[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000709

Length: 1,080

Sequence [FASTA format sequence]
ACATAGGCCG TCTTCAGCCG CAGCATCGAG TCGGCCGTCT TCAGCCGCAG CATCGAGTCG
GCCGTCTTCA GCCGCAGCAT CGAGTCGGCC GTCTTCAGCC GCAGCATCGA GTCGGCCTTG
TTGGCCGGCT GTGACAATTC AAGATGGCGA AGGACCTGGA CGAGCTCTTG GATGAGGTCG
AGTCCAAGTT CTGCGGATCA GACCCCCTGA GACTGGGCAT TGTCGAGCGG CCCAGAGGCT
GCGGCGGCGG TGTCCTCAGC AACGACCGGA GCCGAGCCGA GGAGAAAGAG ACTCTCAGAC
CAACAGAAAC ATTTAAAAAA GAAGATGATC TTGACAGTCT TATTAATGAA ATATTTGAAG
AGCCCAACTT TGACAAAAAA CACTTTAAAT TAAAGTCTAC ATCTTCAGGT AACGCATCTG
TCAGAGCTCC CACTCAAGGC CTTGGTAAAA GTTGCAGCCC AGTGTACCTT GGTGGAAGTG
CTGTTCCTTG TGGGATTGGG ACAAATACTT CACAGAGAGC GTGTGACCAT CTGCGTTGTA
TAGCATGTGA TTTCTGGATA GTAAGCTACG ATGACCATAG GTGGGACACA TCATGCGATT
ACCTGTTTTT CAGGAACAAT ATGCCAGAAT TCCACAAATT GAAAACAAAG TTGGTAAAGA
AGAAAGGAAC ACGGGCCTAT GCCTGCCAGT GCAGCTGGAG AACCATTGAA GCACTGACTG
ACCTTCAGAA TGACCATCAG CTTCGCTGGG TTTGCGGTAA ACACTAAGGA TGCAGGCTTT
CCACATTCAG ACAGATGCCT CCATGAGAGC AGTCTCAGGT CATGGTCACA ACATTTAGGT
AAAGGGACAG AACAATATCA TGGAAAAGAG AGGAAATTTC CTTTCGTGGC TGCGCACATT
TTTGAAGACG AAATGGACTT GAGAAGATAA TGTGCTTTAA CAGTTTAGAA TTATTCCTTT
TTGCTAGATG GACATTTCAC TTAATAAGTA AAGTGTTGAG TTATCCAAAT ACTTCTTTGC
TAGCCTCTCT CCTGGTAAAT AGCAGTTTAA TTGTGTAGTT TCATATAAAT ATGAACTATA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC8orf37hypothetical protein LOC157657 [Homo sapiens]. 3401e-93O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly Protein2610301B20Rikhypothetical protein LOC67157 [Mus musculus]. 3271e-89O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611815PREDICTED: hypothetical protein XP_849528 [Canis familiaris]. 2556e-68


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC614744PREDICTED: hypothetical protein [Bos taurus]. 3509e-97O
Contig/Assembly ProteinLOC614744PREDICTED: hypothetical protein [Bos taurus]. 3509e-97O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153417PREDICTED: uncharacterized protein C8orf37 homolog [Sus scrofa]. 417e-117O


Assembly Members: 16      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10053A01BMWN1_0053_A01.bHX208768 
HTMT10133C06HTMT1_0133_C06.bHX225299 
ITT010081D08ITT01_0081_D08.bBW983199 
LNG010011A12LNG01_0011_A12.bBP433906 
LNG010042F10LNG01_0042_F10.bBP438738 
MLN010001H12MLN01_0001_H12.bBW963337 
MLN010066H09MLN01_0066_H09.bCJ012898 
OVRM10056D05OVRM1_0056_D05.bBP149098 
OVRM10092G09OVRM1_0092_G09.bBP153279 
OVRM10117F06OVRM1_0117_F06.bBP151737 
OVRM10206G05OVRM1_0206_G05.bBP460789 
OVRT10032E07OVRT1_0032_E07.bFS689000 
OVRT10039E07OVRT1_0039_E07.bFS689593 
OVRT10067A06OVRT1_0067_A06.bFS691856 
OVRT10129B06OVRT1_0129_B06.bHX237117 
UTR010022B08UTR01_0022_B08.bBP170217 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
286A900.600WNAAA/K
G240.400AGA/R
288C240.400WNCAG/Q
G900.600GAG/E
360A500.333WNAAG/K
G640.667GAG/E


Alignment:      TOP

20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LNG01_0042_F10.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : ggaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_D05.b :
HTMT1_0133_C06.b :
MLN01_0066_H09.b :
OVRT1_0032_E07.b :
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b :
ITT01_0081_D08.b :
MLN01_0001_H12.b :
OVRT1_0039_E07.b :
OVRT1_0067_A06.b :
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ......................ACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGT
---------+---------+---------+---------+---------+---------+ 38
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGT
LNG01_0011_A12.b : xxxxxxxxxxxxxxxxxxxxxxACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGT
OVRM1_0056_D05.b :
HTMT1_0133_C06.b :
MLN01_0066_H09.b :
OVRT1_0032_E07.b :
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b :
ITT01_0081_D08.b :
MLN01_0001_H12.b :
OVRT1_0039_E07.b :
OVRT1_0067_A06.b :
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : CTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAG
---------+---------+---------+---------+---------+---------+ 98
LNG01_0042_F10.b : CTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAG
LNG01_0011_A12.b : CTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAG
OVRM1_0056_D05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0133_C06.b : atttagggacggaacgacgccgtcgtattta
MLN01_0066_H09.b : agtgattagacagtttgtcxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_E07.b : ggaaccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_G05.b : gcgttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0117_F06.b : tagttgtcxxxxxxxxxxxxxxxxxx
BMWN1_0053_A01.b : nttttgccaagtagacgcagtagtattaaxxxxxxxxx
OVRT1_0129_B06.b : nnnccagtcctnnngnnnccgttagcgcacgxxxxxxxxxxxxxxx
ITT01_0081_D08.b : nnnggatgaacaxxxxxxxx
MLN01_0001_H12.b : nttttctgctgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_E07.b : nnnttccgtctgctgtcgxxxxxxxxxxxxxxxx
OVRT1_0067_A06.b : ngggcctcttctgcgtacgagtgxxxxxxxxxxxxxx
OVRM1_0092_G09.b : ncgttgtcxxxxxxxxxxxxxx
UTR01_0022_B08.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000709 : CCGCAGCATCGAGTCGGCCTTGTTGGCCGGCTGTGACAATTCAAGATGGCGAAGGACCTG
---------+---------+---------+---------+---------+---------+ 158
LNG01_0042_F10.b : CCGCAGCATCGAGTCGGCCTTGTTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : CCGCAGCATCGAGTCGGCCTTGTTGGCCTACTGGGACAATTCAAGATGGCGAAGGACCTG
OVRM1_0056_D05.b : xxxxxxtatagcaactgcagaggtggagGGCTGTGACAATTCAAGATGGCGAAGGACCTG
HTMT1_0133_C06.b : tcgactcctatagggaatttaatgaattGGCTGTGACCCTT*TAGATGGCGAAGGACCTG
MLN01_0066_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGACAATTCAAGATGGCGAAGGACCTG
OVRT1_0032_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGACAATTCAAGATGGCGAAGGACCTG
OVRM1_0206_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAATTCAAGATGGCGAAGGACCTG
OVRM1_0117_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAATTCAAGATGGCGAAGGACCTG
BMWN1_0053_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACAATTCAAGATGGCGAAGGACCTG
OVRT1_0129_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAATTCAAGATGGCGAAGGACCTG
ITT01_0081_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAATTCAAGATGGCGAAGGACCTG
MLN01_0001_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCAATTCAAGATGGCGAAGGACCTG
OVRT1_0039_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggAATTCAAGATGGCGAAGGACCTG
OVRT1_0067_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtATTCAAGATGGCGAAGGACCTG
OVRM1_0092_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAAGATGGCGAAGGACCTG
UTR01_0022_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCAAGATGGCGAAGGACCTG
20110601C-000709 : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
---------+---------+---------+---------+---------+---------+ 218
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRM1_0056_D05.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
HTMT1_0133_C06.b : GACGAGCTCTTGGATGAGGTCCATTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
MLN01_0066_H09.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRT1_0032_E07.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRM1_0206_G05.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRM1_0117_F06.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
BMWN1_0053_A01.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRT1_0129_B06.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
ITT01_0081_D08.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
MLN01_0001_H12.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRT1_0039_E07.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRT1_0067_A06.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
OVRM1_0092_G09.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
UTR01_0022_B08.b : GACGAGCTCTTGGATGAGGTCGAGTCCAAGTTCTGCGGATCAGACCCCCTGAGACTGGGC
20110601C-000709 : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
