[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000771

Length: 1,445

Sequence [FASTA format sequence]
AAAAAATTTG TAAAAAAAAC AGGGTGGTGC CGGTCCGCGA ATTCCTCCAG CACCGGTTGG
CCTACTGGAG CATTGCGGGC AGGTGGTGGC TCTGGGTCCA CTCAGCGCAT CCCGCTCTGC
GAGGCAGACA TGAGGGCGGA GGGCATGTCC CTCTTCCTGG CTCTGGGCCT CCTGGTGGCT
GGGCTCTGCT CCAGGGTCCA CTGCGTCCCA GCGGATGACC TTGCCTCAAA GACTGTGACC
CTGAAGGGCC AGATCACGAA GCTGCCAGCG CACAACACCG CCGTCGTCTC CAGCAACACC
GACTTCGCCT TCAGCCTCTA CAAGCAGCTG GTTTCTTTAG ACCCCAATAA GAACGTCATC
TTCTCCCCGC TGAGCGTCTC CATAGCCTTG GCCTTCCTGT CTCTGGGGGC CCGAGGCTCC
ACCCTGACAG AGCTCCTGGA AGGCCTCAAG TTCAACCTCA CAAAGACCCC CGAGGCAGAA
ATCCACCAGG GCTTCCAGCA CCTCCTGCGG GCCCTCAGCC AACCCAGCAA CCTGCTGCAG
CTGAACGTGG GCAACGCCAT GTTCGTGGAT GAGCGGCTGA AGCTGCTGGA CAAGTTCGTC
CAAGATGCCC GTGAGCTGTA CTTCTCCGAG GTCTTCTCCA TCAGCTTTAA GGACTCCGAT
GCTGCCGTAG AGTTCATCAA CAACTATGTG AAGAATAAGA CCAAGGGGAA AATTGTGGAT
TTGTTCAAAC AACTTTCCCC GGATACCGTC CTGGTTCTGG TGAACTGCAT CTACTTTAAA
GCCAAGTGGA AGACGCCCTT TGATCCCAGC TTTACCACGG AGGCAGATTT CCACGTGAGC
AAGAACAGGA CGGTGAGGGT GCCCATGATG GGCATTTCGG GCCGGACCCT GCCTTACTTC
CGGGACGAGG AGCTGGCCTG CACGGTGGTG GAGCTCCCGT ACACCAGCAA CGACAGCGCG
CTCTTCATCC TCCCTGACGA CGGCAGGATG GCGGCCCGTG GAAACCCCAG CTGCTCCCGG
AGACGCTGAG GAGGTGGAGA GACTCCCTGC ACCAGAGACG GATAACTGCC CTCCACCTGC
CACGGTTTTC CGTCTCCGGG GACTATACGC TGCATGACAT CCTTCCCCAC CTGGGCATTA
AGAAAGTCTT CAGCCATCAG GCTGACCTGT CAGGAATCAC AGATCAAGCA CGCCTGAAAG
TTTCCCAGGT GGTCCACAGA GCTGTGCTTG ACGTGGACGA GGAGGGCACG GAAGGAGCTG
CTGCCACGGG AATCAGCATA GAACTCACAT CCATAGAGTT TTTGACGGTG CATTTCAACA
GGCCCTTTCT CTTTTCCATA ATTCACAAAG ACACCCAGAG CATCATCTTT TCAGGCAAAG
TCACCGACCC CAGTCAAGCC TAGAGCTCCC CTCCAATTGC CAGGTCTCCT CATTAAGGAG
CTGGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINA3alpha-1-antichymotrypsin precursor [Homo sapiens]. 308e-121O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2291e-86O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 280e-105O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 280e-105O
Contig/Assembly ProteinSerpina3nserine protease inhibitor A3N precursor [Mus musculus]. 278e-109O
Contig/Assembly ProteinSerpina3cserine protease inhibitor A3C precursor [Mus musculus]. 278e-110O
Contig/Assembly ProteinSerpina3mserine protease inhibitor A3M precursor [Mus musculus]. 276e-110O
Contig/Assembly ProteinSerpina3gserine protease inhibitor A3G [Mus musculus]. 273e-106O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 1 [Mus musculus]. 271e-107O
Contig/Assembly ProteinSerpina3iserine (or cysteine) peptidase inhibitor, clade A, member 3I [Mus musculus]. 271e-107O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 2 [Mus musculus]. 271e-107O
Contig/Assembly ProteinSerpina3kserine protease inhibitor A3K precursor [Mus musculus]. 265e-105O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480425PREDICTED: similar to Alpha-1-antichymotrypsin precursor (ACT) [Canis familiaris]. 332e-130O
Contig/Assembly ProteinSERPINA1serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 [Canis lupus familiaris]. 2305e-85O
Contig/Assembly ProteinLOC490838PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 2296e-82O
Contig/Assembly ProteinLOC480423PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 [Canis familiaris]. 2264e-84O
Contig/Assembly ProteinLOC481007PREDICTED: similar to Thyroxine-binding globulin precursor (T4-binding globulin) [Canis familiaris]. 2201e-72O
Contig/Assembly ProteinLOC490840PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 [Canis familiaris]. 2148e-85O
Contig/Assembly ProteinLOC612386PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 [Canis familiaris]. 2071e-75O
Contig/Assembly ProteinLOC612381PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 [Canis familiaris]. 2047e-77O
Contig/Assembly ProteinLOC480424PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 [Canis familiaris]. 1971e-74O
Contig/Assembly ProteinLOC612383PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 1593e-50


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINA3-8SERPINA3-8 [Bos taurus]. 361e-143O
Contig/Assembly ProteinSERPINA3-6serpin A3-6 [Bos taurus]. 355e-137O
Contig/Assembly ProteinSERPINA3-2serpin A3-2 [Bos taurus]. 350e-136O
Contig/Assembly ProteinSERPINA3-1serpin A3-1 precursor [Bos taurus]. 349e-137O
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2C-like [Bos taurus]. 348e-135O
Contig/Assembly ProteinLOC100138846PREDICTED: endopin 2C-like [Bos taurus]. 348e-115O
Contig/Assembly ProteinSERPINA3serpin A3-5 [Bos taurus]. 347e-135O
Contig/Assembly ProteinSERPINA3-3serpin A3-3 [Bos taurus]. 342e-133O
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2B-like [Bos taurus]. 342e-134O
Contig/Assembly ProteinSERPINA3-7serpin A3-7 [Bos taurus]. 335e-131O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153899PREDICTED: serpin A3-8 [Sus scrofa]. 5420.0O
Contig/Assembly ProteinLOC100156325PREDICTED: serpin A3-6 [Sus scrofa]. 466e-177O
Contig/Assembly ProteinSERPINA3-2alpha-1-antichymotrypsin 2 [Sus scrofa]. 437e-167O
Contig/Assembly ProteinSERPINA3-3PREDICTED: serpin A3-5 [Sus scrofa]. 427e-142
Contig/Assembly ProteinSERPINA3-1PREDICTED: serpin A3-6 [Sus scrofa]. 3101e-84O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Sus scrofa]. 2332e-86O
Contig/Assembly ProteinLOC100153513PREDICTED: plasma serine protease inhibitor-like [Sus scrofa]. 2161e-83O
Contig/Assembly ProteinLOC100155953PREDICTED: serpin A11 [Sus scrofa]. 2131e-84O
Contig/Assembly ProteinSERPINA11PREDICTED: serpin A11 [Sus scrofa]. 2136e-85O
Contig/Assembly ProteinLOC100157117PREDICTED: LOW QUALITY PROTEIN: kallistatin-like [Sus scrofa]. 2112e-82O


Assembly Members: 405      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010001B01LVR01_0001_B01.bBP441860 
LVR010001D10LVR01_0001_D10.bBP444338 
LVR010001H09LVR01_0001_H09.bBP447832 
LVR010002C01LVR01_0002_C01.bBP442781 
LVR010003B01LVR01_0003_B01.bBP441862 
LVR010003B04LVR01_0003_B04.bBP442094 
LVR010003C01LVR01_0003_C01.bBP442782 
LVR010004A04LVR01_0004_A04.bBP441177 
LVR010004A06LVR01_0004_A06.bBP441332 
LVR010004B01LVR01_0004_B01.bBP441863 
LVR010004C02LVR01_0004_C02.bBP442863 
LVR010004C12LVR01_0004_C12.bBP443604 
LVR010005C08LVR01_0005_C08.bBP443309 
LVR010005D06LVR01_0005_D06.bBP444055 
LVR010005F02LVR01_0005_F02.bBP445504 
LVR010005F07LVR01_0005_F07.bBP445875 
LVR010005H10LVR01_0005_H10.bBP447915 
LVR010008A04LVR01_0008_A04.bBP441179 
LVR010008C08LVR01_0008_C08.bBP443310 
LVR010008E03LVR01_0008_E03.bBP444724 
LVR010008F04LVR01_0008_F04.bBP445658 
LVR010008F08LVR01_0008_F08.bBP445941 
LVR010008G01LVR01_0008_G01.bBP446312 
LVR010009B07LVR01_0009_B07.bBP442328 
LVR010009C10LVR01_0009_C10.bBP443458 
LVR010009D03LVR01_0009_D03.bBP443834 
LVR010009F02LVR01_0009_F02.bBP445506 
LVR010009H04LVR01_0009_H04.bBP447453 
LVR010009H10LVR01_0009_H10.bBP447916 
LVR010010A05LVR01_0010_A05.bBP441259 
LVR010010E07LVR01_0010_E07.bBP445005 
LVR010010G05LVR01_0010_G05.bBP446622 
LVR010011A04LVR01_0011_A04.bBP441182 
LVR010011B02LVR01_0011_B02.bBP441944 
LVR010011C09LVR01_0011_C09.bBP443384 
LVR010011E01LVR01_0011_E01.bBP444574 
LVR010011G03LVR01_0011_G03.bBP446471 
LVR010011G09LVR01_0011_G09.bBP446910 
LVR010012E09LVR01_0012_E09.bBP445134 
LVR010012E11LVR01_0012_E11.bBP445276 
LVR010013E12LVR01_0013_E12.bBP445354 
LVR010015C02LVR01_0015_C02.bBP442872 
LVR010016A09LVR01_0016_A09.bBP441575 
LVR010016A10LVR01_0016_A10.bBP441651 
LVR010016B03LVR01_0016_B03.bBP442025 
LVR010016C11LVR01_0016_C11.bBP443538 
LVR010016D03LVR01_0016_D03.bBP443841 
LVR010016D10LVR01_0016_D10.bBP444350 
LVR010017G07LVR01_0017_G07.bBP446775 
LVR010018A08LVR01_0018_A08.bBP441499 
LVR010018A12LVR01_0018_A12.bBP441801 
LVR010018B10LVR01_0018_B10.bBP442563 
LVR010018E07LVR01_0018_E07.bBP445012 
LVR010018E08LVR01_0018_E08.bBP445074 
LVR010018F01LVR01_0018_F01.bBP445437 AK393974
LVR010018F11LVR01_0018_F11.bBP446172 
LVR010018H12LVR01_0018_H12.bBP448081 
LVR010019A09LVR01_0019_A09.bBP441578 
LVR010019B08LVR01_0019_B08.bBP442414 
LVR010019D04LVR01_0019_D04.bBP443919 
LVR010019E04LVR01_0019_E04.bBP444805 
LVR010019F11LVR01_0019_F11.bBP446173 
LVR010019H05LVR01_0019_H05.bBP447536 
LVR010019H10LVR01_0019_H10.bBP447924 
LVR010020B06LVR01_0020_B06.bBP442263 
LVR010020C01LVR01_0020_C01.bBP442797 
LVR010020F04LVR01_0020_F04.b  AK398924
LVR010020F05LVR01_0020_F05.bBP445739 
LVR010020F09LVR01_0020_F09.bBP446027 
LVR010021D08LVR01_0021_D08.bBP444204 
LVR010021D10LVR01_0021_D10.bBP444355 
LVR010021F09LVR01_0021_F09.bBP446028 
LVR010021H01LVR01_0021_H01.bBP447227 
LVR010021H08LVR01_0021_H08.bBP447773 
LVR010022A05LVR01_0022_A05.bBP441270 
LVR010022D11LVR01_0022_D11.bBP444429 
LVR010025A08LVR01_0025_A08.bBP441503 
LVR010025C03LVR01_0025_C03.bBP442954 
LVR010025D04LVR01_0025_D04.bBP443921 
LVR010025D10LVR01_0025_D10.bBP444356 
LVR010026C08LVR01_0026_C08.bBP443321 
LVR010026G03LVR01_0026_G03.bBP446484 
LVR010028A11LVR01_0028_A11.bBP441734 
LVR010028D09LVR01_0028_D09.bBP444282 
LVR010028E04LVR01_0028_E04.bBP444811 
LVR010028E09LVR01_0028_E09.bBP445146 
LVR010028F07LVR01_0028_F07.bBP445890 
LVR010029D02LVR01_0029_D02.bBP443776 
LVR010030F01LVR01_0030_F01.bBP445446 
LVR010031B06LVR01_0031_B06.bBP442270 
LVR010031C12LVR01_0031_C12.bBP443625 
LVR010031H02LVR01_0031_H02.bBP447312 
LVR010033A05LVR01_0033_A05.bBP441277 
LVR010033B09LVR01_0033_B09.bBP442500 
LVR010033C12LVR01_0033_C12.bBP443626 
LVR010033D10LVR01_0033_D10.bBP444361 
LVR010034A03LVR01_0034_A03.bBP441121 
LVR010034C10LVR01_0034_C10.bBP443476 
LVR010034E11LVR01_0034_E11.bBP445291 
LVR010034F11LVR01_0034_F11.bBP446183 
LVR010034G08LVR01_0034_G08.bBP446855 
LVR010034G11LVR01_0034_G11.bBP447079 
LVR010034H01LVR01_0034_H01.bBP447235 
LVR010035B11LVR01_0035_B11.bBP442652 
LVR010035C09LVR01_0035_C09.bBP443402 
LVR010035G03LVR01_0035_G03.bBP446491 
LVR010035H10LVR01_0035_H10.bBP447936 
LVR010036A09LVR01_0036_A09.bBP441590 
LVR010036C09LVR01_0036_C09.bBP443403 AK345863
LVR010036C11LVR01_0036_C11.bBP443550 
LVR010036H01LVR01_0036_H01.bBP447237 
LVR010036H05LVR01_0036_H05.bBP447548 
LVR010037A07LVR01_0037_A07.bBP441435 
LVR010037A09LVR01_0037_A09.b  
LVR010037C03LVR01_0037_C03.bBP442962 
LVR010037C05LVR01_0037_C05.bBP443113 
LVR010037C07LVR01_0037_C07.bBP443258 
LVR010037F05LVR01_0037_F05.bBP445750 
LVR010037F09LVR01_0037_F09.bBP446035 
LVR010037G06LVR01_0037_G06.bBP446717 
LVR010037G08LVR01_0037_G08.bBP446857 
LVR010038A10LVR01_0038_A10.bBP441668 
LVR010038A12LVR01_0038_A12.bBP441816 
LVR010038C08LVR01_0038_C08.bBP443328 
LVR010038D04LVR01_0038_D04.bBP443930 
LVR010038H03LVR01_0038_H03.bBP447397 
LVR010039C04LVR01_0039_C04.bBP443041 
LVR010039C12LVR01_0039_C12.bBP443631 
LVR010039E01LVR01_0039_E01.bBP444597 
LVR010039E08LVR01_0039_E08.bBP445086 
LVR010039H12LVR01_0039_H12.bBP448097 
LVR010040B05LVR01_0040_B05.bBP442200 
LVR010040D09LVR01_0040_D09.bBP444291 
LVR010040F02LVR01_0040_F02.bBP445528 
LVR010040G11LVR01_0040_G11.bBP447085 
LVR010040H12LVR01_0040_H12.bBP448098 
LVR010041C08LVR01_0041_C08.bBP443331 
LVR010041F08LVR01_0041_F08.bBP445967 
LVR010041G04LVR01_0041_G04.bBP446570 
LVR010041H09LVR01_0041_H09.bBP447865 
LVR010042A04LVR01_0042_A04.bBP441206 
LVR010042A09LVR01_0042_A09.bBP441595 
LVR010042C03LVR01_0042_C03.bBP442967 
LVR010042F07LVR01_0042_F07.bBP445898 
LVR010043E01LVR01_0043_E01.bBP444601 
LVR010043G04LVR01_0043_G04.bBP446572 
LVR010043G09LVR01_0043_G09.bBP446933 
LVR010044C02LVR01_0044_C02.bBP442895 
LVR010044G08LVR01_0044_G08.bBP446864 
LVR010044G10LVR01_0044_G10.bBP447011 
LVR010045C07LVR01_0045_C07.bBP443263 
LVR010045C12LVR01_0045_C12.bBP443636 
LVR010045D04LVR01_0045_D04.bBP443937 
LVR010045E11LVR01_0045_E11.bBP445301 
LVR010046A07LVR01_0046_A07.bBP441443 
LVR010047C12LVR01_0047_C12.bBP443638 
LVR010047D01LVR01_0047_D01.bBP443712 
LVR010048D01LVR01_0048_D01.bBP443713 
LVR010048E02LVR01_0048_E02.bBP444680 
LVR010048F05LVR01_0048_F05.bBP445760 
LVR010048F06LVR01_0048_F06.bBP445833 
LVR010049C07LVR01_0049_C07.bBP443267 
LVR010049E09LVR01_0049_E09.bBP445163 
LVR010049F01LVR01_0049_F01.bBP445463 
LVR010049F02LVR01_0049_F02.bBP445537 
LVR010049H04LVR01_0049_H04.bBP447485 
LVR010050B05LVR01_0050_B05.bBP442209 
LVR010050B08LVR01_0050_B08.bBP442438 
LVR010050B11LVR01_0050_B11.bBP442666 
LVR010050F10LVR01_0050_F10.bBP446123 
LVR010051A03LVR01_0051_A03.bBP441136 
LVR010051A08LVR01_0051_A08.bBP441526 
LVR010051B09LVR01_0051_B09.bBP442515 
LVR010051B10LVR01_0051_B10.bBP442589 
LVR010051B12LVR01_0051_B12.bBP442745 
LVR010051D01LVR01_0051_D01.bBP443716 
LVR010051D02LVR01_0051_D02.bBP443794 
LVR010051D05LVR01_0051_D05.bBP444015 
LVR010051E07LVR01_0051_E07.b  
LVR010051E10LVR01_0051_E10.bBP445236 
LVR010051E11LVR01_0051_E11.bBP445307 
LVR010051H02LVR01_0051_H02.bBP447329 
LVR010051H04LVR01_0051_H04.bBP447487 
LVR010052A01LVR01_0052_A01.bBP440979 
LVR010052B08LVR01_0052_B08.bBP442440 
LVR010052E07LVR01_0052_E07.bFS678437 
LVR010052F01LVR01_0052_F01.bBP445466 
LVR010052F03LVR01_0052_F03.bBP445618 
LVR010052F06LVR01_0052_F06.bBP445837 
LVR010052H06LVR01_0052_H06.bBP447642 
LVR010053A09LVR01_0053_A09.bBP441606 
LVR010053B11LVR01_0053_B11.bBP442669 
LVR010053C09LVR01_0053_C09.bBP443417 
LVR010054A03LVR01_0054_A03.bBP441138 AK232492
LVR010054C02LVR01_0054_C02.bBP442902 
LVR010054C05LVR01_0054_C05.bBP443129 
LVR010054C06LVR01_0054_C06.bBP443203 
LVR010054C12LVR01_0054_C12.bBP443643 
LVR010054F07LVR01_0054_F07.bBP445908 
LVR010054F08LVR01_0054_F08.bBP445979 
LVR010055A11LVR01_0055_A11.bBP441757 
LVR010055H10LVR01_0055_H10.bBP447956 
LVR010056B07LVR01_0056_B07.bBP442366 
LVR010056D10LVR01_0056_D10.bBP444381 
LVR010056G03LVR01_0056_G03.bBP446507 
LVR010057G01LVR01_0057_G01.bBP446353 
LVR010057G04LVR01_0057_G04.bBP446586 
LVR010058A07LVR01_0058_A07.bBP441455 
LVR010058F03LVR01_0058_F03.bBP445623 
LVR010059D09LVR01_0059_D09.bBP444310 
LVR010059G11LVR01_0059_G11.bBP447102 
LVR010060B07LVR01_0060_B07.bBP442370 
LVR010060C07LVR01_0060_C07.bBP443277 
LVR010061A07LVR01_0061_A07.bBP441458 
LVR010061C08LVR01_0061_C08.bBP443350 
LVR010061E11LVR01_0061_E11.bBP445317 
LVR010061F11LVR01_0061_F11.bBP446208 
LVR010062C06LVR01_0062_C06.bBP443209 
LVR010062E09LVR01_0062_E09.bBP445174 
LVR010062G04LVR01_0062_G04.bBP446589 
LVR010062G08LVR01_0062_G08.bBP446881 
LVR010062H03LVR01_0062_H03.bBP447421 
LVR010062H08LVR01_0062_H08.bBP447805 
LVR010063A10LVR01_0063_A10.bBP441691 
LVR010063B08LVR01_0063_B08.bBP442449 
LVR010063D01LVR01_0063_D01.bBP443728 
LVR010063D07LVR01_0063_D07.bBP444166 
LVR010063H04LVR01_0063_H04.bBP447498 
LVR010065A08LVR01_0065_A08.bBP441539 
LVR010065B06LVR01_0065_B06.bBP442297 
LVR010065C01LVR01_0065_C01.bBP442837 
LVR010065D01LVR01_0065_D01.bBP443729 
LVR010065D11LVR01_0065_D11.bBP444464 
LVR010065F02LVR01_0065_F02.bBP445551 
LVR010065F08LVR01_0065_F08.bBP445987 
LVR010065H05LVR01_0065_H05.bBP447576 
LVR010066A05LVR01_0066_A05.bBP441305 
LVR010066D06LVR01_0066_D06.bBP444100 
LVR010066D08LVR01_0066_D08.bBP444237 
LVR010066E07LVR01_0066_E07.bBP445036 
LVR010066G06LVR01_0066_G06.bBP446743 
LVR010067D08LVR01_0067_D08.bBP444238 
LVR010067F02LVR01_0067_F02.bBP445553 
LVR010067F11LVR01_0067_F11.bBP446213 
LVR010068A02LVR01_0068_A02.bBP441072 
LVR010068A04LVR01_0068_A04.bBP441230 
LVR010068C01LVR01_0068_C01.bBP442840 
LVR010068G12LVR01_0068_G12.bBP447188 
LVR010068H03LVR01_0068_H03.bBP447426 
LVR010071A12LVR01_0071_A12.bBP441841 
LVR010071H01LVR01_0071_H01.bBP447267 
LVR010072B04LVR01_0072_B04.bBP442149 
LVR010072B08LVR01_0072_B08.bBP442455 
LVR010072D10LVR01_0072_D10.bBP444393 
LVR010072G05LVR01_0072_G05.bBP446671 
LVR010072H01LVR01_0072_H01.b  
LVR010072H06LVR01_0072_H06.bBP447658 
LVR010073A06LVR01_0073_A06.bBP441385 
LVR010073C05LVR01_0073_C05.bBP443144 
LVR010073C07LVR01_0073_C07.bBP443286 
LVR010073E11LVR01_0073_E11.bBP445326 
LVR010073G07LVR01_0073_G07.bBP446812 
LVR010074B02LVR01_0074_B02.bBP441994 
LVR010074E07LVR01_0074_E07.bBP445042 
LVR010076A10LVR01_0076_A10.bBP441700 
LVR010076H01LVR01_0076_H01.bBP447270 
LVR010077A07LVR01_0077_A07.bBP441470 
LVR010077B02LVR01_0077_B02.bBP441996 
LVR010077B04LVR01_0077_B04.bBP442153 
LVR010077D01LVR01_0077_D01.bBP443738 
LVR010077F11LVR01_0077_F11.bBP446220 
LVR010077G10LVR01_0077_G10.bBP447039 
LVR010077G12LVR01_0077_G12.bBP447194 
LVR010077H08LVR01_0077_H08.bBP447815 
LVR010077H11LVR01_0077_H11.bBP448049 
LVR010078A03LVR01_0078_A03.bBP441158 
LVR010078A06LVR01_0078_A06.bBP441389 
LVR010078B02LVR01_0078_B02.bBP441997 
LVR010078B08LVR01_0078_B08.bBP442460 
LVR010078B09LVR01_0078_B09.bBP442535 
LVR010078D05LVR01_0078_D05.bBP444038 
LVR010078E04LVR01_0078_E04.bBP444847 
LVR010078F10LVR01_0078_F10.bBP446145 
LVR010078G06LVR01_0078_G06.bBP446749 
LVR010078H02LVR01_0078_H02.bBP447351 
LVR010079C11LVR01_0079_C11.bBP443586 
LVR010079F07LVR01_0079_F07.bBP445924 
LVR010079H04LVR01_0079_H04.bBP447509 
LVR010081A03LVR01_0081_A03.bBP441160 
LVR010081B12LVR01_0081_B12.bBP442767 
LVR010081C02LVR01_0081_C02.bBP442923 
LVR010081C05LVR01_0081_C05.bBP443149 
LVR010081D03LVR01_0081_D03.bBP443893 
LVR010081E04LVR01_0081_E04.bBP444849 
LVR010081F09LVR01_0081_F09.bBP446071 
LVR010081G03LVR01_0081_G03.bBP446527 
LVR010081H11LVR01_0081_H11.bBP448052 
LVR010081H12LVR01_0081_H12.bBP448132 
LVR010082C05LVR01_0082_C05.bBP443150 
LVR010082E02LVR01_0082_E02.bBP444708 
LVR010082F05LVR01_0082_F05.bBP445788 
LVR010082H01LVR01_0082_H01.bBP447274 
LVR010082H05LVR01_0082_H05.bBP447587 
LVR010083B03LVR01_0083_B03.bCJ000013 
LVR010083G07LVR01_0083_G07.bCJ000072 
LVR010084B07LVR01_0084_B07.bCJ000105 
LVR010084C07LVR01_0084_C07.bCJ000117 
LVR010084C09LVR01_0084_C09.bCJ000119 
LVR010084H01LVR01_0084_H01.bCJ000165 
LVR010084H05LVR01_0084_H05.bCJ000169 
LVR010085B03LVR01_0085_B03.bCJ000188 
LVR010085D11LVR01_0085_D11.bCJ000214 
LVR010085E08LVR01_0085_E08.bBW962721 
LVR010085F05LVR01_0085_F05.bCJ000229 
LVR010086B01LVR01_0086_B01.bCJ000269 
LVR010086C11LVR01_0086_C11.bCJ000289 
LVR010086D03LVR01_0086_D03.bCJ000293 
LVR010086F12LVR01_0086_F12.bCJ000318 
LVR010086G07LVR01_0086_G07.bCJ000324 
LVR010087B03LVR01_0087_B03.bCJ000352 
LVR010087C04LVR01_0087_C04.bCJ000363 
LVR010087E10LVR01_0087_E10.bCJ000386 
LVR010088B02LVR01_0088_B02.bCJ000432 
LVR010089A05LVR01_0089_A05.bCJ000512 
LVR010089A11LVR01_0089_A11.bCJ000518 
LVR010089C12LVR01_0089_C12.bCJ000541 
LVR010089E03LVR01_0089_E03.bCJ000554 
LVR010089E06LVR01_0089_E06.bCJ000556 
LVR010089F07LVR01_0089_F07.bCJ000567 
LVR010089G02LVR01_0089_G02.bCJ000574 
LVR010090E01LVR01_0090_E01.bCJ000641 
LVR010090E12LVR01_0090_E12.bBW962744 
LVR010090G05LVR01_0090_G05.bCJ000664 
LVR010091B10LVR01_0091_B10.bCJ000697 
LVR010092B07LVR01_0092_B07.bCJ000771 
LVR010092D02LVR01_0092_D02.bCJ000789 
LVR010092D11LVR01_0092_D11.bCJ000798 
LVR010093A12LVR01_0093_A12.bCJ000853 
LVR010093B11LVR01_0093_B11.bCJ000864 
LVR010093E11LVR01_0093_E11.bCJ000880 
LVR010093H05LVR01_0093_H05.b  
LVR010094A02LVR01_0094_A02.bCJ000909 
LVR010094B06LVR01_0094_B06.bCJ000925 
LVR010094C12LVR01_0094_C12.bCJ000941 
LVR010094E01LVR01_0094_E01.bCJ000952 
LVR010094F01LVR01_0094_F01.bCJ000960 
LVR010094F08LVR01_0094_F08.bCJ000967 
LVR010094G06LVR01_0094_G06.bCJ000977 
LVR010095A06LVR01_0095_A06.bBP441393 
LVR010095B09LVR01_0095_B09.bBP442539 
LVR010095C07LVR01_0095_C07.bBP443294 
LVR010095C08LVR01_0095_C08.bBP443366 
LVR010095E08LVR01_0095_E08.bBP445116 
LVR010096A01LVR01_0096_A01.bBP441004 
LVR010096A09LVR01_0096_A09.bBP441630 
LVR010096C05LVR01_0096_C05.bBP443152 
LVR010096E10LVR01_0096_E10.bBP445260 
LVR010096G02LVR01_0096_G02.bBP446452 
LVR010097B05LVR01_0097_B05.bBP442238 
LVR010098C03LVR01_0098_C03.bBP443003 
LVR010098D02LVR01_0098_D02.bBP443821 
LVR010098F09LVR01_0098_F09.bBP446076 
LVR010098G03LVR01_0098_G03.bBP446532 
LVR010099A03LVR01_0099_A03.bBP441166 
LVR010099B11LVR01_0099_B11.bBP442698 
LVR010099C05LVR01_0099_C05.bBP443154 
LVR010099D11LVR01_0099_D11.bBP444481 
LVR010099G05LVR01_0099_G05.bBP446684 
LVR010099H06LVR01_0099_H06.bBP447670 
LVR010099H09LVR01_0099_H09.bBP447904 
LVR010100G07LVR01_0100_G07.bBP446825 
LVR010101B05LVR01_0101_B05.bBP442242 
LVR010101C08LVR01_0101_C08.bBP443371 
LVR010101D01LVR01_0101_D01.bBP443749 
LVR010101D06LVR01_0101_D06.bBP444117 
LVR010101D09LVR01_0101_D09.bBP444333 
LVR010101F02LVR01_0101_F02.bBP445571 
LVR010101F04LVR01_0101_F04.bBP445722 
LVR010101H04LVR01_0101_H04.bBP447518 
LVR010101H08LVR01_0101_H08.bBP447826 
LVR010101H10LVR01_0101_H10.bBP447983 
LVR010102C09LVR01_0102_C09.bBP443448 
LVR010102C11LVR01_0102_C11.bBP443596 
LVR010102C12LVR01_0102_C12.bBP443668 
LVR010102D01LVR01_0102_D01.bBP443750 
LVR010102F08LVR01_0102_F08.bBP446008 
LVR010102G02LVR01_0102_G02.bBP446458 
LVR010102H09LVR01_0102_H09.bBP447907 
LVR010103A06LVR01_0103_A06.bBP441401 
LVR010103A10LVR01_0103_A10.bBP441712 
LVR010103E02LVR01_0103_E02.bBP444716 
LVR010103F01LVR01_0103_F01.bBP445497 
LVR010104A12LVR01_0104_A12.bBP441858 
LVR010104B04LVR01_0104_B04.bBP442167 
LVR010104B11LVR01_0104_B11.bBP442702 
LVR010104D08LVR01_0104_D08.bBP444257 
LVR010104F12LVR01_0104_F12.bBP446305 
LVR010105A01LVR01_0105_A01.bBP441013 
LVR010105D01LVR01_0105_D01.b  
LVR010106B04LVR01_0106_B04.bBP442168 
LVR010106E04LVR01_0106_E04.bBP444861 
LVR010106E12LVR01_0106_E12.bBP445422 
SPLT10013A09SPLT1_0013_A09.bHX240174 
TES010067G04TES01_0067_G04.bCJ034339 
TES010096F08TES01_0096_F08.bCJ036281 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
283A16800.435WNATC/I
G21800.565GTC/V
779A19700.652WNAAA/K
T10500.348ATA/I
794C16700.566WNACG/T
T12800.434ATG/M
801C6700.269WSTTC/F
T18200.731TTT/F
802A2400.116WNAAT/N
G18300.884GAT/D


Alignment:      TOP

20110601C-000771 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0020_F04.b :
LVR01_0052_E07.b :
LVR01_0018_F01.b :
LVR01_0052_F06.b :
LVR01_0020_B06.b :
LVR01_0101_F04.b :
LVR01_0072_B04.b :
LVR01_0037_A09.b :
LVR01_0036_H01.b :
LVR01_0077_G12.b :
LVR01_0090_E01.b :
LVR01_0073_A06.b :
LVR01_0077_H08.b :
LVR01_0001_B01.b :
LVR01_0056_D10.b :
LVR01_0072_D10.b :
LVR01_0092_D02.b :
LVR01_0084_C09.b :
SPLT1_0013_A09.b :
LVR01_0005_D06.b :
LVR01_0089_E03.b :
LVR01_0018_F11.b :
LVR01_0077_H11.b :
LVR01_0091_B10.b :
LVR01_0062_E09.b :
LVR01_0099_B11.b :
LVR01_0004_C12.b :
LVR01_0002_C01.b :
LVR01_0101_D01.b :
LVR01_0104_B11.b :
LVR01_0019_F11.b :
LVR01_0045_C07.b :
LVR01_0051_D05.b :
LVR01_0025_D10.b :
LVR01_0043_G09.b :
LVR01_0065_H05.b :
LVR01_0092_D11.b :
LVR01_0001_D10.b :
LVR01_0096_G02.b :
LVR01_0018_E08.b : ctttat
LVR01_0078_B08.b :
LVR01_0051_A03.b :
LVR01_0021_H01.b :
LVR01_0097_B05.b :
LVR01_0081_C02.b :
LVR01_0035_G03.b :
LVR01_0036_A09.b :
LVR01_0035_B11.b :
LVR01_0035_C09.b :
LVR01_0037_G08.b :
LVR01_0081_G03.b :
LVR01_0103_A10.b :
LVR01_0036_H05.b :
LVR01_0035_H10.b :
LVR01_0038_D04.b :
LVR01_0033_D10.b :
LVR01_0071_A12.b :
LVR01_0103_A06.b :
LVR01_0054_F07.b :
LVR01_0037_F09.b :
LVR01_0047_C12.b :
LVR01_0037_A07.b :
LVR01_0039_E08.b :
LVR01_0004_A04.b :
LVR01_0020_F09.b :
LVR01_0086_G07.b :
LVR01_0093_E11.b :
LVR01_0041_F08.b :
LVR01_0085_E08.b :
LVR01_0025_C03.b :
LVR01_0039_E01.b :
LVR01_0033_B09.b :
LVR01_0026_G03.b :
LVR01_0037_C03.b :
LVR01_0034_F11.b :
LVR01_0094_F08.b :
LVR01_0096_E10.b :
LVR01_0019_B08.b :
LVR01_0065_D11.b :
LVR01_0019_D04.b :
LVR01_0054_C05.b :
LVR01_0089_F07.b :
LVR01_0041_C08.b :
LVR01_0053_C09.b :
LVR01_0020_F05.b :
LVR01_0076_H01.b :
LVR01_0085_D11.b :
LVR01_0079_H04.b :
LVR01_0047_D01.b :
LVR01_0016_D10.b :
LVR01_0054_A03.b : ggcaxxxxxxxxxx
LVR01_0074_E07.b :
LVR01_0038_A10.b :
LVR01_0052_F03.b :
LVR01_0025_D04.b :
LVR01_0095_C07.b :
LVR01_0104_A12.b :
LVR01_0031_H02.b :
LVR01_0026_C08.b :
LVR01_0034_G08.b :
LVR01_0028_D09.b :
LVR01_0062_G08.b :
LVR01_0013_E12.b :
LVR01_0038_A12.b :
LVR01_0034_C10.b :
LVR01_0037_C05.b :
LVR01_0039_C12.b :
LVR01_0081_B12.b :
LVR01_0104_B04.b :
LVR01_0025_A08.b :
LVR01_0081_H11.b :
LVR01_0081_H12.b :
LVR01_0082_H05.b :
LVR01_0102_H09.b :
LVR01_0012_E09.b :
LVR01_0040_G11.b :
LVR01_0034_H01.b :
LVR01_0034_E11.b :
LVR01_0079_C11.b :
LVR01_0062_C06.b :
LVR01_0062_G04.b :
LVR01_0093_H05.b : tctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_F08.b :
LVR01_0061_E11.b :
LVR01_0094_E01.b :
LVR01_0022_D11.b :
LVR01_0052_F01.b :
LVR01_0051_D02.b :
LVR01_0061_F11.b :
LVR01_0038_C08.b :
LVR01_0065_F08.b :
LVR01_0056_G03.b :
LVR01_0019_H10.b :
LVR01_0028_A11.b :
LVR01_0054_F08.b :
LVR01_0098_D02.b :
LVR01_0086_D03.b :
LVR01_0068_C01.b :
LVR01_0021_F09.b :
LVR01_0031_C12.b :
LVR01_0094_G06.b :
LVR01_0028_E09.b :
LVR01_0005_C08.b :
LVR01_0081_F09.b :
LVR01_0077_G10.b :
LVR01_0045_E11.b :
LVR01_0086_C11.b :
LVR01_0018_E07.b :
LVR01_0082_E02.b :
LVR01_0082_H01.b :
LVR01_0040_D09.b :
LVR01_0051_B12.b :
LVR01_0101_D09.b :
LVR01_0093_A12.b :
LVR01_0009_C10.b :
LVR01_0033_A05.b :
LVR01_0089_C12.b :
LVR01_0029_D02.b :
LVR01_0041_G04.b :
LVR01_0055_H10.b :
LVR01_0045_D04.b :
LVR01_0016_D03.b :
LVR01_0048_F06.b :
LVR01_0018_H12.b :
LVR01_0084_H05.b :
LVR01_0008_G01.b :
LVR01_0040_F02.b :
LVR01_0021_D08.b :
LVR01_0104_F12.b :
LVR01_0059_D09.b :
LVR01_0051_B10.b :
LVR01_0051_H02.b :
LVR01_0044_G08.b :
LVR01_0004_B01.b :
LVR01_0051_E11.b :
LVR01_0012_E11.b :
LVR01_0089_A11.b :
LVR01_0053_B11.b :
LVR01_0019_E04.b :
LVR01_0043_G04.b :
LVR01_0050_F10.b :
LVR01_0053_A09.b :
LVR01_0060_C07.b :
LVR01_0054_C02.b :
LVR01_0092_B07.b :
LVR01_0048_F05.b :
LVR01_0042_F07.b :
LVR01_0095_C08.b :
LVR01_0102_D01.b :
LVR01_0087_C04.b :
LVR01_0028_E04.b :
LVR01_0052_H06.b :
LVR01_0059_G11.b :
LVR01_0015_C02.b :
LVR01_0089_E06.b :
LVR01_0003_B04.b :
LVR01_0028_F07.b :
LVR01_0031_B06.b :
LVR01_0049_F01.b :
LVR01_0051_D01.b :
LVR01_0049_H04.b :
LVR01_0087_B03.b :
LVR01_0102_C09.b :
LVR01_0008_E03.b :
LVR01_0010_E07.b :
LVR01_0016_C11.b :
LVR01_0094_B06.b :
LVR01_0049_F02.b :
LVR01_0062_H03.b :
LVR01_0017_G07.b :
LVR01_0077_F11.b :
LVR01_0093_B11.b :
LVR01_0009_B07.b :
LVR01_0009_F02.b :
LVR01_0019_H05.b :
LVR01_0044_G10.b :
LVR01_0051_A08.b :
LVR01_0085_F05.b :
LVR01_0090_G05.b :
LVR01_0081_A03.b :
LVR01_0021_D10.b :
LVR01_0033_C12.b :
LVR01_0034_G11.b :
LVR01_0073_C07.b :
LVR01_0098_F09.b :
LVR01_0040_B05.b :
LVR01_0101_H04.b :
LVR01_0008_F04.b :
LVR01_0008_F08.b :
LVR01_0030_F01.b :
LVR01_0102_G02.b :
LVR01_0039_C04.b :
LVR01_0058_A07.b :
LVR01_0073_C05.b :
LVR01_0078_B09.b :
LVR01_0081_D03.b :
LVR01_0101_H08.b :
LVR01_0042_A09.b :
LVR01_0101_D06.b :
LVR01_0083_G07.b :
LVR01_0106_E04.b :
LVR01_0065_D01.b :
LVR01_0065_F02.b :
LVR01_0066_E07.b :
LVR01_0034_A03.b :
LVR01_0066_G06.b :
LVR01_0078_G06.b :
LVR01_0086_B01.b :
LVR01_0099_D11.b :
LVR01_0101_C08.b :
LVR01_0081_C05.b :
LVR01_0009_H10.b :
LVR01_0041_H09.b :
LVR01_0082_C05.b :
LVR01_0095_B09.b :
LVR01_0084_C07.b :
LVR01_0061_A07.b :
LVR01_0063_D07.b :
LVR01_0094_F01.b :
LVR01_0071_H01.b :
LVR01_0103_F01.b :
LVR01_0011_E01.b :
LVR01_0060_B07.b :
LVR01_0005_F07.b :
LVR01_0096_C05.b :
LVR01_0020_C01.b :
LVR01_0082_F05.b :
LVR01_0051_H04.b :
LVR01_0106_B04.b :
LVR01_0098_C03.b :
LVR01_0001_H09.b :
LVR01_0008_C08.b :
LVR01_0050_B05.b :
LVR01_0096_A01.b : gc
LVR01_0049_C07.b :
LVR01_0073_E11.b :
LVR01_0048_D01.b :
LVR01_0072_H01.b :
LVR01_0067_D08.b :
LVR01_0084_B07.b :
LVR01_0076_A10.b :
LVR01_0054_C12.b :
LVR01_0067_F11.b :
LVR01_0083_B03.b :
LVR01_0072_H06.b :
LVR01_0011_C09.b :
LVR01_0021_H08.b :
LVR01_0065_C01.b :
LVR01_0068_G12.b :
LVR01_0052_B08.b :
LVR01_0004_C02.b :
LVR01_0068_H03.b :
LVR01_0051_B09.b :
LVR01_0042_A04.b :
LVR01_0008_A04.b :
LVR01_0088_B02.b :
LVR01_0005_H10.b :
LVR01_0052_A01.b :
LVR01_0103_E02.b :
LVR01_0057_G04.b :
LVR01_0078_D05.b :
LVR01_0078_B02.b :
LVR01_0077_D01.b :
LVR01_0099_H06.b :
LVR01_0048_E02.b :
LVR01_0011_G09.b :
LVR01_0074_B02.b :
LVR01_0098_G03.b :
LVR01_0018_A12.b :
LVR01_0078_F10.b :
LVR01_0011_B02.b :
LVR01_0040_H12.b :
LVR01_0018_B10.b :
LVR01_0016_A09.b :
LVR01_0077_B02.b :
LVR01_0079_F07.b :
LVR01_0072_G05.b :
LVR01_0005_F02.b :
LVR01_0045_C12.b :
LVR01_0078_H02.b :
LVR01_0100_G07.b :
LVR01_0003_C01.b :
LVR01_0003_B01.b :
LVR01_0078_A03.b :
LVR01_0077_A07.b :
LVR01_0066_D08.b :
LVR01_0099_A03.b :
LVR01_0004_A06.b :
LVR01_0078_E04.b :
LVR01_0099_H09.b :
LVR01_0056_B07.b :
LVR01_0077_B04.b :
LVR01_0063_H04.b :
LVR01_0104_D08.b :
LVR01_0066_A05.b :
LVR01_0063_B08.b :
LVR01_0063_D01.b : cgccccaacaggctttxxxxxxxxxxxx
LVR01_0095_A06.b :
LVR01_0094_C12.b :
LVR01_0106_E12.b :
LVR01_0072_B08.b :
LVR01_0018_A08.b :
LVR01_0022_A05.b :
LVR01_0057_G01.b :
LVR01_0068_A04.b :
LVR01_0016_B03.b :
LVR01_0067_F02.b :
LVR01_0011_G03.b :
LVR01_0010_A05.b :
LVR01_0089_A05.b :
LVR01_0102_C12.b :
LVR01_0101_B05.b :
LVR01_0049_E09.b :
LVR01_0050_B08.b :
LVR01_0089_G02.b :
LVR01_0099_C05.b :
LVR01_0085_B03.b :
LVR01_0019_A09.b :
LVR01_0044_C02.b :
LVR01_0011_A04.b :
LVR01_0043_E01.b :
LVR01_0096_A09.b :
LVR01_0046_A07.b :
LVR01_0037_C07.b :
LVR01_0102_C11.b :
LVR01_0051_E07.b :
LVR01_0055_A11.b :
LVR01_0037_F05.b :
LVR01_0036_C11.b :
LVR01_0073_G07.b :
LVR01_0095_E08.b :
LVR01_0086_F12.b :
LVR01_0054_C06.b :
LVR01_0042_C03.b :
LVR01_0081_E04.b :
LVR01_0038_H03.b :
LVR01_0039_H12.b :
LVR01_0087_E10.b :
LVR01_0009_D03.b :
LVR01_0101_H10.b :
LVR01_0051_E10.b :
LVR01_0062_H08.b :
LVR01_0063_A10.b :
LVR01_0084_H01.b :
LVR01_0058_F03.b :
LVR01_0009_H04.b :
LVR01_0016_A10.b :
LVR01_0090_E12.b :
LVR01_0065_A08.b :
LVR01_0068_A02.b :
LVR01_0101_F02.b :
LVR01_0094_A02.b :
LVR01_0078_A06.b :
LVR01_0099_G05.b :
LVR01_0037_G06.b :
LVR01_0105_D01.b :
LVR01_0036_C09.b :
LVR01_0061_C08.b :
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b :
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : ....................................AAAAAATTTGTAAAAAAAACAGGG
---------+---------+---------+---------+---------+---------+ 24
LVR01_0020_F04.b : ttttttgttgactatatAAAAAATTTGTAAAAAAAACAGGG
LVR01_0052_E07.b : ttttttggtgcttatagtacaagtttgtcgacaaagcagc
LVR01_0018_F01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_F06.b : gcatttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_B06.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_F04.b : ccattgcgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_B04.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0036_H01.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_G12.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E01.b : ggggcatatgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_A06.b : tgcttcgtctcaactgtttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_H08.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_B01.b : tctacgtgacctatanngacxxxxxxxxxxxxxxxxx
LVR01_0056_D10.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D10.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_D02.b : tgaaccggctttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_C09.b : gggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0013_A09.b : nnnnggctattagagg
LVR01_0005_D06.b : gggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E03.b : gcatttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_F11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_H11.b : gctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_B10.b : ggcttggctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_E09.b : ctttttaggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_B11.b : aaggcattggtgcnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_C12.b : cttcacgtgcactanntagacxxxxxxxxxxxxxxxxxxx
LVR01_0002_C01.b : ttaggttgcctacntagacxxxxxxxxxxxxxxxxxxx
LVR01_0101_D01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B11.b : tgttttttccgctttgtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_F11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C07.b : ctttttgtggaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_D05.b : gtgtgtttttttttagcttaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_G09.b : cctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_H05.b : ataaaggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_D11.b : gcattaagtgacntanntagacxxxxxxxxxxxxxxxxx
LVR01_0001_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_G02.b : cgtctcttcttagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_E08.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B08.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_A03.b : gggtggtttttttcagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_H01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_B05.b : cattttggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C02.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_G03.b : ttttttgggtgccttttaaaacagtxxxxxxxxxxxxxxxxx
