG GGCTTTGTGT TCACCAAGGA GGACCTCACT GAGATCAGGG
ACATGCTGCT GGCCAATAAG GTGCCAGCTG CCGCCCGTGC TGGTGCCATA GCCCCATGCG
AAGTCACTGT ACCTGCCCAG AACACTGGTC TGGGGCCTGA GAAGACCTCC TTCTTCCAGG
CTTTAGGCAT CACCACTAAA ATCTCCAGGG GCACCATTGA AATCCTGAGT GATGTGCAGC
TGATTAAGAC TGGAGACAAA GTGGGAGCCA GTGAAGCCAC GTTGCTGAAC ATGTTGAACA
TCTCCCCCTT CTCCTTTGGG CTGATCATCC AGCAGGTGTT TGACAATGGC AGCATCTACA
ACCCTGAAGT GCTTGACATC ACCGAGGAAA CTCTGCATTC TCGCTTCCTG GAGGGTGTCC
GCAATGTTGC CAGCGTATGT CTGCAGATTG GTTACCCAAC TGTTGCATCT GTACCCCATT
CTATCATCAA TGGGTACAAG CGGGTCCTGG CTTTGTCTGT GGAAACTGAT TACACCTTCC
CACTTGCTGA AAAGGTCAAG GCCTTCTTGG CTGATCCATC TGCCTTTGTG GCTGCTGCCC
CTGTGGCTGC AGCCACCACT GCTGCTCCTG CTGCTGCTGC TGCAGCCCCA GCCAAGGTTG
AAGCCAAAGG AGGAGTCGGA GGAGTCGGAC GAGGATATGG GATTTGGTCT CTTTGACTAA
TTTCCAAAAA GCACCAAGTC AGCCAGCTTT ATTTGTGAAA CAAAGAAATA AAGGCTAATT
TCAAAAAAAA AAAAAAAAAA AAAAAAAAAA AA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPLP060S acidic ribosomal protein P0 [Homo sapiens]. 527e-150O
Contig/Assembly ProteinRPLP060S acidic ribosomal protein P0 [Homo sapiens]. 527e-150O
Contig/Assembly ProteinMRTO4mRNA turnover protein 4 homolog [Homo sapiens]. 521e-06O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRplp060S acidic ribosomal protein P0 [Mus musculus]. 518e-147O
Contig/Assembly ProteinGm8730PREDICTED: 60S acidic ribosomal protein P0-like [Mus musculus]. 514e-146O
Contig/Assembly ProteinGm8730PREDICTED: 60S acidic ribosomal protein P0-like [Mus musculus]. 514e-146O
Contig/Assembly ProteinGm5633PREDICTED: mRNA turnover protein 4 homolog isoform 2 [Mus musculus]. 50.43e-06O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 2 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinRPLP0PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 1 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinRPLP0PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 7 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinRPLP0PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 6 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinRPLP0PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 2 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 14 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 13 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 12 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 11 [Canis familiaris]. 528e-150O
Contig/Assembly ProteinLOC609159PREDICTED: similar to 60S acidic ribosomal protein P0 (L10E) isoform 9 [Canis familiaris]. 490e-138O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPLP060S acidic ribosomal protein P0 [Bos taurus]. 531e-151O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC10004969560S acidic ribosomal protein P0 [Sus scrofa]. 532e-151O


Assembly Members: 1176      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010007C01ADR01_0007_C01.bDB782121 
ADR010015F04ADR01_0015_F04.b  
ADR010022E04ADR01_0022_E04.bDB783434 
ADR010030B11ADR01_0030_B11.bDB784123 
ADR010031C03ADR01_0031_C03.bDB784220 
ADR010032H06ADR01_0032_H06.bDB784375 
ADR010033C10ADR01_0033_C10.bDB784412 
ADR010034F06ADR01_0034_F06.bDB784534 
ADR010034G11ADR01_0034_G11.bDB784550 
ADR010035F05ADR01_0035_F05.bDB784612 
ADR010044B07ADR01_0044_B07.bDB785384 
ADR010066B03ADR01_0066_B03.b  
ADR010067B08ADR01_0067_B08.bDB787433 
ADR010069H01ADR01_0069_H01.bDB787670 
ADR010075B06ADR01_0075_B06.bDB788134 
ADR010078C09ADR01_0078_C09.bDB788427 
ADR010078F01ADR01_0078_F01.bDB788452 
ADR010084G09ADR01_0084_G09.bDB788999 
ADR010085D07ADR01_0085_D07.bDB789049 
ADR010097H09ADR01_0097_H09.bDB790169 
ADR010100D11ADR01_0100_D11.bDB790387 
ADR010101C06ADR01_0101_C06.bDB790462 
AMP010009F08AMP01_0009_F08.bBW955634 
BKFL10106B01BKFL1_0106_B01.bFS655761 
BMWN10018F05BMWN1_0018_F05.bHX206663 
BMWN10027G09BMWN1_0027_G09.b  
BMWN10029C11BMWN1_0029_C11.b  
BMWN10077B07BMWN1_0077_B07.bHX210280 
BMWN10079G03BMWN1_0079_G03.bHX210451 
BMWN10087A02BMWN1_0087_A02.b  
BMWN10088C02BMWN1_0088_C02.bHX210971 
CBLT10006G06CBLT1_0006_G06.bHX212216 
CBLT10030E06CBLT1_0030_E06.b  
CBLT10071A01CBLT1_0071_A01.bHX216774 
CBLT10074C07CBLT1_0074_C07.bHX217056 
CBLT10100C01CBLT1_0100_C01.bHX219120 
CBLT10100C03CBLT1_0100_C03.bHX219121 
CLNT10001C06CLNT1_0001_C06.bFS657111 
CLNT10003F10CLNT1_0003_F10.bFS657299 
CLNT10019C11CLNT1_0019_C11.bFS658548 
CLNT10023H01CLNT1_0023_H01.bFS658894 
CLNT10027H10CLNT1_0027_H10.bFS659221 
CLNT10035B10CLNT1_0035_B10.bFS659776 
CLNT10035D09CLNT1_0035_D09.bFS659791 
CLNT10036G12CLNT1_0036_G12.bFS659898 
CLNT10038G08CLNT1_0038_G08.bFS660059 
CLNT10039D04CLNT1_0039_D04.bFS660108 
CLNT10044A11CLNT1_0044_A11.bFS660499 
CLNT10045C04CLNT1_0045_C04.bFS660596 
CLNT10045C11CLNT1_0045_C11.bFS660602 
CLNT10046E05CLNT1_0046_E05.bFS660695 
CLNT10051C10CLNT1_0051_C10.bFS661083 
CLNT10052C03CLNT1_0052_C03.bFS661156 
CLNT10053A03CLNT1_0053_A03.bFS661222 
CLNT10053G12CLNT1_0053_G12.bFS661278 
CLNT10057F04CLNT1_0057_F04.bFS661574 
CLNT10057H02CLNT1_0057_H02.bFS661589 
CLNT10061A09CLNT1_0061_A09.bFS661846 
CLNT10062A09CLNT1_0062_A09.bFS661921 
CLNT10068B12CLNT1_0068_B12.bFS662404 
CLNT10070D12CLNT1_0070_D12.bFS662591 
CLNT10071B12CLNT1_0071_B12.bFS662656 
CLNT10071C08CLNT1_0071_C08.bFS662663 
CLNT10077B04CLNT1_0077_B04.b  
CLNT10080A01CLNT1_0080_A01.b  
CLNT10081A10CLNT1_0081_A10.b  
CLNT10091F11CLNT1_0091_F11.bFS663653 
CLNT10094H03CLNT1_0094_H03.bFS663902 
CLNT10095B11CLNT1_0095_B11.bFS663931 
CLNT10095C06CLNT1_0095_C06.bFS663936 
CLNT10097E08CLNT1_0097_E08.bFS664109 
CLNT10100G11CLNT1_0100_G11.bFS664364 
CLNT10101F07CLNT1_0101_F07.bHX219234 
CLNT10106F02CLNT1_0106_F02.bHX219629 
CLNT10110B07CLNT1_0110_B07.bHX219902 
CLNT10116E08CLNT1_0116_E08.bHX220399 
CLNT10118E03CLNT1_0118_E03.bHX220539 
CLNT10118H06CLNT1_0118_H06.bHX220576 
CLNT10119H04CLNT1_0119_H04.bHX220654 
CLNT10119H09CLNT1_0119_H09.bHX220659 
CLNT10127C02CLNT1_0127_C02.bHX221206 
CLNT10129F03CLNT1_0129_F03.bHX221392 
CLNT10131D07CLNT1_0131_D07.bHX221528 
CLNT10136H06CLNT1_0136_H06.bHX221954 
CLNT10138C05CLNT1_0138_C05.bHX222046 
CLNT10146G12CLNT1_0146_G12.bHX222727 
CLNT10149H05CLNT1_0149_H05.bHX222968 
CLNT10151F08CLNT1_0151_F08.bHX223109 
HTMT10119G08HTMT1_0119_G08.bHX224519 
ILNT10011A04ILNT1_0011_A04.bHX227537 
ILNT10012F05ILNT1_0012_F05.bHX227660 
ILNT10014B07ILNT1_0014_B07.bHX227787 
ILNT10017B03ILNT1_0017_B03.bHX227981 
ILNT10032F09ILNT1_0032_F09.bHX229222 
ILNT10033C06ILNT1_0033_C06.bHX229274 
ILNT10036B06ILNT1_0036_B06.bHX229516 
ILNT10045A01ILNT1_0045_A01.bHX230237 
ILNT10048D11ILNT1_0048_D11.b  
ILNT10049B04ILNT1_0049_B04.bHX230566 
ILNT10052C01ILNT1_0052_C01.bHX230821 
ILNT10059H10ILNT1_0059_H10.bHX231453 
ILNT10075F01ILNT1_0075_F01.bHX232749 
ILNT10077A09ILNT1_0077_A09.bHX232869 
ILNT10081H02ILNT1_0081_H02.bHX233239 
ILNT10088B08ILNT1_0088_B08.bHX233767 
ILNT10090A10ILNT1_0090_A10.bHX233919 
ILNT10093F09ILNT1_0093_F09.bHX234195 
ILNT10098F05ILNT1_0098_F05.b  
ILNT10100F04ILNT1_0100_F04.bHX234703 
ITT010001A03ITT01_0001_A03.b  
ITT010002E01ITT01_0002_E01.bBW976175 
ITT010003A07ITT01_0003_A07.bBW976226 
ITT010005F06ITT01_0005_F06.bBW976464 
ITT010006E05ITT01_0006_E05.bBW976541 
ITT010008C03ITT01_0008_C03.bBW976700 
ITT010008C11ITT01_0008_C11.bBW976708 
ITT010008D04ITT01_0008_D04.bBW976713 
ITT010009B08ITT01_0009_B08.bBW976785 
ITT010009D03ITT01_0009_D03.bBW976803 
ITT010009E12ITT01_0009_E12.bBW976823 
ITT010009G06ITT01_0009_G06.bBW976841 
ITT010010G06ITT01_0010_G06.bBW976936 
ITT010010H10ITT01_0010_H10.bBW976952 
ITT010011C02ITT01_0011_C02.bBW976979 
ITT010011C12ITT01_0011_C12.bBW976989 
ITT010011H07ITT01_0011_H07.bBW977042 
ITT010011H11ITT01_0011_H11.bBW977045 
ITT010012H07ITT01_0012_H07.bBW977133 
ITT010015H10ITT01_0015_H10.bBW977398 
ITT010017H11ITT01_0017_H11.bBW977577 
ITT010019F10ITT01_0019_F10.bBW977733 
ITT010019G10ITT01_0019_G10.bBW977745 
ITT010020A12ITT01_0020_A12.bBW977769 
ITT010020D04ITT01_0020_D04.bBW977796 
ITT010021B09ITT01_0021_B09.bBW977867 
ITT010022D05ITT01_0022_D05.bBW977981 
ITT010022E07ITT01_0022_E07.bBW977994 
ITT010023A10ITT01_0023_A10.bBW978044 
ITT010025A01ITT01_0025_A01.b  
ITT010027C03ITT01_0027_C03.bBW978422 
ITT010027C08ITT01_0027_C08.bBW978427 
ITT010027H05ITT01_0027_H05.bBW978480 
ITT010029A01ITT01_0029_A01.bBW978579 
ITT010030D08ITT01_0030_D08.bBW978698 
ITT010030E07ITT01_0030_E07.bBW978708 
ITT010031E06ITT01_0031_E06.bBW978798 
ITT010031F09ITT01_0031_F09.bBW978813 
ITT010032B10ITT01_0032_B10.bBW978858 
ITT010032H10ITT01_0032_H10.bBW978927 
ITT010034E11ITT01_0034_E11.bBW979074 
ITT010036D04ITT01_0036_D04.bBW979238 
ITT010036F02ITT01_0036_F02.bBW979258 
ITT010038C02ITT01_0038_C02.b  
ITT010038G02ITT01_0038_G02.bBW979454 
ITT010038H10ITT01_0038_H10.bBW979472 
ITT010039C05ITT01_0039_C05.bBW979502 
ITT010039F08ITT01_0039_F08.bBW979536 
ITT010040H04ITT01_0040_H04.bBW979641 
ITT010041A07ITT01_0041_A07.bBW979656 
ITT010041B07ITT01_0041_B07.bBW979668 
ITT010044G08ITT01_0044_G08.bBW979997 
ITT010044G09ITT01_0044_G09.bBW979998 
ITT010045G08ITT01_0045_G08.bBW980091 
ITT010047A03ITT01_0047_A03.bBW980108 
ITT010047E06ITT01_0047_E06.bBW980158 
ITT010049F12ITT01_0049_F12.bBW980360 
ITT010050E08ITT01_0050_E08.bBW980438 
ITT010052A04ITT01_0052_A04.bBW980570 
ITT010052H11ITT01_0052_H11.bBW980657 
ITT010058D08ITT01_0058_D08.bBW981155 
ITT010058H10ITT01_0058_H10.bBW981203 
ITT010060A02ITT01_0060_A02.bBW981296 
ITT010060B12ITT01_0060_B12.bBW981317 
ITT010060D06ITT01_0060_D06.bBW981335 
ITT010060D11ITT01_0060_D11.bBW981340 
ITT010060F01ITT01_0060_F01.bBW981352 
ITT010061B07ITT01_0061_B07.bBW981403 
ITT010061C04ITT01_0061_C04.bBW981410 
ITT010061F06ITT01_0061_F06.bBW981442 
ITT010062F02ITT01_0062_F02.bBW981527 
ITT010063E03ITT01_0063_E03.bBW981606 
ITT010063F02ITT01_0063_F02.bBW981616 
ITT010067G03ITT01_0067_G03.bBW981993 
ITT010067G11ITT01_0067_G11.bBW982001 
ITT010069F03ITT01_0069_F03.bBW982164 
ITT010069G09ITT01_0069_G09.bBW982180 
ITT010071A12ITT01_0071_A12.bBW982293 
ITT010071D11ITT01_0071_D11.bBW982327 
ITT010072C04ITT01_0072_C04.bBW982398 
ITT010077A09ITT01_0077_A09.bBW982820 
ITT010078F03ITT01_0078_F03.bBW982948 
ITT010079C12ITT01_0079_C12.bBW983013 
ITT010080B08ITT01_0080_B08.bBW983084 
ITT010081A01ITT01_0081_A01.bBW983156 
ITT010082G01ITT01_0082_G01.bBW983316 
ITT010087G01ITT01_0087_G01.bBW983749 
ITT010088H02ITT01_0088_H02.bBW983850 
ITT010090A04ITT01_0090_A04.bBW983956 
ITT010090A12ITT01_0090_A12.bBW983964 
ITT010093F09ITT01_0093_F09.bBW984281 
ITT010093H05ITT01_0093_H05.bBW984300 
ITT010094H03ITT01_0094_H03.bBW984389 
ITT010095D11ITT01_0095_D11.bBW984444 
ITT010096D09ITT01_0096_D09.bBW984532 
ITT010096G07ITT01_0096_G07.bBW984565 
ITT010098C11ITT01_0098_C11.bBW984705 AK393088
ITT010100E03ITT01_0100_E03.bBW984906 
ITT010101B10ITT01_0101_B10.bBW984967 
ITT010101E05ITT01_0101_E05.bBW984996 
ITT010102F01ITT01_0102_F01.bBW985096 
ITT010102F04ITT01_0102_F04.bBW985099 
LNG010001E11LNG01_0001_E11.bBP437771 
LNG010001F11LNG01_0001_F11.bBP438790 
LNG010001G07LNG01_0001_G07.bBP439450 
LNG010002D05LNG01_0002_D05.bBP436278 
LNG010002F09LNG01_0002_F09.bBP438625 
LNG010002G12LNG01_0002_G12.bBP439869 
LNG010004C01LNG01_0004_C01.bBP434961 
LNG010004D04LNG01_0004_D04.bBP436195 
LNG010005A12LNG01_0005_A12.bBP433902 
LNG010008H05LNG01_0008_H05.bBP440297 
LNG010009A10LNG01_0009_A10.bBP433749 
LNG010010G09LNG01_0010_G09.bBP439622 
LNG010010G12LNG01_0010_G12.bBP439877 
LNG010011F10LNG01_0011_F10.bBP438718 
LNG010012A02LNG01_0012_A02.bBP433111 
LNG010012F01LNG01_0012_F01.bBP437957 
LNG010015F04LNG01_0015_F04.bBP438215 
LNG010017B04LNG01_0017_B04.bBP434227 
LNG010018D10LNG01_0018_D10.bBP436681 
LNG010018H07LNG01_0018_H07.bBP440461 
LNG010019A08LNG01_0019_A08.bBP433597 
LNG010020B11LNG01_0020_B11.bBP434813 
LNG010020F08LNG01_0020_F08.bBP438554 
LNG010021C10LNG01_0021_C10.bBP435713 
LNG010021E11LNG01_0021_E11.bBP437789 
LNG010026E05LNG01_0026_E05.bBP437279 
LNG010026F01LNG01_0026_F01.bBP437971 
LNG010027D09LNG01_0027_D09.bBP436610 
LNG010029C06LNG01_0029_C06.bBP435382 
LNG010029D05LNG01_0029_D05.bBP436298 
LNG010029G11LNG01_0029_G11.bBP439801 
LNG010030A09LNG01_0030_A09.bBP433684 
LNG010030B06LNG01_0030_B06.bBP434414 
LNG010030D08LNG01_0030_D08.bBP436538 
LNG010030E09LNG01_0030_E09.bBP437621 
LNG010033F10LNG01_0033_F10.bBP438733 
LNG010033H01LNG01_0033_H01.bBP439977 
LNG010033H11LNG01_0033_H11.bBP440801 
LNG010035A09LNG01_0035_A09.bBP433688 
LNG010036G08LNG01_0036_G08.bBP439560 
LNG010041G03LNG01_0041_G03.bBP439149 
LNG010042G10LNG01_0042_G10.bBP439718 
LNG010043B12LNG01_0043_B12.bBP434910 
LNG010044D02LNG01_0044_D02.bBP436055 
LNG010045C04LNG01_0045_C04.bBP435224 
LNG010048A03LNG01_0048_A03.bBP433205 
LNG010056A04LNG01_0056_A04.bBP433284 
LNG010056F01LNG01_0056_F01.bBP437989 
LNG010057B10LNG01_0057_B10.bBP434748 
LNG010062A05LNG01_0062_A05.bBP433374 
LNG010062E08LNG01_0062_E08.bBP437551 
LNG010063A05LNG01_0063_A05.bBP433375 
LNG010064A07LNG01_0064_A07.bBP433543 
LNG010064C08LNG01_0064_C08.bBP435571 
LNG010064E05LNG01_0064_E05.bBP437299 
LNG010064F10LNG01_0064_F10.bBP438752 
LNG010064G07LNG01_0064_G07.bBP439491 
LNG010065C06LNG01_0065_C06.bBP435405 
LNG010065C10LNG01_0065_C10.bBP435740 
LNG010065G07LNG01_0065_G07.bBP439492 
LNG010065H11LNG01_0065_H11.bBP440820 
LNG010066E10LNG01_0066_E10.bBP437731 
LNG010067A09LNG01_0067_A09.bBP433707 
LNG010067H04LNG01_0067_H04.bBP440253 
LNG010070F07LNG01_0070_F07.bBP438501 
LNG010070G02LNG01_0070_G02.bBP439084 
LNG010071B04LNG01_0071_B04.bBP434266 
LNG010071D08LNG01_0071_D08.bBP436558 
LNG010073F01LNG01_0073_F01.bBP438005 
LNG010074F04LNG01_0074_F04.bBP438259 
LNG010078H09LNG01_0078_H09.bBP440664 
LNG010080H02LNG01_0080_H02.bBP440092 
LNG010081A03LNG01_0081_A03.bBP433225 
LNG010083H08LNG01_0083_H08.bBP440584 
LNG010085E04LNG01_0085_E04.bBP437232 
LNG010085H09LNG01_0085_H09.bBP440667 
LNG010086E06LNG01_0086_E06.bBP437405 
LNG010087B08LNG01_0087_B08.bBP434610 
LNG010088B06LNG01_0088_B06.bBP434449 
LNG010088G03LNG01_0088_G03.bBP439182 
LNG010088G04LNG01_0088_G04.bBP439261 
LNG010090A01LNG01_0090_A01.bBP433089 
LNG010091A07LNG01_0091_A07.bBP433568 
LNG010094H08LNG01_0094_H08.bBP440592 
LNG010099H01LNG01_0099_H01.bBP440023 
LNG010099H03LNG01_0099_H03.bBP440194 
LNG010101D11LNG01_0101_D11.bBP436823 
LNG010103C09LNG01_0103_C09.bBP435686 
LNG010104H01LNG01_0104_H01.bBP440028 
LNG010106H02LNG01_0106_H02.bBP440112 
LNG010107F01LNG01_0107_F01.bBP438032 
LNG010110B01LNG01_0110_B01.bBP434054 
LVR010005E12LVR01_0005_E12.bBP445348 
LVR010010A07LVR01_0010_A07.bBP441412 
LVR010019D01LVR01_0019_D01.bBP443689 
LVR010031G11LVR01_0031_G11.bBP447077 
LVR010038F10LVR01_0038_F10.bBP446112 
LVR010042F06LVR01_0042_F06.bBP445829 
LVR010046D02LVR01_0046_D02.bBP443789 
LVR010050C01LVR01_0050_C01.bBP442823 
LVR010079A10LVR01_0079_A10.bBP441703 
LVR010081A05LVR01_0081_A05.bBP441316 
LVR010104C01LVR01_0104_C01.bBP442857 
LVRM10066H06LVRM1_0066_H06.bBP140979 
LVRM10086H03LVRM1_0086_H03.bCJ002914 
LVRM10097F01LVRM1_0097_F01.bCJ003780 
LVRM10123F12LVRM1_0123_F12.bBP452942 
LVRM10152G02LVRM1_0152_G02.bBP453101 
LVRM10193D05LVRM1_0193_D05.bBW963275 
MLN010005H11MLN01_0005_H11.bCJ008115 
MLN010006B07MLN01_0006_B07.bCJ008129 
MLN010006C06MLN01_0006_C06.bCJ008138 
MLN010007F06MLN01_0007_F06.bCJ008243 
MLN010008F08MLN01_0008_F08.bCJ008331 
MLN010011B07MLN01_0011_B07.bBW963360 
MLN010011G07MLN01_0011_G07.bCJ008585 
MLN010013D08MLN01_0013_D08.bCJ008718 
MLN010013G06MLN01_0013_G06.b  
MLN010017D01MLN01_0017_D01.bCJ008934 
MLN010020B11MLN01_0020_B11.bCJ009132 
MLN010020D08MLN01_0020_D08.bCJ009148 
MLN010021F06MLN01_0021_F06.bCJ009256 
MLN010021H05MLN01_0021_H05.bCJ009273 
MLN010022H12MLN01_0022_H12.bCJ009358 
MLN010023C04MLN01_0023_C04.b  
MLN010023F06MLN01_0023_F06.bCJ009417 
MLN010025C09MLN01_0025_C09.bCJ009562 
MLN010025G07MLN01_0025_G07.bCJ009595 
MLN010026F08MLN01_0026_F08.bCJ009668 
MLN010027G08MLN01_0027_G08.bCJ009757 
MLN010027H07MLN01_0027_H07.bCJ009768 
MLN010029A12MLN01_0029_A12.bCJ009855 
MLN010029D08MLN01_0029_D08.bCJ009882 
MLN010031F10MLN01_0031_F10.bCJ010074 
MLN010032A04MLN01_0032_A04.bCJ010100 
MLN010033A06MLN01_0033_A06.bCJ010177 
MLN010033H09MLN01_0033_H09.bCJ010256 
MLN010035F04MLN01_0035_F04.bCJ010394 
MLN010039A08MLN01_0039_A08.bCJ010668 
MLN010039C06MLN01_0039_C06.bCJ010689 
MLN010039D11MLN01_0039_D11.bCJ010705 
MLN010039G06MLN01_0039_G06.bCJ010729 
MLN010040D03MLN01_0040_D03.bCJ010784 
MLN010040G05MLN01_0040_G05.bCJ010814 
MLN010040G11MLN01_0040_G11.bCJ010820 
MLN010041C09MLN01_0041_C09.bCJ010862 
MLN010041E06MLN01_0041_E06.bCJ010881 
MLN010042D02MLN01_0042_D02.bCJ010948 
MLN010043B12MLN01_0043_B12.bCJ011018 
MLN010043E10MLN01_0043_E10.bCJ011051 
MLN010044C09MLN01_0044_C09.bCJ011110 
MLN010044G07MLN01_0044_G07.bCJ011143 
MLN010045A10MLN01_0045_A10.bCJ011164 
MLN010045F12MLN01_0045_F12.bCJ011226 
MLN010049E09MLN01_0049_E09.bCJ011456 
MLN010052G07MLN01_0052_G07.bCJ011735 
MLN010053E02MLN01_0053_E02.bCJ011797 
MLN010054B09MLN01_0054_B09.bCJ011859 
MLN010054E07MLN01_0054_E07.bBW963613 
MLN010055A07MLN01_0055_A07.bCJ011928 
MLN010055C06MLN01_0055_C06.bCJ011951 
MLN010056E08MLN01_0056_E08.bCJ012058 
MLN010056G08MLN01_0056_G08.bCJ012077 
MLN010058D04MLN01_0058_D04.b  
MLN010058F11MLN01_0058_F11.bCJ012227 
MLN010059H08MLN01_0059_H08.bCJ012332 
MLN010061A03MLN01_0061_A03.bCJ012401 
MLN010062E04MLN01_0062_E04.bCJ012519 
MLN010063C12MLN01_0063_C12.bCJ012595 
MLN010063E01MLN01_0063_E01.bCJ012606 
MLN010063F10MLN01_0063_F10.bCJ012626 
MLN010064C01MLN01_0064_C01.bCJ012669 
MLN010065D06MLN01_0065_D06.bCJ012764 
MLN010065G11MLN01_0065_G11.bCJ012801 
MLN010066D05MLN01_0066_D05.bCJ012853 
MLN010066E10MLN01_0066_E10.bCJ012867 
MLN010070G02MLN01_0070_G02.bCJ013228 
MLN010073F06MLN01_0073_F06.bCJ013483 
MLN010074A10MLN01_0074_A10.bCJ013519 
MLN010074D09MLN01_0074_D09.b  
MLN010074F01MLN01_0074_F01.bCJ013555 
MLN010075B01MLN01_0075_B01.bCJ013588 
MLN010076D06MLN01_0076_D06.bCJ013671 
MLN010076E03MLN01_0076_E03.bCJ013678 
MLN010077B06MLN01_0077_B06.bCJ013724 
MLN010077E12MLN01_0077_E12.bCJ013759 
MLN010078E03MLN01_0078_E03.bCJ013838 
MLN010079C04MLN01_0079_C04.bCJ013906 
MLN010079H08MLN01_0079_H08.bCJ013964 
MLN010080A08MLN01_0080_A08.bCJ013975 
MLN010080G08MLN01_0080_G08.bCJ014039 
MLN010083G09MLN01_0083_G09.bCJ014298 
MLN010084A09MLN01_0084_A09.bCJ014320 
MLN010086E07MLN01_0086_E07.bCJ014525 
MLN010088D11MLN01_0088_D11.bCJ014687 
MLN010090D11MLN01_0090_D11.bCJ014847 
MLN010091A07MLN01_0091_A07.bCJ014899 
MLN010091E10MLN01_0091_E10.bCJ014943 
MLN010094A04MLN01_0094_A04.bCJ015161 
MLN010096D01MLN01_0096_D01.bBW963883 
MLN010096E07MLN01_0096_E07.bCJ015369 
MLN010097H11MLN01_0097_H11.bCJ015485 
MLN010098F10MLN01_0098_F10.bCJ015552 
MLN010099D02MLN01_0099_D02.bCJ015613 
MLN010100F02MLN01_0100_F02.bCJ015724 
MLN010101D03MLN01_0101_D03.bCJ015792 
MLN010102F10MLN01_0102_F10.bCJ015913 
MLN010103H03MLN01_0103_H03.bCJ016018 
MLN010104B11MLN01_0104_B11.bCJ016049 
OVR010001A09OVR01_0001_A09.bBP141540 
OVR010003A11OVR01_0003_A11.bBP141620 
OVR010003D08OVR01_0003_D08.bBP142852 
OVR010003F02OVR01_0003_F02.bBP143511 
OVR010005H08OVR01_0005_H08.bBP144659 
OVR010006B06OVR01_0006_B06.bBP141873 
OVR010006F12OVR01_0006_F12.bBP143901 
OVR010007D11OVR01_0007_D11.bBP142962 
OVR010009E08OVR01_0009_E08.bBP143305 
OVR010011B05OVR01_0011_B05.bBP141841 
OVR010011C05OVR01_0011_C05.bBP142292 
OVR010011G08OVR01_0011_G08.bBP144213 
OVR010012A09OVR01_0012_A09.bBP141551 
OVR010012H01OVR01_0012_H01.bBP144402 
OVR010017A01OVR01_0017_A01.bBP141248 
OVR010019D10OVR01_0019_D10.bBP142933 
OVR010019G12OVR01_0019_G12.bBP144372 
OVR010020E02OVR01_0020_E02.bBP143086 
OVR010021F10OVR01_0021_F10.bBP143835 
OVR010022B04OVR01_0022_B04.bBP141813 
OVR010022E04OVR01_0022_E04.bBP143161 
OVR010026F09OVR01_0026_F09.bBP143798 
OVR010027F05OVR01_0027_F05.bBP143649 
OVR010027G04OVR01_0027_G04.bBP144076 
OVR010028A01OVR01_0028_A01.bBP141257 
OVR010029E04OVR01_0029_E04.bBP143166 
OVR010030D04OVR01_0030_D04.bBP142721 
OVR010031H08OVR01_0031_H08.bBP144680 
OVR010032E10OVR01_0032_E10.bBP143388 
OVR010033A12OVR01_0033_A12.bBP141681 
OVR010033B06OVR01_0033_B06.bBP141891 
OVR010033F11OVR01_0033_F11.bBP143881 
OVR010034E06OVR01_0034_E06.bBP143247 
OVR010034G05OVR01_0034_G05.bBP144121 
OVR010037C12OVR01_0037_C12.b  
OVR010037F10OVR01_0037_F10.bBP143848 
OVR010038C02OVR01_0038_C02.bBP142192 
OVR010039D11OVR01_0039_D11.bBP142982 
OVR010041F04OVR01_0041_F04.b  
OVR010041G05OVR01_0041_G05.b  
OVR010042A10OVR01_0042_A10.bBP141611 
OVR010042D08OVR01_0042_D08.bBP142879 
OVR010044A08OVR01_0044_A08.bBP141535 
OVR010045E01OVR01_0045_E01.bBP143067 
OVR010045E02OVR01_0045_E02.bBP143104 
OVR010046A04OVR01_0046_A04.bBP141393 
OVR010046F12OVR01_0046_F12.bBP143932 
OVR010047C07OVR01_0047_C07.bBP142394 
OVR010047E08OVR01_0047_E08.bBP143329 
OVR010047F04OVR01_0047_F04.bBP143625 
OVR010047G10OVR01_0047_G10.bBP144315 
OVR010049A02OVR01_0049_A02.bBW963932 
OVR010051A12OVR01_0051_A12.bBW964125 
OVR010052C12OVR01_0052_C12.bBW964241 
OVR010056C07OVR01_0056_C07.bBW964593 
OVR010056D03OVR01_0056_D03.bBW964600 
OVR010057C01OVR01_0057_C01.bBW964678 
OVR010058G07OVR01_0058_G07.bBW964816 
OVR010058H02OVR01_0058_H02.bBW964823 
OVR010059F04OVR01_0059_F04.bBW964894 
OVR010059F09OVR01_0059_F09.bBW964899 
OVR010059H08OVR01_0059_H08.bBW964921 
OVR010060A09OVR01_0060_A09.bBW964934 
OVR010060C06OVR01_0060_C06.bBW964954 
OVR010061B03OVR01_0061_B03.bBW965031 
OVR010061F07OVR01_0061_F07.bBW965079 
OVR010062F07OVR01_0062_F07.bBW965163 
OVR010062H10OVR01_0062_H10.bBW965186 
OVR010064A08OVR01_0064_A08.bBW965285 
OVR010064E01OVR01_0064_E01.bBW965323 
OVR010064H09OVR01_0064_H09.bBW965364 
OVR010065D09OVR01_0065_D09.bBW965409 
OVR010065G11OVR01_0065_G11.bBW965443 
OVR010066D07OVR01_0066_D07.bBW965495 
OVR010067C10OVR01_0067_C10.bBW965574 
OVR010067H08OVR01_0067_H08.bBW965629 
OVR010068D04OVR01_0068_D04.bBW965670 
OVR010070F06OVR01_0070_F06.bBW965874 
OVR010070H09OVR01_0070_H09.bBW965900 
OVR010072B02OVR01_0072_B02.bBW966008 
OVR010075G09OVR01_0075_G09.bBW966325 
OVR010076B03OVR01_0076_B03.bBW966353 
OVR010076F10OVR01_0076_F10.bBW966406 
OVR010079D02OVR01_0079_D02.bBW966604 
OVR010080E01OVR01_0080_E01.bBW966686 
OVR010080G10OVR01_0080_G10.bBW966710 
OVR010082B07OVR01_0082_B07.bBW966802 AK347722
OVR010082G02OVR01_0082_G02.bBW966830 
OVR010084E01OVR01_0084_E01.bBW966926 
OVR010084G10OVR01_0084_G10.bBW966948 AK234557
OVR010085A02OVR01_0085_A02.bBW966964 
OVR010085B04OVR01_0085_B04.bBW966976 
OVR010089E06OVR01_0089_E06.bBW967309 
OVR010090B05OVR01_0090_B05.bBW967354 
OVR010090B09OVR01_0090_B09.bBW967358 
OVR010090H02OVR01_0090_H02.bBW967413 
OVR010093A02OVR01_0093_A02.bBW967576 
OVR010093G05OVR01_0093_G05.bBW967637 
OVR010094E07OVR01_0094_E07.b  
OVR010094G11OVR01_0094_G11.bBW967709 
OVR010095H02OVR01_0095_H02.bBW967790 
OVR010096B11OVR01_0096_B11.bBW967817 
OVR010097B06OVR01_0097_B06.bBW967885 
OVR010097D02OVR01_0097_D02.bBW967902 
OVR010097H11OVR01_0097_H11.bBW967946 
OVR010098A04OVR01_0098_A04.bBW967951 
OVR010098A09OVR01_0098_A09.bBW967956 
OVR010100B10OVR01_0100_B10.b  
OVR010100C10OVR01_0100_C10.bBW968140 
OVR010101C01OVR01_0101_C01.bBW968207 
OVR010101F05OVR01_0101_F05.bBW968245 
OVR010102B12OVR01_0102_B12.bBW968293 
OVR010103D07OVR01_0103_D07.bBW968400 
OVRM10014E06OVRM1_0014_E06.bBP150413 
OVRM10022C11OVRM1_0022_C11.bBP148443 
OVRM10058H07OVRM1_0058_H07.bBP154364 
OVRM10070F12OVRM1_0070_F12.bBP152322 
OVRM10071C10OVRM1_0071_C10.bBP148366 
OVRM10083H03OVRM1_0083_H03.bBP153940 
OVRM10088D10OVRM1_0088_D10.bBP149657 
OVRM10100G10OVRM1_0100_G10.bBP153401 
OVRM10101E11OVRM1_0101_E11.bBP151002 
OVRM10117B11OVRM1_0117_B11.bBP147280 
OVRM10124D12OVRM1_0124_D12.bBP149911 
OVRM10130A09OVRM1_0130_A09.bBP145791 
OVRM10153D09OVRM1_0153_D09.bBP458146 
OVRM10154E05OVRM1_0154_E05.bBP458797 
OVRM10157G11OVRM1_0157_G11.bBP461229 
OVRM10158G06OVRM1_0158_G06.bBP460834 
OVRM10169D06OVRM1_0169_D06.bBP457915 
OVRM10169G06OVRM1_0169_G06.bBP460844 
OVRM10170H02OVRM1_0170_H02.bBP461478 
OVRM10179A01OVRM1_0179_A01.bCJ016114 
OVRM10187F12OVRM1_0187_F12.bBP460361 
OVRM10198A07OVRM1_0198_A07.bBP455161 
OVRM10208D11OVRM1_0208_D11.bBP458355 
OVRT10004A12OVRT1_0004_A12.bFS686673 
OVRT10004E09OVRT1_0004_E09.bFS686716 
OVRT10007A01OVRT1_0007_A01.bFS686919 
OVRT10011F07OVRT1_0011_F07.bFS687305 
OVRT10046H02OVRT1_0046_H02.bFS690190 
OVRT10064B08OVRT1_0064_B08.bFS691620 
OVRT10065E01OVRT1_0065_E01.bFS691727 