---------+---------+---------+---------+---------+---------+ 278
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACTGGAGCCGAGCC
OVRM1_0056_D05.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
HTMT1_0133_C06.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
MLN01_0066_H09.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRT1_0032_E07.b : ATTGTCGAGCGGCCCAGAAGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRM1_0206_G05.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRM1_0117_F06.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
BMWN1_0053_A01.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRT1_0129_B06.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
ITT01_0081_D08.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
MLN01_0001_H12.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRT1_0039_E07.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRT1_0067_A06.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
OVRM1_0092_G09.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
UTR01_0022_B08.b : ATTGTCGAGCGGCCCAGAGGCTGCGGCGGCGGTGTCCTCAGCAACGACCGGAGCCGAGCC
20110601C-000709 : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
---------+---------+---------+---------+---------+---------+ 338
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRM1_0056_D05.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
HTMT1_0133_C06.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
MLN01_0066_H09.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRT1_0032_E07.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRM1_0206_G05.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRM1_0117_F06.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
BMWN1_0053_A01.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRT1_0129_B06.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTAAAAAAAGAAGATGATCTTGACAGT
ITT01_0081_D08.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
MLN01_0001_H12.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRT1_0039_E07.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRT1_0067_A06.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
OVRM1_0092_G09.b : GAGGAGAGACAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
UTR01_0022_B08.b : GAGGAGAAAGAGACTCTCAGACCAACAGAAACATTTAAAAAAGAAGATGATCTTGACAGT
20110601C-000709 : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
---------+---------+---------+---------+---------+---------+ 398
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRM1_0056_D05.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
HTMT1_0133_C06.b : CTTATTAATGAAATATTTGAAAAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
MLN01_0066_H09.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTCGACAAAAAACACTTTAAATTAAAGTCT
OVRT1_0032_E07.b : CTTATTAATGAAATATTTGAAAAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRM1_0206_G05.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRM1_0117_F06.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
BMWN1_0053_A01.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRT1_0129_B06.b : CTTATTAATGAAATATTTGAAAAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
ITT01_0081_D08.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCC
MLN01_0001_H12.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRT1_0039_E07.b : CTTATTAATGAAATATTTGAAAAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRT1_0067_A06.b : CTTATTAATGAAATATTTGAAAAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
OVRM1_0092_G09.b : CTTATTAATGAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
UTR01_0022_B08.b : CTTATTAATAAAATATTTGAAGAGCCCAACTTTGACAAAAAACACTTTAAATTAAAGTCT
20110601C-000709 : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
---------+---------+---------+---------+---------+---------+ 458
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRM1_0056_D05.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