LVR01_0036_A09.b : atttggtggaatxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_B11.b : gggggagcctaxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_C09.b : atttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_G08.b : ttttgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_G03.b : gtcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_A10.b : ttttgtggctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_H05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H10.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_D04.b : ctttaggtgcgtataxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_D10.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A12.b : atttgggcttatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_A06.b : tttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_F07.b : ctttttggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F09.b : tttttgggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_C12.b : tggtttttttttggcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_A07.b : attttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_E08.b : ggatgggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_A04.b : catacccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_F09.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_G07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_E11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F08.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_E08.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_C03.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_E01.b : ttagagggcngctttgtgatagggggacantttgtaagxxxxxxx
LVR01_0033_B09.b : cttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_F08.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_E10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_B08.b : ccttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D11.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_D04.b : tttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F07.b : ccttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_C08.b : catttatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_C09.b : catttatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_F05.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_H01.b : agtctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_D11.b : gcatttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_H04.b : ggctatgtagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_D01.b : tggggtttttttgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D10.b : ctttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_E07.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_A10.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_F03.b : ccttttcgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_D04.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C07.b : gccttttatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_A12.b : tttttcttctttaaaatgcataggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_H02.b : cttttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_C08.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_G08.b : ctttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_D09.b : ttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_G08.b : ctttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_E12.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_A12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C05.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_C12.b : tgtttggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B04.b : ggtgtgtnatgcttcgtgacntatagacxxxxxxxxxxxxxxxxxx
LVR01_0025_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_H11.b : cgctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_H12.b : aggccttttagcgntgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H05.b : agcttttanngtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_H09.b : ttgactttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_E09.b : ggggtgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_G11.b : tgtttgagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_H01.b : gcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_E11.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_C11.b : gcatttagggtgactatanngacxxxxxxxxxxxxxxxxxx
LVR01_0062_C06.b : catttaagtggacxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_G04.b : gctcaaaagcttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_E11.b : ttttgcaggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E01.b : cgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_D11.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_F01.b : ggcattagcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_D02.b : ggggggggtnnnncagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F11.b : tgtggcgggcttttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_F08.b : tttaaggctttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_G03.b : gcctttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_H10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A11.b : gcattggtgacctanntagacxxxxxxxxxxxxxxxxxxx
LVR01_0054_F08.b : gcttttgcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_D02.b : ccccttgcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_D03.b : tttttgatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_C01.b : gcatttgggntgactacntagacxxxxxxxxxxxxxxxxxx
LVR01_0021_F09.b : gctttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_C12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G06.b : ccttttagctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_E09.b : tttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_C08.b : atttggagccnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_F09.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_G10.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_E11.b : ccatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_C11.b : ggctttagtccnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_E07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_E02.b : gggggggannaagcattagtgactagtagacxxxxxxxxxxxxxxxxxxx
LVR01_0082_H01.b : ggtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_B12.b : ggcatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_A12.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_C10.b : gctttttagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_C12.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_D02.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_G04.b : ttttggagcttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_H10.b : ttttcttagctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_D04.b : cctttagcgtactxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D03.b : ccttttgggtccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F06.b : gggggcttctcgggcttaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_H12.b : cgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_H05.b : acgcagctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_G01.b : ttcggtagcatagtgacntatagacxxxxxxxxxxxxxxxxxx
LVR01_0040_F02.b : ggggggagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_D08.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F12.b : gggcttgtcggcttggtgcnxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_D09.b : tttttcagcttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_B10.b : gtggtgtttttttcagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_H02.b : tggtgtttttttttagcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G08.b : gttttgggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_B01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E11.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_E11.b : gtttgggcatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_A11.b : gaggcattggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_B11.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_E04.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_G04.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_F10.b : gcatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_A09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_C07.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C02.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_B07.b : gcattacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F05.b : gggggcctccgaggcttaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_F07.b : gcctttggtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C08.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_D01.b : gcattatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_C04.b : tttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_E04.b : tttgggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_H06.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_G11.b : ggcctttacgtgactatanngacxxxxxxxxxxxxxxxxxx
LVR01_0015_C02.b : cctttggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E06.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F07.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_B06.b : ctttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_F01.b : tggttttttttttagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_D01.b : ggggggggntcncccgcatagtgactxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_H04.b : ggggtttttatcagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_B03.b : ggcatttggtgactacntagacxxxxxxxxxxxxxxxxxx
LVR01_0102_C09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_E03.b : gcattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_E07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_B06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_F02.b : ggggttttntntcgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H03.b : cccgccaggcatttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_F11.b : cccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_B11.b : gcttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_B07.b : gcatttggtgacctanntagacxxxxxxxxxxxxxxxxxx
LVR01_0009_F02.b : ctttttgcgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_H05.b : gctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G10.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_A08.b : cccttttggtccnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_F05.b : ggcttttggtgcgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_G05.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_A03.b : gactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_D10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_C12.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_G11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_C07.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_F09.b : ccttttagttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_B05.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_H04.b : gcatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_F04.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_F08.b : cattcggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_F01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_G02.b : ctgagcatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_C04.b : atggaagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_A07.b : actxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_C05.b : ggcttttaggctgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B09.b : agcatttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_D03.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_H08.b : tagcccttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_A09.b : gcattaggtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D06.b : cccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_E04.b : gtgtttttggctttgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D01.b : ggggacagatttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_F02.b : tttctcagcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E07.b : gcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_A03.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_G06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_G06.b : gcatttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_B01.b : ggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_C08.b : cctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C05.b : gcttttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_H10.b : gtggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_H09.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_C05.b : gccttttagctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B09.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_C07.b : atttggtggactacntagacxxxxxxxxxxxxxxxxxx
LVR01_0061_A07.b : gtttttttctgaaacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_D07.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_F01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_H01.b : ttaattataatacagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_F01.b : tttttttctagcatagtgcnxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_E01.b : tgccctcgctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_B07.b : attacggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_F07.b : gggcattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_C05.b : ggcttaataaggctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_C01.b : tttttaaggcttagtgacntatagacxxxxxxxxxxxxxxxxxx
LVR01_0082_F05.b : ccttttgcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_H04.b : gggggggtttttattgctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_B04.b : gggtnttnntgcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_C03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_H09.b : aacccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_B05.b : gggtgtttttttttagatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_A01.b : cattttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_C07.b : gggtgtttttttttagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_E11.b : tttttgattttataagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_D01.b : ggggttttttttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_H01.b : ttttttttttttttgcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_D08.b : ggcattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_B07.b : cgctttatgtgcntanntagacxxxxxxxxxxxxxxxxxx
LVR01_0076_A10.b : tttttttttttttttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C12.b : ggctttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_B03.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_H06.b : tttttttttttaccagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_C09.b : ggtttaagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_H08.b : gcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_C01.b : gtcaacggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_G12.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B08.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_C02.b : tatacgtgacntacntagacxxxxxxxxxxxxxxxxxx
LVR01_0068_H03.b : ttttttttttttttctgtttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_B09.b : gttgttttttttcctgctagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_A04.b : tttaaacaagctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A04.b : gcggcttctggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_B02.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_H10.b : ggctttagtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_A01.b : tggttgtctttttttggaaacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_E02.b : gggtgtttggctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_G04.b : ccttttgcgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_D05.b : gcctttaacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B02.b : ggggggttttatagcttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_D01.b : ggggttcttccggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H06.b : gagcattagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E02.b : ggggtgtctttntggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G09.b : gggaggggcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_B02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_G03.b : gctttttgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_A12.b : gcctttggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_B02.b : ttttataggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_H12.b : ttttttggcttagtgacntatagacxxxxxxxxxxxxxxxxxx
LVR01_0018_B10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_A09.b : gcattttgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_B02.b : ggggggttttttaagcttagtgacgtatagacxxxxxxxxxxxxxxxxxx
LVR01_0079_F07.b : gcctttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_G05.b : tttttttttttccggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_F02.b : gggcattggtgacctactagacxxxxxxxxxxxxxxxxxxx
LVR01_0045_C12.b : gttttttcaagcttggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_H02.b : ggggggcctggcattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_G07.b : ggcttttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_C01.b : acacggtgcactanntagacxxxxxxxxxxxxxxxxxx
LVR01_0003_B01.b : caaactggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A03.b : gtttttttttttttctgcttggtgcactxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A07.b : tgggggttttttcccgtttggtgcactxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_D08.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A03.b : gagcataggtgcnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_A06.b : ctatactgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_E04.b : ccctatagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H09.b : gagcatttgtgcntatanngacxxxxxxxxxxxxxxxxxx
LVR01_0056_B07.b : cctttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_B04.b : gcatttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_H04.b : ggttaaaacaagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_D08.b : gtgtctccctggcctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_A05.b : ttttggagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_B08.b : gcttttttaaagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_A06.b : gtttttttacagctttgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C12.b : tgttcaagcatttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_E12.b : ggctttccattgctttgtgacntatagacxxxxxxxxxxxxxxxxxx
LVR01_0072_B08.b : gttttttttagagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_A08.b : ccatttggtgacctanntagacxxxxxxxxxxxxxxxxxx
LVR01_0022_A05.b : ccttttggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_G01.b : tcgttcagcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A04.b : agcatttacggtgactatanngacxxxxxxxxxxxxxxxxxx
LVR01_0016_B03.b : acaagggcctggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F02.b : ggcatctgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G03.b : ggggcagctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_A05.b : gcaatacgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_A05.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_C12.b : cattttggtccnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_B05.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_E09.b : gttgtgttggggctgacccggcactxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_B08.b : ggttgtttttttttagcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G02.b : gaagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_C05.b : ggcatctaggtccntanntagacxxxxxxxxxxxxxxxxxxx
LVR01_0085_B03.b : gggccctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_A09.b : tttttagagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_C02.b : ggggaacctgcatagtgacctxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_A04.b : ttggatatgatacgggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E01.b : ggggaaacttgcttcgtgactggccnacxxxxxxxxxxxxxxxxxx
LVR01_0096_A09.b : gtgtttatatagcatagtgacctxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_A07.b : ttttttttaagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_C11.b : gctttttgctgacnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E07.b : ggggggtttttcaggcttagtgacttatataaatatgtttgtaaagcaa
LVR01_0055_A11.b : tggggctagatttggtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F05.b : ttttggggccxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_C11.b : ttatggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_G07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_E08.b : ttttttggtgcctxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_F12.b : gcattatgtgcacxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C06.b : ccattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_C03.b : gcttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_E04.b : tcatttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_H03.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_H12.b : tttttggctttggtgcxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E10.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_D03.b : ggagcatttgtgacntnntagacxxxxxxxxxxxxxxx
LVR01_0101_H10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E10.b : gggtttttttttncgctagggagxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H08.b : tttttttggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_A10.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_H01.b : cacggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F03.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_H04.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_A10.b : gcccaggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E12.b : cgcgcccctttttccgcagcttgtacgtatagacxxxxxxxxxxxxxxxx
LVR01_0065_A08.b : tctcatcactttggtgxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A02.b : ttcttttggtttaccgcttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_F02.b : ttaggcattggtgcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_A02.b : tgaacaggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A06.b : gctttctacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_G05.b : gggcattggtgxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_G06.b :
LVR01_0105_D01.b : gggggaccgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_C09.b :
LVR01_0061_C08.b :
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b :
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : TGGTGCCGGTCCGCGAATTCCTCCAGCACCGGTTGGCCTACTGGAGCATTGC*GGGCAGG
---------+---------+---------+---------+---------+---------+ 83
LVR01_0020_F04.b : TGGTGCCGGTCCGCGAATTCCTCCAGCACCGCTTTGTCTACTGGAGCATTGC*TGGCCGG
LVR01_0052_E07.b : gctggtgccggtccgcgagacctccaccaccGTTGGCGTACTGGAGCATTGC*GGGCCGG
LVR01_0018_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGGCCTACTGGAGCATTGC*GGGCAGG
LVR01_0052_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagggACTGGAGCATTGC*GGGCGGG
LVR01_0020_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAGCATTGC*GGGCAGG
LVR01_0101_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAGCATTGC*GGGCAGG
LVR01_0072_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctactggCTGGAGCATTGC*GGGCAGG
LVR01_0037_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncccttttagTGGAGCATTGC*GGGCAGG
LVR01_0036_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0077_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0090_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0073_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0077_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0001_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCATTGC*GGGCAGG
LVR01_0056_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCATTGC*GGGCAGG
LVR01_0072_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCATTGC*GGGCAGG
LVR01_0092_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCATTGC*GGGCAGG
LVR01_0084_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCATTGC*GGGCAGG
SPLT1_0013_A09.b : ccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCATTGC*GGGCATG
LVR01_0005_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCATTGC*GGGCAGG
LVR01_0089_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0018_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCATTGC*GGGCAGG
LVR01_0077_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0091_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0062_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0099_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAGCATTGC*GGGCAGG
LVR01_0004_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCATTGC*GGGCAGG
LVR01_0002_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0101_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATTGC*GGGCAGG
LVR01_0104_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0019_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0045_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0051_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0025_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgagtcggccAGCATTGC*GGGCAGG
LVR01_0043_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0065_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0092_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0001_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0096_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0018_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGCATTGC*GGGCAGG
LVR01_0078_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0051_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0021_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCATTGC*GGGCAGG
LVR01_0097_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0035_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0036_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0035_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0035_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0103_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0036_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0035_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0038_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0033_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0071_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0103_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0047_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0039_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0004_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0020_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0086_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0093_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0041_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0085_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0025_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0039_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0033_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0026_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0096_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0065_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0041_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0053_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0020_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0076_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0085_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0079_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0047_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0016_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0074_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0038_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0052_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0025_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0095_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0104_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0031_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0026_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0028_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0062_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0013_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0038_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0039_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0104_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0025_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0082_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0012_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0040_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0079_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0062_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0062_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0093_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0061_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0022_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0052_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0061_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0038_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0065_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0056_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0028_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0098_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0086_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0068_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0021_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0031_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0028_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0005_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0045_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0086_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0018_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0082_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0082_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0040_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0093_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0009_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0033_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0029_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0041_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0055_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGTAGG
LVR01_0045_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0016_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0048_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0018_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0084_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0040_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0021_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0104_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0059_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0004_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0012_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0053_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0043_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0050_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0053_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0060_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0092_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0048_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0042_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0095_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCATTGC*GGGCAGG