OVRT10078C01OVRT1_0078_C01.bFS692746 
OVRT10079F03OVRT1_0079_F03.bFS692863 
OVRT10079H01OVRT1_0079_H01.bFS692882 
OVRT10094D12OVRT1_0094_D12.bFS694073 
OVRT10121B02OVRT1_0121_B02.bHX236481 
OVRT10121C04OVRT1_0121_C04.bHX236494 
OVRT10125F04OVRT1_0125_F04.bHX236833 
OVRT10134G01OVRT1_0134_G01.bHX237556 
PBL010001B12PBL01_0001_B12.bBP155448 
PBL010003C12PBL01_0003_C12.bBP155634 
PBL010004D11PBL01_0004_D11.bBP155789 
PBL010004F06PBL01_0004_F06.bBW968696 
PBL010004G01PBL01_0004_G01.bBW968700 
PBL010007G12PBL01_0007_G12.bBW968914 
PBL010010A10PBL01_0010_A10.bBW969080 
PBL010010B10PBL01_0010_B10.bBW969091 
PBL010012B08PBL01_0012_B08.bBW969258 
PBL010012C03PBL01_0012_C03.bBW969263 
PBL010013D06PBL01_0013_D06.bBW969333 
PBL010014D03PBL01_0014_D03.bBW969397 
PBL010018E02PBL01_0018_E02.bBW969591 
PBL010019H05PBL01_0019_H05.bBW969693 
PBL010020B12PBL01_0020_B12.bBW969717 
PBL010020F12PBL01_0020_F12.bBW969746 
PBL010022C05PBL01_0022_C05.bBW969835 
PBL010024A02PBL01_0024_A02.bBP155024 
PBL010032D07PBL01_0032_D07.bBP155749 
PBL010035A04PBL01_0035_A04.bBP155077 
PBL010036A01PBL01_0036_A01.bBP155008 
PBL010036A12PBL01_0036_A12.bBP155252 
PBL010039B10PBL01_0039_B10.bBW970334 
PBL010039E11PBL01_0039_E11.bBW970366 
PBL010041F11PBL01_0041_F11.bBW970506 
PBL010052B06PBL01_0052_B06.bBP155365 
PBL010053D06PBL01_0053_D06.bBW971199 
PBL010053D07PBL01_0053_D07.bBW971200 
PBL010053H09PBL01_0053_H09.bBW971247 
PBL010054H08PBL01_0054_H08.bBW971329 
PBL010055C09PBL01_0055_C09.bBW971355 
PBL010055F03PBL01_0055_F03.bBW971376 
PBL010056B06PBL01_0056_B06.bBP155366 
PBL010056C01PBL01_0056_C01.bBP155494 
PBL010057C05PBL01_0057_C05.b  
PBL010058D03PBL01_0058_D03.bBW971498 
PBL010059A07PBL01_0059_A07.bBW971538 
PBL010059B11PBL01_0059_B11.bBW971548 
PBL010062D10PBL01_0062_D10.bBW971770 
PBL010063D02PBL01_0063_D02.bBW971839 
PBL010065H10PBL01_0065_H10.b  
PBL010066E07PBL01_0066_E07.bBW972102 
PBL010070F02PBL01_0070_F02.bBW972420 
PBL010070F03PBL01_0070_F03.bBW972421 
PBL010071H01PBL01_0071_H01.bBW972517 
PBL010071H04PBL01_0071_H04.bBW972520 
PBL010072C11PBL01_0072_C11.bBW972557 
PBL010072E10PBL01_0072_E10.bBW972579 
PBL010072H06PBL01_0072_H06.bBW972607 
PBL010077D08PBL01_0077_D08.bBW973002 
PBL010077F08PBL01_0077_F08.bBW973025 
PBL010078C11PBL01_0078_C11.bBW973083 
PBL010078D06PBL01_0078_D06.bBW973090 
PBL010079F12PBL01_0079_F12.bBW973209 
PBL010084G04PBL01_0084_G04.bBW973657 
PBL010085C02PBL01_0085_C02.bBW973701 
PBL010087H09PBL01_0087_H09.bBW973943 
PBL010091C06PBL01_0091_C06.bBW974238 
PBL010096D07PBL01_0096_D07.bBW974600 
PBL010096F06PBL01_0096_F06.bBW974622 
PBL010097C11PBL01_0097_C11.bBW974684 
PBL010098G01PBL01_0098_G01.bBW974811 
PBL010099C10PBL01_0099_C10.bBW974863 
PBL010100E03PBL01_0100_E03.bBW974972 
PBL010102G06PBL01_0102_G06.bBW975174 
PCT010010C04PCT01_0010_C04.bFS695302 
PCT010015H02PCT01_0015_H02.b  
PCT010020E07PCT01_0020_E07.b  
PST010003D05PST01_0003_D05.bFS697232 
PST010007B01PST01_0007_B01.bFS697516 
PST010011F10PST01_0011_F10.bFS697878 
PST010012G11PST01_0012_G11.bFS697967 
PST010028A04PST01_0028_A04.bFS699158 
PST010034A11PST01_0034_A11.bFS699479 
PST010035H08PST01_0035_H08.bFS699616 
PST010044E02PST01_0044_E02.bFS700303 
PST010055A06PST01_0055_A06.bFS701156 
PST010056D10PST01_0056_D10.bFS701265 
PST010058F09PST01_0058_F09.bFS701440 
PST010059D09PST01_0059_D09.bFS701502 
PST010064C07PST01_0064_C07.b  
PST010074E09PST01_0074_E09.bFS702672 
PST010088A03PST01_0088_A03.bFS703778 
PST010090D05PST01_0090_D05.bFS703964 
PST010096H06PST01_0096_H06.bFS704453 
PTG010014C08PTG01_0014_C08.bFS705626 
PTG010034E12PTG01_0034_E12.bFS707412 
PTG010046C02PTG01_0046_C02.bFS708459 
PTG010102H04PTG01_0102_H04.bFS712751 
SKNB10005A08SKNB1_0005_A08.bDB800339 
SKNB10007H09SKNB1_0007_H09.bDB800506 
SKNB10009C04SKNB1_0009_C04.bDB800546 
SKNB10011G08SKNB1_0011_G08.bDB800646 
SKNB10011H01SKNB1_0011_H01.bDB800650 
SKNB10014B07SKNB1_0014_B07.b  
SKNB10018D09SKNB1_0018_D09.bDB801001 
SKNB10019A07SKNB1_0019_A07.b  
SKNB10019E09SKNB1_0019_E09.bFS713380 
SKNB10019F05SKNB1_0019_F05.b  
SKNB10020D01SKNB1_0020_D01.bDB801073 
SKNB10021C03SKNB1_0021_C03.b  
SKNB10022H06SKNB1_0022_H06.b  
SKNB10030E03SKNB1_0030_E03.bDB801633 
SKNB10030F12SKNB1_0030_F12.bDB801646 
SKNB10033B02SKNB1_0033_B02.b  
SKNB10033D10SKNB1_0033_D10.bDB801783 
SKNB10033G06SKNB1_0033_G06.bDB801804 
SKNB10038A02SKNB1_0038_A02.b  
SKNB10039C08SKNB1_0039_C08.bDB802133 
SKNB10040G12SKNB1_0040_G12.bDB802236 
SKNB10041D10SKNB1_0041_D10.bDB802276 
SKNB10042B01SKNB1_0042_B01.bDB802319 
SKNB10042E08SKNB1_0042_E08.bDB802348 
SKNB10042F02SKNB1_0042_F02.bDB802354 
SKNB10044G06SKNB1_0044_G06.bDB802500 
SKNB10045A08SKNB1_0045_A08.bDB802520 
SKNB10046F02SKNB1_0046_F02.bDB802634 
SKNB10048F05SKNB1_0048_F05.bDB802776 
SKNB10050C07SKNB1_0050_C07.bDB802894 
SKNB10050E05SKNB1_0050_E05.bDB802909 
SKNB10051A06SKNB1_0051_A06.bDB802946 
SKNB10056D02SKNB1_0056_D02.bDB803331 
SKNB10056H03SKNB1_0056_H03.bDB803368 
SKNB10058A08SKNB1_0058_A08.bDB803448 
SKNB10059C07SKNB1_0059_C07.bDB803522 
SKNB10063C11SKNB1_0063_C11.b  
SKNB10065E11SKNB1_0065_E11.b  
SKNB10065F05SKNB1_0065_F05.bDB803961 
SKNB10070D11SKNB1_0070_D11.bDB804254 AK400933
SKNB10072B05SKNB1_0072_B05.b  
SKNB10072B08SKNB1_0072_B08.b  
SKNB10074B01SKNB1_0074_B01.bDB804502 
SKNB10078F12SKNB1_0078_F12.b  
SKNB10078H10SKNB1_0078_H10.bFS713451 
SKNB10080F10SKNB1_0080_F10.b  
SKNB10081C04SKNB1_0081_C04.bDB804910 
SKNB10081C06SKNB1_0081_C06.bDB804912 
SKNB10083B06SKNB1_0083_B06.b  
SKNB10085E05SKNB1_0085_E05.bDB805179 
SKNB10089G09SKNB1_0089_G09.b  
SKNB10091B03SKNB1_0091_B03.bDB805459 
SKNB10092E07SKNB1_0092_E07.bDB805550 
SKNB10096H02SKNB1_0096_H02.bDB805797 
SKNB10098B05SKNB1_0098_B05.bDB805874 
SMG010001D01SMG01_0001_D01.bFS713505 
SMG010001E04SMG01_0001_E04.bFS713520 
SMG010001F11SMG01_0001_F11.bFS713537 
SMG010002F09SMG01_0002_F09.b  
SMG010003A07SMG01_0003_A07.b  
SMG010003A11SMG01_0003_A11.b  
SMG010003C11SMG01_0003_C11.bFS713678 
SMG010004A05SMG01_0004_A05.bFS713742 
SMG010005A04SMG01_0005_A04.bFS713831 
SMG010006G07SMG01_0006_G07.bFS713986 
SMG010007B05SMG01_0007_B05.bFS714013 
SMG010008B02SMG01_0008_B02.bFS714093 
SMG010010B01SMG01_0010_B01.bFS714212 
SMG010013D08SMG01_0013_D08.bFS714374 
SMG010013D11SMG01_0013_D11.bFS714377 
SMG010013H07SMG01_0013_H07.bFS714420 
SMG010014C06SMG01_0014_C06.bFS714454 
SMG010014D07SMG01_0014_D07.bFS714467 
SMG010015H07SMG01_0015_H07.bFS714599 
SMG010016C01SMG01_0016_C01.bFS714627 
SMG010016D08SMG01_0016_D08.bFS714644 
SMG010016H01SMG01_0016_H01.bFS714682 
SMG010017C12SMG01_0017_C12.bFS714723 
SMG010017H01SMG01_0017_H01.bFS714769 
SMG010018F03SMG01_0018_F03.bFS714835 
SMG010019E07SMG01_0019_E07.bFS714923 
SMG010019E10SMG01_0019_E10.bFS714925 
SMG010019F04SMG01_0019_F04.bFS714931 
SMG010021B12SMG01_0021_B12.bFS715072 
SMG010022A09SMG01_0022_A09.bFS715147 
SMG010022F07SMG01_0022_F07.bFS715205 
SMG010024G08SMG01_0024_G08.bFS715401 
SMG010027A02SMG01_0027_A02.bFS715601 
SMG010027A06SMG01_0027_A06.bFS715604 
SMG010028H06SMG01_0028_H06.bFS715775 
SMG010029B04SMG01_0029_B04.bFS715795 
SMG010030H12SMG01_0030_H12.bFS715953 
SMG010031F07SMG01_0031_F07.bFS716016 
SMG010034E01SMG01_0034_E01.bFS716263 
SMG010035B02SMG01_0035_B02.bFS716319 
SMG010036C04SMG01_0036_C04.bFS716415 
SMG010036D03SMG01_0036_D03.bFS716426 
SMG010036H05SMG01_0036_H05.bFS716475 
SMG010038G04SMG01_0038_G04.bFS716633 
SMG010038G08SMG01_0038_G08.bFS716637 
SMG010039C06SMG01_0039_C06.bFS716679 
SMG010039G11SMG01_0039_G11.b  
SMG010042B11SMG01_0042_B11.bFS716916 
SMG010043G09SMG01_0043_G09.bFS717056 
SMG010043G11SMG01_0043_G11.bFS717058 
SMG010044H12SMG01_0044_H12.bFS717154 
SMG010045E11SMG01_0045_E11.bFS717209 
SMG010045G11SMG01_0045_G11.bFS717231 
SMG010046F08SMG01_0046_F08.bFS717305 
SMG010047D03SMG01_0047_D03.bFS717369 
SMG010048G09SMG01_0048_G09.bFS717493 
SMG010049E05SMG01_0049_E05.bFS717554 
SMG010050G11SMG01_0050_G11.bFS717668 
SMG010053B06SMG01_0053_B06.bFS717857 
SMG010053F04SMG01_0053_F04.bFS717896 
SMG010054B11SMG01_0054_B11.bFS717937 
SMG010056E01SMG01_0056_E01.bFS718119 
SMG010056H03SMG01_0056_H03.bFS718153 
SMG010057B04SMG01_0057_B04.bFS718173 
SMG010058F04SMG01_0058_F04.bFS718303 
SMG010059C07SMG01_0059_C07.b  
SMG010059E05SMG01_0059_E05.bFS718373 
SMG010059F12SMG01_0059_F12.bFS718390 
SMG010061F01SMG01_0061_F01.bFS718555 
SMG010063A12SMG01_0063_A12.bFS718677 
SMG010063H10SMG01_0063_H10.bFS718754 
SMG010064B03SMG01_0064_B03.bFS718764 
SMG010067C06SMG01_0067_C06.bFS719046 
SMG010067D10SMG01_0067_D10.bFS719060 
SMG010068B08SMG01_0068_B08.b  
SMG010069G01SMG01_0069_G01.bFS719253 
SMG010070H01SMG01_0070_H01.bFS719353 
SMG010070H09SMG01_0070_H09.bFS719360 
SMG010071C11SMG01_0071_C11.bFS719395 
SMG010072D12SMG01_0072_D12.bFS719493 
SMG010073B04SMG01_0073_B04.bFS719551 
SMG010074D08SMG01_0074_D08.bFS719663 
SMG010075F06SMG01_0075_F06.bFS719771 
SMG010075F08SMG01_0075_F08.bFS719773 
SMG010076B06SMG01_0076_B06.bFS719813 
SMG010077C03SMG01_0077_C03.bFS719905 
SMG010077F12SMG01_0077_F12.bFS719946 
SMG010078C08SMG01_0078_C08.bFS720000 
SMG010078D08SMG01_0078_D08.bFS720009 
SMG010079G04SMG01_0079_G04.bFS720127 
SMG010080E12SMG01_0080_E12.bFS720205 
SMG010081A05SMG01_0081_A05.bFS720238 
SMG010081G02SMG01_0081_G02.bFS720296 
SMG010082F11SMG01_0082_F11.bFS720379 
SMG010082G04SMG01_0082_G04.bFS720384 
SMG010082H09SMG01_0082_H09.bFS720399 
SMG010083E10SMG01_0083_E10.bFS720451 
SMG010083H11SMG01_0083_H11.bFS720481 
SMG010084H09SMG01_0084_H09.bFS720568 
SMG010085F10SMG01_0085_F10.bFS720634 
SMG010086F11SMG01_0086_F11.bFS720725 
SMG010087G10SMG01_0087_G10.b  
SMG010087H04SMG01_0087_H04.bFS720826 
SMG010090C05SMG01_0090_C05.bFS721031 
SMG010091E11SMG01_0091_E11.b  
SMG010093C09SMG01_0093_C09.bFS721300 
SMG010093E10SMG01_0093_E10.bFS721317 
SMG010097A01SMG01_0097_A01.bFS721592 
SMG010097D01SMG01_0097_D01.bFS721621 
SMG010097E06SMG01_0097_E06.b  
SMG010097H03SMG01_0097_H03.b  
SMG010098A04SMG01_0098_A04.bFS721672 
SMG010098B10SMG01_0098_B10.bFS721688 
SPL010002A06SPL01_0002_A06.bBP156806 
SPL010002D01SPL01_0002_D01.bBP157661 
SPL010006D06SPL01_0006_D06.bBP157819 
SPL010012A09SPL01_0012_A09.bBP156895 
SPL010012G07SPL01_0012_G07.bBP158891 
SPL010014F02SPL01_0014_F02.bBP158403 
SPL010014F11SPL01_0014_F11.bBP158660 
SPL010016H02SPL01_0016_H02.bBP159081 
SPL010017E11SPL01_0017_E11.bBP158313 
SPL010019C08SPL01_0019_C08.bBP157542 
SPL010019H02SPL01_0019_H02.bBP159083 
SPL010020F06SPL01_0020_F06.bBP158528 
SPL010021G09SPL01_0021_G09.bBP158951 
SPL010023H07SPL01_0023_H07.bBP159223 
SPL010024E03SPL01_0024_E03.bBP158095 
SPL010025G12SPL01_0025_G12.bBP159028 
SPL010025H06SPL01_0025_H06.bBP159199 
SPL010026H05SPL01_0026_H05.bBP159173 
SPL010027C07SPL01_0027_C07.bBP157522 
SPL010028B02SPL01_0028_B02.bBP157040 
SPL010028C12SPL01_0028_C12.bBP157654 
SPL010032B12SPL01_0032_B12.bCJ016497 
SPL010033B12SPL01_0033_B12.bCJ016585 
SPL010034A03SPL01_0034_A03.bCJ016658 
SPL010034F02SPL01_0034_F02.bCJ016716 
SPL010035E10SPL01_0035_E10.bBP158295 
SPL010036F01SPL01_0036_F01.bBP158387 
SPL010037A01SPL01_0037_A01.bBP156700 
SPL010039D03SPL01_0039_D03.bBP157752 
SPL010041F06SPL01_0041_F06.bBP158540 
SPL010042F01SPL01_0042_F01.bCJ016807 
SPL010043H06SPL01_0043_H06.bCJ016928 
SPL010045H03SPL01_0045_H03.bCJ017109 
SPL010047B02SPL01_0047_B02.bCJ017220 
SPL010047E08SPL01_0047_E08.bCJ017259 
SPL010047G10SPL01_0047_G10.bCJ017284 
SPL010048E08SPL01_0048_E08.bCJ017352 
SPL010049H05SPL01_0049_H05.bCJ017468 
SPL010050G08SPL01_0050_G08.bCJ017546 
SPL010054G06SPL01_0054_G06.bCJ017907 
SPL010055A08SPL01_0055_A08.bCJ017930 
SPL010056F01SPL01_0056_F01.bCJ018071 
SPL010056H06SPL01_0056_H06.bCJ018096 
SPL010057G08SPL01_0057_G08.bCJ018177 
SPL010058A04SPL01_0058_A04.bCJ018197 
SPL010058C10SPL01_0058_C10.bCJ018226 
SPL010060D07SPL01_0060_D07.bCJ018411 
SPL010064G08SPL01_0064_G08.bCJ018818 
SPL010067D02SPL01_0067_D02.bCJ019037 
SPL010068E03SPL01_0068_E03.bCJ019141 
SPL010069D04SPL01_0069_D04.bCJ019221 
SPL010070E04SPL01_0070_E04.bCJ019323 
SPL010070F01SPL01_0070_F01.bCJ019330 
SPL010071E09SPL01_0071_E09.bCJ019417 
SPL010073B07SPL01_0073_B07.bCJ019561 
SPL010075H01SPL01_0075_H01.bCJ019804 
SPL010076A07SPL01_0076_A07.bCJ019821 
SPL010078F03SPL01_0078_F03.bCJ020058 
SPL010080D09SPL01_0080_D09.bCJ020221 
SPL010081B01SPL01_0081_B01.bCJ020283 
SPL010081F11SPL01_0081_F11.bCJ020339 
SPL010082C03SPL01_0082_C03.bCJ020387 
SPL010082G06SPL01_0082_G06.bCJ020437 
SPL010083G05SPL01_0083_G05.bCJ020529 
SPL010084G07SPL01_0084_G07.bCJ020626 
SPL010087C10SPL01_0087_C10.bCJ020843 
SPL010090B01SPL01_0090_B01.bCJ021089 
SPL010090D10SPL01_0090_D10.bCJ021120 
SPL010091G08SPL01_0091_G08.bCJ021244 
SPL010092D07SPL01_0092_D07.bCJ021297 
SPL010093B09SPL01_0093_B09.b  
SPL010093F09SPL01_0093_F09.bCJ021408 
SPL010093G04SPL01_0093_G04.bCJ021415 
SPL010095C05SPL01_0095_C05.bCJ021554 
SPL010095G03SPL01_0095_G03.bCJ021597 
SPL010096B07SPL01_0096_B07.bCJ021637 
SPL010097A07SPL01_0097_A07.bCJ021714 
SPL010098A06SPL01_0098_A06.bCJ021803 
SPL010098B07SPL01_0098_B07.bCJ021816 
SPL010098G12SPL01_0098_G12.bCJ021875 
SPL010098H12SPL01_0098_H12.bCJ021887 
SPL010099E11SPL01_0099_E11.bCJ021942 
SPL010100F11SPL01_0100_F11.bCJ022033 
SPL010103D11SPL01_0103_D11.bCJ022263 
SPL010105D03SPL01_0105_D03.bCJ022434 
SPL010105F05SPL01_0105_F05.bCJ022459 
SPL010105F06SPL01_0105_F06.bCJ022460 
SPLT10026G12SPLT1_0026_G12.bHX241247 
SPLT10031F04SPLT1_0031_F04.bHX241604 
SPLT10034G01SPLT1_0034_G01.bHX241853 
SPLT10039A06SPLT1_0039_A06.bHX242195 
SPLT10050A09SPLT1_0050_A09.b  
SPLT10057E04SPLT1_0057_E04.bHX243612 
SPLT10074B10SPLT1_0074_B10.bHX244937 
SPLT10086G05SPLT1_0086_G05.bHX245925 
SPLT10094B12SPLT1_0094_B12.b  
TCH010001B03TCH01_0001_B03.bCJ022501 
TCH010003D03TCH01_0003_D03.bCJ022662 
TCH010004F05TCH01_0004_F05.bBW975678 
TCH010008D01TCH01_0008_D01.bCJ023032 
TCH010009D09TCH01_0009_D09.bCJ023120 
TCH010010G11TCH01_0010_G11.bCJ023219 
TCH010013B05TCH01_0013_B05.bCJ023377 
TCH010014H06TCH01_0014_H06.bCJ023505 
TCH010016C09TCH01_0016_C09.bCJ023610 
TCH010016E08TCH01_0016_E08.bCJ023628 
TCH010017C12TCH01_0017_C12.bCJ023683 
TCH010018H10TCH01_0018_H10.b  
TCH010019G04TCH01_0019_G04.bCJ023864 
TCH010025H11TCH01_0025_H11.bCJ024328 
TCH010026F09TCH01_0026_F09.bCJ024382 
TCH010030C02TCH01_0030_C02.bCJ024652 
TCH010030C11TCH01_0030_C11.bCJ024659 
TCH010030C12TCH01_0030_C12.bCJ024660 
TCH010030H12TCH01_0030_H12.bCJ024704 
TCH010031G08TCH01_0031_G08.bCJ024764 
TCH010031G10TCH01_0031_G10.bCJ024766 
TCH010032A07TCH01_0032_A07.bCJ024784 
TCH010032B11TCH01_0032_B11.bCJ024798 
TCH010032E03TCH01_0032_E03.bCJ024819 
TCH010034G04TCH01_0034_G04.bCJ024986 
TCH010035G07TCH01_0035_G07.bCJ025062 
TCH010036B03TCH01_0036_B03.bCJ025089 
TCH010036H04TCH01_0036_H04.bCJ025146 
TCH010037E04TCH01_0037_E04.bCJ025195 
TCH010038H01TCH01_0038_H01.bCJ025299 
TCH010044E06TCH01_0044_E06.bCJ025742 
TCH010045E08TCH01_0045_E08.bCJ025809 
TCH010046A03TCH01_0046_A03.bCJ025838 
TCH010047C10TCH01_0047_C10.bCJ025937 
TCH010047D09TCH01_0047_D09.bCJ025944 
TCH010047E12TCH01_0047_E12.bCJ025957 
TCH010048E08TCH01_0048_E08.bCJ026032 
TCH010049B02TCH01_0049_B02.bCJ026073 
TCH010050D12TCH01_0050_D12.bCJ026176 
TCH010051F07TCH01_0051_F07.bCJ026267 
TCH010053B03TCH01_0053_B03.bBW975816 
TCH010054E06TCH01_0054_E06.bBW975920 
TCH010056C03TCH01_0056_C03.bCJ026391 
TCH010057D08TCH01_0057_D08.bCJ026484 
TCH010065D07TCH01_0065_D07.bCJ027088 
TCH010067B09TCH01_0067_B09.bCJ027221 
TCH010068H07TCH01_0068_H07.bCJ027337 
TCH010073G10TCH01_0073_G10.bCJ027721 
TCH010073H06TCH01_0073_H06.bCJ027728 
TCH010074A03TCH01_0074_A03.bCJ027736 
TCH010077A09TCH01_0077_A09.bCJ027965 
TCH010078A09TCH01_0078_A09.bCJ028038 
TCH010079A05TCH01_0079_A05.bCJ028112 
TCH010079A07TCH01_0079_A07.bCJ028114 
TCH010080B02TCH01_0080_B02.bCJ028193 
TCH010082A02TCH01_0082_A02.bCJ028342 
TCH010083H07TCH01_0083_H07.bCJ028492 
TCH010085D08TCH01_0085_D08.bCJ028609 
TCH010097A12TCH01_0097_A12.bCJ029503 
TCH010097F12TCH01_0097_F12.bCJ029548 
TES010004D01TES01_0004_D01.bCJ030248 
TES010007H06TES01_0007_H06.bCJ030494 
TES010017D05TES01_0017_D05.bCJ031142 
TES010017F04TES01_0017_F04.bCJ031155 
TES010019G06TES01_0019_G06.bCJ031302 
TES010023G08TES01_0023_G08.b  
TES010024F08TES01_0024_F08.bCJ031631 
TES010025A10TES01_0025_A10.bCJ031658 
TES010026D02TES01_0026_D02.bCJ031725 
TES010029C06TES01_0029_C06.bCJ031904 
TES010032C08TES01_0032_C08.bCJ032115 
TES010036F10TES01_0036_F10.bCJ032394 
TES010038A06TES01_0038_A06.bCJ032478 
TES010038G10TES01_0038_G10.b  
TES010038H05TES01_0038_H05.bCJ032534 
TES010039A02TES01_0039_A02.bCJ032542 
TES010039B01TES01_0039_B01.bCJ032546 
TES010043G10TES01_0043_G10.bCJ032811 
TES010046H09TES01_0046_H09.bCJ033001 
TES010047D10TES01_0047_D10.b  
TES010051H01TES01_0051_H01.bCJ033286 
TES010055A01TES01_0055_A01.bCJ033463 
TES010056A07TES01_0056_A07.bCJ033535 
TES010057A11TES01_0057_A11.bCJ033615 
TES010060H02TES01_0060_H02.bCJ033874 
TES010065H08TES01_0065_H08.bFS722238 
TES010069D02TES01_0069_D02.bCJ034453 
TES010073A06TES01_0073_A06.bCJ034696 
TES010077F08TES01_0077_F08.bCJ034968 
TES010080G05TES01_0080_G05.bCJ035180 
TES010093D04TES01_0093_D04.bCJ036033 
TES010093E12TES01_0093_E12.bCJ036046 
TES010107D02TES01_0107_D02.bCJ037059 
TES010111B06TES01_0111_B06.bCJ037302 
TES010112D12TES01_0112_D12.bCJ037399 
THY010003A06THY01_0003_A06.bBP159872 
THY010003H12THY01_0003_H12.bBP169283 
THY010008G12THY01_0008_G12.bBP167994 
THY010011A03THY01_0011_A03.bBP159570 
THY010013A12THY01_0013_A12.bBP160485 
THY010014F09THY01_0014_F09.bBP166422 
THY010017A06THY01_0017_A06.bBP159885 
THY010018B07THY01_0018_B07.bBP161214 
THY010019F11THY01_0019_F11.bBP166627 
THY010022F03THY01_0022_F03.bBP165808 
THY010026G11THY01_0026_G11.bBP167904 
THY010029D06THY01_0029_D06.bBP163616 
THY010030D09THY01_0030_D09.bBP163923 
THY010032C10THY01_0032_C10.bBP162792 
THY010033F09THY01_0033_F09.bBP166437 
THY010039G04THY01_0039_G04.bBP167174 
THY010042G05THY01_0042_G05.bBP167285 
THY010043H01THY01_0043_H01.bBP168128 
THY010044B11THY01_0044_B11.bBP161659 
THY010047H01THY01_0047_H01.bBP168131 
THY010050F02THY01_0050_F02.bBP165721 
THY010053H04THY01_0053_H04.bBP168463 
THY010057B08THY01_0057_B08.bBP161353 
THY010062G07THY01_0062_G07.bBP167510 
THY010064H06THY01_0064_H06.bBP168689 
THY010065B10THY01_0065_B10.bBP161570 
THY010066G10THY01_0066_G10.bBP167836 
THY010070B02THY01_0070_B02.bBP160735 
THY010071H11THY01_0071_H11.bBP169234 
THY010072A08THY01_0072_A08.bBP160132 
THY010072H09THY01_0072_H09.bBP169018 
THY010074G04THY01_0074_G04.bBP167206 
THY010080G06THY01_0080_G06.bBP167417 
THY010084E10THY01_0084_E10.bBP165326 
THY010086F02THY01_0086_F02.bBP165749 
THY010090D07THY01_0090_D07.bBP163764 
THY010091G03THY01_0091_G03.bBP167104 
THY010092E07THY01_0092_E07.bBP165025 
THY010093F08THY01_0093_F08.bBP166376 
THY010093F11THY01_0093_F11.bBP166683 
THY010093H08THY01_0093_H08.b  
THY010094F05THY01_0094_F05.bBP166083 
THY010095A08THY01_0095_A08.bBP160141 
THY010095F09THY01_0095_F09.bBP166483 
THY010099A04THY01_0099_A04.bBP159745 
THY010104B08THY01_0104_B08.bBP161386 
THY010107G11THY01_0107_G11.bBP167966 
THY010108A10THY01_0108_A10.bBP160350 
THY010108H09THY01_0108_H09.bBP169042 
THY010111A09THY01_0111_A09.bBP160253 
THY010111B05THY01_0111_B05.bBP161079 
THY010111H03THY01_0111_H03.bBP168400 
THY010118C01THY01_0118_C01.bBP161923 
THY010120B11THY01_0120_B11.bBP161717 
THY010120D10THY01_0120_D10.bBP164096 
THY010121F07THY01_0121_F07.bBP166299 
THY010122F09THY01_0122_F09.bBP166506 
THY010125F10THY01_0125_F10.bBP166606 
THY010126E07THY01_0126_E07.bBP165057 
THY010201F05THY01_0201_F05.bBP166109 
THY010202C03THY01_0202_C03.bBP162138 
UTR010003A06UTR01_0003_A06.bBP169575 
UTR010005F05UTR01_0005_F05.bBP172209 
UTR010006F05UTR01_0006_F05.bBP172210 
UTR010007C02UTR01_0007_C02.bBP170471 
UTR010007E09UTR01_0007_E09.bBP171857 
UTR010008D09UTR01_0008_D09.bBP171328 
UTR010008E11UTR01_0008_E11.bBP171945 
UTR010009G04UTR01_0009_G04.bBP172698 
UTR010010A11UTR01_0010_A11.bBP169807 
UTR010013C02UTR01_0013_C02.bBP170477 
UTR010013C06UTR01_0013_C06.bBP170655 
UTR010014C10UTR01_0014_C10.bBP170835 
UTR010014E10UTR01_0014_E10.bBP171908 
UTR010014F11UTR01_0014_F11.bBP172476 
UTR010015B08UTR01_0015_B08.bBP170211 
UTR010016E06UTR01_0016_E06.bBP171730 
UTR010017F09UTR01_0017_F09.bBP172394 
UTR010019E04UTR01_0019_E04.bBP171647 
UTR010021H02UTR01_0021_H02.bBP173161 
UTR010025A10UTR01_0025_A10.bBP169775 
UTR010025B02UTR01_0025_B02.bBP169951 
UTR010025C12UTR01_0025_C12.bBP170935 
UTR010026F10UTR01_0026_F10.bBP172447 
UTR010028C05UTR01_0028_C05.bBP170624 
UTR010028D01UTR01_0028_D01.bBP170984 
UTR010032A07UTR01_0032_A07.bBP169647 
UTR010033F11UTR01_0033_F11.bBP172494 
UTR010035E01UTR01_0035_E01.bBP171528 
UTR010036B05UTR01_0036_B05.bBP170093 
UTR010037E02UTR01_0037_E02.bBP171571 
UTR010038A06UTR01_0038_A06.bBP169605 
UTR010039E01UTR01_0039_E01.bBP171531 
UTR010039F04UTR01_0039_F04.bBP172195 
UTR010040G05UTR01_0040_G05.bBP172770 
UTR010041B02UTR01_0041_B02.bBP169965 
UTR010041C08UTR01_0041_C08.bBP170771 
UTR010042E06UTR01_0042_E06.bBP171754 
UTR010046F06UTR01_0046_F06.bBP172290 
UTR010048A07UTR01_0048_A07.bBP169660 
UTR010048F06UTR01_0048_F06.bBP172292 
UTR010049A12UTR01_0049_A12.bBP169884 
UTR010050D07UTR01_0050_D07.bBP463684 
UTR010053G01UTR01_0053_G01.bBP464401 
UTR010055H01UTR01_0055_H01.bBP464697 
UTR010059E02UTR01_0059_E02.bBP463860 
UTR010059H08UTR01_0059_H08.bBP464866 
UTR010061D06UTR01_0061_D06.bBP463669 
UTR010062H11UTR01_0062_H11.bBP464943 
UTR010063A12UTR01_0063_A12.bBP462945 
UTR010063B04UTR01_0063_B04.bBP463043 
UTR010066D04UTR01_0066_D04.bBP463627 
UTR010069B01UTR01_0069_B01.bBP462974 
UTR010070G02UTR01_0070_G02.bBP464438 
UTR010072F01UTR01_0072_F01.bBP464133 
UTR010074A06UTR01_0074_A06.bBP462804 
UTR010075F04UTR01_0075_F04.bBP464204 
UTR010076C11UTR01_0076_C11.bBP463509 
UTR010079A01UTR01_0079_A01.bBP462683 
UTR010079F12UTR01_0079_F12.bBP464396 
UTR010079H11UTR01_0079_H11.bBP464955 
UTR010082F01UTR01_0082_F01.bCJ037582 
UTR010083G11UTR01_0083_G11.bCJ037695 
UTR010083G12UTR01_0083_G12.bCJ037696 
UTR010084G10UTR01_0084_G10.bCJ037785 
UTR010085E01UTR01_0085_E01.bCJ037847 
UTR010085E03UTR01_0085_E03.bCJ037849 
UTR010085E06UTR01_0085_E06.bCJ037852 
UTR010087B02UTR01_0087_B02.bCJ037999 
UTR010088B03UTR01_0088_B03.bCJ038093 
UTR010088E05UTR01_0088_E05.bCJ038130 
UTR010088H12UTR01_0088_H12.bCJ038172 
UTR010089E11UTR01_0089_E11.bCJ038230 
UTR010090C01UTR01_0090_C01.bCJ038290 
UTR010091B07UTR01_0091_B07.bCJ038379 
UTR010092H04UTR01_0092_H04.bCJ038531 
UTR010093F09UTR01_0093_F09.bCJ038604 
UTR010093G03UTR01_0093_G03.bCJ038609 
UTR010095G06UTR01_0095_G06.bCJ038796 
UTR010096E01UTR01_0096_E01.bCJ038863 
UTR010096E03UTR01_0096_E03.bCJ038865 
UTR010096H05UTR01_0096_H05.bCJ038903 
UTR010098C05UTR01_0098_C05.bCJ038937 
UTR010099A12UTR01_0099_A12.bCJ039014 
UTR010099B01UTR01_0099_B01.bCJ039015 
UTR010099C01UTR01_0099_C01.bCJ039027 
UTR010100E03UTR01_0100_E03.bCJ039149 
UTR010102A11UTR01_0102_A11.bCJ039292 
UTR010103B12UTR01_0103_B12.bCJ039395 
UTR010104D10UTR01_0104_D10.bCJ039511 
UTR010105A08UTR01_0105_A08.bCJ039565 
UTR010105B03UTR01_0105_B03.bCJ039572 
UTR010105E10UTR01_0105_E10.bCJ039613 
UTR010106D10UTR01_0106_D10.bCJ039696 
UTR010107A01UTR01_0107_A01.bCJ039743 
UTR010107C02UTR01_0107_C02.bCJ039768 
UTR010107E08UTR01_0107_E08.bCJ039797 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
611A667270.612WSGTA/V
C44000.388GTC/V
1269A400.500W-
T400.500
1270A600.545W-
C500.455


Alignment:      TOP

20110601C-000678 : ...................................................TACTTACCT
---------+---------+---------+---------+---------+---------+ 9
ITT01_0098_C11.b : nnnggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtacttacct
SPL01_0025_G12.b :
SMG01_0003_A07.b :
LNG01_0002_D05.b :
OVR01_0062_F07.b :
MLN01_0056_G08.b :
LNG01_0002_G12.b :
SPL01_0026_H05.b :
LNG01_0056_A04.b :
SPL01_0097_A07.b :
TES01_0073_A06.b :
TES01_0026_D02.b :
OVR01_0027_G04.b :
UTR01_0092_H04.b :
LNG01_0030_A09.b :
THY01_0017_A06.b :
SMG01_0087_G10.b :
OVR01_0031_H08.b :
UTR01_0098_C05.b :
OVR01_0037_F10.b :
OVRM1_0101_E11.b :
SPL01_0017_E11.b :
UTR01_0007_E09.b :
UTR01_0089_E11.b :
LVR01_0042_F06.b :
LNG01_0062_A05.b :
CBLT1_0074_C07.b :
MLN01_0005_H11.b :
LNG01_0021_C10.b :
ITT01_0008_D04.b :
SMG01_0024_G08.b :
ITT01_0009_B08.b :
MLN01_0054_B09.b :
MLN01_0022_H12.b :
ITT01_0067_G03.b :
SPL01_0084_G07.b :