HTMT1_0133_C06.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
MLN01_0066_H09.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRT1_0032_E07.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRM1_0206_G05.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRM1_0117_F06.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
BMWN1_0053_A01.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRT1_0129_B06.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
ITT01_0081_D08.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
MLN01_0001_H12.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRT1_0039_E07.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRT1_0067_A06.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
OVRM1_0092_G09.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGTAGC
UTR01_0022_B08.b : ACATCTTCAGGTAACGCATCTGTCAGAGCTCCCACTCAAGGCCTTGGTAAAAGTTGCAGC
20110601C-000709 : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
---------+---------+---------+---------+---------+---------+ 518
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRM1_0056_D05.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
HTMT1_0133_C06.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
MLN01_0066_H09.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRT1_0032_E07.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRM1_0206_G05.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRM1_0117_F06.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
BMWN1_0053_A01.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRT1_0129_B06.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
ITT01_0081_D08.b : CCAGTGTACCTTGGTGGAAGTGCTGTCCCTTGTGGGATTGGGACAAATACTTCACAGAGA
MLN01_0001_H12.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRT1_0039_E07.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRT1_0067_A06.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
OVRM1_0092_G09.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
UTR01_0022_B08.b : CCAGTGTACCTTGGTGGAAGTGCTGTTCCTTGTGGGATTGGGACAAATACTTCACAGAGA
20110601C-000709 : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
---------+---------+---------+---------+---------+---------+ 578
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRM1_0056_D05.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
HTMT1_0133_C06.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
MLN01_0066_H09.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRT1_0032_E07.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRM1_0206_G05.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRM1_0117_F06.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
BMWN1_0053_A01.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRT1_0129_B06.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
ITT01_0081_D08.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
MLN01_0001_H12.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRT1_0039_E07.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRT1_0067_A06.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
OVRM1_0092_G09.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
UTR01_0022_B08.b : GCGTGTGACCATCTGCGTTGTATAGCATGTGATTTCTGGATAGTAAGCTACGATGACCAT
20110601C-000709 : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
---------+---------+---------+---------+---------+---------+ 638
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRM1_0056_D05.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
HTMT1_0133_C06.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
MLN01_0066_H09.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRT1_0032_E07.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRM1_0206_G05.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRM1_0117_F06.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