LVR01_0087_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0028_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0059_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0015_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0003_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0028_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0031_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0049_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0049_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0087_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0010_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0016_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0049_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0062_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0017_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0093_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0009_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0009_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0044_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0085_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0090_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0021_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0033_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0073_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0098_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0040_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0030_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0039_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0058_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0073_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0042_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0083_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0106_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0065_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0065_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0066_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0034_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0066_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0086_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0099_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0081_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0009_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0041_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0082_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0095_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0084_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0061_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0063_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0071_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0103_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0011_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0060_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0005_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0096_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0020_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0082_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0106_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0098_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0001_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0050_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0096_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0049_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0073_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0048_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*CGGCAGG
LVR01_0067_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0084_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0076_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0054_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0067_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0083_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0072_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttGCATTGC*GGGCAGG
LVR01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0021_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0065_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0068_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0052_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0004_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0068_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0051_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0042_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0008_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0088_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0005_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0052_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0103_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0057_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0099_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0048_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0011_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0074_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0098_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0018_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0011_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0040_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0018_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0016_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0079_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0072_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0005_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0045_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0100_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0003_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACTGC*GGGCAGG
LVR01_0003_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0066_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0099_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0004_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0099_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0056_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0077_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0063_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0104_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0066_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0063_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0063_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGCGGGGCAGG
LVR01_0095_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0094_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0106_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0072_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0018_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0022_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0057_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0068_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0016_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0067_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0011_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0010_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0102_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0101_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0049_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0050_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0089_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0099_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0085_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0019_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0044_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0011_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0043_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0096_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0046_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGC*GGGCAGG
LVR01_0037_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCATTGC*GGGCAGG
LVR01_0102_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgggGATTGC*GGGCAGG
LVR01_0051_E07.b : gctggctccggtccgtgattactccctcactctttgtctactggatgATTGT*GGGCAGG
LVR01_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTGC*GGGCAGG
LVR01_0037_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0036_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0073_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0095_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0086_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTTGC*GGGCAGG
LVR01_0054_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0042_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0081_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0038_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0039_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0087_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0009_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0101_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0051_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0062_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0063_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0084_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0058_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0009_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTGC*GGGCAGG
LVR01_0016_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0090_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0068_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0101_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0094_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0078_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC*GGGCAGG
LVR01_0099_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*GGGCAGG
LVR01_0037_G06.b : cctcctgtgctcttactcggtagcatttgctgggcacGG
LVR01_0105_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtccttccccgcct
LVR01_0036_C09.b :
LVR01_0061_C08.b :
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b :
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
---------+---------+---------+---------+---------+---------+ 127
LVR01_0020_F04.b : TGGTGGCTCT*GGCTCCACTCAGCGCGTCCCGCTCTGCGAGGCAA***************
LVR01_0052_E07.b : TGGTGGCTCC*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_F01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_F06.b : TGGTGGCTCT*CTTTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0020_B06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_F04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_B04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_A09.b : TGGTGGCTCT*GGGTCCTTTCAGCGCATCCCGCTCTGCGAGGCAT***************
LVR01_0036_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_G12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0090_E01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0073_A06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_H08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0001_B01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0056_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0092_D02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0084_C09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
SPLT1_0013_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0005_D06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_E03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_H11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0091_B10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_E09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_B11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0004_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0002_C01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0104_B11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0045_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_D05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0025_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0043_G09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_H05.b : TGGTGGCT***GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0092_D11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0001_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0096_G02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_E08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0021_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0097_B05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_C02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0035_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0036_A09.b : TGGCGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0035_B11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0035_C09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_G08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0103_A10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0036_H05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0035_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0038_D04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0033_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0071_A12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0103_A06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_F09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0047_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_A07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0039_E08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0004_A04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0020_F09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0086_G07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0093_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0041_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0085_E08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0025_C03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0039_E01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0033_B09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0026_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_C03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0096_E10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_D11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_D04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGGGGCAG***************
LVR01_0089_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0041_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0053_C09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0020_F05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0076_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0085_D11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0079_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0047_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAA***************
LVR01_0074_E07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0038_A10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_F03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0025_D04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0095_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0104_A12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0031_H02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0026_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_G08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0028_D09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_G08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0013_E12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0038_A12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_C10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0039_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_B12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0104_B04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0025_A08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_H11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_H12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0082_H05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_H09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0012_E09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0040_G11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0079_C11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_C06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_G04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0093_H05.b : GGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAA***************
LVR01_0102_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0061_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_E01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0022_D11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_F01.b : TGGTGGCTCT*GGGTCCACTCAGTGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_D02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0061_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0038_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0056_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0028_A11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0098_D02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0086_D03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0068_C01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0021_F09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0031_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_G06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0028_E09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0005_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_F09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_G10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0045_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0086_C11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_E07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0082_E02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0082_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0040_D09.b : TGGTGGCTCT*GGGTCCACTCGGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_B12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_D09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0093_A12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_C10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0033_A05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0029_D02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0041_G04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0055_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0045_D04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_D03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0048_F06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_H12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0084_H05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_G01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0040_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0021_D08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0104_F12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0059_D09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_B10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_H02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0044_G08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0004_B01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0012_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_A11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0053_B11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_E04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0043_G04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0050_F10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0053_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0060_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_C02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0092_B07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0048_F05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0042_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0095_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0087_C04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0028_E04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_H06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0059_G11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0015_C02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_E06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0003_B04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0028_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0031_B06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0049_F01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0049_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0087_B03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_C09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_E03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0010_E07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_C11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_B06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0049_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_H03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGGAGTTTTGCTTTTCA
LVR01_0017_G07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0093_B11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_B07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_H05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0044_G10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_A08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0085_F05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0090_G05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0021_D10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0033_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_G11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0073_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0098_F09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0040_B05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_F04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_F08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0030_F01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_G02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0039_C04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0058_A07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0073_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_B09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_D03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_H08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0042_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_D06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0083_G07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0106_E04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0066_E07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0034_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0066_G06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_G06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0086_B01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_D11.b : TGGCGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0041_H09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0082_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0095_B09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0084_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0061_A07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0063_D07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_F01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0071_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0103_F01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0011_E01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0060_B07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0005_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0096_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0020_C01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0082_F05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0106_B04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0098_C03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0001_H09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_C08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0050_B05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0096_A01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0049_C07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0073_E11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0048_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0067_D08.b : TGGCGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0084_B07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0076_A10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0067_F11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0083_B03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_H06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAAGCAG***************
LVR01_0011_C09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0021_H08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_C01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0068_G12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0004_C02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0068_H03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_B09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0042_A04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0008_A04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0088_B02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0005_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0052_A01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0103_E02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0057_G04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_D05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_B02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_H06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0048_E02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0011_G09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0074_B02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0098_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_A12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_F10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0011_B02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0040_H12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_B10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_B02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0079_F07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_G05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0005_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0045_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_H02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0100_G07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0003_C01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0003_B01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_A07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0066_D08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_A03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0004_A06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_E04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_H09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0056_B07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0077_B04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0063_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0104_D08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0066_A05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0063_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0063_D01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0095_A06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0106_E12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0072_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0018_A08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0022_A05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0057_G01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0068_A04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_B03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0067_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0011_G03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0010_A05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_A05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_C12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_B05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0049_E09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0050_B08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0089_G02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_C05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0085_B03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0019_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0044_C02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0011_A04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0043_E01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0096_A09.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0046_A07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_C07.b : TGGTGGCTCT*GGGTCCACTCAACGCATCCCGCTCTGCGAGGCAG***************
LVR01_0102_C11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_E07.b : TGGTGGCTCT*GGGTCCACTCGGCGCCTCCCACTCTGCGAGGCAG***************
LVR01_0055_A11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_F05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0036_C11.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0073_G07.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0095_E08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0086_F12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0054_C06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0042_C03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0081_E04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0038_H03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0039_H12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0087_E10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_D03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_H10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0051_E10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0062_H08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0063_A10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0084_H01.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0058_F03.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0009_H04.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0016_A10.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0090_E12.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0065_A08.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0068_A02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0101_F02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0094_A02.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0078_A06.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0099_G05.b : TGGTGGCTCT*GGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0037_G06.b : TGGTGGCTCTAGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAG***************
LVR01_0105_D01.b : tttctgtctctgggacctggcggcgggactgGCTCGGCGAGGCAG***************
LVR01_0036_C09.b : agggccgaagggcatga
LVR01_0061_C08.b :
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b :
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
---------+---------+---------+---------+---------+---------+ 185