UTR01_0048_F06.b :
MLN01_0084_A09.b :
UTR01_0085_E06.b :
CBLT1_0071_A01.b :
CBLT1_0006_G06.b :
LNG01_0064_C08.b :
SPLT1_0026_G12.b :
SMG01_0031_F07.b :
OVR01_0037_C12.b :
OVR01_0041_G05.b :
MLN01_0080_G08.b :
OVR01_0012_A09.b :
TES01_0017_D05.b :
OVR01_0075_G09.b :
SPL01_0042_F01.b :
OVRM1_0153_D09.b :
OVRM1_0070_F12.b :
SMG01_0059_C07.b :
OVR01_0097_B06.b :
TES01_0111_B06.b :
CLNT1_0116_E08.b :
TCH01_0053_B03.b :
ILNT1_0077_A09.b :
SPL01_0058_C10.b :
MLN01_0007_F06.b :
LNG01_0033_F10.b :
LVR01_0050_C01.b :
SPL01_0045_H03.b :
SKNB1_0050_E05.b :
OVR01_0047_G10.b :
THY01_0008_G12.b :
CLNT1_0138_C05.b :
ITT01_0058_D08.b :
LNG01_0001_F11.b :
SMG01_0086_F11.b :
SMG01_0064_B03.b :
ITT01_0060_A02.b :
LNG01_0081_A03.b :
MLN01_0029_A12.b :
BMWN1_0088_C02.b :
MLN01_0094_A04.b :
MLN01_0061_A03.b :
LNG01_0019_A08.b :
OVR01_0045_E02.b :
OVR01_0097_H11.b :
CLNT1_0003_F10.b :
UTR01_0106_D10.b :
THY01_0072_A08.b :
THY01_0039_G04.b :
THY01_0095_A08.b :
MLN01_0079_C04.b :
SPL01_0019_C08.b :
OVR01_0085_B04.b :
OVR01_0001_A09.b :
PBL01_0091_C06.b :
ITT01_0027_C08.b :
UTR01_0091_B07.b :
THY01_0111_B05.b :
THY01_0107_G11.b :
THY01_0122_F09.b :
OVR01_0082_B07.b :
THY01_0120_B11.b :
TES01_0093_D04.b :
TES01_0093_E12.b :
TES01_0077_F08.b :
SPL01_0034_F02.b :
LVRM1_0123_F12.b :
LVRM1_0097_F01.b :
OVRM1_0130_A09.b :
TES01_0024_F08.b :
THY01_0042_G05.b :
BMWN1_0018_F05.b :
PBL01_0001_B12.b :
THY01_0003_H12.b :
SPL01_0012_A09.b :
UTR01_0025_A10.b :
THY01_0003_A06.b :
UTR01_0028_C05.b :
UTR01_0070_G02.b :
TES01_0019_G06.b :
UTR01_0041_B02.b :
UTR01_0015_B08.b :
OVRT1_0121_B02.b :
SMG01_0063_H10.b :
OVR01_0041_F04.b :
ILNT1_0032_F09.b :
MLN01_0091_E10.b :
MLN01_0090_D11.b :
SMG01_0008_B02.b :
OVRT1_0007_A01.b :
SMG01_0075_F08.b :
SKNB1_0041_D10.b :
UTR01_0069_B01.b :
ITT01_0093_F09.b :
THY01_0053_H04.b :
SPL01_0082_C03.b :
MLN01_0102_F10.b :
CBLT1_0100_C01.b :
LNG01_0070_F07.b :
CLNT1_0052_C03.b :
OVR01_0028_A01.b :
SPL01_0073_B07.b :
PBL01_0087_H09.b :
UTR01_0107_A01.b :
MLN01_0080_A08.b :
LNG01_0004_C01.b :
PBL01_0100_E03.b :
CBLT1_0100_C03.b :
ILNT1_0017_B03.b :
LNG01_0064_G07.b :
MLN01_0078_E03.b :
TES01_0004_D01.b :
SKNB1_0070_D11.b :
ITT01_0031_F09.b :
ITT01_0071_A12.b :
CLNT1_0019_C11.b :
PBL01_0062_D10.b :
THY01_0125_F10.b :
PBL01_0019_H05.b :
OVRM1_0158_G06.b :
OVRM1_0083_H03.b :
OVRM1_0124_D12.b :
OVRM1_0088_D10.b :
UTR01_0014_C10.b :
UTR01_0010_A11.b :
SPL01_0034_A03.b :
OVR01_0100_C10.b :
UTR01_0079_F12.b :
OVR01_0060_A09.b :
OVR01_0059_F09.b :
UTR01_0006_F05.b :
SMG01_0019_E10.b :
UTR01_0041_C08.b :
THY01_0043_H01.b :
PBL01_0010_B10.b :
OVR01_0056_C07.b :
OVR01_0042_D08.b :
SPL01_0099_E11.b :
SPL01_0082_G06.b :
HTMT1_0119_G08.b :
SMG01_0028_H06.b :
UTR01_0005_F05.b :
SMG01_0097_A01.b :
BMWN1_0079_G03.b :
LNG01_0048_A03.b :
SMG01_0081_A05.b :
LNG01_0107_F01.b :
SPL01_0100_F11.b :
OVR01_0067_C10.b :
SPL01_0069_D04.b :
SPL01_0033_B12.b :
SMG01_0059_E05.b :
TCH01_0019_G04.b :
MLN01_0013_G06.b :
UTR01_0096_E01.b :
UTR01_0088_E05.b :
LNG01_0021_E11.b :
LNG01_0010_G12.b :
LNG01_0030_B06.b :
UTR01_0075_F04.b :
MLN01_0054_E07.b :
PBL01_0039_B10.b :
LVR01_0019_D01.b :
OVR01_0006_F12.b :
THY01_0091_G03.b :
SPL01_0006_D06.b :
PBL01_0020_F12.b :
LVR01_0079_A10.b :
SMG01_0038_G04.b :
OVRT1_0121_C04.b :
SKNB1_0051_A06.b :
CLNT1_0027_H10.b :
SMG01_0038_G08.b :
THY01_0065_B10.b :
ADR01_0034_G11.b :
TCH01_0016_E08.b :
SPL01_0047_G10.b :
SMG01_0016_C01.b :
SPL01_0047_E08.b :
MLN01_0008_F08.b :
CLNT1_0118_E03.b :
OVR01_0090_H02.b :
UTR01_0048_A07.b :
THY01_0057_B08.b :
MLN01_0062_E04.b :
OVR01_0019_G12.b :
TCH01_0065_D07.b :
CLNT1_0091_F11.b :
SPL01_0091_G08.b :
TCH01_0050_D12.b :
SPL01_0035_E10.b :
MLN01_0091_A07.b :
UTR01_0053_G01.b :
TCH01_0044_E06.b :
MLN01_0035_F04.b :
SKNB1_0030_F12.b :
ITT01_0022_D05.b :
SPL01_0090_B01.b :
THY01_0090_D07.b :
ITT01_0022_E07.b :
SKNB1_0072_B05.b :
ITT01_0058_H10.b :
THY01_0093_F08.b :
MLN01_0039_D11.b :
LVR01_0010_A07.b :
ITT01_0063_E03.b :
SPL01_0095_C05.b :
PBL01_0077_D08.b :
CLNT1_0071_B12.b :
OVR01_0097_D02.b :
ITT01_0017_H11.b :
SPL01_0032_B12.b :
TCH01_0079_A05.b :
ITT01_0063_F02.b :
LNG01_0064_E05.b :
ITT01_0038_H10.b :
ITT01_0011_C12.b :
ITT01_0011_C02.b :
ITT01_0023_A10.b :
ITT01_0078_F03.b :
ILNT1_0012_F05.b :
LNG01_0073_F01.b :
SPLT1_0050_A09.b :
SMG01_0056_E01.b :
ILNT1_0011_A04.b :
SPLT1_0034_G01.b :
UTR01_0008_D09.b :
SMG01_0070_H01.b :
UTR01_0033_F11.b :
OVR01_0065_G11.b :
SMG01_0027_A02.b :
SMG01_0097_D01.b :
ILNT1_0059_H10.b :
SPLT1_0094_B12.b :
BMWN1_0029_C11.b :
ILNT1_0052_C01.b :
OVR01_0090_B05.b :
ITT01_0025_A01.b :
SMG01_0097_H03.b :
ITT01_0102_F01.b :
SPLT1_0057_E04.b :
PTG01_0046_C02.b :
CLNT1_0070_D12.b :
ILNT1_0045_A01.b :
TCH01_0073_G10.b :
SPLT1_0086_G05.b :
ITT01_0061_B07.b :
SMG01_0061_F01.b :
CBLT1_0030_E06.b :
LNG01_0088_G04.b :
SMG01_0079_G04.b :
OVR01_0064_A08.b :
LNG01_0099_H03.b :
MLN01_0058_F11.b :
LNG01_0017_B04.b :
MLN01_0027_G08.b :
LNG01_0087_B08.b :
LNG01_0083_H08.b :
LNG01_0033_H01.b :
ITT01_0027_H05.b :
ILNT1_0081_H02.b :
ITT01_0039_C05.b :
ILNT1_0093_F09.b :
LNG01_0056_F01.b :
LNG01_0088_B06.b :
ILNT1_0088_B08.b :
UTR01_0046_F06.b :
OVR01_0005_H08.b :
LNG01_0088_G03.b :
SPLT1_0074_B10.b :
LNG01_0002_F09.b :
TCH01_0097_A12.b :
TCH01_0025_H11.b :
TCH01_0097_F12.b :
ILNT1_0014_B07.b :
ILNT1_0090_A10.b :
ILNT1_0100_F04.b :
SKNB1_0042_B01.b :
CLNT1_0045_C11.b :
ITT01_0100_E03.b :
OVR01_0061_B03.b :
PBL01_0096_F06.b :
ILNT1_0033_C06.b :
ILNT1_0049_B04.b :
SKNB1_0098_B05.b :
CLNT1_0053_G12.b :
ITT01_0011_H11.b :
ADR01_0100_D11.b :
ITT01_0044_G08.b :
MLN01_0029_D08.b :
SMG01_0010_B01.b :
OVR01_0084_G10.b :
SMG01_0053_B06.b :
PBL01_0004_G01.b :
THY01_0121_F07.b :
SMG01_0098_B10.b :
THY01_0111_A09.b :
THY01_0108_H09.b :
OVR01_0080_G10.b :
SMG01_0054_B11.b :
THY01_0111_H03.b :
THY01_0104_B08.b :
OVR01_0094_E07.b :
THY01_0120_D10.b :
SMG01_0098_A04.b :
THY01_0108_A10.b :
THY01_0126_E07.b :
TES01_0038_H05.b :
LVRM1_0193_D05.b :
SMG01_0057_B04.b :
LVRM1_0086_H03.b :
OVR01_0022_E04.b :
SMG01_0022_F07.b :
LVR01_0081_A05.b :
SMG01_0067_C06.b :
OVR01_0084_E01.b :
OVR01_0076_F10.b :
PBL01_0004_F06.b :
PBL01_0007_G12.b :
SMG01_0002_F09.b :
OVR01_0076_B03.b :
PBL01_0004_D11.b :
LVRM1_0066_H06.b :
OVR01_0082_G02.b :
OVRM1_0154_E05.b :
OVR01_0080_E01.b :
OVRM1_0198_A07.b :
SMG01_0093_C09.b :
PBL01_0003_C12.b :
OVRM1_0179_A01.b :
OVRM1_0170_H02.b :
LVRM1_0152_G02.b :
OVRM1_0169_D06.b :
OVRM1_0169_G06.b :
OVRM1_0014_E06.b :
OVRM1_0187_F12.b :
OVRM1_0058_H07.b :
LNG01_0042_G10.b :
OVRM1_0208_D11.b :
OVR01_0070_H09.b :
OVR01_0100_B10.b :
OVR01_0101_C01.b :
PTG01_0102_H04.b :
SPL01_0023_H07.b :
OVR01_0102_B12.b :
UTR01_0014_F11.b :
OVRM1_0071_C10.b :
THY01_0011_A03.b :
OVRM1_0022_C11.b :
ADR01_0015_F04.b :
SMG01_0016_D08.b :
SPL01_0028_C12.b :
UTR01_0014_E10.b :
SMG01_0076_B06.b :
SPL01_0016_H02.b :
LVR01_0038_F10.b :
SMG01_0069_G01.b :
THY01_0070_B02.b :
THY01_0013_A12.b :
SMG01_0039_G11.b :
SPL01_0014_F11.b :
SMG01_0030_H12.b :
SPL01_0021_G09.b :
SPL01_0024_E03.b :
UTR01_0025_C12.b :
SPL01_0025_H06.b :
THY01_0050_F02.b :
SMG01_0005_A04.b :
SPL01_0014_F02.b :
OVR01_0070_F06.b :
SPL01_0020_F06.b :
TCH01_0045_E08.b :
THY01_0019_F11.b :
UTR01_0008_E11.b :
SPL01_0028_B02.b :
SPL01_0027_C07.b :
OVR01_0096_B11.b :
UTR01_0007_C02.b :
UTR01_0028_D01.b :
UTR01_0026_F10.b :
PBL01_0022_C05.b :
SPL01_0060_D07.b :
OVR01_0052_C12.b :
UTR01_0009_G04.b :
OVR01_0101_F05.b :
UTR01_0025_B02.b :
SMG01_0059_F12.b :
SPL01_0012_G07.b :
OVR01_0103_D07.b :
OVR01_0059_H08.b :
OVR01_0034_E06.b :
OVR01_0027_F05.b :
UTR01_0021_H02.b :
PBL01_0036_A12.b :
SPL01_0098_G12.b :
UTR01_0040_G05.b :
UTR01_0103_B12.b :
TES01_0112_D12.b :
UTR01_0039_E01.b :
TES01_0032_C08.b :
UTR01_0042_E06.b :
SMG01_0036_H05.b :
OVR01_0064_H09.b :
CLNT1_0068_B12.b :
THY01_0014_F09.b :
SPL01_0103_D11.b :
UTR01_0017_F09.b :
SMG01_0042_B11.b :
ADR01_0035_F05.b :
SMG01_0013_H07.b :
UTR01_0019_E04.b :
SMG01_0013_D11.b :
SMG01_0077_F12.b :
UTR01_0039_F04.b :
OVR01_0098_A09.b :
UTR01_0003_A06.b :
UTR01_0016_E06.b :
SMG01_0014_D07.b :
SMG01_0007_B05.b :
SMG01_0016_H01.b :
PBL01_0053_D06.b :
SPL01_0070_F01.b :
OVR01_0066_D07.b :
SMG01_0021_B12.b :
PBL01_0036_A01.b :
SMG01_0004_A05.b :
THY01_0026_G11.b :
CLNT1_0119_H09.b :
SMG01_0034_E01.b :
UTR01_0032_A07.b :
PBL01_0020_B12.b :
OVR01_0062_H10.b :
SPL01_0098_H12.b :
CLNT1_0136_H06.b :
PBL01_0018_E02.b :
THY01_0044_B11.b :
LNG01_0063_A05.b :
MLN01_0017_D01.b :
SPL01_0048_E08.b :
PBL01_0039_E11.b :
OVR01_0047_E08.b :
ITT01_0041_B07.b :
UTR01_0035_E01.b :
CLNT1_0101_F07.b :
SMG01_0078_D08.b :
SMG01_0003_C11.b :
SMG01_0045_E11.b :
SMG01_0001_F11.b :
SMG01_0070_H09.b :
UTR01_0037_E02.b :
OVR01_0065_D09.b :
SMG01_0082_H09.b :
SMG01_0046_F08.b :
SMG01_0072_D12.b :
OVR01_0079_D02.b :
SMG01_0090_C05.b :
ADR01_0007_C01.b :
THY01_0047_H01.b :
SMG01_0083_H11.b :
CLNT1_0106_F02.b :
SMG01_0050_G11.b :
THY01_0064_H06.b :
CLNT1_0053_A03.b :
OVR01_0042_A10.b :
LNG01_0035_A09.b :
LNG01_0074_F04.b :
UTR01_0038_A06.b :
SMG01_0071_C11.b :
PTG01_0034_E12.b :
SMG01_0045_G11.b :
TES01_0038_A06.b :
TCH01_0032_B11.b :
ADR01_0022_E04.b :
OVRT1_0079_H01.b :
SMG01_0093_E10.b :
OVR01_0068_D04.b :
OVR01_0061_F07.b :
SPL01_0071_E09.b :
MLN01_0025_G07.b :
TCH01_0018_H10.b :
SMG01_0017_H01.b :
SMG01_0083_E10.b :
LNG01_0008_H05.b :
CLNT1_0110_B07.b :
LNG01_0004_D04.b :
OVR01_0098_A04.b :
LNG01_0029_C06.b :
OVR01_0060_C06.b :
SMG01_0081_G02.b :
SPL01_0095_G03.b :
UTR01_0088_H12.b :
OVR01_0094_G11.b :
THY01_0201_F05.b :
MLN01_0083_G09.b :
SMG01_0015_H07.b :
LNG01_0030_E09.b :
UTR01_0099_A12.b :
SPL01_0080_D09.b :
THY01_0018_B07.b :
CLNT1_0119_H04.b :
LNG01_0030_D08.b :
UTR01_0072_F01.b :
SMG01_0085_F10.b :
SPL01_0058_A04.b :
OVR01_0089_E06.b :
SMG01_0044_H12.b :
SMG01_0056_H03.b :
SPL01_0037_A01.b :
LNG01_0012_F01.b :
LNG01_0033_H11.b :
TCH01_0054_E06.b :
UTR01_0036_B05.b :
OVR01_0022_B04.b :
SPL01_0041_F06.b :
OVR01_0032_E10.b :
OVR01_0057_C01.b :
SMG01_0080_E12.b :
SKNB1_0033_B02.b :
UTR01_0076_C11.b :
LNG01_0086_E06.b :
UTR01_0059_E02.b :
SPL01_0083_G05.b :
SMG01_0048_G09.b :
SMG01_0036_C04.b :
UTR01_0083_G11.b :
UTR01_0083_G12.b :
ITT01_0002_E01.b :
SPL01_0075_H01.b :
OVR01_0045_E01.b :
LVR01_0031_G11.b :
SPL01_0076_A07.b :
SMG01_0078_C08.b :
SKNB1_0056_H03.b :
CLNT1_0061_A09.b :
CLNT1_0118_H06.b :
CLNT1_0129_F03.b :
PBL01_0013_D06.b :
OVR01_0046_F12.b :
PBL01_0072_E10.b :
MLN01_0039_A08.b :
LNG01_0029_G11.b :
OVR01_0038_C02.b :
TES01_0017_F04.b :
LNG01_0020_B11.b :
THY01_0094_F05.b :
OVRT1_0134_G01.b :
MLN01_0006_B07.b :
PTG01_0014_C08.b :
TES01_0043_G10.b :
MLN01_0011_B07.b :
ITT01_0021_B09.b :
ITT01_0038_C02.b :
PBL01_0057_C05.b :
OVR01_0044_A08.b :
ITT01_0101_B10.b :
ITT01_0061_C04.b :
PBL01_0012_B08.b :
PBL01_0053_H09.b :
OVR01_0007_D11.b :
LVR01_0104_C01.b :
OVR01_0033_F11.b :
OVR01_0039_D11.b :
PBL01_0012_C03.b :
ITT01_0008_C03.b :
SMG01_0077_C03.b :
PBL01_0032_D07.b :
OVR01_0034_G05.b :
ITT01_0061_F06.b :
ADR01_0044_B07.b :
SMG01_0053_F04.b :
PBL01_0024_A02.b :
OVRT1_0064_B08.b :
SMG01_0082_G04.b :
SMG01_0027_A06.b :
OVR01_0033_B06.b :
UTR01_0099_C01.b :
CLNT1_0057_H02.b :
ITT01_0049_F12.b :
SMG01_0022_A09.b :
ADR01_0069_H01.b :
SMG01_0058_F04.b :
TCH01_0057_D08.b :
PBL01_0056_C01.b :
ITT01_0036_F02.b :
ITT01_0102_F04.b :
ADR01_0066_B03.b :
PBL01_0070_F02.b :
PBL01_0054_H08.b :
PBL01_0053_D07.b :
ITT01_0087_G01.b :
SMG01_0084_H09.b :
SMG01_0074_D08.b :
ITT01_0038_G02.b :
ITT01_0032_B10.b :
ITT01_0088_H02.b :
THY01_0072_H09.b :
UTR01_0079_H11.b :
ITT01_0096_G07.b :
PBL01_0059_B11.b :
SMG01_0073_B04.b :
SMG01_0035_B02.b :
UTR01_0066_D04.b :
OVRT1_0065_E01.b :
CLNT1_0057_F04.b :
OVRT1_0125_F04.b :
SMG01_0029_B04.b :
PBL01_0010_A10.b :
THY01_0202_C03.b :
OVRT1_0004_E09.b :
OVRT1_0011_F07.b :
OVRT1_0078_C01.b :
CLNT1_0038_G08.b :
CLNT1_0044_A11.b :
CLNT1_0023_H01.b :
SMG01_0006_G07.b :
SMG01_0043_G11.b :
SMG01_0087_H04.b :
CLNT1_0039_D04.b :
LNG01_0085_H09.b :
SMG01_0097_E06.b :
LNG01_0071_D08.b :
SMG01_0001_E04.b :
SMG01_0013_D08.b :
ITT01_0101_E05.b :
SMG01_0019_F04.b :
ADR01_0101_C06.b :
MLN01_0006_C06.b :
MLN01_0027_H07.b :
MLN01_0063_F10.b :
CLNT1_0035_B10.b :
SMG01_0019_E07.b :
ITT01_0069_G09.b :
ADR01_0033_C10.b :
ADR01_0097_H09.b :
ITT01_0034_E11.b :
ITT01_0071_D11.b :
SPL01_0050_G08.b :
LNG01_0091_A07.b :
LNG01_0080_H02.b :
MLN01_0076_D06.b :
CLNT1_0151_F08.b :
SMG01_0047_D03.b :
ITT01_0050_E08.b :
THY01_0071_H11.b :
OVRT1_0079_F03.b :
SPL01_0055_A08.b :
TCH01_0068_H07.b :
MLN01_0059_H08.b :
SMG01_0018_F03.b :
LNG01_0065_H11.b :
MLN01_0070_G02.b :
OVR01_0085_A02.b :
OVRT1_0004_A12.b :
SMG01_0043_G09.b :
SMG01_0075_F06.b :
CLNT1_0062_A09.b :
MLN01_0099_D02.b :
MLN01_0079_H08.b :
MLN01_0074_A10.b :
ITT01_0011_H07.b :
PBL01_0059_A07.b :
LNG01_0110_B01.b :
LNG01_0062_E08.b :
OVR01_0051_A12.b :
MLN01_0101_D03.b :
SMG01_0036_D03.b :
PBL01_0052_B06.b :
PBL01_0058_D03.b :
OVR01_0072_B02.b :
MLN01_0066_E10.b :
OVRT1_0094_D12.b :
CLNT1_0046_E05.b :
THY01_0080_G06.b :
LNG01_0015_F04.b :
THY01_0074_G04.b :
MLN01_0097_H11.b :
MLN01_0066_D05.b :
MLN01_0058_D04.b :
SMG01_0039_C06.b :
LNG01_0036_G08.b :
SPL01_0002_D01.b :
MLN01_0044_C09.b :
LNG01_0078_H09.b :
CLNT1_0036_G12.b :
UTR01_0050_D07.b :
SPL01_0002_A06.b :
TCH01_0082_A02.b :
THY01_0093_F11.b :
LNG01_0041_G03.b :
LNG01_0067_H04.b :
MLN01_0013_D08.b :
MLN01_0056_E08.b :
OVR01_0033_A12.b :
MLN01_0039_C06.b :
MLN01_0098_F10.b :
MLN01_0077_B06.b :
MLN01_0032_A04.b :
UTR01_0079_A01.b :
UTR01_0087_B02.b :
MLN01_0033_H09.b :
TCH01_0030_H12.b :
TCH01_0004_F05.b :
SMG01_0082_F11.b :
LVR01_0046_D02.b :
MLN01_0040_D03.b :
MLN01_0042_D02.b :
UTR01_0105_B03.b :
MLN01_0063_E01.b :
MLN01_0049_E09.b :
UTR01_0093_G03.b :
TCH01_0017_C12.b :
SMG01_0063_A12.b :
PBL01_0055_F03.b :
OVR01_0049_A02.b :
SPL01_0056_F01.b :
LNG01_0070_G02.b :
TCH01_0056_C03.b :
PBL01_0070_F03.b :
OVR01_0056_D03.b :
LNG01_0085_E04.b :
ITT01_0010_G06.b :
SPL01_0090_D10.b :
SPL01_0105_F06.b :
UTR01_0107_C02.b :
UTR01_0049_A12.b :
THY01_0032_C10.b :
SPL01_0096_B07.b :
OVR01_0064_E01.b :
MLN01_0026_F08.b :
MLN01_0064_C01.b :
MLN01_0065_D06.b :
OVR01_0003_A11.b :
LNG01_0029_D05.b :
OVR01_0021_F10.b :
OVR01_0026_F09.b :
LNG01_0020_F08.b :
UTR01_0100_E03.b :
LNG01_0104_H01.b :
MLN01_0074_F01.b :
TCH01_0079_A07.b :
LNG01_0065_C10.b :
THY01_0033_F09.b :
OVR01_0059_F04.b :
CLNT1_0001_C06.b :
SPL01_0039_D03.b :
UTR01_0105_E10.b :
TCH01_0031_G10.b :
CLNT1_0071_C08.b :
ITT01_0077_A09.b :
OVR01_0019_D10.b :
CLNT1_0127_C02.b :
LNG01_0011_F10.b :
ADR01_0067_B08.b :
TCH01_0032_E03.b :
LNG01_0027_D09.b :
OVR01_0047_F04.b :
LNG01_0065_G07.b :
SPL01_0047_B02.b :
SPL01_0105_D03.b :
MLN01_0044_G07.b :
SPL01_0105_F05.b :
UTR01_0102_A11.b :
LNG01_0066_E10.b :
MLN01_0075_B01.b :
OVR01_0058_G07.b :
LNG01_0026_F01.b :
LNG01_0018_H07.b :
UTR01_0085_E03.b :
THY01_0030_D09.b :
SPL01_0054_G06.b :
TCH01_0051_F07.b :
UTR01_0095_G06.b :
UTR01_0104_D10.b :
ITT01_0093_H05.b :
BKFL1_0106_B01.b : nnnnnnnnnnnnn
OVR01_0006_B06.b :
LNG01_0010_G09.b :
LNG01_0106_H02.b :
UTR01_0096_H05.b :
SPL01_0056_H06.b :
LVR01_0005_E12.b :
LNG01_0005_A12.b :
UTR01_0074_A06.b :
SPL01_0057_G08.b :
THY01_0022_F03.b :
CLNT1_0131_D07.b :
TES01_0056_A07.b :
LNG01_0018_D10.b :
LNG01_0001_G07.b :
MLN01_0065_G11.b :
THY01_0086_F02.b :
THY01_0062_G07.b :
SPL01_0043_H06.b :
CLNT1_0095_B11.b :
OVR01_0011_G08.b :
OVR01_0029_E04.b :
ADR01_0031_C03.b :
OVR01_0030_D04.b :
LNG01_0101_D11.b :
MLN01_0086_E07.b :
MLN01_0011_G07.b :
MLN01_0073_F06.b :
OVR01_0046_A04.b :
MLN01_0063_C12.b :
MLN01_0021_F06.b :
SMG01_0001_D01.b :
AMP01_0009_F08.b :
THY01_0095_F09.b :
UTR01_0055_H01.b :
SPL01_0081_F11.b :
SPL01_0019_H02.b :
MLN01_0076_E03.b :
LNG01_0009_A10.b :
LNG01_0044_D02.b :
LNG01_0045_C04.b :
THY01_0084_E10.b :
LNG01_0103_C09.b :
SPL01_0070_E04.b :
ITT01_0081_A01.b :
UTR01_0093_F09.b :
MLN01_0043_B12.b :
TCH01_0003_D03.b :
UTR01_0105_A08.b :
MLN01_0096_D01.b :
ITT01_0045_G08.b :
LNG01_0064_A07.b :
OVR01_0012_H01.b :
SPL01_0081_B01.b :
THY01_0092_E07.b :
OVR01_0003_D08.b :
LNG01_0057_B10.b :
ITT01_0009_E12.b :
SPL01_0067_D02.b :
MLN01_0045_F12.b :
THY01_0093_H08.b :
UTR01_0084_G10.b :
MLN01_0055_A07.b :
ITT01_0047_E06.b :
PBL01_0014_D03.b :
MLN01_0039_G06.b :
TCH01_0035_G07.b :
CLNT1_0051_C10.b :
OVR01_0017_A01.b :
THY01_0029_D06.b :
TCH01_0031_G08.b :
ITT01_0069_F03.b :
TCH01_0001_B03.b :
ITT01_0060_F01.b :
PBL01_0079_F12.b :
OVR01_0011_C05.b :
MLN01_0055_C06.b :
CLNT1_0100_G11.b :
ITT01_0096_D09.b :
ITT01_0030_D08.b :
MLN01_0103_H03.b :
ITT01_0079_C12.b :
UTR01_0082_F01.b :
ITT01_0044_G09.b :
ITT01_0015_H10.b :
ITT01_0094_H03.b :
ADR01_0085_D07.b :
ITT01_0041_A07.b :
MLN01_0043_E10.b :
ITT01_0029_A01.b :
ITT01_0072_C04.b :
CLNT1_0146_G12.b :
TCH01_0030_C02.b :
MLN01_0040_G05.b :
OVRT1_0046_H02.b :
ADR01_0034_F06.b :
SPL01_0064_G08.b :
SPL01_0093_B09.b :
TCH01_0037_E04.b :
MLN01_0031_F10.b :
SPL01_0068_E03.b :
ITT01_0039_F08.b :
ITT01_0062_F02.b :
UTR01_0063_A12.b :
CLNT1_0094_H03.b :
OVR01_0058_H02.b :
CLNT1_0045_C04.b :
SPL01_0098_A06.b :
LNG01_0071_B04.b :
ITT01_0031_E06.b :
LNG01_0094_H08.b :
TCH01_0030_C11.b :
ITT01_0032_H10.b :
ITT01_0052_A04.b :
PBL01_0056_B06.b :
PBL01_0096_D07.b :
PBL01_0077_F08.b :
PBL01_0035_A04.b :
TCH01_0046_A03.b :
LNG01_0099_H01.b :
OVR01_0093_G05.b :
TCH01_0008_D01.b :
TCH01_0077_A09.b :
SPL01_0092_D07.b :
PBL01_0071_H01.b :
OVR01_0003_F02.b :
UTR01_0063_B04.b :
OVR01_0095_H02.b :
ADR01_0078_F01.b :
ITT01_0036_D04.b :
MLN01_0052_G07.b :
SPL01_0078_F03.b :
SPL01_0093_G04.b :
ITT01_0005_F06.b :
MLN01_0023_F06.b :
OVR01_0020_E02.b :
UTR01_0107_E08.b :
THY01_0099_A04.b :
PBL01_0098_G01.b :
MLN01_0100_F02.b :
MLN01_0104_B11.b :
SPL01_0036_F01.b :
OVR01_0093_A02.b :
TES01_0055_A01.b :
UTR01_0099_B01.b :
MLN01_0021_H05.b :
SPL01_0049_H05.b :
PST01_0056_D10.b :
ITT01_0003_A07.b :
ITT01_0030_E07.b :
MLN01_0033_A06.b :
ITT01_0090_A12.b :
TCH01_0026_F09.b :
LNG01_0012_A02.b :
PBL01_0072_H06.b :
UTR01_0090_C01.b :
MLN01_0041_C09.b :
LNG01_0067_A09.b :
SKNB1_0045_A08.b :
OVR01_0009_E08.b :
PBL01_0097_C11.b :
ITT01_0006_E05.b :
ITT01_0019_F10.b :
OVR01_0011_B05.b :
TCH01_0067_B09.b :
ITT01_0060_B12.b :
ITT01_0009_G06.b :
TCH01_0049_B02.b :
PBL01_0078_D06.b :
ITT01_0008_C11.b :
ITT01_0082_G01.b :
PBL01_0055_C09.b :
ITT01_0060_D06.b :
PBL01_0085_C02.b :
ITT01_0010_H10.b :
ITT01_0019_G10.b :
ADR01_0078_C09.b :
ADR01_0030_B11.b :
ITT01_0020_D04.b :
ADR01_0075_B06.b :
ITT01_0090_A04.b :
PBL01_0084_G04.b :
PBL01_0063_D02.b :
ITT01_0020_A12.b :
ITT01_0080_B08.b :
ITT01_0095_D11.b :
PBL01_0066_E07.b :
PBL01_0071_H04.b :
UTR01_0088_B03.b :
PBL01_0078_C11.b :
PBL01_0072_C11.b :
ITT01_0052_H11.b :
TCH01_0032_A07.b :
MLN01_0096_E07.b :
MLN01_0077_E12.b :
LNG01_0065_C06.b :
TCH01_0085_D08.b :
UTR01_0096_E03.b :
MLN01_0041_E06.b :
TCH01_0034_G04.b :
TCH01_0078_A09.b :
MLN01_0040_G11.b :
TCH01_0013_B05.b :
TCH01_0009_D09.b :
TCH01_0080_B02.b :
MLN01_0045_A10.b :
TCH01_0047_E12.b :
TCH01_0036_B03.b :
TCH01_0047_C10.b :
TCH01_0047_D09.b :
MLN01_0074_D09.b :
BMWN1_0027_G09.b :
TES01_0107_D02.b :
TES01_0023_G08.b :
SMG01_0091_E11.b :
BMWN1_0077_B07.b :
SKNB1_0033_D10.b :
SKNB1_0005_A08.b :
SKNB1_0096_H02.b :
SMG01_0014_C06.b :
TES01_0065_H08.b :
SKNB1_0083_B06.b :
CLNT1_0035_D09.b :
TES01_0060_H02.b :
PBL01_0102_G06.b :
SPL01_0087_C10.b :
ADR01_0032_H06.b :
SKNB1_0044_G06.b :
SKNB1_0056_D02.b :
CLNT1_0097_E08.b :
TCH01_0073_H06.b :
CLNT1_0095_C06.b :
SKNB1_0011_H01.b :
TES01_0047_D10.b :
PST01_0074_E09.b :
SKNB1_0042_E08.b :
SKNB1_0007_H09.b :
MLN01_0025_C09.b :
TES01_0007_H06.b :
PST01_0088_A03.b :
TES01_0039_B01.b :
TES01_0036_F10.b :
SKNB1_0050_C07.b :
SKNB1_0030_E03.b :
SMG01_0003_A11.b :
TES01_0069_D02.b :
UTR01_0013_C02.b :
SMG01_0017_C12.b :
SKNB1_0065_F05.b :
SKNB1_0040_G12.b :
OVR01_0090_B09.b :
SMG01_0067_D10.b :
SKNB1_0059_C07.b :
SKNB1_0020_D01.b :
SKNB1_0081_C06.b :
SKNB1_0019_A07.b :
PST01_0090_D05.b :
SKNB1_0011_G08.b :
PCT01_0010_C04.b :
SKNB1_0091_B03.b :
SKNB1_0074_B01.b :
CLNT1_0081_A10.b :
CLNT1_0077_B04.b :
UTR01_0085_E01.b :
SKNB1_0033_G06.b :
UTR01_0059_H08.b :
LNG01_0043_B12.b :
PST01_0044_E02.b :
UTR01_0061_D06.b :
SKNB1_0065_E11.b :
ITT01_0047_A03.b :
SKNB1_0014_B07.b :
PST01_0096_H06.b :
SKNB1_0039_C08.b :
PST01_0059_D09.b :
SKNB1_0009_C04.b :
THY01_0066_G10.b :
MLN01_0053_E02.b :
PST01_0007_B01.b :
PST01_0064_C07.b :
SKNB1_0018_D09.b :
SKNB1_0072_B08.b :
PST01_0011_F10.b :
PST01_0034_A11.b :
SKNB1_0038_A02.b :
PST01_0058_F09.b :
PBL01_0065_H10.b :
ITT01_0012_H07.b :
ITT01_0067_G11.b :
TCH01_0010_G11.b :
TCH01_0038_H01.b :
OVRM1_0117_B11.b :
SMG01_0049_E05.b :
ITT01_0001_A03.b :
PBL01_0099_C10.b :
TCH01_0083_H07.b :
TCH01_0014_H06.b :
TES01_0025_A10.b :
TES01_0046_H09.b :
TES01_0051_H01.b :
TES01_0029_C06.b :
LNG01_0026_E05.b :
CLNT1_0080_A01.b :
LNG01_0001_E11.b :
TCH01_0074_A03.b :
PST01_0055_A06.b :
TES01_0080_G05.b :
TES01_0038_G10.b :
PCT01_0015_H02.b :
TES01_0057_A11.b :
SKNB1_0081_C04.b :
SKNB1_0019_E09.b :
PST01_0035_H08.b :
SKNB1_0092_E07.b :
ITT01_0060_D11.b :
SKNB1_0046_F02.b :
SKNB1_0021_C03.b :
ILNT1_0075_F01.b :
SKNB1_0085_E05.b :
TES01_0039_A02.b :
SKNB1_0048_F05.b :
PST01_0028_A04.b :
PST01_0012_G11.b :
SKNB1_0063_C11.b :
MLN01_0020_D08.b :
SKNB1_0042_F02.b :
PST01_0003_D05.b :
SKNB1_0078_F12.b :
PCT01_0020_E07.b :
BMWN1_0087_A02.b :
UTR01_0013_C06.b :
CLNT1_0149_H05.b :
UTR01_0062_H11.b :
SKNB1_0089_G09.b :
SKNB1_0080_F10.b :
THY01_0118_C01.b :
MLN01_0088_D11.b :
TCH01_0036_H04.b :
OVR01_0067_H08.b :
LNG01_0064_F10.b :
TCH01_0048_E08.b :
TCH01_0030_C12.b :
TCH01_0016_C09.b :
ITT01_0009_D03.b :
OVRM1_0100_G10.b :
SKNB1_0019_F05.b :
PBL01_0041_F11.b :
MLN01_0020_B11.b :
MLN01_0023_C04.b :
ITT01_0027_C03.b :
LNG01_0090_A01.b :
SPL01_0098_B07.b :
OVRM1_0157_G11.b :
ADR01_0084_G09.b :
SMG01_0068_B08.b :
OVR01_0047_C07.b :
ITT01_0040_H04.b :
SPL01_0093_F09.b :
SKNB1_0058_A08.b :
SPLT1_0031_F04.b :
SKNB1_0078_H10.b :
SKNB1_0022_H06.b :
ILNT1_0036_B06.b :
SPLT1_0039_A06.b :
ILNT1_0098_F05.b :
ILNT1_0048_D11.b :
20110601C-000678 : GGCAGGGGAGATACCATGATCACGAAGGTGGTTTTCCCAGGGCGAGGCTCACCCATTGCA
---------+---------+---------+---------+---------+---------+ 69
ITT01_0098_C11.b : ggcaggggagataccatgatcacgaaggtggttttcccagggcgaggctcacccattgca
SPL01_0025_G12.b : gcct
SMG01_0003_A07.b :
LNG01_0002_D05.b :
OVR01_0062_F07.b :
MLN01_0056_G08.b :
LNG01_0002_G12.b :
SPL01_0026_H05.b : c
LNG01_0056_A04.b :
SPL01_0097_A07.b :
TES01_0073_A06.b :
TES01_0026_D02.b :
OVR01_0027_G04.b :
UTR01_0092_H04.b :
LNG01_0030_A09.b :
THY01_0017_A06.b :
SMG01_0087_G10.b :
OVR01_0031_H08.b :
UTR01_0098_C05.b :
OVR01_0037_F10.b :
OVRM1_0101_E11.b :
SPL01_0017_E11.b :
UTR01_0007_E09.b :
UTR01_0089_E11.b :
LVR01_0042_F06.b :
LNG01_0062_A05.b :
CBLT1_0074_C07.b :
MLN01_0005_H11.b :
LNG01_0021_C10.b :
ITT01_0008_D04.b :
SMG01_0024_G08.b : nnnn
ITT01_0009_B08.b :
MLN01_0054_B09.b :
MLN01_0022_H12.b :
ITT01_0067_G03.b :
SPL01_0084_G07.b :
UTR01_0048_F06.b :
MLN01_0084_A09.b :
UTR01_0085_E06.b :
CBLT1_0071_A01.b :
CBLT1_0006_G06.b :
LNG01_0064_C08.b :
SPLT1_0026_G12.b :
SMG01_0031_F07.b :
OVR01_0037_C12.b :
OVR01_0041_G05.b :
MLN01_0080_G08.b :
OVR01_0012_A09.b : caaaatttgaaca
TES01_0017_D05.b :
OVR01_0075_G09.b :
SPL01_0042_F01.b :
OVRM1_0153_D09.b :
OVRM1_0070_F12.b :
SMG01_0059_C07.b :
OVR01_0097_B06.b : gc
TES01_0111_B06.b :
CLNT1_0116_E08.b :
TCH01_0053_B03.b :
ILNT1_0077_A09.b :
SPL01_0058_C10.b :
MLN01_0007_F06.b :
LNG01_0033_F10.b : gcc
LVR01_0050_C01.b :
SPL01_0045_H03.b :
SKNB1_0050_E05.b :
OVR01_0047_G10.b :
THY01_0008_G12.b :
CLNT1_0138_C05.b :
ITT01_0058_D08.b :
LNG01_0001_F11.b :
SMG01_0086_F11.b :
SMG01_0064_B03.b :
ITT01_0060_A02.b :
LNG01_0081_A03.b :
MLN01_0029_A12.b :
BMWN1_0088_C02.b :
MLN01_0094_A04.b :
MLN01_0061_A03.b :
LNG01_0019_A08.b :
OVR01_0045_E02.b :
OVR01_0097_H11.b :
CLNT1_0003_F10.b :
UTR01_0106_D10.b :
THY01_0072_A08.b :
THY01_0039_G04.b :
THY01_0095_A08.b :
MLN01_0079_C04.b :
SPL01_0019_C08.b :
OVR01_0085_B04.b :
OVR01_0001_A09.b : ggaat
PBL01_0091_C06.b :
ITT01_0027_C08.b :
UTR01_0091_B07.b :
THY01_0111_B05.b :
THY01_0107_G11.b :
THY01_0122_F09.b :
OVR01_0082_B07.b :
THY01_0120_B11.b :
TES01_0093_D04.b :
TES01_0093_E12.b :
TES01_0077_F08.b :
SPL01_0034_F02.b :
LVRM1_0123_F12.b :
LVRM1_0097_F01.b :
OVRM1_0130_A09.b :
TES01_0024_F08.b :
THY01_0042_G05.b :
BMWN1_0018_F05.b :
PBL01_0001_B12.b :
THY01_0003_H12.b : ggcaxxxxxxxxxxxxx
SPL01_0012_A09.b :
UTR01_0025_A10.b :