BMWN1_0053_A01.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRT1_0129_B06.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
ITT01_0081_D08.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
MLN01_0001_H12.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRT1_0039_E07.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRT1_0067_A06.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
OVRM1_0092_G09.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
UTR01_0022_B08.b : AGGTGGGACACATCATGCGATTACCTGTTTTTCAGGAACAATATGCCAGAATTCCACAAA
20110601C-000709 : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
---------+---------+---------+---------+---------+---------+ 698
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRM1_0056_D05.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
HTMT1_0133_C06.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
MLN01_0066_H09.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCCGG
OVRT1_0032_E07.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRM1_0206_G05.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRM1_0117_F06.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
BMWN1_0053_A01.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRT1_0129_B06.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
ITT01_0081_D08.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
MLN01_0001_H12.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRT1_0039_E07.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRT1_0067_A06.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
OVRM1_0092_G09.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
UTR01_0022_B08.b : TTGAAAACAAAGTTGGTAAAGAAGAAAGGAACACGGGCCTATGCCTGCCAGTGCAGCTGG
20110601C-000709 : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
---------+---------+---------+---------+---------+---------+ 758
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRM1_0056_D05.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
HTMT1_0133_C06.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
MLN01_0066_H09.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRT1_0032_E07.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRM1_0206_G05.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRM1_0117_F06.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGN
BMWN1_0053_A01.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRT1_0129_B06.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
ITT01_0081_D08.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
MLN01_0001_H12.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRT1_0039_E07.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRT1_0067_A06.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
OVRM1_0092_G09.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
UTR01_0022_B08.b : AGAACCATTGAAGCACTGACTGACCTTCAGAATGACCATCAGCTTCGCTGGGTTTGCGGT
20110601C-000709 : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
---------+---------+---------+---------+---------+---------+ 818
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRM1_0056_D05.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
HTMT1_0133_C06.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
MLN01_0066_H09.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRT1_0032_E07.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRM1_0206_G05.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCCCAG
OVRM1_0117_F06.b : TAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
BMWN1_0053_A01.b : AAACACTAAGGATGCAGGCTTTTCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRT1_0129_B06.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
ITT01_0081_D08.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
MLN01_0001_H12.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRT1_0039_E07.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRT1_0067_A06.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