LVR01_0020_F04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_E07.b : *ACATGA*CGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_F06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0020_B06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_F04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_B04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_A09.b : *ACATGATTGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0036_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_G12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0090_E01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0073_A06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_H08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0001_B01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0056_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0092_D02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0084_C09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
SPLT1_0013_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0005_D06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_E03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_H11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0091_B10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_E09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_B11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0004_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0002_C01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0104_B11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0045_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_D05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0025_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0043_G09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0092_D11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0001_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0096_G02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGACTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_E08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0021_H01.b : *ACATGA*GGGCGGGGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0097_B05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_C02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0035_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0036_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGGCTCCTGGTGGCTGGGCT
LVR01_0035_B11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0035_C09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_G08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0103_A10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0036_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0035_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0038_D04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0033_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0071_A12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0103_A06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_F09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0047_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_A07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0039_E08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0004_A04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0020_F09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0086_G07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0093_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0041_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0085_E08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0025_C03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0039_E01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0033_B09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0026_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_C03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCCGGTGGCTGGGCT
LVR01_0094_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0096_E10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_D11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_D04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0041_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0053_C09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0020_F05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0076_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0085_D11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0079_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0047_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0074_E07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0038_A10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_F03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0025_D04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0095_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0104_A12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0031_H02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0026_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_G08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0028_D09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_G08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0013_E12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0038_A12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_C10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0039_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_B12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0104_B04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0025_A08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_H11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_H12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0082_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_H09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0012_E09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0040_G11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0079_C11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_C06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_G04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0093_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGGGGCTGGGCT
LVR01_0102_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0061_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_E01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0022_D11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_D02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0061_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0038_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0056_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0028_A11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0098_D02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0086_D03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0068_C01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0021_F09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0031_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_G06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0028_E09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0005_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_F09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_G10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0045_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0086_C11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_E07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0082_E02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0082_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0040_D09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_B12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_D09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0093_A12.b : *ACATGA*GGGCGGAGGGCACGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_C10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0033_A05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0029_D02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0041_G04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0055_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0045_D04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_D03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0048_F06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_H12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0084_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_G01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0040_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0021_D08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0104_F12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0059_D09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_B10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_H02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0044_G08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0004_B01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0012_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_A11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0053_B11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_E04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0043_G04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0050_F10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0053_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0060_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_C02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0092_B07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0048_F05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0042_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0095_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0087_C04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0028_E04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_H06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0059_G11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0015_C02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_E06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0003_B04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0028_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0031_B06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0049_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0049_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0087_B03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_C09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_E03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0010_E07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_C11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_B06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0049_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_H03.b : GACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0017_G07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0093_B11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_B07.b : *ACATGA*GGGCGGAGGGCATGTCTCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGG*CCTCCTGGTGGCTGGGCT
LVR01_0019_H05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0044_G10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_A08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0085_F05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0090_G05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0021_D10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0033_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_G11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0073_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0098_F09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0040_B05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_F04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_F08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0030_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_G02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0039_C04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0058_A07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0073_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_B09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_D03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_H08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0042_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_D06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0083_G07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0106_E04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0066_E07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0034_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0066_G06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_G06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0086_B01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_D11.b : *ACATGA*GGGCGGAGGGCATGCCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0041_H09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0082_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0095_B09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0084_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0061_A07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCCCCTGGTGGCTGGGCT
LVR01_0063_D07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0071_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0103_F01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_E01.b : *ACATGA*GGGCGGAGGGCATGTCCCACTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0060_B07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0005_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0096_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0020_C01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0082_F05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0106_B04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0098_C03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0001_H09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_C08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0050_B05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0096_A01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0049_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0073_E11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0048_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0067_D08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0084_B07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0076_A10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0067_F11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0083_B03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_H06.b : *ACGTGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_C09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0021_H08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_C01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0068_G12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0052_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCCGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0004_C02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0068_H03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_B09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0042_A04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0008_A04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0088_B02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0005_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCCGGGCT
LVR01_0052_A01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0103_E02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0057_G04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_D05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_B02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_D01.b : *ACATGA*GGGCGGAAGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_H06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0048_E02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_G09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0074_B02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCCCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0098_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_A12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_F10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_B02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0040_H12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_B10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_B02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0079_F07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_G05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0005_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0045_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_H02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0100_G07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0003_C01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0003_B01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_A07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0066_D08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_A03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0004_A06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_E04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_H09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0056_B07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0077_B04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0063_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0104_D08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0066_A05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0063_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0063_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0095_A06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0106_E12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0072_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0018_A08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0022_A05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0057_G01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0068_A04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_B03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0067_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_G03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0010_A05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_A05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_C12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_B05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0049_E09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0050_B08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0089_G02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_C05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0085_B03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0019_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0044_C02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0011_A04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0043_E01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0096_A09.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0046_A07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_C07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0102_C11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_E07.b : *ACATGA*GGGCGGATGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0055_A11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_F05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0036_C11.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0073_G07.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0095_E08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0086_F12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0054_C06.b : *ACGTGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0042_C03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0081_E04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0038_H03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0039_H12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0087_E10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_D03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_H10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0051_E10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0062_H08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0063_A10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0084_H01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0058_F03.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0009_H04.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0016_A10.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0090_E12.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0065_A08.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0068_A02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0101_F02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0094_A02.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0078_A06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0099_G05.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0037_G06.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0105_D01.b : *ACATGA*GGGCGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0036_C09.b : catagatgggcaGGAGGGCATGTCCCTCTTCCTGGCTCTGGGCCTCCTGGTGGCTGGGCT
LVR01_0061_C08.b : ttttttaagcatttxxxxx
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b :
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
---------+---------+---------+---------+---------+---------+ 244
LVR01_0020_F04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCTAAGACTGTGACC*CTGA
LVR01_0052_E07.b : CAGCTCCACGGTCCACTGCGGCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_F06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0020_B06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_F04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_B04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_A09.b : CTGCTCCAGGGTCCACTGCGTCCCATCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0036_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_G12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0090_E01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0073_A06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGATTGTGACC*CTGA
LVR01_0077_H08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0001_B01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0056_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0092_D02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0084_C09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
SPLT1_0013_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0005_D06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_E03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_H11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0091_B10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_E09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_B11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0004_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0002_C01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0104_B11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0045_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_D05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0025_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0043_G09.b : CTGCTCCAGGGTCCACCGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0092_D11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0001_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0096_G02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_E08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0021_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0097_B05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_C02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0035_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0036_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0035_B11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0035_C09.b : CTGCTACAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_G08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0103_A10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0036_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0035_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0038_D04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0033_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0071_A12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0103_A06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_F09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0047_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_A07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0039_E08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0004_A04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0020_F09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0086_G07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0093_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0041_F08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0085_E08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0025_C03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0039_E01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0033_B09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0026_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_C03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_F08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0096_E10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_D11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_D04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0041_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0053_C09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0020_F05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0076_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0085_D11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0079_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0047_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0074_E07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0038_A10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_F03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0025_D04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0095_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0104_A12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0031_H02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0026_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_G08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0028_D09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_G08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0013_E12.b : CTGCTCCAGGGTCCTCTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0038_A12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_C10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0039_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_B12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0104_B04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0025_A08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_H11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_H12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0082_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_H09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0012_E09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0040_G11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0079_C11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_C06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_G04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0093_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAAACTGTGACC*CTGA
LVR01_0102_F08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0061_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_E01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0022_D11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_D02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0061_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0038_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_F08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0056_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0028_A11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_F08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0098_D02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0086_D03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0068_C01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCCCAAAGACTGTGACC*CTGA
LVR01_0021_F09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0031_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_G06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0028_E09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0005_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_F09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_G10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0045_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0086_C11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_E07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0082_E02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0082_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0040_D09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_B12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_D09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0093_A12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0009_C10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0033_A05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_C12.b : CGGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0029_D02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0041_G04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0055_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0045_D04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_D03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0048_F06.b : CTGTTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_H12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0084_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_G01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0040_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0021_D08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0104_F12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0059_D09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_B10.b : CTGCTCCAGGGTCCACTACGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_H02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0044_G08.b : CTGCTCCAGGGTCCGCTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0004_B01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0012_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_A11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0053_B11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_E04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCTCTGA
LVR01_0043_G04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0050_F10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0053_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0060_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_C02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0092_B07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0048_F05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0042_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0095_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0087_C04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0028_E04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_H06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0059_G11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0015_C02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_E06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0003_B04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0028_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0031_B06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0049_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0049_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0087_B03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_C09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_E03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0010_E07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_C11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_B06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0049_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_H03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0017_G07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0093_B11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0009_B07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0009_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0019_H05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0044_G10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_A08.b : CTGCTCCAGGGCCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0085_F05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGGCTGTGACC*CTGA
LVR01_0090_G05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0021_D10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0033_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_G11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0073_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0098_F09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0040_B05.b : CTGCTCCAGGGTCCGCTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_F04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_F08.b : CTGCTCCAGGGTCCACCGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0030_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_G02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACCGTGACC*CTGA
LVR01_0039_C04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0058_A07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0073_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_B09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_D03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_H08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0042_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_D06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0083_G07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0106_E04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCGAAGACTGTGACC*CTGA
LVR01_0066_E07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0034_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0066_G06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_G06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0086_B01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_D11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0009_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0041_H09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0082_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0095_B09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0084_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0061_A07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0063_D07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0071_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0103_F01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_E01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGGCCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0060_B07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0005_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0096_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0020_C01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0082_F05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0106_B04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0098_C03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0001_H09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_C08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0050_B05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0096_A01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0049_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0073_E11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0048_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0067_D08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0084_B07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0076_A10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0067_F11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0083_B03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_H06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_C09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0021_H08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_C01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0068_G12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0004_C02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0068_H03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_B09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0042_A04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0008_A04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0088_B02.b : CTGCTCCAGGGCCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0005_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0052_A01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0103_E02.b : CCGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0057_G04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_D05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_B02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_H06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0048_E02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_G09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0074_B02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0098_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_A12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_F10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_B02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0040_H12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_B10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_B02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0079_F07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_G05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0005_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0045_C12.b : CTGCTCCAGGGTCCACTGCTTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_H02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0100_G07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0003_C01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0003_B01.b : CTGCTTCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_A07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0066_D08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_A03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0004_A06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_E04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_H09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0056_B07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0077_B04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0063_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0104_D08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0066_A05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0063_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0063_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGAAC*CTGA
LVR01_0095_A06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0106_E12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0072_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0018_A08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0022_A05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0057_G01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0068_A04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_B03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0067_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_G03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0010_A05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_A05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_C12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_B05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0049_E09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0050_B08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0089_G02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_C05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0085_B03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTTAAAGACTGTGACC*CTGA
LVR01_0019_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0044_C02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0011_A04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0043_E01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0096_A09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0046_A07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_C07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0102_C11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_E07.b : CTGCTCCAGGGTCCACTGCGTCCCACCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0055_A11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_F05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0036_C11.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0073_G07.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0095_E08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0086_F12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0054_C06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0042_C03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0081_E04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0038_H03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0039_H12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0087_E10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACT*CTGA
LVR01_0009_D03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_H10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0051_E10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0062_H08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0063_A10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0084_H01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0058_F03.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0009_H04.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0016_A10.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0090_E12.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0065_A08.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0068_A02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0101_F02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0094_A02.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0078_A06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0099_G05.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0037_G06.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0105_D01.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0036_C09.b : CTGCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACC*CTGA
LVR01_0061_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0067_G04.b :
TES01_0096_F08.b :
LVR01_0010_G05.b : gcatttg
LVR01_0050_B11.b :
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
---------+---------+---------+---------+---------+---------+ 304
LVR01_0020_F04.b : TCGGCCACATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0052_E07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0018_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0052_F06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0020_B06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0101_F04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0072_B04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0037_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0036_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_G12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0090_E01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0073_A06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACGCCGCCATCGTCTCCAGCAACACCGACT
LVR01_0077_H08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0001_B01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0056_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0072_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACGCCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0092_D02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0084_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
SPLT1_0013_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0005_D06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0089_E03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0018_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_H11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0091_B10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0062_E09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0099_B11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0004_C12.b : GGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0002_C01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0101_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0104_B11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0019_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0045_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0051_D05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0025_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0043_G09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0065_H05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0092_D11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0001_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0096_G02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0018_E08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0078_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0021_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0097_B05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_C02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0035_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0036_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0035_B11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0035_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0037_G08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0103_A10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0036_H05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0035_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0038_D04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0033_D10.b : AGGGCCAGATCACGAAGCTGCCGGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0071_A12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0103_A06.b : AGGGCCAGATCCCGAAGCTGCCAGCGCACAACACCGCCCTCGTCTCCAGCAACACCGACT
LVR01_0054_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGCCTCCAGCAACACCGACT
LVR01_0037_F09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0047_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0037_A07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0039_E08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0004_A04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0020_F09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0086_G07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0093_E11.b : GGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0041_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0085_E08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0025_C03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0039_E01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0033_B09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAGCACCGACT
LVR01_0026_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0037_C03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0034_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0094_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0096_E10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0019_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0065_D11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0019_D04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0054_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0089_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0041_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0053_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0020_F05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0076_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0085_D11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0079_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0047_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0016_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0054_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0074_E07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0038_A10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0052_F03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0025_D04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0095_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0104_A12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0031_H02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0026_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0034_G08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0028_D09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0062_G08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0013_E12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0038_A12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0034_C10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0037_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0039_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0081_B12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0104_B04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0025_A08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_H11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_H12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0082_H05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0102_H09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0012_E09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0040_G11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0034_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0034_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0079_C11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0062_C06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0062_G04.b : AGGGCCAGTTCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0093_H05.b : AGGGCCAAATCACGAAGCTGCCACCGCACAACACCGCCGTCTTCTCCAGCAACACCGACT
LVR01_0102_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0061_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0094_E01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0022_D11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0052_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_D02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0061_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0038_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0065_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0056_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0019_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0028_A11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0054_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGCCTCCAGCAACACCGACT
LVR01_0098_D02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0086_D03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0068_C01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0021_F09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0031_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0094_G06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0028_E09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0005_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0081_F09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_G10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0045_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0086_C11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0018_E07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0082_E02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0082_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0040_D09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_B12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0101_D09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0093_A12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0009_C10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0033_A05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0089_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0029_D02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0041_G04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0055_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0045_D04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0016_D03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0048_F06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0018_H12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0084_H05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0008_G01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0040_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0021_D08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0104_F12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0059_D09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_B10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_H02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0044_G08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0004_B01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0012_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0089_A11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0053_B11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACGACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0019_E04.b : AGGGCCAGATCACAAAGCTGCCAGCGCACGACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0043_G04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0050_F10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0053_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0060_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0054_C02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0092_B07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0048_F05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0042_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0095_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0102_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0087_C04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0028_E04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCGGCAACACCGACT
LVR01_0052_H06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0059_G11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0015_C02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0089_E06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0003_B04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0028_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0031_B06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0049_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0049_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0087_B03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0102_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0008_E03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0010_E07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0016_C11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0094_B06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0049_F02.b : AGGGCCAGATCACGAAGCTACCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0062_H03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0017_G07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0077_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0093_B11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0009_B07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0009_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0019_H05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0044_G10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_A08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0085_F05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0090_G05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0021_D10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAGCACCGACT
LVR01_0033_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0034_G11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0073_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0098_F09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0040_B05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAGCACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0101_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0008_F04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0008_F08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0030_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0102_G02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0039_C04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0058_A07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0073_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_B09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_D03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0101_H08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0042_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0101_D06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0083_G07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0106_E04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0065_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0065_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0066_E07.b : AGGGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0034_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0066_G06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_G06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0086_B01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0099_D11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACGCCGACT
LVR01_0101_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0081_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0009_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0041_H09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0082_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0095_B09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGCCGTCTCCAGCAACACCGACT
LVR01_0084_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0061_A07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0063_D07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0094_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0071_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0103_F01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0011_E01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0060_B07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0005_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0096_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0020_C01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0082_F05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0106_B04.b : AGGGCCAGATCACGAAGTTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0098_C03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0001_H09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0008_C08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0050_B05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0096_A01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0049_C07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0073_E11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0048_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0072_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0067_D08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0084_B07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0076_A10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0054_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0067_F11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0083_B03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0072_H06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0011_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0021_H08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0065_C01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0068_G12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0052_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0004_C02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0068_H03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_B09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0042_A04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0008_A04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0088_B02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0005_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0052_A01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0103_E02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0057_G04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_D05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_B02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0099_H06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0048_E02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0011_G09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0074_B02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0098_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0018_A12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_F10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0011_B02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0040_H12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0018_B10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0016_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0077_B02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0079_F07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0072_G05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0005_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0045_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_H02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0100_G07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0003_C01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0003_B01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0078_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_A07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0066_D08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0099_A03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0004_A06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0078_E04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0099_H09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0056_B07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0077_B04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0063_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0104_D08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0066_A05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0063_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0063_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0095_A06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGCCGTCTCCAGCAACACCGACT
LVR01_0094_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0106_E12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0072_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0018_A08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0022_A05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0057_G01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0068_A04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0016_B03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0067_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0011_G03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0010_A05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0089_A05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0102_C12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0101_B05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0049_E09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0050_B08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0089_G02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0099_C05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0085_B03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0019_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0044_C02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0011_A04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0043_E01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0096_A09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0046_A07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0037_C07.b : AGGGCCAGATCGCGAATCTGCCAGCGCACAACACCGCCGTCATCTCCAGCAACACCCACT
LVR01_0102_C11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_E07.b : TGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0055_A11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0037_F05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0036_C11.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0073_G07.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0095_E08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0086_F12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0054_C06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0042_C03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0081_E04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0038_H03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0039_H12.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0087_E10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0009_D03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0101_H10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0051_E10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0062_H08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0063_A10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0084_H01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0058_F03.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0009_H04.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0016_A10.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0090_E12.b : AGGGCCTGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0065_A08.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0068_A02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0101_F02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0094_A02.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0078_A06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0099_G05.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0037_G06.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
LVR01_0105_D01.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0036_C09.b : AGGGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCATCGTCTCCAGCAACACCGACT
LVR01_0061_C08.b : xxxxxxxxxxCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACT
TES01_0067_G04.b : nactactgttgctatggAACACCGGCATCGTCTCC*GCAACACCGACT
TES01_0096_F08.b : ttttactgctgtggctatggacacCCGACT
LVR01_0010_G05.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_B11.b : ggttttttttttttagcttcg
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
---------+---------+---------+---------+---------+---------+ 363
LVR01_0020_F04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_E07.b : TCGCCTTCAGCCTCTACAAA*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_F06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0020_B06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_F04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0072_B04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_A09.b : TCGCCTTCAGCCTCTACAAGACAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0036_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_G12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0090_E01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0073_A06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_H08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0001_B01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0056_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0072_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0092_D02.b : CCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0084_C09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
SPLT1_0013_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0005_D06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_E03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_H11.b : TCGCCTTTAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0091_B10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_E09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_B11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0004_C12.b : TCGCCTTCAGCCTCTACGAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0002_C01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0104_B11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0045_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_D05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0025_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0043_G09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_H05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0092_D11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0001_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0096_G02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_E08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_A03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0021_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0097_B05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_C02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0035_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0036_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTCCGGTCGACCCCAAAAAGAATGTCATCTTC
LVR01_0035_B11.b : TCGCCTTCAGCCTCTACAAG*TAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0035_C09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_G08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0103_A10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0036_H05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0035_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0038_D04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0033_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0071_A12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0103_A06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_F07.b : TCGCCTTCAGCCTCTACAAG*CAGTTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_F09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0047_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_A07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0039_E08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0004_A04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0020_F09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0086_G07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0093_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0041_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTCCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0085_E08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0025_C03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0039_E01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0033_B09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0026_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_C03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0096_E10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_D11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_D04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_F07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0041_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0053_C09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0020_F05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0076_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0085_D11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0079_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0047_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_A03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0074_E07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0038_A10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_F03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0025_D04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0095_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0104_A12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0031_H02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0026_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_G08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0028_D09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_G08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0013_E12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0038_A12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_C10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0039_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_B12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0104_B04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0025_A08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_H11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_H12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0082_H05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0102_H09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0012_E09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0040_G11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0079_C11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_C06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_G04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0093_H05.b : TCCCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAAACCCCAATAAAAACGTCATCTTC
LVR01_0102_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0061_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_E01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0022_D11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_D02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0061_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0038_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0056_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0028_A11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_F08.b : TCGCCTTCAGCCTCTACAAG*CAGTTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0098_D02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0086_D03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0068_C01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0021_F09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0031_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_G06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0028_E09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0005_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_F09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_G10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0045_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0086_C11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_E07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0082_E02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0082_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0040_D09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_B12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_D09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0093_A12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_C10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0033_A05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0029_D02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0041_G04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0055_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0045_D04.b : TCGCCTTCAGCTTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_D03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0048_F06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_H12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGCTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0084_H05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_G01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0040_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0021_D08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0104_F12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0059_D09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_B10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_H02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0044_G08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0004_B01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCCTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0012_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAAAACGTCATCTTC
LVR01_0089_A11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0053_B11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_E04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAAAACGTCATCTTC
LVR01_0043_G04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0050_F10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0053_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0060_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_C02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0092_B07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0048_F05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0042_F07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0095_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0102_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0087_C04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0028_E04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_H06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0059_G11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0015_C02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_E06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0003_B04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0028_F07.b : TCGCCTTCAGTCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0031_B06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0049_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0049_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0087_B03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0102_C09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_E03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0010_E07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_C11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_B06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0049_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_H03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0017_G07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0093_B11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_B07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_H05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0044_G10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_A08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0085_F05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0090_G05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_A03.b : TCGCCTTCACCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0021_D10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0033_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_G11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0073_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0098_F09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0040_B05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_F04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0030_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0102_G02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0039_C04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0058_A07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0073_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_B09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_D03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_H08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0042_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_D06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0083_G07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0106_E04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0066_E07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0034_A03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0066_G06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_G06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0086_B01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_D11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0041_H09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0082_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0095_B09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0084_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0061_A07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0063_D07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0071_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0103_F01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_E01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0060_B07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0005_F07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0096_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0020_C01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAGTAAGAACGTCATCTTC
LVR01_0082_F05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0106_B04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0098_C03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0001_H09.b : TCGCCTTCAGCTTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0050_B05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0096_A01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0049_C07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0073_E11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0048_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCAT*TTC
LVR01_0072_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0067_D08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0084_B07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0076_A10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0067_F11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0083_B03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0072_H06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_C09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0021_H08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_C01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0068_G12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0004_C02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0068_H03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_B09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0042_A04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0008_A04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0088_B02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0005_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0052_A01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0103_E02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0057_G04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_D05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_B02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGCTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_H06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0048_E02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_G09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0074_B02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0098_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_A12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_F10.b : TCGCCTTCAGCCTCCACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_B02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0040_H12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_B10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_B02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0079_F07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0072_G05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0005_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0045_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_H02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0100_G07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0003_C01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0003_B01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_A03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_A07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0066_D08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_A03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0004_A06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_E04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_H09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0056_B07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0077_B04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0063_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0104_D08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0066_A05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0063_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0063_D01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0095_A06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0106_E12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0072_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0018_A08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0022_A05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0057_G01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0068_A04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_B03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0067_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_G03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0010_A05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_A05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0102_C12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_B05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0049_E09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0050_B08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0089_G02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0099_C05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0085_B03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0019_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0044_C02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0011_A04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0043_E01.b : CCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0096_A09.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0046_A07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_C07.b : TCTCCTTCATCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACATCCTCTTC
LVR01_0102_C11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_E07.b : TCGCCTTCTGCCTCTACAAG*CAACTGGTTTCTTTAGACCCCAATAAAAACGTCATCTTC
LVR01_0055_A11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_F05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCCTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0036_C11.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0073_G07.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0095_E08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0086_F12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0054_C06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0042_C03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0081_E04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0038_H03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0039_H12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0087_E10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_D03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_H10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0051_E10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0062_H08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0063_A10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0084_H01.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0058_F03.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0009_H04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0016_A10.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0090_E12.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0065_A08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0068_A02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0101_F02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0094_A02.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0078_A06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTACACCCCAATAAGAACGTCATCTTC
LVR01_0099_G05.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0037_G06.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0105_D01.b : TCACCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0036_C09.b : TCGCCTTCAGCCTCTACAAG*CAGTTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0061_C08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
TES01_0067_G04.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
TES01_0096_F08.b : TCGCCTTCAGCCTCTACAAG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0010_G05.b : xxxxxxxxxxxxxxxxxxxG*CAGCTGGTTTCTTTAGACCCCAATAAGAACGTCATCTTC
LVR01_0050_B11.b : tgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_A01.b :
LVR01_0065_B06.b :
LVR01_0066_D06.b :
20110601C-000771 : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
---------+---------+---------+---------+---------+---------+ 423
LVR01_0020_F04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCGCC
LVR01_0018_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_F06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0020_B06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_F04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_B04.b : TCCCCGCTGAGCGCCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0036_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_G12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0090_E01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0073_A06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_H08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0001_B01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0056_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0092_D02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0084_C09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
SPLT1_0013_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0005_D06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_E03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_H11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0091_B10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_E09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_B11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0004_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTAGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0002_C01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0104_B11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0045_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_D05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0025_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0043_G09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0092_D11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0001_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0096_G02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_E08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0021_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0097_B05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_C02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0035_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0036_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0035_B11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0035_C09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_G08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0103_A10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0036_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0035_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0038_D04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0033_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0071_A12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0103_A06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_F09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0047_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_A07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0039_E08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGGGGCTCCACC
LVR01_0004_A04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0020_F09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0086_G07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0093_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0041_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0085_E08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0025_C03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0039_E01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0033_B09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0026_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_C03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0096_E10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_D11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_D04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0041_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0053_C09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0020_F05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0076_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0085_D11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0079_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0047_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0074_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0038_A10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_F03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0025_D04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0095_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0104_A12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0031_H02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0026_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_G08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0028_D09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_G08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0013_E12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0038_A12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_C10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0039_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_B12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0104_B04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0025_A08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_H11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_H12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0082_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_H09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0012_E09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0040_G11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0079_C11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_C06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_G04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0093_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0061_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_E01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0022_D11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_D02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0061_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0038_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0056_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0028_A11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0098_D02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0086_D03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0068_C01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0021_F09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0031_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_G06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0028_E09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0005_C08.b : TCCCCGCTGAACGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_F09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_G10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0045_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0086_C11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0082_E02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0082_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0040_D09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_B12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_D09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGCCTCTGGGGGCCCGAGGCTCCACC
LVR01_0093_A12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0009_C10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0033_A05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0029_D02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0041_G04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0055_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0045_D04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_D03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0048_F06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_H12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0084_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_G01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0040_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0021_D08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0104_F12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0059_D09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_B10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_H02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0044_G08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0004_B01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0012_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_A11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0053_B11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_E04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0043_G04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0050_F10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0053_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0060_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_C02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0092_B07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0048_F05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0042_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0095_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0087_C04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0028_E04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_H06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0059_G11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0015_C02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_E06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGCCTCTGGGGGCCCGAGGCTCCACC
LVR01_0003_B04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0028_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0031_B06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0049_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0049_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0087_B03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_C09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_E03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0010_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_C11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_B06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0049_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_H03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0017_G07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0093_B11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCCGGGGGCCCGAGGCTCCACC
LVR01_0009_B07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0009_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_H05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0044_G10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_A08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0085_F05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0090_G05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0021_D10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0033_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_G11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0073_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0098_F09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0040_B05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_F04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0030_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_G02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0039_C04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0058_A07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0073_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_B09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_D03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_H08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0042_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_D06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0083_G07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCTTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0106_E04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0066_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0034_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0066_G06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_G06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0086_B01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_D11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0009_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0041_H09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0082_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0095_B09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0084_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0061_A07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0063_D07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0071_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0103_F01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_E01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0060_B07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0005_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0096_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0020_C01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0082_F05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0106_B04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0098_C03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0001_H09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0050_B05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0096_A01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0049_C07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0073_E11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0048_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0067_D08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0084_B07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0076_A10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0067_F11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0083_B03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_H06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_C09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0021_H08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_C01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0068_G12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0004_C02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0068_H03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_B09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0042_A04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0008_A04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0088_B02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCGCC
LVR01_0005_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0052_A01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0103_E02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0057_G04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_D05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_B02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_H06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0048_E02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_G09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0074_B02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0098_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_A12.b : TCCCCGCCGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_F10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_B02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0040_H12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_B10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_B02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0079_F07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_G05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0005_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCTACC
LVR01_0045_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_H02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0100_G07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0003_C01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0003_B01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_A07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0066_D08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_A03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0004_A06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_E04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_H09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0056_B07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0077_B04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0063_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0104_D08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0066_A05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0063_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0063_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0095_A06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0106_E12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0072_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0018_A08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0022_A05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0057_G01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0068_A04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_B03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0067_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_G03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0010_A05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_A05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0102_C12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_B05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0049_E09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0050_B08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0089_G02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_C05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0085_B03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0019_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0044_C02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0011_A04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0043_E01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0096_A09.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0046_A07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_C07.b : TCCCCGCTGAGCGTCTCCATAACCTTGGCCTTCCTGTCTCTGGGGGCACGAGGCTCCACC
LVR01_0102_C11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_E07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0055_A11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_F05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0036_C11.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0073_G07.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0095_E08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0086_F12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0054_C06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0042_C03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0081_E04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0038_H03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0039_H12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0087_E10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0009_D03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_H10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0051_E10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0062_H08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0063_A10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0084_H01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0058_F03.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0009_H04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0016_A10.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0090_E12.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0065_A08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0068_A02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0101_F02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0094_A02.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0078_A06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0099_G05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0037_G06.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0105_D01.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0036_C09.b : TCCCCGCAGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0061_C08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
TES01_0067_G04.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
TES01_0096_F08.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0010_G05.b : TCCCCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0050_B11.b : xxxxxxxxxxxxxxCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGCCCGAGGCTCCACC
LVR01_0105_A01.b : ggttgttttagcttagtgacntatagacxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B06.b : tttttaagcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_D06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000771 : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
---------+---------+---------+---------+---------+---------+ 480
LVR01_0020_F04.b : CTGACAGAGCTCCTGGACGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_E07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACACCGACCCCCGAGGCAGAA
LVR01_0018_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_F06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0020_B06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_F04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_B04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_A09.b : CTGACAGAGCTCCTGGAATGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0036_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTCCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_G12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0090_E01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0073_A06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_H08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0001_B01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0056_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0092_D02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0084_C09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
SPLT1_0013_A09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0005_D06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_E03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_H11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0091_B10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_E09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0004_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0002_C01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0104_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0045_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_D05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0025_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0043_G09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_H05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0092_D11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0001_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0096_G02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_E08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_B08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0021_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0097_B05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_C02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC**CTCACAAAGACCCCCCGAGCAGAA
LVR01_0035_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0036_A09.b : CTGATAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0035_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0035_C09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_G08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0103_A10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0036_H05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0035_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0038_D04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0033_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAGCC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0071_A12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0103_A06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_F09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0047_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_A07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0039_E08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0004_A04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0020_F09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0086_G07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0093_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0041_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0085_E08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0025_C03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0039_E01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0033_B09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0026_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_C03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGTCCCCCGAGGCAGAA
LVR01_0034_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0096_E10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_B08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_D11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_D04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0041_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0053_C09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0020_F05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0076_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0085_D11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0079_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0047_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0074_E07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0038_A10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_F03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0025_D04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0095_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0104_A12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0031_H02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0026_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_G08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0028_D09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_G08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0013_E12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0038_A12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_C10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0039_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_B12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0104_B04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0025_A08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_H11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_H12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0082_H05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0102_H09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0012_E09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0040_G11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_E11.b : CTGACAGAGTTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0079_C11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_C06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_G04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0093_H05.b : CTGACAAACCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAAACCCCCGAGGCAAAA
LVR01_0102_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0061_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_E01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0022_D11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_D02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0061_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGGCCCCCGAGGCAGAA
LVR01_0038_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0056_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0028_A11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0098_D02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0086_D03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0068_C01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0021_F09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0031_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_G06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0028_E09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0005_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_F09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_G10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0045_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0086_C11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_E07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0082_E02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0082_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0040_D09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_B12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_D09.b : CTGACAAAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0093_A12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_C10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0033_A05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0029_D02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0041_G04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0055_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0045_D04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_D03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0048_F06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_H12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0084_H05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_G01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0040_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0021_D08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGCTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0104_F12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0059_D09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_B10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_H02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0044_G08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0004_B01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0012_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_A11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0053_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_E04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0043_G04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0050_F10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0053_A09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0060_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_C02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0092_B07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0048_F05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0042_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0095_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0102_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0087_C04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0028_E04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_H06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0059_G11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0015_C02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_E06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0003_B04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0028_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0031_B06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0049_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0049_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0087_B03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0102_C09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_E03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0010_E07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_C11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_B06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0049_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_H03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0017_G07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0093_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_B07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_H05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0044_G10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_A08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0085_F05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0090_G05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0021_D10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0033_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_G11.b : CTGACAGAGCTCCTAGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0073_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0098_F09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0040_B05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_F04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0030_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0102_G02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0039_C04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0058_A07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0073_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_B09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_D03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_H08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0042_A09.b : CTGACAGAGCTCCTGGAAGGGCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_D06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0083_G07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0106_E04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0066_E07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0034_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0066_G06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_G06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0086_B01.b : CTGACAGAGCTCCTGGAAGGACTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_D11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0041_H09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0082_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0095_B09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0084_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0061_A07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0063_D07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0071_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0103_F01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_E01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0060_B07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0005_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0096_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0020_C01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0082_F05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0106_B04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0098_C03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0001_H09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0050_B05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0096_A01.b : CTGACAGGGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0049_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0073_E11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0048_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0067_D08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0084_B07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACCGGCTCACAAAGACCCCCGAGGCAGAA