THY01_0003_A06.b :
UTR01_0028_C05.b :
UTR01_0070_G02.b :
TES01_0019_G06.b :
UTR01_0041_B02.b : ttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B08.b :
OVRT1_0121_B02.b :
SMG01_0063_H10.b :
OVR01_0041_F04.b :
ILNT1_0032_F09.b :
MLN01_0091_E10.b :
MLN01_0090_D11.b :
SMG01_0008_B02.b :
OVRT1_0007_A01.b :
SMG01_0075_F08.b :
SKNB1_0041_D10.b :
UTR01_0069_B01.b :
ITT01_0093_F09.b :
THY01_0053_H04.b :
SPL01_0082_C03.b :
MLN01_0102_F10.b :
CBLT1_0100_C01.b :
LNG01_0070_F07.b :
CLNT1_0052_C03.b :
OVR01_0028_A01.b :
SPL01_0073_B07.b :
PBL01_0087_H09.b :
UTR01_0107_A01.b :
MLN01_0080_A08.b :
LNG01_0004_C01.b :
PBL01_0100_E03.b :
CBLT1_0100_C03.b :
ILNT1_0017_B03.b :
LNG01_0064_G07.b :
MLN01_0078_E03.b :
TES01_0004_D01.b :
SKNB1_0070_D11.b :
ITT01_0031_F09.b :
ITT01_0071_A12.b :
CLNT1_0019_C11.b :
PBL01_0062_D10.b :
THY01_0125_F10.b :
PBL01_0019_H05.b :
OVRM1_0158_G06.b :
OVRM1_0083_H03.b :
OVRM1_0124_D12.b :
OVRM1_0088_D10.b :
UTR01_0014_C10.b :
UTR01_0010_A11.b :
SPL01_0034_A03.b :
OVR01_0100_C10.b :
UTR01_0079_F12.b :
OVR01_0060_A09.b :
OVR01_0059_F09.b :
UTR01_0006_F05.b :
SMG01_0019_E10.b :
UTR01_0041_C08.b :
THY01_0043_H01.b :
PBL01_0010_B10.b :
OVR01_0056_C07.b :
OVR01_0042_D08.b :
SPL01_0099_E11.b :
SPL01_0082_G06.b :
HTMT1_0119_G08.b :
SMG01_0028_H06.b :
UTR01_0005_F05.b :
SMG01_0097_A01.b :
BMWN1_0079_G03.b :
LNG01_0048_A03.b :
SMG01_0081_A05.b :
LNG01_0107_F01.b :
SPL01_0100_F11.b :
OVR01_0067_C10.b :
SPL01_0069_D04.b :
SPL01_0033_B12.b :
SMG01_0059_E05.b :
TCH01_0019_G04.b :
MLN01_0013_G06.b :
UTR01_0096_E01.b :
UTR01_0088_E05.b :
LNG01_0021_E11.b :
LNG01_0010_G12.b :
LNG01_0030_B06.b :
UTR01_0075_F04.b :
MLN01_0054_E07.b :
PBL01_0039_B10.b :
LVR01_0019_D01.b :
OVR01_0006_F12.b : gtggc
THY01_0091_G03.b :
SPL01_0006_D06.b :
PBL01_0020_F12.b :
LVR01_0079_A10.b :
SMG01_0038_G04.b :
OVRT1_0121_C04.b :
SKNB1_0051_A06.b :
CLNT1_0027_H10.b :
SMG01_0038_G08.b :
THY01_0065_B10.b :
ADR01_0034_G11.b :
TCH01_0016_E08.b :
SPL01_0047_G10.b :
SMG01_0016_C01.b :
SPL01_0047_E08.b :
MLN01_0008_F08.b :
CLNT1_0118_E03.b :
OVR01_0090_H02.b :
UTR01_0048_A07.b :
THY01_0057_B08.b :
MLN01_0062_E04.b :
OVR01_0019_G12.b :
TCH01_0065_D07.b :
CLNT1_0091_F11.b :
SPL01_0091_G08.b :
TCH01_0050_D12.b :
SPL01_0035_E10.b :
MLN01_0091_A07.b :
UTR01_0053_G01.b :
TCH01_0044_E06.b :
MLN01_0035_F04.b :
SKNB1_0030_F12.b :
ITT01_0022_D05.b :
SPL01_0090_B01.b :
THY01_0090_D07.b :
ITT01_0022_E07.b :
SKNB1_0072_B05.b :
ITT01_0058_H10.b :
THY01_0093_F08.b :
MLN01_0039_D11.b :
LVR01_0010_A07.b :
ITT01_0063_E03.b :
SPL01_0095_C05.b :
PBL01_0077_D08.b :
CLNT1_0071_B12.b :
OVR01_0097_D02.b :
ITT01_0017_H11.b :
SPL01_0032_B12.b :
TCH01_0079_A05.b :
ITT01_0063_F02.b :
LNG01_0064_E05.b :
ITT01_0038_H10.b :
ITT01_0011_C12.b :
ITT01_0011_C02.b :
ITT01_0023_A10.b :
ITT01_0078_F03.b :
ILNT1_0012_F05.b :
LNG01_0073_F01.b :
SPLT1_0050_A09.b :
SMG01_0056_E01.b :
ILNT1_0011_A04.b :
SPLT1_0034_G01.b :
UTR01_0008_D09.b :
SMG01_0070_H01.b :
UTR01_0033_F11.b :
OVR01_0065_G11.b :
SMG01_0027_A02.b :
SMG01_0097_D01.b :
ILNT1_0059_H10.b :
SPLT1_0094_B12.b :
BMWN1_0029_C11.b :
ILNT1_0052_C01.b :
OVR01_0090_B05.b :
ITT01_0025_A01.b :
SMG01_0097_H03.b :
ITT01_0102_F01.b :
SPLT1_0057_E04.b :
PTG01_0046_C02.b :
CLNT1_0070_D12.b :
ILNT1_0045_A01.b :
TCH01_0073_G10.b :
SPLT1_0086_G05.b :
ITT01_0061_B07.b :
SMG01_0061_F01.b :
CBLT1_0030_E06.b :
LNG01_0088_G04.b :
SMG01_0079_G04.b :
OVR01_0064_A08.b :
LNG01_0099_H03.b :
MLN01_0058_F11.b :
LNG01_0017_B04.b :
MLN01_0027_G08.b :
LNG01_0087_B08.b :
LNG01_0083_H08.b :
LNG01_0033_H01.b :
ITT01_0027_H05.b :
ILNT1_0081_H02.b :
ITT01_0039_C05.b :
ILNT1_0093_F09.b :
LNG01_0056_F01.b :
LNG01_0088_B06.b :
ILNT1_0088_B08.b :
UTR01_0046_F06.b :
OVR01_0005_H08.b :
LNG01_0088_G03.b :
SPLT1_0074_B10.b :
LNG01_0002_F09.b :
TCH01_0097_A12.b :
TCH01_0025_H11.b :
TCH01_0097_F12.b :
ILNT1_0014_B07.b :
ILNT1_0090_A10.b :
ILNT1_0100_F04.b :
SKNB1_0042_B01.b :
CLNT1_0045_C11.b :
ITT01_0100_E03.b :
OVR01_0061_B03.b :
PBL01_0096_F06.b :
ILNT1_0033_C06.b :
ILNT1_0049_B04.b :
SKNB1_0098_B05.b :
CLNT1_0053_G12.b :
ITT01_0011_H11.b :
ADR01_0100_D11.b :
ITT01_0044_G08.b :
MLN01_0029_D08.b :
SMG01_0010_B01.b :
OVR01_0084_G10.b :
SMG01_0053_B06.b :
PBL01_0004_G01.b :
THY01_0121_F07.b :
SMG01_0098_B10.b :
THY01_0111_A09.b :
THY01_0108_H09.b :
OVR01_0080_G10.b :
SMG01_0054_B11.b :
THY01_0111_H03.b :
THY01_0104_B08.b :
OVR01_0094_E07.b :
THY01_0120_D10.b :
SMG01_0098_A04.b :
THY01_0108_A10.b :
THY01_0126_E07.b :
TES01_0038_H05.b :
LVRM1_0193_D05.b : agaagtccacacgggggtccnancc
SMG01_0057_B04.b :
LVRM1_0086_H03.b :
OVR01_0022_E04.b :
SMG01_0022_F07.b :
LVR01_0081_A05.b :
SMG01_0067_C06.b :
OVR01_0084_E01.b :
OVR01_0076_F10.b :
PBL01_0004_F06.b :
PBL01_0007_G12.b :
SMG01_0002_F09.b :
OVR01_0076_B03.b :
PBL01_0004_D11.b :
LVRM1_0066_H06.b :
OVR01_0082_G02.b :
OVRM1_0154_E05.b :
OVR01_0080_E01.b :
OVRM1_0198_A07.b :
SMG01_0093_C09.b :
PBL01_0003_C12.b :
OVRM1_0179_A01.b :
OVRM1_0170_H02.b :
LVRM1_0152_G02.b :
OVRM1_0169_D06.b :
OVRM1_0169_G06.b :
OVRM1_0014_E06.b :
OVRM1_0187_F12.b :
OVRM1_0058_H07.b :
LNG01_0042_G10.b :
OVRM1_0208_D11.b :
OVR01_0070_H09.b :
OVR01_0100_B10.b :
OVR01_0101_C01.b :
PTG01_0102_H04.b :
SPL01_0023_H07.b :
OVR01_0102_B12.b :
UTR01_0014_F11.b :
OVRM1_0071_C10.b :
THY01_0011_A03.b :
OVRM1_0022_C11.b :
ADR01_0015_F04.b :
SMG01_0016_D08.b :
SPL01_0028_C12.b :
UTR01_0014_E10.b :
SMG01_0076_B06.b :
SPL01_0016_H02.b :
LVR01_0038_F10.b :
SMG01_0069_G01.b :
THY01_0070_B02.b :
THY01_0013_A12.b :
SMG01_0039_G11.b :
SPL01_0014_F11.b :
SMG01_0030_H12.b :
SPL01_0021_G09.b :
SPL01_0024_E03.b :
UTR01_0025_C12.b : ggggggacttatxxxxxxxxxxxxxxxxxx
SPL01_0025_H06.b :
THY01_0050_F02.b :
SMG01_0005_A04.b :
SPL01_0014_F02.b :
OVR01_0070_F06.b :
SPL01_0020_F06.b :
TCH01_0045_E08.b :
THY01_0019_F11.b :
UTR01_0008_E11.b :
SPL01_0028_B02.b :
SPL01_0027_C07.b :
OVR01_0096_B11.b :
UTR01_0007_C02.b :
UTR01_0028_D01.b :
UTR01_0026_F10.b :
PBL01_0022_C05.b :
SPL01_0060_D07.b :
OVR01_0052_C12.b :
UTR01_0009_G04.b :
OVR01_0101_F05.b :
UTR01_0025_B02.b :
SMG01_0059_F12.b :
SPL01_0012_G07.b :
OVR01_0103_D07.b :
OVR01_0059_H08.b :
OVR01_0034_E06.b :
OVR01_0027_F05.b :
UTR01_0021_H02.b :
PBL01_0036_A12.b :
SPL01_0098_G12.b :
UTR01_0040_G05.b :
UTR01_0103_B12.b :
TES01_0112_D12.b :
UTR01_0039_E01.b :
TES01_0032_C08.b :
UTR01_0042_E06.b :
SMG01_0036_H05.b :
OVR01_0064_H09.b :
CLNT1_0068_B12.b :
THY01_0014_F09.b :
SPL01_0103_D11.b :
UTR01_0017_F09.b :
SMG01_0042_B11.b :
ADR01_0035_F05.b :
SMG01_0013_H07.b :
UTR01_0019_E04.b :
SMG01_0013_D11.b :
SMG01_0077_F12.b :
UTR01_0039_F04.b :
OVR01_0098_A09.b :
UTR01_0003_A06.b :
UTR01_0016_E06.b :
SMG01_0014_D07.b :
SMG01_0007_B05.b :
SMG01_0016_H01.b :
PBL01_0053_D06.b :
SPL01_0070_F01.b :
OVR01_0066_D07.b :
SMG01_0021_B12.b :
PBL01_0036_A01.b :
SMG01_0004_A05.b :
THY01_0026_G11.b :
CLNT1_0119_H09.b :
SMG01_0034_E01.b :
UTR01_0032_A07.b :
PBL01_0020_B12.b :
OVR01_0062_H10.b :
SPL01_0098_H12.b :
CLNT1_0136_H06.b :
PBL01_0018_E02.b :
THY01_0044_B11.b :
LNG01_0063_A05.b :
MLN01_0017_D01.b :
SPL01_0048_E08.b :
PBL01_0039_E11.b :
OVR01_0047_E08.b :
ITT01_0041_B07.b :
UTR01_0035_E01.b :
CLNT1_0101_F07.b :
SMG01_0078_D08.b :
SMG01_0003_C11.b :
SMG01_0045_E11.b :
SMG01_0001_F11.b :
SMG01_0070_H09.b :
UTR01_0037_E02.b :
OVR01_0065_D09.b :
SMG01_0082_H09.b :
SMG01_0046_F08.b :
SMG01_0072_D12.b :
OVR01_0079_D02.b :
SMG01_0090_C05.b :
ADR01_0007_C01.b :
THY01_0047_H01.b :
SMG01_0083_H11.b :
CLNT1_0106_F02.b :
SMG01_0050_G11.b :
THY01_0064_H06.b :
CLNT1_0053_A03.b :
OVR01_0042_A10.b : ag
LNG01_0035_A09.b :
LNG01_0074_F04.b :
UTR01_0038_A06.b :
SMG01_0071_C11.b :
PTG01_0034_E12.b :
SMG01_0045_G11.b :
TES01_0038_A06.b :
TCH01_0032_B11.b :
ADR01_0022_E04.b :
OVRT1_0079_H01.b :
SMG01_0093_E10.b :
OVR01_0068_D04.b :
OVR01_0061_F07.b :
SPL01_0071_E09.b :
MLN01_0025_G07.b :
TCH01_0018_H10.b :
SMG01_0017_H01.b :
SMG01_0083_E10.b : nnnnnnnnnnn
LNG01_0008_H05.b :
CLNT1_0110_B07.b :
LNG01_0004_D04.b :
OVR01_0098_A04.b :
LNG01_0029_C06.b :
OVR01_0060_C06.b :
SMG01_0081_G02.b :
SPL01_0095_G03.b :
UTR01_0088_H12.b :
OVR01_0094_G11.b :
THY01_0201_F05.b :
MLN01_0083_G09.b :
SMG01_0015_H07.b :
LNG01_0030_E09.b :
UTR01_0099_A12.b :
SPL01_0080_D09.b :
THY01_0018_B07.b : ccccnnnnnnnnnnnnnnnnnnnnnnnannnnnnn
CLNT1_0119_H04.b :
LNG01_0030_D08.b :
UTR01_0072_F01.b :
SMG01_0085_F10.b :
SPL01_0058_A04.b :
OVR01_0089_E06.b :
SMG01_0044_H12.b :
SMG01_0056_H03.b :
SPL01_0037_A01.b :
LNG01_0012_F01.b :
LNG01_0033_H11.b :
TCH01_0054_E06.b :
UTR01_0036_B05.b :
OVR01_0022_B04.b :
SPL01_0041_F06.b :
OVR01_0032_E10.b :
OVR01_0057_C01.b :
SMG01_0080_E12.b :
SKNB1_0033_B02.b :
UTR01_0076_C11.b :
LNG01_0086_E06.b : nnnngggccttagnnnnnggattggaaatga
UTR01_0059_E02.b :
SPL01_0083_G05.b :
SMG01_0048_G09.b :
SMG01_0036_C04.b :
UTR01_0083_G11.b :
UTR01_0083_G12.b :
ITT01_0002_E01.b :
SPL01_0075_H01.b :
OVR01_0045_E01.b :
LVR01_0031_G11.b :
SPL01_0076_A07.b :
SMG01_0078_C08.b :
SKNB1_0056_H03.b :
CLNT1_0061_A09.b :
CLNT1_0118_H06.b :
CLNT1_0129_F03.b :
PBL01_0013_D06.b :
OVR01_0046_F12.b :
PBL01_0072_E10.b :
MLN01_0039_A08.b : nngg
LNG01_0029_G11.b :
OVR01_0038_C02.b :
TES01_0017_F04.b :
LNG01_0020_B11.b :
THY01_0094_F05.b :
OVRT1_0134_G01.b :
MLN01_0006_B07.b :
PTG01_0014_C08.b :
TES01_0043_G10.b :
MLN01_0011_B07.b :
ITT01_0021_B09.b :
ITT01_0038_C02.b :
PBL01_0057_C05.b :
OVR01_0044_A08.b :
ITT01_0101_B10.b :
ITT01_0061_C04.b :
PBL01_0012_B08.b :
PBL01_0053_H09.b :
OVR01_0007_D11.b :
LVR01_0104_C01.b :
OVR01_0033_F11.b :
OVR01_0039_D11.b :
PBL01_0012_C03.b :
ITT01_0008_C03.b :
SMG01_0077_C03.b :
PBL01_0032_D07.b :
OVR01_0034_G05.b :
ITT01_0061_F06.b :
ADR01_0044_B07.b :
SMG01_0053_F04.b :
PBL01_0024_A02.b :
OVRT1_0064_B08.b :
SMG01_0082_G04.b :
SMG01_0027_A06.b :
OVR01_0033_B06.b :
UTR01_0099_C01.b :
CLNT1_0057_H02.b :
ITT01_0049_F12.b :
SMG01_0022_A09.b :
ADR01_0069_H01.b :
SMG01_0058_F04.b :
TCH01_0057_D08.b :
PBL01_0056_C01.b :
ITT01_0036_F02.b :
ITT01_0102_F04.b :
ADR01_0066_B03.b :
PBL01_0070_F02.b :
PBL01_0054_H08.b :
PBL01_0053_D07.b :
ITT01_0087_G01.b :
SMG01_0084_H09.b :
SMG01_0074_D08.b :
ITT01_0038_G02.b :
ITT01_0032_B10.b :
ITT01_0088_H02.b :
THY01_0072_H09.b :
UTR01_0079_H11.b :
ITT01_0096_G07.b :
PBL01_0059_B11.b :
SMG01_0073_B04.b :
SMG01_0035_B02.b :
UTR01_0066_D04.b :
OVRT1_0065_E01.b :
CLNT1_0057_F04.b :
OVRT1_0125_F04.b :
SMG01_0029_B04.b :
PBL01_0010_A10.b :
THY01_0202_C03.b :
OVRT1_0004_E09.b :
OVRT1_0011_F07.b :
OVRT1_0078_C01.b :
CLNT1_0038_G08.b :
CLNT1_0044_A11.b :
CLNT1_0023_H01.b :
SMG01_0006_G07.b :
SMG01_0043_G11.b :
SMG01_0087_H04.b :
CLNT1_0039_D04.b :
LNG01_0085_H09.b :
SMG01_0097_E06.b :
LNG01_0071_D08.b :
SMG01_0001_E04.b :
SMG01_0013_D08.b :
ITT01_0101_E05.b :
SMG01_0019_F04.b :
ADR01_0101_C06.b :
MLN01_0006_C06.b :
MLN01_0027_H07.b :
MLN01_0063_F10.b :
CLNT1_0035_B10.b :
SMG01_0019_E07.b :
ITT01_0069_G09.b :
ADR01_0033_C10.b :
ADR01_0097_H09.b :
ITT01_0034_E11.b :
ITT01_0071_D11.b :
SPL01_0050_G08.b : nnngggtttttccnnnggcttggaatataac
LNG01_0091_A07.b :
LNG01_0080_H02.b :
MLN01_0076_D06.b :
CLNT1_0151_F08.b :
SMG01_0047_D03.b :
ITT01_0050_E08.b :
THY01_0071_H11.b :
OVRT1_0079_F03.b :
SPL01_0055_A08.b :
TCH01_0068_H07.b :
MLN01_0059_H08.b :
SMG01_0018_F03.b :
LNG01_0065_H11.b :
MLN01_0070_G02.b :
OVR01_0085_A02.b :
OVRT1_0004_A12.b :
SMG01_0043_G09.b :
SMG01_0075_F06.b :
CLNT1_0062_A09.b :
MLN01_0099_D02.b :
MLN01_0079_H08.b :
MLN01_0074_A10.b :
ITT01_0011_H07.b :
PBL01_0059_A07.b :
LNG01_0110_B01.b :
LNG01_0062_E08.b :
OVR01_0051_A12.b :
MLN01_0101_D03.b :
SMG01_0036_D03.b :
PBL01_0052_B06.b :
PBL01_0058_D03.b :
OVR01_0072_B02.b :
MLN01_0066_E10.b :
OVRT1_0094_D12.b :
CLNT1_0046_E05.b :
THY01_0080_G06.b :
LNG01_0015_F04.b :
THY01_0074_G04.b :
MLN01_0097_H11.b :
MLN01_0066_D05.b :
MLN01_0058_D04.b :
SMG01_0039_C06.b :
LNG01_0036_G08.b :
SPL01_0002_D01.b :
MLN01_0044_C09.b :
LNG01_0078_H09.b :
CLNT1_0036_G12.b :
UTR01_0050_D07.b :
SPL01_0002_A06.b :
TCH01_0082_A02.b :
THY01_0093_F11.b : tg
LNG01_0041_G03.b :
LNG01_0067_H04.b :
MLN01_0013_D08.b :
MLN01_0056_E08.b :
OVR01_0033_A12.b :
MLN01_0039_C06.b :
MLN01_0098_F10.b :
MLN01_0077_B06.b :
MLN01_0032_A04.b :
UTR01_0079_A01.b :
UTR01_0087_B02.b :
MLN01_0033_H09.b :
TCH01_0030_H12.b :
TCH01_0004_F05.b :
SMG01_0082_F11.b :
LVR01_0046_D02.b :
MLN01_0040_D03.b :
MLN01_0042_D02.b :
UTR01_0105_B03.b :
MLN01_0063_E01.b :
MLN01_0049_E09.b :
UTR01_0093_G03.b :
TCH01_0017_C12.b :
SMG01_0063_A12.b :
PBL01_0055_F03.b :
OVR01_0049_A02.b :
SPL01_0056_F01.b :
LNG01_0070_G02.b :
TCH01_0056_C03.b :
PBL01_0070_F03.b :
OVR01_0056_D03.b :
LNG01_0085_E04.b :
ITT01_0010_G06.b :
SPL01_0090_D10.b :
SPL01_0105_F06.b :
UTR01_0107_C02.b :
UTR01_0049_A12.b :
THY01_0032_C10.b :
SPL01_0096_B07.b :
OVR01_0064_E01.b :
MLN01_0026_F08.b :
MLN01_0064_C01.b :
MLN01_0065_D06.b :
OVR01_0003_A11.b : ggtga
LNG01_0029_D05.b :
OVR01_0021_F10.b :
OVR01_0026_F09.b :
LNG01_0020_F08.b :
UTR01_0100_E03.b :
LNG01_0104_H01.b :
MLN01_0074_F01.b :
TCH01_0079_A07.b :
LNG01_0065_C10.b :
THY01_0033_F09.b :
OVR01_0059_F04.b :
CLNT1_0001_C06.b :
SPL01_0039_D03.b :
UTR01_0105_E10.b :
TCH01_0031_G10.b :
CLNT1_0071_C08.b :
ITT01_0077_A09.b :
OVR01_0019_D10.b :
CLNT1_0127_C02.b :
LNG01_0011_F10.b :
ADR01_0067_B08.b :
TCH01_0032_E03.b :
LNG01_0027_D09.b :
OVR01_0047_F04.b :
LNG01_0065_G07.b :
SPL01_0047_B02.b :
SPL01_0105_D03.b :
MLN01_0044_G07.b :
SPL01_0105_F05.b :
UTR01_0102_A11.b :
LNG01_0066_E10.b :
MLN01_0075_B01.b :
OVR01_0058_G07.b :
LNG01_0026_F01.b :
LNG01_0018_H07.b :
UTR01_0085_E03.b :
THY01_0030_D09.b :
SPL01_0054_G06.b :
TCH01_0051_F07.b :
UTR01_0095_G06.b :
UTR01_0104_D10.b :
ITT01_0093_H05.b :
BKFL1_0106_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0006_B06.b :
LNG01_0010_G09.b :
LNG01_0106_H02.b :
UTR01_0096_H05.b :
SPL01_0056_H06.b :
LVR01_0005_E12.b : cxx
LNG01_0005_A12.b :
UTR01_0074_A06.b :
SPL01_0057_G08.b :
THY01_0022_F03.b :
CLNT1_0131_D07.b :
TES01_0056_A07.b :
LNG01_0018_D10.b :
LNG01_0001_G07.b :
MLN01_0065_G11.b :
THY01_0086_F02.b : tttxxxxxxxxxxxxxxxx
THY01_0062_G07.b :
SPL01_0043_H06.b :
CLNT1_0095_B11.b :
OVR01_0011_G08.b : aagacat
OVR01_0029_E04.b :
ADR01_0031_C03.b :
OVR01_0030_D04.b :
LNG01_0101_D11.b :
MLN01_0086_E07.b :
MLN01_0011_G07.b :
MLN01_0073_F06.b :
OVR01_0046_A04.b :
MLN01_0063_C12.b :
MLN01_0021_F06.b :
SMG01_0001_D01.b :
AMP01_0009_F08.b : nnaaacgtatcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_F09.b :
UTR01_0055_H01.b :
SPL01_0081_F11.b :
SPL01_0019_H02.b :
MLN01_0076_E03.b :
LNG01_0009_A10.b :
LNG01_0044_D02.b :
LNG01_0045_C04.b :
THY01_0084_E10.b :
LNG01_0103_C09.b :
SPL01_0070_E04.b :
ITT01_0081_A01.b :
UTR01_0093_F09.b :
MLN01_0043_B12.b :
TCH01_0003_D03.b :
UTR01_0105_A08.b :
MLN01_0096_D01.b :
ITT01_0045_G08.b :
LNG01_0064_A07.b :
OVR01_0012_H01.b : ggaaaatt
SPL01_0081_B01.b : nntttgc
THY01_0092_E07.b : ggg
OVR01_0003_D08.b : gggaaatt
LNG01_0057_B10.b :
ITT01_0009_E12.b :
SPL01_0067_D02.b :
MLN01_0045_F12.b :
THY01_0093_H08.b : atattttttgacttagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0084_G10.b :
MLN01_0055_A07.b :
ITT01_0047_E06.b :
PBL01_0014_D03.b :
MLN01_0039_G06.b :
TCH01_0035_G07.b :
CLNT1_0051_C10.b :
OVR01_0017_A01.b :
THY01_0029_D06.b :
TCH01_0031_G08.b :
ITT01_0069_F03.b :
TCH01_0001_B03.b :
ITT01_0060_F01.b :
PBL01_0079_F12.b :
OVR01_0011_C05.b : ccaaacgt
MLN01_0055_C06.b :
CLNT1_0100_G11.b :
ITT01_0096_D09.b :
ITT01_0030_D08.b :
MLN01_0103_H03.b :
ITT01_0079_C12.b :
UTR01_0082_F01.b :
ITT01_0044_G09.b :
ITT01_0015_H10.b :
ITT01_0094_H03.b :
ADR01_0085_D07.b :
ITT01_0041_A07.b :
MLN01_0043_E10.b :
ITT01_0029_A01.b :
ITT01_0072_C04.b :
CLNT1_0146_G12.b :
TCH01_0030_C02.b :
MLN01_0040_G05.b :
OVRT1_0046_H02.b :
ADR01_0034_F06.b :
SPL01_0064_G08.b :
SPL01_0093_B09.b :
TCH01_0037_E04.b :
MLN01_0031_F10.b :
SPL01_0068_E03.b :
ITT01_0039_F08.b :
ITT01_0062_F02.b :
UTR01_0063_A12.b :
CLNT1_0094_H03.b :
OVR01_0058_H02.b :
CLNT1_0045_C04.b :
SPL01_0098_A06.b :
LNG01_0071_B04.b :
ITT01_0031_E06.b :
LNG01_0094_H08.b :
TCH01_0030_C11.b :
ITT01_0032_H10.b :
ITT01_0052_A04.b :
PBL01_0056_B06.b :
PBL01_0096_D07.b :
PBL01_0077_F08.b :
PBL01_0035_A04.b :
TCH01_0046_A03.b :
LNG01_0099_H01.b :
OVR01_0093_G05.b :
TCH01_0008_D01.b :
TCH01_0077_A09.b :
SPL01_0092_D07.b :
PBL01_0071_H01.b :
OVR01_0003_F02.b : attg
UTR01_0063_B04.b :
OVR01_0095_H02.b :
ADR01_0078_F01.b :
ITT01_0036_D04.b :
MLN01_0052_G07.b :
SPL01_0078_F03.b :
SPL01_0093_G04.b :
ITT01_0005_F06.b :
MLN01_0023_F06.b :
OVR01_0020_E02.b :
UTR01_0107_E08.b :
THY01_0099_A04.b :
PBL01_0098_G01.b :
MLN01_0100_F02.b :
MLN01_0104_B11.b :
SPL01_0036_F01.b :
OVR01_0093_A02.b :
TES01_0055_A01.b :
UTR01_0099_B01.b :
MLN01_0021_H05.b :
SPL01_0049_H05.b :
PST01_0056_D10.b :
ITT01_0003_A07.b :
ITT01_0030_E07.b :
MLN01_0033_A06.b :
ITT01_0090_A12.b :
TCH01_0026_F09.b :
LNG01_0012_A02.b :
PBL01_0072_H06.b :
UTR01_0090_C01.b :
MLN01_0041_C09.b :
LNG01_0067_A09.b :
SKNB1_0045_A08.b :
OVR01_0009_E08.b : cagaactt
PBL01_0097_C11.b :
ITT01_0006_E05.b :
ITT01_0019_F10.b :
OVR01_0011_B05.b : caaaata
TCH01_0067_B09.b :
ITT01_0060_B12.b :
ITT01_0009_G06.b :
TCH01_0049_B02.b :
PBL01_0078_D06.b :
ITT01_0008_C11.b :
ITT01_0082_G01.b :
PBL01_0055_C09.b :
ITT01_0060_D06.b :
PBL01_0085_C02.b :
ITT01_0010_H10.b :
ITT01_0019_G10.b :
ADR01_0078_C09.b :
ADR01_0030_B11.b :
ITT01_0020_D04.b :
ADR01_0075_B06.b :
ITT01_0090_A04.b :
PBL01_0084_G04.b :
PBL01_0063_D02.b :
ITT01_0020_A12.b :
ITT01_0080_B08.b :
ITT01_0095_D11.b :
PBL01_0066_E07.b :
PBL01_0071_H04.b :
UTR01_0088_B03.b :
PBL01_0078_C11.b :
PBL01_0072_C11.b :
ITT01_0052_H11.b :
TCH01_0032_A07.b :
MLN01_0096_E07.b :
MLN01_0077_E12.b :
LNG01_0065_C06.b :
TCH01_0085_D08.b :
UTR01_0096_E03.b :
MLN01_0041_E06.b :
TCH01_0034_G04.b :
TCH01_0078_A09.b :
MLN01_0040_G11.b :
TCH01_0013_B05.b :
TCH01_0009_D09.b :
TCH01_0080_B02.b :
MLN01_0045_A10.b :
TCH01_0047_E12.b :
TCH01_0036_B03.b :
TCH01_0047_C10.b :
TCH01_0047_D09.b :
MLN01_0074_D09.b :
BMWN1_0027_G09.b :
TES01_0107_D02.b :
TES01_0023_G08.b :
SMG01_0091_E11.b :
BMWN1_0077_B07.b :
SKNB1_0033_D10.b :
SKNB1_0005_A08.b :
SKNB1_0096_H02.b :
SMG01_0014_C06.b :
TES01_0065_H08.b :
SKNB1_0083_B06.b :
CLNT1_0035_D09.b :
TES01_0060_H02.b :
PBL01_0102_G06.b :
SPL01_0087_C10.b :
ADR01_0032_H06.b :
SKNB1_0044_G06.b :
SKNB1_0056_D02.b :
CLNT1_0097_E08.b :
TCH01_0073_H06.b :
CLNT1_0095_C06.b :
SKNB1_0011_H01.b :
TES01_0047_D10.b :
PST01_0074_E09.b :
SKNB1_0042_E08.b :
SKNB1_0007_H09.b :
MLN01_0025_C09.b :
TES01_0007_H06.b :
PST01_0088_A03.b :
TES01_0039_B01.b :
TES01_0036_F10.b :
SKNB1_0050_C07.b :
SKNB1_0030_E03.b :
SMG01_0003_A11.b :
TES01_0069_D02.b :
UTR01_0013_C02.b :
SMG01_0017_C12.b :
SKNB1_0065_F05.b :
SKNB1_0040_G12.b :
OVR01_0090_B09.b :
SMG01_0067_D10.b :
SKNB1_0059_C07.b :
SKNB1_0020_D01.b :
SKNB1_0081_C06.b :
SKNB1_0019_A07.b :
PST01_0090_D05.b :
SKNB1_0011_G08.b :
PCT01_0010_C04.b :
SKNB1_0091_B03.b :
SKNB1_0074_B01.b :
CLNT1_0081_A10.b :
CLNT1_0077_B04.b :
UTR01_0085_E01.b :
SKNB1_0033_G06.b :
UTR01_0059_H08.b :
LNG01_0043_B12.b :
PST01_0044_E02.b :
UTR01_0061_D06.b :
SKNB1_0065_E11.b :
ITT01_0047_A03.b :
SKNB1_0014_B07.b :
PST01_0096_H06.b :
SKNB1_0039_C08.b :
PST01_0059_D09.b :
SKNB1_0009_C04.b :
THY01_0066_G10.b :
MLN01_0053_E02.b :
PST01_0007_B01.b :
PST01_0064_C07.b :
SKNB1_0018_D09.b :
SKNB1_0072_B08.b :
PST01_0011_F10.b :
PST01_0034_A11.b :
SKNB1_0038_A02.b :
PST01_0058_F09.b :
PBL01_0065_H10.b :
ITT01_0012_H07.b :
ITT01_0067_G11.b :
TCH01_0010_G11.b :
TCH01_0038_H01.b :
OVRM1_0117_B11.b :
SMG01_0049_E05.b :
ITT01_0001_A03.b :
PBL01_0099_C10.b :
TCH01_0083_H07.b :
TCH01_0014_H06.b :
TES01_0025_A10.b :
TES01_0046_H09.b :
TES01_0051_H01.b :
TES01_0029_C06.b :
LNG01_0026_E05.b : attttttgggaac
CLNT1_0080_A01.b :
LNG01_0001_E11.b : ccxxxxxxxxxxxxxxx
TCH01_0074_A03.b :
PST01_0055_A06.b :
TES01_0080_G05.b :
TES01_0038_G10.b :
PCT01_0015_H02.b :
TES01_0057_A11.b :
SKNB1_0081_C04.b :
SKNB1_0019_E09.b :
PST01_0035_H08.b :
SKNB1_0092_E07.b :
ITT01_0060_D11.b :
SKNB1_0046_F02.b :
SKNB1_0021_C03.b :
ILNT1_0075_F01.b :
SKNB1_0085_E05.b :
TES01_0039_A02.b :
SKNB1_0048_F05.b :
PST01_0028_A04.b :
PST01_0012_G11.b :
SKNB1_0063_C11.b :
MLN01_0020_D08.b : ngccaagann
SKNB1_0042_F02.b :
PST01_0003_D05.b :
SKNB1_0078_F12.b :
PCT01_0020_E07.b :
BMWN1_0087_A02.b :
UTR01_0013_C06.b :
CLNT1_0149_H05.b :
UTR01_0062_H11.b :
SKNB1_0089_G09.b :
SKNB1_0080_F10.b :
THY01_0118_C01.b :
MLN01_0088_D11.b :
TCH01_0036_H04.b :
OVR01_0067_H08.b :
LNG01_0064_F10.b :
TCH01_0048_E08.b :
TCH01_0030_C12.b :
TCH01_0016_C09.b :
ITT01_0009_D03.b :
OVRM1_0100_G10.b :
SKNB1_0019_F05.b :
PBL01_0041_F11.b :
MLN01_0020_B11.b :
MLN01_0023_C04.b :
ITT01_0027_C03.b :
LNG01_0090_A01.b :
SPL01_0098_B07.b :
OVRM1_0157_G11.b :
ADR01_0084_G09.b :
SMG01_0068_B08.b :
OVR01_0047_C07.b :
ITT01_0040_H04.b :
SPL01_0093_F09.b :
SKNB1_0058_A08.b :
SPLT1_0031_F04.b :
SKNB1_0078_H10.b :
SKNB1_0022_H06.b :
ILNT1_0036_B06.b :
SPLT1_0039_A06.b :
ILNT1_0098_F05.b :
ILNT1_0048_D11.b :
20110601C-000678 : CTCCGGGTGTGCTGACCCCTGCGATTTCCCCAAATGTGGGAAACTCGACTGCATAATTTG
---------+---------+---------+---------+---------+---------+ 129
ITT01_0098_C11.b : ctccgggtgtgctgacccctgcgatttccccaaatgtgggaaactcgactgcataatttg
SPL01_0025_G12.b : ttaggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0003_A07.b : nnnnttttaannnnnnaacgtttcnaantgagacaacagcg
LNG01_0002_D05.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0062_F07.b : nnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0056_G08.b : gctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_G12.b : ggatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_H05.b : atttgggtggactactagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_A04.b : nnttaccttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_A07.b : nnntttgcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0073_A06.b :
TES01_0026_D02.b :
OVR01_0027_G04.b : ggaccttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_H04.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_A09.b : gggcatttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0017_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_G10.b : nnttcgttttttnttngggataaagcagcggn
OVR01_0031_H08.b : caagggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0098_C05.b : nnnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0037_F10.b : ggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_E11.b : cagttgtcxxxxxxxxxxxxxxxxxxxx
SPL01_0017_E11.b : tgggttgcactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0007_E09.b : actttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_E11.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_F06.b : gttttgggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_A05.b : ttttnggcttggacttgacxxxxxxxxxxxxxxxxxxxxx
CBLT1_0074_C07.b : ttttggacggtagaggccgtaxxxxx
MLN01_0005_H11.b : gggggttgggcatggtacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_C10.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_D04.b : nnnggtgaagcxxxxxxxxxx
SMG01_0024_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
ITT01_0009_B08.b : nnggatgaacaxxxxxxxxx
MLN01_0054_B09.b : nnggattggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0022_H12.b : ntccgtaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0067_G03.b : nnnggatgaacaxxxxxxxxx
SPL01_0084_G07.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_F06.b : gcttttagggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0084_A09.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0085_E06.b : nnnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0071_A01.b : ttttggcaggtagaggccgtxxxxx
CBLT1_0006_G06.b : tttttggcaggtagacgccgtagtatt
LNG01_0064_C08.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxx
SPLT1_0026_G12.b : nttttttcgacggagacgxxxxxxxxxx
SMG01_0031_F07.b : nncccgattttntnnggggtcaaxxxxxx
OVR01_0037_C12.b : aggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0041_G05.b : gagggttttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_G08.b : ngggtaggactatgacagtttgtacxxxxxxxxxxxxxxxx
OVR01_0012_A09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0017_D05.b :
OVR01_0075_G09.b : agggacctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0042_F01.b : nnggtggctgtgacttgacxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_D09.b : nagttgtcxxxxxxxxxxxxxxxxx