OVRM1_0092_G09.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
UTR01_0022_B08.b : AAACACTAAGGATGCAGGCTTTCCACATTCAGACAGATGCCTCCATGAGAGCAGTCTCAG
20110601C-000709 : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
---------+---------+---------+---------+---------+---------+ 878
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A12.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRM1_0056_D05.b : GTCATGGTCACAACATTTNAGGTAAGGGACAGAAACATATCATGGGAAAGAGAGGAA
HTMT1_0133_C06.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATTTCATGGAAAAGAGAGGAAATT
MLN01_0066_H09.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRT1_0032_E07.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRM1_0206_G05.b : GTCATGGTCACNACATTTNAGGTAAGGGACAGAACAATATCATGGGAAAGAGAGGAAATT
OVRM1_0117_F06.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGANNCATATCATGGAAAAGAGAGGAA*TT
BMWN1_0053_A01.b : GTCATGGTCANCACATTTANGTAAAGGGACAGAANCATATCATGAAAAAGAGAGGAAATT
OVRT1_0129_B06.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAAACATATCATGGGAAAGAGAGGAAATT
ITT01_0081_D08.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
MLN01_0001_H12.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRT1_0039_E07.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRT1_0067_A06.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
OVRM1_0092_G09.b : GTCATGGTCACNNACATTTAGGTAAGGGACAGAACNATATCATGGGAAAGAGAGGAAATT
UTR01_0022_B08.b : GTCATGGTCACAACATTTAGGTAAAGGGACAGAACAATATCATGGAAAAGAGAGGAAATT
20110601C-000709 : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
---------+---------+---------+---------+---------+---------+ 938
LNG01_0042_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcgaaatggaac
LNG01_0011_A12.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAAAAGATAATGTGCTTT
MLN01_0066_H09.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRT1_0032_E07.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRM1_0206_G05.b : TCCTTTCGTGGCTGCGCc
OVRM1_0117_F06.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAggaaatgtg
BMWN1_0053_A01.b : TTCTTNCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATNATGTGCTTT
OVRT1_0129_B06.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAAGATATGTGCTTT
ITT01_0081_D08.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
MLN01_0001_H12.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRT1_0039_E07.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRT1_0067_A06.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
OVRM1_0092_G09.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGAacgaatgg
UTR01_0022_B08.b : TCCTTTCGTGGCTGCGCACATTTTTGAAGACGAAATGGACTTGAGAAGATAATGTGCTTT
20110601C-000709 : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTAATAA*GTAAAGTGT
---------+---------+---------+---------+---------+---------+ 996
LNG01_0042_F10.b : gcgcccctggaagcgggcgcattaaaccgcggggggggggggggggttacgcgccagcgg
LNG01_0011_A12.b : AACAGTTTAAGAATTATCCTTTTTTGCTAGATGGACATTTCACTTnaataagtaaaggtg
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : AACAGTTTAGAAATTATTCCTTTTTGCTGGAGGGACATTTCCCTTAATAA*ATTAAGTGT
MLN01_0066_H09.b : AACAGTTTAGAATTATTCCTTTTTTGCTAAAAGGACATTTCACTTAATAAAGTAAAGTGT
OVRT1_0032_E07.b : AACAGTTTA*AAATTATTCCTTTTTGCTAGATGGACATTTCCACTTATAA*GTAAAGTGT
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : NACAGTTTA*GAATTATCCNTTTTTGCTAGATGGACATTTTCACTTNATA*GTAANGTGG
OVRT1_0129_B06.b : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTAATAA*GTAAAGTGT
ITT01_0081_D08.b : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTAATAAAGT*AAGTGT
MLN01_0001_H12.b : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTAATAA*GTAAAGGGG
OVRT1_0039_E07.b : TACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTNNATA*GTAAAGTGT
OVRT1_0067_A06.b : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTA*TAA*GTAAAGTGT
OVRM1_0092_G09.b :
UTR01_0022_B08.b : AACAGTTTA*GAATTATTCCTTTTTGCTAGATGGACATTTCACTTAATAA*GTAAAGTGT
20110601C-000709 : TGAGTTATCCAAATACTTCTTTGCTAGCCTCTCTCCTGGTAAATAGCAGTTTAATTGTGT
---------+---------+---------+---------+---------+---------+ 1056
LNG01_0042_F10.b : gaacccctaacctttgcccaggccccctaaccgccccgcctcctttttcctttttttttc
LNG01_0011_A12.b : ttgagttattcaaaatactttcttttgctagccctctcttcctg
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : TGAGTTATCCAAATCCTTCTTgctaccctctctcctgttaaataaccattttattggtgt
MLN01_0066_H09.b : TGAGTTATCCAAATACTTCTTTGCTAagcctctctcctgttaaatagcagtttaattgtg
OVRT1_0032_E07.b : TGAGTTATCC*AATACTTCTTTGCTAGCCTCTCTCCggtaaatagcagtttattggggta
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : TGAGTTATCCNAATACTTCNTTGCTAGCCTCTCTCCTGtaantagcagtttattgttgta
OVRT1_0129_B06.b : TGAGTTATCCAAATACTTCTTTGCTAGCCTCTCTCtggtaaatagcagttaaatgtgtag
ITT01_0081_D08.b : TGAGTTATCCAAATACTTCTTTGCTAGCCTCTCTCCTGGTAAATAGCAGTTTAATTGTGT
MLN01_0001_H12.b : TGAATTATCCAAATACCTCTTTGCTAGCCTCTCTCCggttaataaccagttaattgtgta
OVRT1_0039_E07.b : TGAGTTATCCAAATACTTCTTTGCTAGCCTCTCTCCTGGTAAATAGCAGTTTAATTGTGT
OVRT1_0067_A06.b : TGAGTTATCCCAATACTTCctgctagcctctctcctgtaaatagcagtttattgtgtaag
OVRM1_0092_G09.b :
UTR01_0022_B08.b : TGA
20110601C-000709 : AGTTTCATATAAATATGAACTATA....................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b : cctttccttttctgcgcccaaatttcccccgggggtttttcccccgctcaaaggctttaa
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : agtttcatataaatatgaactatatccattcagttggcaccgcgtattccggaacccaca
MLN01_0066_H09.b : aagttttcatataaatatgaactaaatccctttcatttgcacttgcggtattcccgaacg
OVRT1_0032_E07.b : gttcctataaatatgaactatatcatttcgttgcaactgcggtatttctgaacctctacc
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : gttcnataaatatgaactatatcaatcagttgcacctgcggtattctgacgctactacac
OVRT1_0129_B06.b : tttctaataatatgactaattcattcagtgccactgcgtatcctgaccctctaccctaac
ITT01_0081_D08.b : AGTTTCATATAAATATGAACTATAtcccatcagttgcaactgcggtattcctgacgctac
MLN01_0001_H12.b : gtttcatataaatatggactatttccattcagttgccactgcgggttttcctgaccctac
OVRT1_0039_E07.b : AGTTTCATATAAATATGAACTATAttccatcagttgcaactgcggaattctggagctact
OVRT1_0067_A06.b : ttcatataatatgaactatatccatcagttggcactgcgttatcctgaccctactacact
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b : aaaaatcgggggggggcccccccttttttagggggtttctccgaaatttttaaggggggt
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : cccctgacgtaagcctcccttgtttaaacacattcaggaaataactggtgggtcagaaag
MLN01_0066_H09.b : cttcctaccttttaccgtaaaccttccttgtttaatagcaatttcaaggataaagctggg
OVRT1_0032_E07.b : cttagggtaagcctccttggttataacagttcagggataagctggggggtccaaaaggcc
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : tagcgtagccctcctgtttaaaacanttcaagaaaaagcggtggggtcaaaaagtcattg
OVRT1_0129_B06.b : gtaggcttcctgttaaagcattcaggaaaagctgggggtccaaaaggctttggggggcct
ITT01_0081_D08.b : tacacttagcgtaagcactccttgtttatagcagttcaaggataaagctggtgggttcag
MLN01_0001_H12.b : tacctttacctaaagccccctttgtttatagcatttcaaggataaaacggtggggttcaa
OVRT1_0039_E07.b : acacttacgtaagcctccttgttaatagcagtcaagataaagctgggggttcagaaggtc
OVRT1_0067_A06.b : agcgtagcacttcctggttttagcttcaagataaagctggtgggtcagaaggtcattgag
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b : tttttttaggggggggccccccctcccgccccccccccccccccaaaaaaaaaaaaaaaa
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : ggctatgaggggtgcaacattacctcctccccccaaatgtttgtccccagaggcatatta
MLN01_0066_H09.b : gggggttccaaagaggtccttttaggggggcgcataatttaccctctccccgcccgaatt
OVRT1_0032_E07.b : ttgaggggggcaaatttccccctccgccaaattggtgtcccaaggtcttaatttatattt
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : agggtggctaattacccccccccccgatttttgtccccaagggttaattttatttttcca
OVRT1_0129_B06.b : ctttccccccccccaatttgttcccaagggtaaatttaatttccaaaacctggtgagaac
ITT01_0081_D08.b : agaggtcattgaggggtgcatacattacctcctcccgccagatctgntgtcaccaaagtc
MLN01_0001_H12.b : aaaagtctttgagggtggcaaactttcctcctcccccccaaattttttgttcccaagggc
OVRT1_0039_E07.b : atggagggggaatcataactccttcggccgatctgtgccccaaagtctaattataatttt
OVRT1_0067_A06.b : gggtgatacattactcctcgccgaatctgtggccaaagggcctatttaatttttcaaacc