OVRM1_0070_F12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_C07.b : nnggcggtcttntnnggggtaaagc
OVR01_0097_B06.b : taggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0111_B06.b :
CLNT1_0116_E08.b : nnnccttctgcgnaggagtgxxxxxxxxx
TCH01_0053_B03.b : nnnnnggataggactatgacagtttgtacxxxxxxxxxxxxxx
ILNT1_0077_A09.b : nngggcaggtacgacgcagtagta
SPL01_0058_C10.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0007_F06.b : ggggttgctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxx
LNG01_0033_F10.b : tttttgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_C01.b : tgggggcttnnatagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_H03.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0050_E05.b :
OVR01_0047_G10.b : aggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0008_G12.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_C05.b : ntttactcagctgtacgatgxxxxxxxxxxxxx
ITT01_0058_D08.b : nnnggagaaacaxxxxxxxxx
LNG01_0001_F11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0086_F11.b : ngcaatttnnnngggagtaagcagcggtc
SMG01_0064_B03.b : nnccgttatnnnnnggagtxxxxxxx
ITT01_0060_A02.b : naagtgaaacaxxxxxxx
LNG01_0081_A03.b : nnnngggctgtacttgacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0029_A12.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0088_C02.b : nnnggcgacggtagacgxxxxxxxx
MLN01_0094_A04.b : nnnnggctaggctatgacagtttgtacxxxxxxxxxxxxxxx
MLN01_0061_A03.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0019_A08.b : ggcatttggntgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0045_E02.b : aagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_H11.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0003_F10.b : atccgttcagcgtcggxxxxxxxxxxxxxx
UTR01_0106_D10.b : nnggcttggacttanacxxxxxxxxxxxxxxxxxxxxx
THY01_0072_A08.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_G04.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_A08.b : gttttaaaagcattcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0079_C04.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_C08.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_B04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_A09.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0091_C06.b : aaaaggtgcaacax
ITT01_0027_C08.b : nnggatgaacxxxxxxxx
UTR01_0091_B07.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_B05.b : cgtgcaaaacxx
THY01_0107_G11.b : gttgcxxxxxxx
THY01_0122_F09.b : gttgcaaaacagcgg
OVR01_0082_B07.b :
THY01_0120_B11.b : gtgtcaaaaca
TES01_0093_D04.b :
TES01_0093_E12.b :
TES01_0077_F08.b :
SPL01_0034_F02.b : tttttggcttggacttnacagtttgtcxxxxxxxxxx
LVRM1_0123_F12.b : nagttgtcxxxxxxxxxxx
LVRM1_0097_F01.b : nagttgtcxxxxxxxxxxx
OVRM1_0130_A09.b : cgttgtcxxxxxxxxxxx
TES01_0024_F08.b :
THY01_0042_G05.b : gggggaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0018_F05.b : tttttacgagagtagacxxxxxxxxx
PBL01_0001_B12.b : ccnnttcggagacagaxxxx
THY01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0012_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_A10.b : tgggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0003_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_C05.b : gggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0070_G02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_G06.b :
UTR01_0041_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B08.b : ggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_B02.b : ncgtctgctgtcgxxxxxxxxxxxxx
SMG01_0063_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0041_F04.b : aggacttttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0032_F09.b : nnnaacgaggaacgaggccgtaxxxxxxxxxxxx
MLN01_0091_E10.b : ngctaggactatgacxxxxxxxxxxxxxxxxxx
MLN01_0090_D11.b : ngctaggactataacxxxxxxxxxxxxxxxxxxx
SMG01_0008_B02.b : nnnccgctattnnnnnggactaagcagcggn
OVRT1_0007_A01.b : nnnnnccgttagctgtangagtgxxxxxxxxx
SMG01_0075_F08.b : atccccnggagtaagcagcgg
SKNB1_0041_D10.b :
UTR01_0069_B01.b : ggtgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0093_F09.b : nnnaatgaaacaxxxxxx
THY01_0053_H04.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0082_C03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxx
MLN01_0102_F10.b : nnnaagttgtgacttgacagtttgtacxxxxxxxxxxxx
CBLT1_0100_C01.b : nnccgctggtagaggccgtx
LNG01_0070_F07.b : nnnnnggatggacttgacxxxxxxxxxxxxxxxxxxxx
CLNT1_0052_C03.b : nnggctgtttnnnnnggnnccgtttgcgtacgagtgxxxxxxxxx
OVR01_0028_A01.b : gggccattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_B07.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxx
PBL01_0087_H09.b : nnaagatgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_A01.b : nnnnggcatgtgacttgacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_A08.b : ngctgtgacttgacxxxxxxxxxxxxxxxxxxxx
LNG01_0004_C01.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0100_E03.b : nnggatgaacax
CBLT1_0100_C03.b : nttccgacggaagaggccgta
ILNT1_0017_B03.b : nnggcgcagagagaggccgta
LNG01_0064_G07.b : ttagnnggctaggacttgacagtttgtacxxxxxxxxx
MLN01_0078_E03.b : nnngggtaggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0004_D01.b :
SKNB1_0070_D11.b :
ITT01_0031_F09.b : nnnggatgaacax
ITT01_0071_A12.b : nnnnggatcaacax
CLNT1_0019_C11.b : nttccttctgctgtcngagtgxxxxxxxxxx
PBL01_0062_D10.b : nnnggatxxxxxx
THY01_0125_F10.b : gtttcaaaacaxxx
PBL01_0019_H05.b : ttgtgxxxx
OVRM1_0158_G06.b : cagttgtcxxxxxxxxxxxxxx
OVRM1_0083_H03.b : agttgtcxxxxxxxxxxxxxx
OVRM1_0124_D12.b : nagttgtcxxxxxxxxx
OVRM1_0088_D10.b : agttgtcxxxxxxxxxxxxxx
UTR01_0014_C10.b : ggggaactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0010_A11.b : attttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_A03.b : nnggaggcttggacttnacxxxxxxxxxxxxxxxxxxx
OVR01_0100_C10.b : ggttgggactatgaxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0079_F12.b : cttagcgtgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_A09.b : tttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_F09.b : ggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0006_F05.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0019_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0041_C08.b : ggggcactattagxxxxxxxxxxxxxxxxxxxxxx
THY01_0043_H01.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0010_B10.b : nggactttanggataaa
OVR01_0056_C07.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_D08.b : gggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0099_E11.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0082_G06.b : nnggctaggacttaaacxxxxxxxxxxxxxxxxxxxx
HTMT1_0119_G08.b : nnnnggacggtacgacgxxxxx
SMG01_0028_H06.b : nnggggtgttnnnnnggataaagcagcgg
UTR01_0005_F05.b : ttttggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0097_A01.b : nnnnnnnnnnnnnnnnnnnnn
BMWN1_0079_G03.b : ttttcgcaggtacgaggccgt
LNG01_0048_A03.b : ggcatcatcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_A05.b : nnnaagttttttnnngggataaagcagcxxx
LNG01_0107_F01.b : ttcgggggctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_F11.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0067_C10.b : nnggctttggactataacxxxxxxxxxxxxxxxxxxx
SPL01_0069_D04.b : nnnggctaggacttanacxxxxxxxxxxxxxxxxxx
SPL01_0033_B12.b : ttttagcttggactatnacxxxxxxxxxxxxxxxxx
SMG01_0059_E05.b : nccgcatttttttggagtaaag
TCH01_0019_G04.b : nnnnttagtggacttgacagtttgtcxxxxxxxxxxxxxxxxxxx
MLN01_0013_G06.b : nntttgatggacttanacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_E01.b : nnnnggctaggacttagacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_E05.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_E11.b : agcttttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_G12.b : ggctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_B06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_F04.b : ttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0054_E07.b : nnggttaggacttgacxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0039_B10.b : aacaxxxxxx
LVR01_0019_D01.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0006_F12.b : ccctctagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0091_G03.b : gcttttcggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0006_D06.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_F12.b : gcaacaxxxxx
LVR01_0079_A10.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0038_G04.b : nnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0121_C04.b : ncgtcagcgnacgxxxxxxxxxxxxxxxx
SKNB1_0051_A06.b :
CLNT1_0027_H10.b : ttcgttctgcgtcggxxxxxxxxxxxxxx
SMG01_0038_G08.b : nncccgtgttnnnnnnggagctaa
THY01_0065_B10.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0034_G11.b : nnnggttaaananggctaaacaxxxxx
TCH01_0016_E08.b : nnnnaactggacttgacagtttgtcxxxxxxxxxxxxx
SPL01_0047_G10.b : nnggtgctaggacttanacxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_C01.b : nngggttatannnnggataaagcagcxx
SPL01_0047_E08.b : nnnnnggcattggacttnacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0008_F08.b : nnnnttattggacatgacagtttgtacxxxxxxxxxxxxx
CLNT1_0118_E03.b : nnnccccgttagctgtcgxxxxxxxxxxxxxxx
OVR01_0090_H02.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_A07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_B08.b : tgggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_E04.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxx
OVR01_0019_G12.b : tggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0065_D07.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0091_F11.b : ngggcttttnnnnnntccgtctgcgnacgxxxxxxxxxxxxxxxx
SPL01_0091_G08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0050_D12.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxx
SPL01_0035_E10.b : gggcattagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0091_A07.b : nggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0053_G01.b : ttggagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0044_E06.b : nngcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0035_F04.b : ngggtaggacttgacagtttgtacxxxxxxxx
SKNB1_0030_F12.b :
ITT01_0022_D05.b : nnnggtgxxxxx
SPL01_0090_B01.b : nnnngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_D07.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0022_E07.b : nnnggataaacaxxxxx
SKNB1_0072_B05.b :
ITT01_0058_H10.b : nnnggtgaagcxxxxxx
THY01_0093_F08.b : gtggccccccccagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_D11.b : cggaactaggactatnacxxxxxxxxxxxxxxxxxxxx
LVR01_0010_A07.b : gcatatcgtgncnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0063_E03.b : nnnggtgaagcxxxxxx
SPL01_0095_C05.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxx
PBL01_0077_D08.b : nnnggtgxxxxxxxxx
CLNT1_0071_B12.b : ngattccgtcagcgnacgxxxxxxxxxxxxxxxxx
OVR01_0097_D02.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0017_H11.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0032_B12.b : nnnngggctggacttgacxxxxxxxxxxxxxxxxxxxx
TCH01_0079_A05.b : nnnggctaggactatgacagtttgtacxxxxxxxxxx
ITT01_0063_F02.b : nnnttgtgaagcxxxxxx
LNG01_0064_E05.b : nttacgnggcatggacttgacxxxxxxxxxxxxxxxxxx
ITT01_0038_H10.b : nnnggtgaaac
ITT01_0011_C12.b : nnaagataaac
ITT01_0011_C02.b : nggatgaacax
ITT01_0023_A10.b : nnnggatgaacx
ITT01_0078_F03.b : nnnggatgaacaxxxxxx
ILNT1_0012_F05.b : nnnaagacggtagacgccg
LNG01_0073_F01.b : gtnttgcatggtacttaaxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_A09.b : ntaatgcccgtagacgccg
SMG01_0056_E01.b : nggccttatnnnnttggagtaaagca
ILNT1_0011_A04.b : nnnnaagcgagtagaggccgt
SPLT1_0034_G01.b : nnngttgacggtagaggccgt
UTR01_0008_D09.b : atttgggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0070_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0033_F11.b : cttttggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_G11.b : nnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxx
SMG01_0027_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0097_D01.b : nnnnnnnnnnnnnnnnnnnnn
ILNT1_0059_H10.b : nnggagacggtacgacgccg
SPLT1_0094_B12.b : nttttatgtcagttacgcngccagatttt
BMWN1_0029_C11.b : ttttggcaagtagaggccgta
ILNT1_0052_C01.b : nngggacggtacgaggccgt
OVR01_0090_B05.b : nnggcttgtgacttnacxxxxxxxxxxxxxxxxx
ITT01_0025_A01.b : ntttagagtaacaxxx
SMG01_0097_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0102_F01.b : nnggatgaacaxxxx
SPLT1_0057_E04.b : nnncgcgagtagaggccgt
PTG01_0046_C02.b : nngggcttttnnnnggataaa
CLNT1_0070_D12.b : ngggttttnnnnntnggctcagcgnacgagtgxxxxxxxxxxx
ILNT1_0045_A01.b : tttggtggatggtxxxxxxxxxx
TCH01_0073_G10.b : taggnnggctggacttgacagtttgtacxxxxxxxx
SPLT1_0086_G05.b : nnaatgccggaacgacgccg
ITT01_0061_B07.b : nnnnggataaacaxxxxx
SMG01_0061_F01.b : nccccttattnntttgctaaagcagcggtaxxxxxxxxxxxxxxx
CBLT1_0030_E06.b : nnnncgacagtagaggccg
LNG01_0088_G04.b : ttnnngggtggacttgacagtttgtcxxxxxxx
SMG01_0079_G04.b : nnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0064_A08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0099_H03.b : nntttagctggatatgacagtttgtcxxxxxxxxxxx
MLN01_0058_F11.b : tttgtgctatgacxxxxxxxxxxxxxxxxxxxx
LNG01_0017_B04.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_G08.b : nggttggactatgacagtttgtcxxxxxxxxxxxxx
LNG01_0087_B08.b : ggggtgggatcggacttagnacagxxxxxxxxxxxxxxx
LNG01_0083_H08.b : nnnnaagctggacttgacagtttgtacxxxxxxxx
LNG01_0033_H01.b : gccattaggtccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0027_H05.b : nttgatgaacaxx
ILNT1_0081_H02.b : nnnggggcggtagacgxxxx
ITT01_0039_C05.b : nnnaatgxxxxxxxxx
ILNT1_0093_F09.b : nttatgaccgaagacgccgt
LNG01_0056_F01.b : nnttttccttggacttgacxxxxxxxxxxxxxxxxx
LNG01_0088_B06.b : ngggggggtggacttgacagtttgtcxxxxxxxxxxxxxx
ILNT1_0088_B08.b : nnnttgcgagtagaggccg
UTR01_0046_F06.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_H08.b : tagggggccctattcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0088_G03.b : tttgttggtggacttgacagtttgtcxxxxxxxxxxxxx
SPLT1_0074_B10.b : nnccgcggtacgaggccgt
LNG01_0002_F09.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0097_A12.b : nnttgctaggactatgacxxxxxxxxxxxxxxxxxx
TCH01_0025_H11.b : tggctgtgacttgacxxxxxxxxxxxxxxxxxx
TCH01_0097_F12.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxx
ILNT1_0014_B07.b : tttgggagagtagaggcc
ILNT1_0090_A10.b : nnnggagcaagtagacgccg
ILNT1_0100_F04.b : nnnaatgaggtagacgccg
SKNB1_0042_B01.b :
CLNT1_0045_C11.b : gtatccgttagcgnacgxxxxxxxxxxxxxxx
ITT01_0100_E03.b : nnggagxxxx
OVR01_0061_B03.b : nnnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0096_F06.b : nngggtgatacax
ILNT1_0033_C06.b : nnggcgcggtacgaggccgt
ILNT1_0049_B04.b : nnnggacggtacgaggcc
SKNB1_0098_B05.b :
CLNT1_0053_G12.b : attcccgttagcgnacgxxxxxxxxxxxxxxx
ITT01_0011_H11.b : nnnggatgaacaxxxx
ADR01_0100_D11.b : taaaanggagtaacaxxxx
ITT01_0044_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxx
MLN01_0029_D08.b : nnnggcttggactatgacagtttgtacxxxxxxxxx
SMG01_0010_B01.b : nnnngggctttannnnnggacactacag
OVR01_0084_G10.b : tttttatttttttttttgtgcttggactattacagxxxxxxxxxxxxxxxxxx
SMG01_0053_B06.b : ntttgggtttttnnnnggacgtaagcagc
PBL01_0004_G01.b : gtgacacaxxx
THY01_0121_F07.b : tggcaaaacg
SMG01_0098_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0111_A09.b : agtgtcaaagcagcggcc
THY01_0108_H09.b : gttgcaaaaa
OVR01_0080_G10.b :
SMG01_0054_B11.b : nnggcggtttnnttnnggtaaagcagc
THY01_0111_H03.b : attgtcaaacg
THY01_0104_B08.b : gttgcxxxxxxxxx
OVR01_0094_E07.b : nagcaaaacgcctgggcaatggacatgcacaacxxxxxxxxxxxxxxxxxxxxx
THY01_0120_D10.b : gtgtcaaaaacx
SMG01_0098_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0108_A10.b : gttgtcaaaagcggxxxxxxxxx
THY01_0126_E07.b : gttgtcaaaacaxxx
TES01_0038_H05.b :
LVRM1_0193_D05.b : ttatctacactatccgataggggggccaggggcgccacaaccatcgtcxxxxxxxxxxxx
SMG01_0057_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0086_H03.b : cccttgtcxxxxxxxxxxxx
OVR01_0022_E04.b : ggccatttggccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0022_F07.b : nggcgatnntttaagacgtaacag
LVR01_0081_A05.b : gggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_C06.b : tattttggcgtaagcagc
OVR01_0084_E01.b : gctttgggacttatacxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_F10.b : ggacctatgaaxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_F06.b : gggggggnnnnaaagttagcaxxx
PBL01_0007_G12.b : nngagggtnttaagggtaaacagc
SMG01_0002_F09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0076_B03.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_D11.b : nnaacggtatxxxxxxxx
LVRM1_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxx
OVR01_0082_G02.b : ttgcttggcataanaxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_E05.b : ncgttgtcxxxxxxxxxxxx
OVR01_0080_E01.b : ngggttaggactatxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_A07.b : cagtgtcxxxxxxxxxxxx
SMG01_0093_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PBL01_0003_C12.b : gtccnnttaagctaaacagc
OVRM1_0179_A01.b : ttgtcxxxxxxxxxxx
OVRM1_0170_H02.b : agttgtcxxxxxxxxxxxx
LVRM1_0152_G02.b : nagttgtcxxxxxxxxxxxx
OVRM1_0169_D06.b : agttgtcxxxxxxxxxxxx
OVRM1_0169_G06.b : gcgttgtcxxxxxxxxxxxx
OVRM1_0014_E06.b : xxxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_F12.b : gagttgtcxxxxxxxxxxxx
OVRM1_0058_H07.b : agttgacxxxxxxxxxxxx
LNG01_0042_G10.b : gggatannaaagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0208_D11.b : tagttgtcxxxxxxxxxxxx
OVR01_0070_H09.b : nnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
OVR01_0100_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0101_C01.b : ntttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxx
PTG01_0102_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0023_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0102_B12.b : nnttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_F11.b : gggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_C10.b : cxxxxxxxxxxxxxxxxxxxxxxx
THY01_0011_A03.b : gatxxxxx
OVRM1_0022_C11.b : aattttgtgcaactxxxxxxxxxx
ADR01_0015_F04.b : tatgaacaxx
SMG01_0016_D08.b : nnnnnnnnnnnnnnnnnnnnnnn
SPL01_0028_C12.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_E10.b : gggggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_B06.b : nngggcttttnnnnggataaagcagc
SPL01_0016_H02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0069_G01.b : ncccgtatatntttggataaagcag
THY01_0070_B02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0013_A12.b : ccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0039_G11.b : nnntcgcaattnttnnggggctaagca
SPL01_0014_F11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0030_H12.b : nnccaacttattaaaangggtaaagcagc
SPL01_0021_G09.b : gggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_E03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0025_H06.b : ctttttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0050_F02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0005_A04.b : nnnnaacgatatnnnnngggctaacagc
SPL01_0014_F02.b : ctttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_F06.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_F06.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0045_E08.b : ggttgtgacttgacxxxxxxxxxxxxxxx
THY01_0019_F11.b : ccxxxxx
UTR01_0008_E11.b : ccttttagaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0028_B02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0027_C07.b : tttttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0096_B11.b : agtgacttgacxxxxxxxxxxxxxxxxxxxxxx
UTR01_0007_C02.b : cttatggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_D01.b : attttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_F10.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0022_C05.b : tgaacaxxx
SPL01_0060_D07.b : tgggcttggactataacagtttgtcxxxxxxxxxxxx
OVR01_0052_C12.b : nnttggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxx
UTR01_0009_G04.b : cttaagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_F05.b : nnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_B02.b : gggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_F12.b : nnnnnnnnnnnnnnnnnnnn
SPL01_0012_G07.b : atttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0103_D07.b : nggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_H08.b : taggacttagacxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0034_E06.b : agattttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0027_F05.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0021_H02.b : gggtaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0036_A12.b : gatcaacaxxx
SPL01_0098_G12.b : ntttggcttggactatgacagtttgtacxxxxxxxxxxx
UTR01_0040_G05.b : gggtgcactattagxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_B12.b : nnnnggataggactatgacagtttgtcxxxxxxxxxxxx
TES01_0112_D12.b :
UTR01_0039_E01.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0032_C08.b :
UTR01_0042_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0036_H05.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0064_H09.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0068_B12.b : nnggttttnnnngnnnncctatagcggacgxxxxxxxxxxxxxx
THY01_0014_F09.b : tagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_D11.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0017_F09.b : tgggttgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0042_B11.b : tttttggataaagcag
ADR01_0035_F05.b : nnggtgaaacxxx
SMG01_0013_H07.b : nnccccttttnnataagagtatagcagc
UTR01_0019_E04.b : aggggtgcctattagxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0013_D11.b : attaaacnannggatxxxxxxxx
SMG01_0077_F12.b : tttttggactaaxxxxx
UTR01_0039_F04.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0098_A09.b : nnttggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_A06.b : gggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_E06.b : ggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_D07.b : nggttgatnannggagtaagaxx
SMG01_0007_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0016_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PBL01_0053_D06.b : ngtgaaacaxx
SPL01_0070_F01.b : nnnagcttgtgacttnacxxxxxxxxxxxxxxxxxxxx
OVR01_0066_D07.b : nggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
SMG01_0021_B12.b : nnnccgcgatttnntttgctxxxxxxxx
PBL01_0036_A01.b : aaagatgaacax
SMG01_0004_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0026_G11.b : gggggcactattagxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0119_H09.b : nnnccccgttagcgnacgxxxxxxxxxxxxxx
SMG01_0034_E01.b : nncccttttnnnnnggggtaaagcagc
UTR01_0032_A07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_B12.b : nnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0062_H10.b : ntttgataggacttagacagtttgtacxxxxxxxxxxx
SPL01_0098_H12.b : tttgcgcttggactatnacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0136_H06.b : nnnnnccgttagctgtagxxxxxxxxxxxxxx
PBL01_0018_E02.b : ngtgcaacxxxxxxx
THY01_0044_B11.b : ctttttgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_A05.b : nnnnggtttnttcnncgaacggacttgacagtttgtcxxxxxxx
MLN01_0017_D01.b : nntttcttgtggacttgacagctttgtcxxxxxxxxxxxx
SPL01_0048_E08.b : nnnggcttggacttanacxxxxxxxxxxxxxxxxxxxxx
PBL01_0039_E11.b : gactaacaxxxx
OVR01_0047_E08.b : gagcttttgtgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_B07.b : nnggatgaacaxxxxxxxxx
UTR01_0035_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0101_F07.b : nnnnnccgtcagctgtggxxxxxxxxxxxxxx
SMG01_0078_D08.b : aaaantggatatagcagc
SMG01_0003_C11.b : nnnaagtttaannnnnggagatagcag
SMG01_0045_E11.b : nggctatttnntngggctaaagcagcx
SMG01_0001_F11.b : nnccctttnnnnnttgatcaacagc
SMG01_0070_H09.b : ngcgttannnnnttgataaagcag
UTR01_0037_E02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_D09.b : nggcttggacttanacxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0082_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0046_F08.b : nnggcgatttnnnnggataaagcagc
SMG01_0072_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0079_D02.b : nttgcttgtgacttgacxxxxxxxxxxxxxxxx
SMG01_0090_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0007_C01.b : nnnggtgaacaxxxx
THY01_0047_H01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0083_H11.b : ccttnnnataaagataaagcag
CLNT1_0106_F02.b : nnnnnacgtcagcgnacgxxxxxxxxxxxxxx
SMG01_0050_G11.b : nnggcttttnnnttagataaagcag
THY01_0064_H06.b : cattttgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0053_A03.b : nttccgtttgcgtcggxxxxxxxxxxxxxxx
OVR01_0042_A10.b : ggcttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A09.b : ccatttggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0074_F04.b : nnnnnggctggacttgacagtttgtcxxxxxxxxx
UTR01_0038_A06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0071_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0034_E12.b : nttttttgactaacaxx
SMG01_0045_G11.b : nncccatattnnnnnggctaaagcagcxxxxxxxxxxxx