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b : a
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : taaattgtccaaaccattcaagagagaaggttaaagggttttcaaattagtgttttgtgt
MLN01_0066_H09.b : tgtttgtcaccaaagggtcaatatttaaattttgttccaaacctcttgattataaaacct
OVRT1_0032_E07.b : tcaaaacctgtaataaaactgttgagggtttcaaaataaggtttttggggggaaaccggg
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : aacctttgagaaaaacaatttgaaggtttacaaaaaaggttttttgggggaaaaaccccc
OVRT1_0129_B06.b : ggtgaaggtttcaaataaaggttttgtgggaaaaccgcgggtgcacttttcccccccaaa
ITT01_0081_D08.b : ataattaagatttgtcaaaaccatgtgatgaaaaactgatgaagggtttcaagagtaaag
MLN01_0001_H12.b : atattttaattttttcaaaaaccattgtttgaaaaaacgatttgaggggtttccagaata
OVRT1_0039_E07.b : caaaacatttaaaaaaccgtttgaaggtttcaaaattagggaattgagggaaaacttcgg
OVRT1_0067_A06.b : ctggaagaaaaccgatgaaggttttagattaggttaatgggggggaaaaggcgtggttac
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : gggaacacggcgggtgtgacacttttcccaccctaataaatttggcaataataagtgctc
MLN01_0066_H09.b : gtttttaaggg
OVRT1_0032_E07.b : cggggtgggactttttcccacccaagaattttgtcagaaaaaagggctcccccctaattt
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b : gtgtggtactttctcccccccaacaaatttgttcgaaaaatttg
OVRT1_0129_B06.b : attttgtgccaaaagggttccccttttttttccccttttaattaaaaaatatggggcccc
ITT01_0081_D08.b : tttattggaggtgaaacctgcttggttcgacctatttcccactcaaccaaatttgggccg
MLN01_0001_H12.b : aagt
OVRT1_0039_E07.b : ggttgagcttcttccccccaagattttgtcccaaaagagggctccccctaacttttcccc
OVRT1_0067_A06.b : cttttctcacctaggcaatttggccgaaaggagggtcccccttgttattccccctttttt
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : cacaccttactctctcccctcttttatgaacaaagattatttgttccgccacaaattttt
MLN01_0066_H09.b :
OVRT1_0032_E07.b : ttcccccttttattacaaaaattttatttgggcttcaaaatttttctttaaaagtgtttg
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b : caattttttttaaggtttggccacaacggacaaaaaggggtgtttttcctctctccccaa
ITT01_0081_D08.b : gaaaagttgcttacggcctacctttttccccccttcattacaacaaagtgtttattggcc
MLN01_0001_H12.b :
OVRT1_0039_E07.b : ctttttaaaaaaaattatttggcccttcaaatttttcttttaaagttttggccccacccg
OVRT1_0067_A06.b : aaccaaaattttgttggctctccaatatttctttaaagttttttgcccacccagaaacct
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : tctatattaaatgttctgccccacaccgagaaatatctaaagggcttttgttttcgctct
MLN01_0066_H09.b :
OVRT1_0032_E07.b : cccaaaccaaaaaaa
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b : caaaaaaatatccctttggttgtgggttttnnnnaaataaatttnnnnnnnnnnnttctc
ITT01_0081_D08.b : tttccaattttttctttttaaaaggttttgggccccaacccggaaaccataaaacggggt
MLN01_0001_H12.b :
OVRT1_0039_E07.b : gaacctaccagggttgggttttggccttcctccccaccacaaaaacgaaatttccccgtt
OVRT1_0067_A06.b : aacacgggttgttttcccccttctcttcccaa
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : tctctatccacaccnctataaaaccaattttctggccttctctcgtgagagccttctata
MLN01_0066_H09.b :
OVRT1_0032_E07.b :
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b : ttcaagggggcgtccgtctacccacacaacagnnnnnnnnt
ITT01_0081_D08.b : tttggtttttggcctctctttgcccccccccaaaaaaccgttattttcggcgcgttttt
MLN01_0001_H12.b :
OVRT1_0039_E07.b : tttggggaaattataaaaa
OVRT1_0067_A06.b :
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : agaaaaaacaacagactntctttctncaaagctgaaaatattcagcggagaagagggtct
MLN01_0066_H09.b :
OVRT1_0032_E07.b :
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b :
ITT01_0081_D08.b :
MLN01_0001_H12.b :
OVRT1_0039_E07.b :
OVRT1_0067_A06.b :
OVRM1_0092_G09.b :
UTR01_0022_B08.b :
20110601C-000709 : ............................................................
---------+---------+---------+---------+---------+---------+ 1080
LNG01_0042_F10.b :
LNG01_0011_A12.b :
OVRM1_0056_D05.b :
HTMT1_0133_C06.b : gtctcttctccataagaagcatatatatn
MLN01_0066_H09.b :
OVRT1_0032_E07.b :
OVRM1_0206_G05.b :
OVRM1_0117_F06.b :
BMWN1_0053_A01.b :
OVRT1_0129_B06.b :
ITT01_0081_D08.b :
MLN01_0001_H12.b :
OVRT1_0039_E07.b :
OVRT1_0067_A06.b :
OVRM1_0092_G09.b :
UTR01_0022_B08.b :