TES01_0038_A06.b :
TCH01_0032_B11.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_E04.b : taaacaxx
OVRT1_0079_H01.b : ngggctcctatagctgtatgagtgxxxxxxxxxx
SMG01_0093_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0068_D04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_F07.b : nnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_E09.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxx
MLN01_0025_G07.b : gcttggacttgacxxxxxxxxxxxxxxxxxxxxxx
TCH01_0018_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0017_H01.b : ngggggtttaaannggataaagcagc
SMG01_0083_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0008_H05.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0110_B07.b : nttttcccttagctgacgxxxxxxxxxxxxx
LNG01_0004_D04.b : cctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0098_A04.b : nnnnagctaggactatgacagtttgtacxxxxxxxxxxx
LNG01_0029_C06.b : ggcattatgctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_C06.b : nnggcttggactatnacxxxxxxxxxxxxxxxxxxxx
SMG01_0081_G02.b : nggcgattannttttgagtaaagcag
SPL01_0095_G03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_H12.b : nttttgctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
OVR01_0094_G11.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
THY01_0201_F05.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_G09.b : ngctaggctatgacxxxxxxxxxxxxxxxxxxxxxx
SMG01_0015_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0030_E09.b : gcatttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_A12.b : nntttgcttggactatnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0080_D09.b : nggcttggactataacxxxxxxxxxxxxxxxxxxxxxx
THY01_0018_B07.b : ntttttgggagaagcctagctattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0119_H04.b : nttgttttnnnnnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxx
LNG01_0030_D08.b : gcttttgctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0072_F01.b : ctttttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0085_F10.b : taaaattgactaacxxx
SPL01_0058_A04.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_E06.b : nggcttggacttanacagtttgtcacxxxxxxxxxxx
SMG01_0044_H12.b : nggcctttttttaatgactxxxxxxx
SMG01_0056_H03.b : ncggtttttttttggcgtaagcagc
SPL01_0037_A01.b : caagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_F01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_H11.b : gcttttggttgaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0054_E06.b : nnnnggctagtgacttgacagtttgtcxxxxxxx
UTR01_0036_B05.b : gggtggacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0022_B04.b : gggcatttgggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0041_F06.b : ggggctattatcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_E10.b : gagagatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0057_C01.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxx
SMG01_0080_E12.b : ngcgtttnnnnntgataaagcagc
SKNB1_0033_B02.b :
UTR01_0076_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0086_E06.b : acagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_E02.b : gcctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_G05.b : nnnggctaggacttaaacxxxxxxxxxxxxxxxxxxxxx
SMG01_0048_G09.b : nggcaattnnnnnagagtaagcagcx
SMG01_0036_C04.b : nggcgttatnnnnnggagtaagcag
UTR01_0083_G11.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
UTR01_0083_G12.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_E01.b : ntttgagcaacxxxx
SPL01_0075_H01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxx
OVR01_0045_E01.b : acaagctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_A07.b : nttgctaggactataacxxxxxxxxxxxxxxxxxxxxxx
SMG01_0078_C08.b : ttatnnnagctaaacaxxx
SKNB1_0056_H03.b :
CLNT1_0061_A09.b : nnnnnccgttagctgtcgxxxxxxxxxxxxxx
CLNT1_0118_H06.b : nnncctcgacagcgtaggxxxxxxxxxxxxxx
CLNT1_0129_F03.b : nnnnccgtttgctgaggxxxxxxxxxxxxxx
PBL01_0013_D06.b : tatacaxxx
OVR01_0046_F12.b : ataaggattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0072_E10.b : tcacacaxx
MLN01_0039_A08.b : ctttttcgggggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0029_G11.b : ggctttttgctacnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0038_C02.b : aagggcttaggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0017_F04.b :
LNG01_0020_B11.b : gcttctcccccctacgggattgcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0094_F05.b : atttgggcctaacggcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_G01.b : nnnaaactatnnnnnnnncccgtttgcgnacgxxxxxxxxxxxxxx
MLN01_0006_B07.b : ntatttggctggattgaxxxxxxxxxxxxxxxxxxxxxx
PTG01_0014_C08.b : nngccgttttnnnnggctaaagcag
TES01_0043_G10.b :
MLN01_0011_B07.b : nnnntctggacttgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_B09.b : nnggatgaacaxxx
ITT01_0038_C02.b : nnggtgxxxxxxx
PBL01_0057_C05.b : ngttgaacaxxxx
OVR01_0044_A08.b : gggcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0101_B10.b : nnnttgatgaacaxxx
ITT01_0061_C04.b : nnnggtgatacaxxx
PBL01_0012_B08.b : nnnnggtgcaagcgg
PBL01_0053_H09.b : naagtgxxxxxxx
OVR01_0007_D11.b : cgggggccctattttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_C01.b : cggggcccactgattcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_F11.b : cgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_D11.b : agggacttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0012_C03.b : nnnggtgaaacaggxx
ITT01_0008_C03.b : nnnggtgcaacaxxx
SMG01_0077_C03.b : ttttggatatacaxx
PBL01_0032_D07.b : nggatgaacaxxx
OVR01_0034_G05.b : gggctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_F06.b : nnnnggtgaaacaxxxx
ADR01_0044_B07.b : nggtgcaacaxx
SMG01_0053_F04.b : attannnggagtaagcag
PBL01_0024_A02.b : nggtgxxxxxxxxx
OVRT1_0064_B08.b : ncggattnnnnnnnnaagttagcgnacgxxxxxxxxxxxxxx
SMG01_0082_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0027_A06.b : nggctttttntnnggatacagcagc
OVR01_0033_B06.b : gggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_C01.b : nnnnnggcatgtgacttgacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0057_H02.b : ntttccgtcagcgnacgxxxxxxxxxxxxxx
ITT01_0049_F12.b : nnaaagataaacaxx
SMG01_0022_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0069_H01.b : nnnnnnnnnnnnnnnnnnnnnnn
SMG01_0058_F04.b : ngctttttnnnnggataaagcag
TCH01_0057_D08.b : nnnggcttgtgacttnacxxxxxxxxxxxxxxx
PBL01_0056_C01.b : naaaatgxxxxxxxx
ITT01_0036_F02.b : tttgtgcaacaxxx
ITT01_0102_F04.b : nnggatgaacaxxx
ADR01_0066_B03.b : nnnaaattaaannnnggagtaagcag
PBL01_0070_F02.b : naagtgcaagaxxxxxxxxxxxxxxx
PBL01_0054_H08.b : aaaagtgaaagax
PBL01_0053_D07.b : ngtgaca
ITT01_0087_G01.b : nnttgatgaacaxx
SMG01_0084_H09.b : nnggcttttnnnnnntgagtaaagcagc
SMG01_0074_D08.b : atctangggagtaagcagc
ITT01_0038_G02.b : nnnaatgxxxxxxxxx
ITT01_0032_B10.b : nnnggatgaacxxxx
ITT01_0088_H02.b : nnggatatacaxxx
THY01_0072_H09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0079_H11.b : cgttggtgactatanngacxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_G07.b : nnnggatxxxxxxxxx
PBL01_0059_B11.b : nnnggatxxxxxxxx
SMG01_0073_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0035_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0066_D04.b : gatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_E01.b : nncccccttcagcgnacgxxxxxxxxxxxxx
CLNT1_0057_F04.b : nnnccgtcagcgnacgxxxxxxxxxxxxxx
OVRT1_0125_F04.b : nnnccgttagctgtggxxxxxxxxxxxxxx
SMG01_0029_B04.b : ngggtttttnnnnngggtcaacagc
PBL01_0010_A10.b : ncgttattnnnggatacaca
THY01_0202_C03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_E09.b : nnccccctatagcgtacgagtgxxxxxxxxxx
OVRT1_0011_F07.b : nncttcgtctgcgnacgxxxxxxxxxxxxx
OVRT1_0078_C01.b : nnggctttnnnnnnnnncctattgcgcacgagtgxxxxxxxxxx
CLNT1_0038_G08.b : ngggcccgatagcggacgxxxxxxxxxxxxxx
CLNT1_0044_A11.b : ntttccgtcagcgnacgxxxxxxxxxxxxxx
CLNT1_0023_H01.b : tttgttctgctgacgxxxxxxxxxxxxxx
SMG01_0006_G07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0043_G11.b : nccgctttttttttggacgtaacagc
SMG01_0087_H04.b : ngggctttnnntnggatxxxxxxxx
CLNT1_0039_D04.b : ngggaccgttagctgacgxxxxxxxxxxxxxxxx
LNG01_0085_H09.b : nnnttttgttggacttgacagtttgtcxxxxxx
SMG01_0097_E06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0071_D08.b : nnnnnggctggctatgacagtttgtcxxxxxx
SMG01_0001_E04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0013_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0101_E05.b : nnnggatgaacaxxx
SMG01_0019_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0101_C06.b : tttcaaaggcgtaacgg
MLN01_0006_C06.b : nnntttgtggacttgacagtttgtcxxxxxxxxxxxx
MLN01_0027_H07.b : nttggttggacttgacagtttgtacxxxxxxxxxxx
MLN01_0063_F10.b : cttgtgctatgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0035_B10.b : gatccgttctgcgtcggxxxxxxxxxxxxxx
SMG01_0019_E07.b : ngggatatnnnnnggataaagcag
ITT01_0069_G09.b : nnngatgaacaxxx
ADR01_0033_C10.b : nnngggttttanantgagtatagcagcx
ADR01_0097_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0034_E11.b : nnnggatgaacaxxxx
ITT01_0071_D11.b : nnnggatgaacaxxx
SPL01_0050_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_A07.b : tttggnggatggacttgacagtttgtcxxxxxxxxxxxx
LNG01_0080_H02.b : nnttttctaggacttgacagtttgtcxxxxxxxxxxxx
MLN01_0076_D06.b : nngggtaggacatgacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0151_F08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxx
SMG01_0047_D03.b : nggctattttnnnggctaaagcagc
ITT01_0050_E08.b : gatgaacaxxx
THY01_0071_H11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_F03.b : nccgtttnnnnnnnnccctatctgcgcacgxxxxxxxxxxxxxx
SPL01_0055_A08.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
TCH01_0068_H07.b : nttttagcatggacatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0059_H08.b : nnccgctaggactatnacxxxxxxxxxxxxxxxxxxxxx
SMG01_0018_F03.b : ngggtttannnnnggatacagcag
LNG01_0065_H11.b : ntcgttggctggatatgacagtttgtcxxxxxxxxxxxx
MLN01_0070_G02.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_A02.b : nnnnggcttggtacttgacxxxxxxxxxxxxxxxx
OVRT1_0004_A12.b : naaaaccgttagcngtacgxxxxxxxxxxxxxx
SMG01_0043_G09.b : nnggggatttnnnnntgactxxxxxxx
SMG01_0075_F06.b : attanggataaacaxx
CLNT1_0062_A09.b : ngggtttnnnnnnnccgttctgcgttcgxxxxxxxxxxxxxx
MLN01_0099_D02.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0079_H08.b : nnnggctaggactataacagtttgtacxxxxxxxxxxx
MLN01_0074_A10.b : ggtaggacttgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0011_H07.b : nnggatgaacaxxx
PBL01_0059_A07.b : nnngatatxxxxxx
LNG01_0110_B01.b : nnnntttgctggtctatnacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_E08.b : nttcttggcatggacttgacxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_A12.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_D03.b : nnnggtaggcctatgacagtttgtcxxxxxxxxxxxx
SMG01_0036_D03.b : tacaannggagtaagcag
PBL01_0052_B06.b : nnnggtgaaacaxxx
PBL01_0058_D03.b : nnnggtgxxxxxxxx
OVR01_0072_B02.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_E10.b : nccggttggactatgacxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_D12.b : nnnccccgtttgcgnacgxxxxxxxxxxxxxx
CLNT1_0046_E05.b : gaaccgtttgctcacgxxxxxxxxxxxxxx
THY01_0080_G06.b : atattttttttttcagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0015_F04.b : ttttgggttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_G04.b : ttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_H11.b : nnnnggcttggactataacxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_D05.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0058_D04.b : nnnggctaggacttgacagtttgtacxxxxxxxxxxx
SMG01_0039_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0036_G08.b : cctttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0002_D01.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0044_C09.b : nggctaggactatgacagtttgtacxxxxxxxxxxx
LNG01_0078_H09.b : nnttttgcttgtctatgacagtttgtcxxxxxx
CLNT1_0036_G12.b : aaatccgttcagcgtacgagtgxxxxxxxxxx
UTR01_0050_D07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0002_A06.b : atttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0082_A02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
THY01_0093_F11.b : ggttttaacagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0041_G03.b : cttttggcgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0067_H04.b : nttttggttggacttgacagtttgtacxxxxxxxxxxxx
MLN01_0013_D08.b : nnnnggtaggacttgacagtttgtcxxxxxxxxxxxxx
MLN01_0056_E08.b : tagtgacttgacxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_A12.b : caagagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_C06.b : ntcgccgcatggactatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_F10.b : ntttggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_B06.b : ngttaggacttgacagtttgacxxxxxxxxxxxx
MLN01_0032_A04.b : nttagggnnggctggacttgacagtttgtcxxxxxxxxxxxx
UTR01_0079_A01.b : attacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_B02.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_H09.b : nnnttgctaggacttgacagtttgtacxxxxxxxxxxx
TCH01_0030_H12.b : tggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0004_F05.b : nggtaggactatgacxxxxxxxxxxxxxxxxxxxxx
SMG01_0082_F11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0046_D02.b : ggggggaagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_D03.b : nnnngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_D02.b : ttttgggctgtactatgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0105_B03.b : nnttggcttgtgacttnacagtttgtacxxxxxxxxxxx
MLN01_0063_E01.b : nnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0049_E09.b : ttttggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0093_G03.b : nnnttgctaggacttagacxxxxxxxxxxxxxxxxxxxxx
TCH01_0017_C12.b : nttttggctggacttgacagtttgtacxxxxx
SMG01_0063_A12.b : nggcggttttttaatgagtaaagcagcx
PBL01_0055_F03.b : nnggtgaagcxxx
OVR01_0049_A02.b : nnnntttgcctgtgacttgacxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_F01.b : nnnnagctaggacttanacxxxxxxxxxxxxxxxxxxxxx
LNG01_0070_G02.b : tggnnggctggacttgacagtttgtcxxxxxxxxxxxxx
TCH01_0056_C03.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
PBL01_0070_F03.b : nnnggtgatacaxx
OVR01_0056_D03.b : nnnnggcttggacttagacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_E04.b : ntttttggctggacttgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_G06.b : nnnggagxxxxxxxx
SPL01_0090_D10.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_F06.b : nnnnagctaggactatnacxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_C02.b : nnnnagcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
UTR01_0049_A12.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_B07.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_E01.b : nnnttgctagtgacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0026_F08.b : ngggtaggatatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0064_C01.b : nngctaggacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0065_D06.b : nggctaggacttgacxxxxxxxxxxxxxxxxxxxxx
OVR01_0003_A11.b : accctctagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0029_D05.b : ttttttttttttttcggcattggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0021_F10.b : ggcctttgggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0026_F09.b : ggggcattttgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_F08.b : catatggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0100_E03.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxx
LNG01_0104_H01.b : nnntttgctggacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0074_F01.b : cggtaggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_A07.b : nnnggcttggactatgacxxxxxxxxxxxxxxx
LNG01_0065_C10.b : nnngggtttnttcgctggttggacttgacxxxxxxxxxxxxxxx
THY01_0033_F09.b : ttttgggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_F04.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0001_C06.b : ggaaccgtttgctgacgxxxxxxxxxxxxxx
SPL01_0039_D03.b : gggggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0105_E10.b : nnnggcttggacttaaacxxxxxxxxxxxxxxxxxxxxx
TCH01_0031_G10.b : ngttgtgacttgacxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_C08.b : nnnnnccgtcagcgtacgagtgxxxxxxxxxx
ITT01_0077_A09.b : nnnnggcgtaacaxx
OVR01_0019_D10.b : gggtggtgaacctattagxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0127_C02.b : ngcacaattnnngnaccgttagcgtacgagtgxxxxxxxxxx
LNG01_0011_F10.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0067_B08.b : nnnnggttttaaaaagataaagcagcxxxxxxxxxxx
TCH01_0032_E03.b : nnngggtaggacttgacxxxxxxxxxxxxxxxx
LNG01_0027_D09.b : ttggcctttaaggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_F04.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_G07.b : nnggggttnttcggtgttggacttgacagttgnacxxxxxxxxx
SPL01_0047_B02.b : ttttggcattggacttnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_D03.b : nnnnggcatgtgacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0044_G07.b : nnnggctaggacttanacxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_F05.b : nnnnggcttggactataacagtttgtacxxxxxxxxxxx
UTR01_0102_A11.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_E10.b : nnnnnggctggacttgacagtttgtcxxxxxxxxxxxx
MLN01_0075_B01.b : nnnggttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
OVR01_0058_G07.b : nggcttggactataacxxxxxxxxxxxxxxxxxxxx
LNG01_0026_F01.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0018_H07.b : ggcatttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0085_E03.b : nnnnnggataggactatgacxxxxxxxxxxxxxxxxxxxxxx
THY01_0030_D09.b : ttgggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0054_G06.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0051_F07.b : nggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0095_G06.b : nnnggcttggactatnacagtttgtacxxxxxxxxxxx
UTR01_0104_D10.b : nnggctagtgacttgacagtttgtacxxxxxxxxxxx
ITT01_0093_H05.b : nnaatgxxxxxxxxx
BKFL1_0106_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0006_B06.b : aagggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_G09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0106_H02.b : nnnnggcatggacttgacagtttgtcxxxxxxxxxxxxxxx
UTR01_0096_H05.b : nnttgcttggacttanacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_H06.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_A12.b : tcgcccccctttgcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0074_A06.b : ttttggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_G08.b : nnnggcttggactatnacagtttgtcacxxxxxxxxxxx
THY01_0022_F03.b : gggccctttttxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0131_D07.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxx
TES01_0056_A07.b :
LNG01_0018_D10.b : tattgtggggnttcatgacttgtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0001_G07.b : gcatttggagccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0065_G11.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0062_G07.b : gggggaacttataggaaacxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_H06.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0095_B11.b : ggatccgtctgcgnacgxxxxxxxxxxxxxx
OVR01_0011_G08.b : atggacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_E04.b : gaggattttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0031_C03.b : ataananggatxxxxxxxxxx
OVR01_0030_D04.b : gggagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_D11.b : ttttttggatggactatnacxxxxxxxxxxxxxxxxxx
MLN01_0086_E07.b : nnncctaggcgtatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0011_G07.b : nnttttgtggacttgacagtttgtcxxxxxxxxxxxx
MLN01_0073_F06.b : nnggcttggacttgacagtttgtacxxxxxxxxxxx
OVR01_0046_A04.b : gagactttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0063_C12.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0021_F06.b : nnggtaggacttgacagtttgtcxxxxxxxxxxxx
SMG01_0001_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0009_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0095_F09.b : gcattttatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_H01.b : ttgggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0081_F11.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_H02.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0076_E03.b : nnnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_A10.b : cttgtttctttttttatggcattggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0044_D02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0045_C04.b : ttgttttttttagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0084_E10.b : cattttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0103_C09.b : nnnnnaagctggacttgacxxxxxxxxxxxxxxxxxxxx
SPL01_0070_E04.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_A01.b : tttagatcaacaxxx
UTR01_0093_F09.b : nnnnnggcctggactatgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0043_B12.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxx
TCH01_0003_D03.b : nnngggtaggactatgacxxxxxxxxxxxxxxxxxxxx
UTR01_0105_A08.b : nnnggctaggactatgacagtttgtacxxxxxxxxxxx
MLN01_0096_D01.b : nttttgctaggactatnacxxxxxxxxxxxxxxxxxxxxx
ITT01_0045_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0064_A07.b : nnggcttggctatgacagtttgtcxxxxxxxxxxxx
OVR01_0012_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0081_B01.b : tagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0092_E07.b : gggcggcaaggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0003_D08.b : ttcacatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0057_B10.b : nccgcaggnnttcggctggacttgacagtttgtcxxxxxx
ITT01_0009_E12.b : nnnagataaacaxxxxxxxxxxxxxxxx
SPL01_0067_D02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_F12.b : tttttggtaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0093_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0084_G10.b : nnttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0055_A07.b : nnnnggcttggactatgacagtttgtacxxxxxxxxxxx
ITT01_0047_E06.b : nnnggatgaacaxxx
PBL01_0014_D03.b : natgaagcxxxxx
MLN01_0039_G06.b : nttccgcgctaggacttgacagtttgtacxxxxxxxxxxx
TCH01_0035_G07.b : ttggctaggactatgacxxxxxxxxxxxxxxx
CLNT1_0051_C10.b : nccgtttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxx
OVR01_0017_A01.b : ttttggtgtacctattagxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0029_D06.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0031_G08.b : nggcttggactatgacxxxxxxxxxxxxxxxx
ITT01_0069_F03.b : nnggatga
TCH01_0001_B03.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxx
ITT01_0060_F01.b : nnaatgxxxxxxx
PBL01_0079_F12.b : atgcaacaxxx
OVR01_0011_C05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0055_C06.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0100_G11.b : ggactacgttagctgacgxxxxxxxxxxxxx
ITT01_0096_D09.b : nnnaatgaaacaxxx
ITT01_0030_D08.b : nngggtgaacaxxx
MLN01_0103_H03.b : nnnaagtaggacttgacagtttgtacxxxxxxxxxxx
ITT01_0079_C12.b : nnnnggctgaacaxxx
UTR01_0082_F01.b : nnnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxx
ITT01_0044_G09.b : nnnggttgaacaxxx
ITT01_0015_H10.b : nnaagctgaacaxx
ITT01_0094_H03.b : naatgaaacaxx
ADR01_0085_D07.b : nnnnnnggactaacxxxx
ITT01_0041_A07.b : nnnggagxxxxxxxx
MLN01_0043_E10.b : nnggttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0029_A01.b : ttaagatgaacaxxx
ITT01_0072_C04.b : nnggagaagcxxxx
CLNT1_0146_G12.b : ntttccgtcagcgtacgagtgxxxxxxxxxx
TCH01_0030_C02.b : nnngggttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_G05.b : nnnngggtaggacttgacagtttgtacxxxxxxxxxxx
OVRT1_0046_H02.b : nnnnacgtcagcgtacgxxxxxxxxxxxxxx
ADR01_0034_F06.b : nncctttaannnnggctaaacaxx
SPL01_0064_G08.b : tttnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0093_B09.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxx
TCH01_0037_E04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0031_F10.b : nnggctaggacttaacagtttgtacxxxxxxxxxxx
SPL01_0068_E03.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxx
ITT01_0039_F08.b : nnnaatgxxxxxxx
ITT01_0062_F02.b : ntttgagtaacaxxx
UTR01_0063_A12.b : gagcatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0094_H03.b : gacttttnnnggggcccgttagcgnacgxxxxxxxxxxxxxx
OVR01_0058_H02.b : nnntttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0045_C04.b : gggaccgttctgcgtcggxxxxxxxxxxxxxx
SPL01_0098_A06.b : nnnaagctaggactatnacxxxxxxxxxxxxxxxxxxxxx
LNG01_0071_B04.b : nnnnnggatggatatgacagtttgtcxxxxxxxxxxxx
ITT01_0031_E06.b : nnggatgaacaxxx
LNG01_0094_H08.b : nnnnttgatggacttgacagtttgtcxxxxxxxxxxxx
TCH01_0030_C11.b : nggttggactatgacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0032_H10.b : nnnggatgaacaxxx
ITT01_0052_A04.b : nnnggtgaagcxxxx
PBL01_0056_B06.b : nnnagtgaagcxxxx
PBL01_0096_D07.b : nnnggtgxxxxxxxx
PBL01_0077_F08.b : nnnagtgxxxxxxx
PBL01_0035_A04.b : nnaatgaacaxx
TCH01_0046_A03.b : nggggggattggacttnacxxxxxxxxxxxxxxxxxxxxx
LNG01_0099_H01.b : nnntttgctggatatgacxxxxxxxxxxxxxxxx
OVR01_0093_G05.b : nnnaagctaggactatgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0008_D01.b : tgggttccttggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0077_A09.b : nnnaagctaggactatnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_D07.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxx
PBL01_0071_H01.b : naagtgxxxxxxx
OVR01_0003_F02.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0063_B04.b : ttttactggcattcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_H02.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_F01.b : nnntttgagtaagaxxxxx
ITT01_0036_D04.b : nnnggatgaacxxxx
MLN01_0052_G07.b : cagnnnntgcttggacttgacxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_F03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
SPL01_0093_G04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
ITT01_0005_F06.b : nnnggatgaa
MLN01_0023_F06.b : gggggnttcgggcttggacttgacagtttgtacxxxxxxxxxxx
OVR01_0020_E02.b : gggggtggacctattagxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_E08.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
THY01_0099_A04.b : gcatttagggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0098_G01.b : nngggtgxxxxxxxx
MLN01_0100_F02.b : ttggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0104_B11.b : gttgtgacttgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0036_F01.b : ccgagattaggtgcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_A02.b : nnnnggcatggactatnacxxxxxxxxxxxxxxxxxxxxx
TES01_0055_A01.b :
UTR01_0099_B01.b : nnnttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0021_H05.b : nntttcgtggacttgacagtttgtcxxxxxxxxxxxx
SPL01_0049_H05.b : nnnggtgcatggactatnacagtttgtacxxxxxxxxxxx
PST01_0056_D10.b :
ITT01_0003_A07.b : nnnggagaagcxxxx
ITT01_0030_E07.b : nnnggatgaacaxxx
MLN01_0033_A06.b : nnnngggtaggacttgacagtttgtacxxxxxxxxxxx
ITT01_0090_A12.b : nnnggtgaaacaxxxx
TCH01_0026_F09.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0012_A02.b : cgcattagggtgaantatanngacxxxxxxxxxxxxxxxxx
PBL01_0072_H06.b : naaagatgaacxxx
UTR01_0090_C01.b : nnttggctaggactatgacagtttgtcacxxxxxxxxxxx
MLN01_0041_C09.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
LNG01_0067_A09.b : nttttggttggacttgacxxxxxxxxxxxxxxxxxxxxx
SKNB1_0045_A08.b :
OVR01_0009_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0097_C11.b : nnnnggctgaacaxxx
ITT01_0006_E05.b : nnnggataaacagc
ITT01_0019_F10.b : nnnggatgaacaxxx
OVR01_0011_B05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0067_B09.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0060_B12.b : nnnaatgaaacaxx
ITT01_0009_G06.b : nnaagtgaagcxxx
TCH01_0049_B02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxx
PBL01_0078_D06.b : nnnggtgaaacaxx
ITT01_0008_C11.b : nnnggtgaagcxxxx
ITT01_0082_G01.b : nnnggagaaacaxxx
PBL01_0055_C09.b : nnggtgaaacaxxx
ITT01_0060_D06.b : nnnaatggxxxxxxx
PBL01_0085_C02.b : nnnggatgaacaxx
ITT01_0010_H10.b : nnaagtgxxxxxxx
ITT01_0019_G10.b : nnnggatgaacaxx
ADR01_0078_C09.b : nnnnnnggctaaacaxxx
ADR01_0030_B11.b : aaaaaggctgatacaxx
ITT01_0020_D04.b : nnnggtgaaacaxxx
ADR01_0075_B06.b : taaannnggagtaacag
ITT01_0090_A04.b : nnnaactgaacaxxx
PBL01_0084_G04.b : nnnggtgaagcxxx
PBL01_0063_D02.b : natgaagcxxxx
ITT01_0020_A12.b : nnnggatgaa
ITT01_0080_B08.b : nnnnggtcaacaxxx
ITT01_0095_D11.b : nnnaatgaagcxxxx
PBL01_0066_E07.b : nnnaagctacacaxx
PBL01_0071_H04.b : nnggtgxxxxxxxx
UTR01_0088_B03.b : nnnaagctaggactatnacxxxxxxxxxxxxxxxxxxxxx
PBL01_0078_C11.b : nnnggtgaagcxxxx
PBL01_0072_C11.b : nnnggtgxxxxxxx
ITT01_0052_H11.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxx
TCH01_0032_A07.b : nngctaggacttgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0096_E07.b : ngctaggactatgacxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_E12.b : ngggtaggactatgacxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_C06.b : nnnttagagttggacttgacxxxxxxxxxxxxxxxx
TCH01_0085_D08.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxx
UTR01_0096_E03.b : nnnnggctaggacttanacxxxxxxxxxxxxxxxxxxxx
MLN01_0041_E06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_G04.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0078_A09.b : nnnggttgtgacttaacxxxxxxxxxxxxxxxxxxxxx
MLN01_0040_G11.b : nnnccgctaggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0013_B05.b : nnnnggctagtgacttgacagtttgtacxxxxxxxxxxx
TCH01_0009_D09.b : nggttgtaggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_B02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_A10.b : nttngggtaggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0047_E12.b : nnnnnggctaggactatnacxxxxxxxxxxxxxxxx
TCH01_0036_B03.b : nntttcgctggacttgacxxxxxxxxxxxxxxxxxxxxx
TCH01_0047_C10.b : nnnnggataggacttanacxxxxxxxxxxxxxxxxxxxxx
TCH01_0047_D09.b : nnnnaacttggactatnacxxxxxxxxxxxxxxxxxxxxx
MLN01_0074_D09.b : ggttggctatgacxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0027_G09.b : nttccaatgacgacgcagtatgxxxxxxx
TES01_0107_D02.b :
TES01_0023_G08.b :
SMG01_0091_E11.b : ggaatttttnnnnnnggagtaaagcaggcgg
BMWN1_0077_B07.b : nttacagagaagaggccgntaxxxxxxxxxx
SKNB1_0033_D10.b :
SKNB1_0005_A08.b :
SKNB1_0096_H02.b :
SMG01_0014_C06.b : ngagttcttnnnggatxxxxxxx
TES01_0065_H08.b :
SKNB1_0083_B06.b :
CLNT1_0035_D09.b : aatccgttagctgacgxxxxxxxxxxxxxx
TES01_0060_H02.b :
PBL01_0102_G06.b : nnngggctgaacax
SPL01_0087_C10.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxxxx
ADR01_0032_H06.b : aaaaanggatxxxxxxxx
SKNB1_0044_G06.b :
SKNB1_0056_D02.b :
CLNT1_0097_E08.b : tggatccgttagctgacgxxxxxxxxxxxxxx
TCH01_0073_H06.b : cgggttggttggacttgacagtttgtacxxxxx
CLNT1_0095_C06.b : nccgttttnnngggacccgtcagcgttcgxxxxxxxxxxxx
SKNB1_0011_H01.b :
TES01_0047_D10.b :
PST01_0074_E09.b :
SKNB1_0042_E08.b :
SKNB1_0007_H09.b :
MLN01_0025_C09.b : nnnggtaggacttgacagtttgtacxxxxxxxxxx
TES01_0007_H06.b :
PST01_0088_A03.b :
TES01_0039_B01.b :
TES01_0036_F10.b :
SKNB1_0050_C07.b :
SKNB1_0030_E03.b :
SMG01_0003_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0069_D02.b :
UTR01_0013_C02.b : ggggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0017_C12.b : gtattcgatntgggtaaag
SKNB1_0065_F05.b :
SKNB1_0040_G12.b :
OVR01_0090_B09.b : nnggctaggactatcacxxxxxxxxxxxxxxxxxxx
SMG01_0067_D10.b : ncgcatttnnnntgag
SKNB1_0059_C07.b :
SKNB1_0020_D01.b :
SKNB1_0081_C06.b :
SKNB1_0019_A07.b :
PST01_0090_D05.b :
SKNB1_0011_G08.b :
PCT01_0010_C04.b :
SKNB1_0091_B03.b :
SKNB1_0074_B01.b :
CLNT1_0081_A10.b : nnggggtcgctnngnnccgactgcgacgagtgtcttcgc
CLNT1_0077_B04.b : nnnnccgttagcgtcggxxxxxxxxxxxxxx
UTR01_0085_E01.b : nnnnnggcttggactatgacxxxxxxxxxxxxxxxxxxx
SKNB1_0033_G06.b :
UTR01_0059_H08.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0043_B12.b : gggttncccaggattggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0044_E02.b :
UTR01_0061_D06.b : gctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0065_E11.b :
ITT01_0047_A03.b : nnnggatgaacxxxx
SKNB1_0014_B07.b :
PST01_0096_H06.b :
SKNB1_0039_C08.b :
PST01_0059_D09.b :
SKNB1_0009_C04.b :
THY01_0066_G10.b : tttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0053_E02.b : nnnnggctagtgacttgacagtttgtacxxxxxxxxx
PST01_0007_B01.b :
PST01_0064_C07.b :
SKNB1_0018_D09.b :
SKNB1_0072_B08.b :
PST01_0011_F10.b :
PST01_0034_A11.b :
SKNB1_0038_A02.b :
PST01_0058_F09.b :
PBL01_0065_H10.b : nnnaagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_H07.b : nnnggagtaag
ITT01_0067_G11.b : nnnnggctgaacaxxxx
TCH01_0010_G11.b : nnngggtaggacttgacagtttgtcxxxxx
TCH01_0038_H01.b : nnnnggctagtgacttgacxxxxxxxxxxxxxx
OVRM1_0117_B11.b : nagttgtcxxxxxxxxxx
SMG01_0049_E05.b : aaaanggataaag
ITT01_0001_A03.b : nnngggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0099_C10.b : naatgaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0083_H07.b : nnnggctaggacttaaacxxxxxxxxxxxxxxxxx
TCH01_0014_H06.b : nnnaagctagtgacttnacxxxxxxxxxxxxxxxxxx
TES01_0025_A10.b :
TES01_0046_H09.b :
TES01_0051_H01.b :
TES01_0029_C06.b :
LNG01_0026_E05.b : ttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0080_A01.b : nnggctatttnggnctagttagcgacgaggttxxxxxxxx
LNG01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0074_A03.b : nnnnggctaggacttagacxxxxxxxxxxxxxxxx
PST01_0055_A06.b :
TES01_0080_G05.b :
TES01_0038_G10.b :
PCT01_0015_H02.b :
TES01_0057_A11.b :
SKNB1_0081_C04.b :
SKNB1_0019_E09.b :
PST01_0035_H08.b :
SKNB1_0092_E07.b :
ITT01_0060_D11.b : nnnggtgaaacax
SKNB1_0046_F02.b :
SKNB1_0021_C03.b :
ILNT1_0075_F01.b : nccaaatgaagaggccgtaxx
SKNB1_0085_E05.b :
TES01_0039_A02.b :
SKNB1_0048_F05.b :
PST01_0028_A04.b :
PST01_0012_G11.b :
SKNB1_0063_C11.b :
MLN01_0020_D08.b : nnttcagtggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0042_F02.b :
PST01_0003_D05.b :
SKNB1_0078_F12.b :
PCT01_0020_E07.b :
BMWN1_0087_A02.b : nnggaccgagtagaggcag
UTR01_0013_C06.b : gxxxxxxxxxxxxxxxxxxx
CLNT1_0149_H05.b : nnnncctc
UTR01_0062_H11.b : gctxxxxxxxxxxxxxxxxxxxx
SKNB1_0089_G09.b :
SKNB1_0080_F10.b :
THY01_0118_C01.b :
MLN01_0088_D11.b : gctagtga
TCH01_0036_H04.b :
OVR01_0067_H08.b :
LNG01_0064_F10.b : tt
TCH01_0048_E08.b :
TCH01_0030_C12.b :
TCH01_0016_C09.b :
ITT01_0009_D03.b :
OVRM1_0100_G10.b :
SKNB1_0019_F05.b :
PBL01_0041_F11.b :
MLN01_0020_B11.b :
MLN01_0023_C04.b : tgtgactxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0027_C03.b :
LNG01_0090_A01.b :
SPL01_0098_B07.b :
OVRM1_0157_G11.b :
ADR01_0084_G09.b :
SMG01_0068_B08.b :
OVR01_0047_C07.b :
ITT01_0040_H04.b :
SPL01_0093_F09.b :
SKNB1_0058_A08.b :
SPLT1_0031_F04.b :
SKNB1_0078_H10.b :
SKNB1_0022_H06.b :
ILNT1_0036_B06.b :
SPLT1_0039_A06.b :
ILNT1_0098_F05.b :
ILNT1_0048_D11.b :
20110601C-000678 : TGGTAGTGGGGGACTGCGTTCGCGCTTTGGCCTACTCTGGCTCTCG*CCAG*GCG*TCCT
---------+---------+---------+---------+---------+---------+ 186
ITT01_0098_C11.b : tggtagtgggggactgcgttcgcgctttcccctgCC*TC*CTCTCG*CCAG*GCG*TCCT
SPL01_0025_G12.b : xxxxxxxxxxxxxxxxxxxxxxcttGTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
SMG01_0003_A07.b : gtacggntcggaattctcgagcaggnTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
LNG01_0002_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
OVR01_0062_F07.b : xxxxxxxxxxxxxxxxxxxxxxxttgTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
MLN01_0056_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxgTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
LNG01_0002_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
SPL01_0026_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxttgTGGCCTACT*G**CTCTCG*CCAG*GCG*TCCT
LNG01_0056_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxgttggCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
SPL01_0097_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTACT*GG*CTCTCG*CCAG*GCG*TCCT
TES01_0073_A06.b : ncctgctgtgGCTCT*GG*CTCTCG*CC*G*GCG*TCCT
TES01_0026_D02.b : tgtgGCTCT*GG*CTCTCG*CC*G*GCG*TCCT
OVR01_0027_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxctcgttCTACT*GG*CTCTCG*CCAG*GCG*TCCT
UTR01_0092_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*CTCTC*CTCTCG*CCAG*GCG*TCCT
LNG01_0030_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxtgttggCTACT*GG*CTCTCG*CCAG*GCG*TCCT
THY01_0017_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGCT*CT*CTCTCG*CCAG*GCG*TCCT
SMG01_0087_G10.b : acggntccgnaatcctcgagcacggttggcctTACT*GG*CTCTCG*CCAG*GCG*TCCT
OVR01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACT*GG*CTCTCG*CCAG*GCG*TCCT
UTR01_0098_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGGCTCTC*CTCTCG*CCAG*GCG*TCCT
OVR01_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcgttaTACTGG*CTCTCG*CCAG*GCG*TCCT
OVRM1_0101_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctCTCTC*CTCTCG*CCAG*GCG*TCCT
SPL01_0017_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*CT*CTCTCG*CCAG*GCG*TCCT
UTR01_0007_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*GG*CTCTCG*CCAG*GCG*TCCT
UTR01_0089_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTCTC*CTCTCG*CCAG*GCG*TCCT
LVR01_0042_F06.b : xxxxxxxxxxxxxxxxxxxxxcctttgctactggCTCTC*CTCTCG*CCAG*GCG*TCCT
LNG01_0062_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCTCG*CCAG*GCG*TCCT
CBLT1_0074_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTCTCTCTCTCG*CCAG*GCG*TCCT
MLN01_0005_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCT*CT*CTCTCG*CCAG*GCG*TCCT
LNG01_0021_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
ITT01_0008_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
SMG01_0024_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttCTCTC*CTCTCG*CCAGNGCG*TCCT
ITT01_0009_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
MLN01_0054_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCTCTCTCTCTCG*CCAG*GCG*TCCT
MLN01_0022_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCTCG*CCAG*GCG*TCCT
ITT01_0067_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
SPL01_0084_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
UTR01_0048_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
MLN01_0084_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
UTR01_0085_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*CT*CTCTCG*CCAG*GCG*TCCT
CBLT1_0071_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTCTCTCTCTCG*CCAG*GCG*TCCT
CBLT1_0006_G06.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxgctCTCTC*CTCTCG*CCAG*GCG*TCCT
LNG01_0064_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTC*CTCTCG*CCAG*GCG*TCCT
SPLT1_0026_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaagC*TC*CTCTCG*CCAG*GCG*TCCT
SMG01_0031_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCTCG*CCAG*GCG*TCCT
OVR01_0037_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgttaaACTGGCTCTCG*NCAG*GNG*NCCT
OVR01_0041_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttaaACTGGCTCTCG*CCAG*GCG*TCCT
MLN01_0080_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCTCG*CCAG*GCG*TCCT
OVR01_0012_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGCTCTCTCG*CCAG*GCG*TCCT
TES01_0017_D05.b : gcgtggctcTGGCTCTCTCT*CCCG*GCG*TCCT
OVR01_0075_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG*CTCTCG*CCAG*GCG*TCCT
SPL01_0042_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
OVRM1_0153_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTC*CTCTCG*CCAG*GCG*TCCT
OVRM1_0070_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
SMG01_0059_C07.b : agcggnacggntccgaaatcctcgagcaggnttggcCTGGCTCTCG*CCAG*GCG*TCCT
OVR01_0097_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTC*CTCTCG*CCAG*GCG*TCCT
TES01_0111_B06.b : ttcctgctgttgctCTGGCTCTCC*GCCG*GCG*TCCT
CLNT1_0116_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
TCH01_0053_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
ILNT1_0077_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTC*CTCTCG*CCAG*GCG*TCCT
SPL01_0058_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTC*CTCTCG*CCAG*GCG*TCCT
MLN01_0007_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTCTCTCTCG*CCAG*GCG*TCCT
LNG01_0033_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
LVR01_0050_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCTCTCTCTCG*CCAG*GCG*TCCT
SPL01_0045_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTC*CTCTCG*CCAG*GCG*TCCT
SKNB1_0050_E05.b : nnnnncctcctgtggctATGGCTCTCG*CC*G*GCG*TCCT
OVR01_0047_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
THY01_0008_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
CLNT1_0138_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
ITT01_0058_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctCTCTCTCTCG*CCAG*GCG*TCCT
LNG01_0001_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcCTC*CTCTCG*CCAG*GCG*TCCT
SMG01_0086_F11.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
SMG01_0064_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
ITT01_0060_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
LNG01_0081_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTC*CTCTCG*CCAG*GCG*TCCT
MLN01_0029_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccCTC*CTCTCG*CCAG*GCG*TCCT
BMWN1_0088_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccCTC*CTCTCG*TCAG*GCG*TCCT
MLN01_0094_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
MLN01_0061_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
LNG01_0019_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGCTCTCTCG*CCAG*GCG*TCCT
OVR01_0045_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCTCG*CCAG*GCG*TCCT
OVR01_0097_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
CLNT1_0003_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccCTGGCTCTCG*CCAG*GCG*TCCT
UTR01_0106_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
THY01_0072_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
THY01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
THY01_0095_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
MLN01_0079_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTC*CTCTCG*CCAG*GCG*TCCT
SPL01_0019_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
OVR01_0085_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTC*CTCTCG*CCAG*GCG*TCCT
OVR01_0001_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
PBL01_0091_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCTCTCG*CCAG*GCG*TCCT
ITT01_0027_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCTCG*CCAG*GCG*TCCT
UTR01_0091_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCTCG*CCAG*GCG*TCCT
THY01_0111_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
THY01_0107_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
THY01_0122_F09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgAAACTCTCG*CCAG*GCG*TC*T
OVR01_0082_B07.b : taxxxxxxxxxxxxxxxxxxxxxxGG*CTCTCG*CCAG*GCG*TCCT
THY01_0120_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
TES01_0093_D04.b : tttctggctgttgctctgatcgagtcggccttgtTGGCTCTCG*CC*G*GCG*TCCT
TES01_0093_E12.b : tttttcctcgctttgctaTGGCTCTCG*CCAG*GCG*TCCT
TES01_0077_F08.b : acggcgtggctaTGGCTCTCTCGCCG*GCG*TCCT
SPL01_0034_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
LVRM1_0123_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
LVRM1_0097_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG*CTCTCG*CCAG*GCG*TCCT
OVRM1_0130_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
TES01_0024_F08.b : tgtggctatgGGGCTCTCG*CC*G*GCG*TCCT
THY01_0042_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
BMWN1_0018_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
PBL01_0001_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
THY01_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCTCTCG*CCAG*GCG*TCCT
SPL01_0012_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGCTCTCG*CCAG*GCG*TCCT
UTR01_0025_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG*CTCTCG*CCAG*GCG*TCCT
THY01_0003_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCTCG*CCAG*GCG*TCCT
UTR01_0028_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*CTCTCG*CCAG*GCG*TCCT
UTR01_0070_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
TES01_0019_G06.b : cgctgtggctaTGGCTCTCT*CCCG*GCG*TCCT
UTR01_0041_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCTCTCG*CCAG*GCG*TCCT
UTR01_0015_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
OVRT1_0121_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
SMG01_0063_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntGGGCTCTCG*CCAG*GCG*TCCT
OVR01_0041_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxccggtaaaaTGGCTCTCG*CCAG*GNG*NC*T
ILNT1_0032_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
MLN01_0091_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG*CTCTCG*CCAG*GCG*TCCT
MLN01_0090_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
SMG01_0008_B02.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG*CTCTCG*CCAG*GCG*TCCT
OVRT1_0007_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
SMG01_0075_F08.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
SKNB1_0041_D10.b : nnnnnttcgctgtggctaTGGCTCTCT*CCCG*GCG*TCCT
UTR01_0069_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
ITT01_0093_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
THY01_0053_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
SPL01_0082_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
MLN01_0102_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
CBLT1_0100_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
LNG01_0070_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
CLNT1_0052_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
OVR01_0028_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtcataTGGCTCTCG*CCAG*GCG*TCCT
SPL01_0073_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
PBL01_0087_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCTCTCG*CCAG*GCG*TCCT
UTR01_0107_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
MLN01_0080_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
LNG01_0004_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
PBL01_0100_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
CBLT1_0100_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
ILNT1_0017_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCTCG*CCAG*GCG*TCCT
LNG01_0064_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
MLN01_0078_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTCTCTCG*CCAG*GCG*TCCT
TES01_0004_D01.b : ntttcccgctgtggctctggggCTCCTCTCG*CC*G*GCG*TCCT
SKNB1_0070_D11.b : nnnccgctgcgttggctaCGGCTCTCT*CCCG*GCG*TCCT
ITT01_0031_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
ITT01_0071_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
CLNT1_0019_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctTGGCTCTCG*CCAG*GCG*TCCT
PBL01_0062_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTCTCG*CCAG*GCG*TCCT
THY01_0125_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
PBL01_0019_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVRM1_0158_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
OVRM1_0083_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
OVRM1_0124_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVRM1_0088_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
UTR01_0014_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
UTR01_0010_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGGCTCTCG*CCAG*GCG*TCCT
SPL01_0034_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0100_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
UTR01_0079_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0060_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
OVR01_0059_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
UTR01_0006_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SMG01_0019_E10.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
UTR01_0041_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
THY01_0043_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
PBL01_0010_B10.b : cagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0056_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0042_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SPL01_0099_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SPL01_0082_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
HTMT1_0119_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCTCG*CCAG*GCG*TCCT
SMG01_0028_H06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
UTR01_0005_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SMG01_0097_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
BMWN1_0079_G03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*CTCTCG*CCAG*GCG*TCCT
LNG01_0048_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgggcCTCTCTCG*CCAG*GCG*TCCT
SMG01_0081_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
LNG01_0107_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SPL01_0100_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0067_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0069_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0033_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SMG01_0059_E05.b : cagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
TCH01_0019_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagtcGGCTCTCG*CCAG*GCG*TCCT
MLN01_0013_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgGGCTCTCC*CCAC*GCG*TCCT
UTR01_0096_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCCCG*CCAG*GCG*TCCT
UTR01_0088_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
LNG01_0021_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
LNG01_0010_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
LNG01_0030_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
UTR01_0075_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
MLN01_0054_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
PBL01_0039_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
LVR01_0019_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0006_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
THY01_0091_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0006_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
PBL01_0020_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
LVR01_0079_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SMG01_0038_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxGGCTCTCG*CCAG*GCG*TCCT
OVRT1_0121_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SKNB1_0051_A06.b : nnnnncctgctgtggctaGGCTCTCG*CC*G*GCG*TCCT
CLNT1_0027_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGTCTCTCG*CCAG*GCG*TCCT
SMG01_0038_G08.b : cagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
THY01_0065_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
ADR01_0034_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
TCH01_0016_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGCCTCTCG*CCAG*GCG*TCCT
SPL01_0047_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SMG01_0016_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0047_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
MLN01_0008_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
CLNT1_0118_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
OVR01_0090_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtggggTCCTCTCG*CCAG*GCG*TCCT
UTR01_0048_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
THY01_0057_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCTCG*CCAG*GCG*TCCT
MLN01_0062_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
OVR01_0019_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
TCH01_0065_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCTCTCG*CCAG*GCG*TCCT
CLNT1_0091_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCTCTCG*CCAG*GCG*TCCT
SPL01_0091_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
TCH01_0050_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0035_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
MLN01_0091_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
UTR01_0053_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
TCH01_0044_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggaTCCTCTCG*CCAG*GCG*TCCT
MLN01_0035_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SKNB1_0030_F12.b : nnnattctcgctgtggctacGGCTCTCG*CC*G*GCG*TCCT
ITT01_0022_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
SPL01_0090_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
THY01_0090_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
ITT01_0022_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SKNB1_0072_B05.b : nnnggttgacggtggcacGGCTCTCG*CC*G*GCG*TCCT
ITT01_0058_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
THY01_0093_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
MLN01_0039_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
LVR01_0010_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
ITT01_0063_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
SPL01_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
PBL01_0077_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
CLNT1_0071_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
OVR01_0097_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
ITT01_0017_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTCTCG*CCAGNGCG*TCCT
SPL01_0032_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
TCH01_0079_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACTCTCG*CCAG*GCG*TCCT
ITT01_0063_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
LNG01_0064_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
ITT01_0038_H10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
ITT01_0011_C12.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GTG*TCCT
ITT01_0011_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
ITT01_0023_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTCTCG*CCAG*GCG*TCCT
ITT01_0078_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCTCG*CCAG*GCG*TCCT
ILNT1_0012_F05.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
LNG01_0073_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctaGCTCTCG*CCAG*GCG*TCCT
SPLT1_0050_A09.b : tagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCC*TCCT
SMG01_0056_E01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ILNT1_0011_A04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SPLT1_0034_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
UTR01_0008_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SMG01_0070_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGCTCTCG*CCAG*GCGNTCCT
UTR01_0033_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
OVR01_0065_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SMG01_0027_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxctgCCTCTCG*CCAG*GCG*TCCT
SMG01_0097_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGCTCTCG*CCAG*GCGCTCCT
ILNT1_0059_H10.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SPLT1_0094_B12.b : atttaatactcttcactagagggtaatttaaatgatttgTCTCTCG*CCAGGCGC*TCCT
BMWN1_0029_C11.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCTCG*CCTT*TCG*TCCT
ILNT1_0052_C01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
OVR01_0090_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ITT01_0025_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGCTCTCG*CCAG*GCG*TCCT
SMG01_0097_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGCTCTCG*CCAGGCGN*TCCT
ITT01_0102_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
SPLT1_0057_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
PTG01_0046_C02.b : gcagcggnacggnccggaatcctcgagcacggttggcctGCTCTCG*CCAG*GCG*TCCT
CLNT1_0070_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
ILNT1_0045_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAC*GTT*TCCT
TCH01_0073_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
SPLT1_0086_G05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ITT01_0061_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
SMG01_0061_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
CBLT1_0030_E06.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TTTT
LNG01_0088_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTCTCG*CCAG*GCG*TCCT
SMG01_0079_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGCTCTCG*CCAG*GCGNTCCT
OVR01_0064_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
LNG01_0099_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaACTCTCG*CCAG*GCG*TCCT
MLN01_0058_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
LNG01_0017_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
MLN01_0027_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
LNG01_0087_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
LNG01_0083_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTCTCTCG*CCAG*GCG*TCCT
LNG01_0033_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ITT01_0027_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGCTCTCG*CCAG*GCG*TCCT
ILNT1_0081_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ITT01_0039_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
ILNT1_0093_F09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAC*GCT*TCCT
LNG01_0056_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
LNG01_0088_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
ILNT1_0088_B08.b : tagtatttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCCTCTCG*CCAG*GCG*TCCT
UTR01_0046_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
OVR01_0005_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgACTCTCG*CCAG*GCG*TCCT
LNG01_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SPLT1_0074_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
LNG01_0002_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
TCH01_0097_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
TCH01_0025_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
TCH01_0097_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ILNT1_0014_B07.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ILNT1_0090_A10.b : tagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCCTCTCG*CCAG*GCG*TCCT
ILNT1_0100_F04.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SKNB1_0042_B01.b : nnggtacagctgtggctcGCTCTCG*CC*G*GCG*TCCT
CLNT1_0045_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTCTCG*CCAG*GCG*TCCT
ITT01_0100_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
OVR01_0061_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGCTCTCG*CCAG*GCG*TCCT
PBL01_0096_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ILNT1_0033_C06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ILNT1_0049_B04.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
SKNB1_0098_B05.b : nnncctggctgttggctctggaaaaACTCTCG*CCAG*GCG*TCCT
CLNT1_0053_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCTCG*CCAG*GCG*TCCT
ITT01_0011_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCG*CCAG*GCG*TCCT
ADR01_0100_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
ITT01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTCG*CCAG*GCG*TCCT
MLN01_0029_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTCTCG*CCAG*GCG*TCCT
SMG01_0010_B01.b : cggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0084_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0053_B06.b : ggntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0004_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0121_F07.b : gctggtacggtccggaatcctcagcactgtggcctactggCTCTCG*CCAG*GCG*TCCT
SMG01_0098_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTCG*CCAG*GCG*TCCT
THY01_0111_A09.b : ggtccggaatcctcagcacgtggcctactggggctctctcCTCTCG*CCAG*GCG*TC*T
THY01_0108_H09.b : caggctggtacggtcggaatcctcagcactgtggctatggCTCTCG*CC*G*GCG*TCCT
OVR01_0080_G10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0054_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0111_H03.b : gcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TC*T
THY01_0104_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0094_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0120_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0098_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0108_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0126_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TES01_0038_H05.b : tgtggctatGGCTCT*CCCG*GCG*TCCT
LVRM1_0193_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0057_B04.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVRM1_0086_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0022_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0022_F07.b : cggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVR01_0081_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0067_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0084_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0076_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0004_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0007_G12.b : tggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0002_F09.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0076_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0004_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVRM1_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0082_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0154_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0080_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0198_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0093_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTCG*CCAG*GCGNTCCT
PBL01_0003_C12.b : tggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0179_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0170_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVRM1_0152_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0169_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0169_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0014_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0187_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0058_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0042_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0208_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0070_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0100_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTCG*CCAG*GCG*TCCT
OVR01_0101_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PTG01_0102_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgaCTCTCG*CCAG*GCGNTCCT
SPL01_0023_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0102_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0014_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0071_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0011_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRM1_0022_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
ADR01_0015_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCC
SMG01_0016_D08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0028_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0014_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0076_B06.b : ggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0016_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVR01_0038_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0069_G01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0070_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0013_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0039_G11.b : gcggnacggntccgnattcctcgagcaggnttggcctatgCTCTCG*CCAG*GCG*TCCT
SPL01_0014_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0030_H12.b : ggnccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0021_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0024_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0025_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0025_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0050_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0014_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0070_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0020_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TCH01_0045_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0019_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0008_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0028_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0027_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0096_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0007_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0028_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0026_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0022_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0060_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0052_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0009_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0101_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0025_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0059_F12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0012_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0103_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0059_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0034_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0027_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0021_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0036_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0098_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0040_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0103_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TES01_0112_D12.b : ttctgctgtggctatgGTCTCT*CCCG*GCG*TCCT
UTR01_0039_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TES01_0032_C08.b : cgttggctctggtcctcGTCTCG*CCAG*GCG*TCCT
UTR01_0042_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0036_H05.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0064_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0068_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0014_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0103_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0017_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0042_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
ADR01_0035_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0013_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0019_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0013_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0077_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0098_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0003_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCGG*GCG*TCCT
UTR01_0016_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0014_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0007_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0016_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0053_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0070_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0066_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0021_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0036_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0004_A05.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0026_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0119_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0034_E01.b : ggnacggntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0032_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0020_B12.b : nnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0062_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0098_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0136_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0018_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0063_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
MLN01_0017_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0048_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PBL01_0039_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0047_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
ITT01_0041_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0035_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0101_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0003_C11.b : cggtacggntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0045_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0001_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0070_H09.b : cggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0037_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0065_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0082_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0046_F08.b : ggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0072_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0079_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0090_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTCG*CCAG*GCGNTCCT
ADR01_0007_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0047_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0083_H11.b : cggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0106_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0050_G11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0064_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0053_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0042_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCC
LNG01_0035_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0074_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0038_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0071_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
PTG01_0034_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0045_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TES01_0038_A06.b : ccacgctggctctGGCTCT*CCCG*GCG*TCCT
TCH01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
ADR01_0022_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVRT1_0079_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0093_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTCTCG*CCAG*GCGNTCCT
OVR01_0068_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0061_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0071_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
MLN01_0025_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TCH01_0018_H10.b : nnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0017_H01.b : ggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0083_E10.b : nnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAGGGCG*TCCT
LNG01_0008_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCTCTCG*CCAG*GCG*TCCT
CLNT1_0110_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0004_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0098_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0029_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0060_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0081_G02.b : cgtgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0095_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0088_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0201_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
MLN01_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0015_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0030_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0099_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0080_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
THY01_0018_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
CLNT1_0119_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0030_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0072_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0085_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0058_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0089_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0044_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0056_H03.b : ggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0037_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0012_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0033_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
TCH01_0054_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0036_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0022_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0041_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0032_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0057_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0080_E12.b : ggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SKNB1_0033_B02.b : nnnggctttnnnnnnncctacgggtgctcggctctCTCTCG*CC*G*GCG*TCCT
UTR01_0076_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LNG01_0086_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0059_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0083_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0048_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0036_C04.b : cggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
UTR01_0083_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
ITT01_0002_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0075_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
OVR01_0045_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
LVR01_0031_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SPL01_0076_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT
SMG01_0078_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCTCG*CCAG*GCG*TCCT