LVR01_0076_A10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0067_F11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0083_B03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_H06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_C09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0021_H08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_C01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0068_G12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_B08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0004_C02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0068_H03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_B09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0042_A04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0008_A04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0088_B02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0005_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0052_A01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0103_E02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0057_G04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_D05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_B02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_H06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0048_E02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_G09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0074_B02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0098_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_A12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_F10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_B02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0040_H12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_B10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_A09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_B02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0079_F07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_G05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0005_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0045_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_H02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0100_G07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0003_C01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0003_B01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_A07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0066_D08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_A03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0004_A06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_E04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_H09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0056_B07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0077_B04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0063_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0104_D08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0066_A05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0063_B08.b : CTGACAGAACTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0063_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0095_A06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0106_E12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0072_B08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0018_A08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0022_A05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0057_G01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0068_A04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_B03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0067_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_G03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0010_A05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_A05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0102_C12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_B05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0049_E09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0050_B08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0089_G02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_C05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0085_B03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0019_A09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0044_C02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0011_A04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0043_E01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0096_A09.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0046_A07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_C07.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACACAGACCCCCAAGGCAGAA
LVR01_0102_C11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_E07.b : CTGACAGAACTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0055_A11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_F05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0036_C11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0073_G07.b : CTGACAAAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0095_E08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGTAGAA
LVR01_0086_F12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0054_C06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0042_C03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0081_E04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0038_H03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0039_H12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0087_E10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_D03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0101_H10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0051_E10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0062_H08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0063_A10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0084_H01.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0058_F03.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0009_H04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0016_A10.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0090_E12.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0065_A08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0068_A02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACGAAGACCCCCGAGGCAGAA
LVR01_0101_F02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0094_A02.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0078_A06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0099_G05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0037_G06.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0105_D01.b : CTGACAGAGCTCCTGGAAGGCCTCAAATTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0036_C09.b : CTGACAGAGCTCCTGTAAGGCCTCAAGTTCAACC***TAACAAAGACCCCCGAGGCAGAA
LVR01_0061_C08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
TES01_0067_G04.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
TES01_0096_F08.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0010_G05.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0050_B11.b : CTGACAGAGCTCCTGGAAGGCCTCAAGTTCAACC***TCACAAAGACCCCCGAGGCAGAA
LVR01_0105_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAAAGACCCCCGAGGCAGAA
LVR01_0065_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAAAGACCCCCGAGGCAGAA
LVR01_0066_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCCCCGAGGCAGAA
20110601C-000771 : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
---------+---------+---------+---------+---------+---------+ 537
LVR01_0020_F04.b : ATCCACCAGGG*CTTCCACCACCTCCTGCGGGCCCTCATCCAAACC*AGCA*ACCTGCTG
LVR01_0052_E07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AACA*ACCTGCTG
LVR01_0018_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_F06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0020_B06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_F04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_B04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCTCTCAACCC*ACCA*ACCTGCTG
LVR01_0036_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_G12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0090_E01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0073_A06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_H08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0001_B01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAACCAACCC*AGCA*ACCTGCTG
LVR01_0056_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0092_D02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0084_C09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
SPLT1_0013_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0005_D06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_E03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_H11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0091_B10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_E09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_B11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0004_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0002_C01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0104_B11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0045_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_D05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0025_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0043_G09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0092_D11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0001_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0096_G02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_E08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0021_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0097_B05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_C02.b : ATCCACCAGGGGCTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0035_G03.b : ATCCACCAAGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0036_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0035_B11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0035_C09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_G08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCAAACCTGCTG
LVR01_0081_G03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0103_A10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0036_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0035_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0038_D04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0033_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0071_A12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0103_A06.b : ATCCACCACGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_F09.b : ATCCACCAAGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AACA*ACCTGCTG
LVR01_0047_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_A07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0039_E08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0004_A04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0020_F09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0086_G07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*TGCA*ACCTGCTG
LVR01_0093_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0041_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0085_E08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0025_C03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0039_E01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0033_B09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0026_G03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_C03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0096_E10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_D11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_D04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0041_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0053_C09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0020_F05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0076_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0085_D11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0079_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0047_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0074_E07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0038_A10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_F03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0025_D04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0095_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0104_A12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0031_H02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0026_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_G08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0028_D09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_G08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0013_E12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0038_A12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_C10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0039_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_B12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0104_B04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0025_A08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_H11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_H12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0082_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_H09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0012_E09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0040_G11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0079_C11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_C06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_G04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0093_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0061_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_E01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0022_D11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_D02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0061_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0038_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0056_G03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0028_A11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0098_D02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0086_D03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0068_C01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAGCCC*AGCA*ACCTGCTG
LVR01_0021_F09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0031_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_G06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0028_E09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0005_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_F09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_G10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0045_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0086_C11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_E07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0082_E02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0082_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0040_D09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_B12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_D09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0093_A12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_C10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0033_A05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0029_D02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0041_G04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0055_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0045_D04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_D03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0048_F06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_H12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0084_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_G01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0040_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0021_D08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0104_F12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0059_D09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_B10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_H02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0044_G08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0004_B01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0012_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_A11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0053_B11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_E04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0043_G04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0050_F10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0053_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0060_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_C02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0092_B07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0048_F05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0042_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0095_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0087_C04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0028_E04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_H06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0059_G11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0015_C02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_E06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0003_B04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0028_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0031_B06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0049_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0049_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0087_B03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_C09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_E03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0010_E07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_C11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_B06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0049_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_H03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0017_G07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0093_B11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_B07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_H05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0044_G10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_A08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0085_F05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0090_G05.b : ATCCACCAGGG*CTTTCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0021_D10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0033_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_G11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0073_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0098_F09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0040_B05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_F04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0030_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_G02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0039_C04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0058_A07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0073_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_B09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_D03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_H08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0042_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_D06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0083_G07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0106_E04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAATCC*AGCA*ACCTGCTG
LVR01_0065_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0066_E07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0034_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0066_G06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_G06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0086_B01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_D11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0041_H09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0082_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0095_B09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0084_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0061_A07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0063_D07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0071_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0103_F01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_E01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0060_B07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0005_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0096_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0020_C01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0082_F05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0106_B04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0098_C03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0001_H09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0050_B05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0096_A01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0049_C07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0073_E11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0048_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0067_D08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0084_B07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0076_A10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0067_F11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0083_B03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_H06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_C09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0021_H08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_C01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0068_G12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0004_C02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0068_H03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_B09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0042_A04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0008_A04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0088_B02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0005_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0052_A01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0103_E02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0057_G04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_D05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_B02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_H06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0048_E02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_G09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0074_B02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0098_G03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_A12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_F10.b : ACCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_B02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0040_H12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_B10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_B02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0079_F07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_G05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0005_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0045_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_H02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0100_G07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0003_C01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0003_B01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_A07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0066_D08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_A03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0004_A06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_E04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_H09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0056_B07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0077_B04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0063_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0104_D08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0066_A05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0063_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0063_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0095_A06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0106_E12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0072_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0018_A08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0022_A05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0057_G01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0068_A04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_B03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0067_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_G03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0010_A05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_A05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_C12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_B05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0049_E09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0050_B08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0089_G02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_C05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0085_B03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0019_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0044_C02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0011_A04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0043_E01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0096_A09.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0046_A07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_C07.b : ATCCACCCTGG*ATTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0102_C11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_E07.b : ATCCACCATGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCTACCC*AGCA*ACCTGCTG
LVR01_0055_A11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_F05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0036_C11.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCCCAACA*ACCTGCTG
LVR01_0073_G07.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0095_E08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0086_F12.b : ATCCACCAGGG*CTTCCAGCAACTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0054_C06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0042_C03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0081_E04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0038_H03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0039_H12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0087_E10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_D03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_H10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0051_E10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0062_H08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0063_A10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0084_H01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0058_F03.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0009_H04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0016_A10.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0090_E12.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_A08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0068_A02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0101_F02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0094_A02.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0078_A06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0099_G05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0037_G06.b : ATCCACCAGGG*CTTCCAGCATCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0105_D01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0036_C09.b : ATCCACCAGGG*CTCCCAGCACCTCCTGCGGGCCCTCAGCTTACCCATTCA*ACCTGCTG
LVR01_0061_C08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
TES01_0067_G04.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
TES01_0096_F08.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0010_G05.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCCGCTG
LVR01_0050_B11.b : ATCCACCAGGG*CTTCCAGCACTTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0105_A01.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0065_B06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
LVR01_0066_D06.b : ATCCACCAGGG*CTTCCAGCACCTCCTGCGGGCCCTCAGCCAACCC*AGCA*ACCTGCTG
20110601C-000771 : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
---------+---------+---------+---------+---------+---------+ 593
LVR01_0020_F04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_E07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_F06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0020_B06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_F04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_B04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_A09.b : CAGCTGAAC*GTGGGCAACGCCT*TGTTCTTGGATGA*ACGGCTGAAGCTGCT*GGACAA
LVR01_0036_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_G12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0090_E01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0073_A06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_H08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0001_B01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0056_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0092_D02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0084_C09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
SPLT1_0013_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0005_D06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_E03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_H11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0091_B10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_E09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_B11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0004_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0002_C01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0104_B11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACTA
LVR01_0019_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0045_C07.b : CAGCTGAAC*GTGGGCAACGTCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_D05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0025_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0043_G09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_H05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0092_D11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0001_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0096_G02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_E08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0021_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0097_B05.b : CAGCTGAAC*GTGGGCAACGCCC*TGTTTCTGGGTGA*GCGGCTTAAGCTGCTTGGACAA
LVR01_0081_C02.b : CACCTGAAC*GGGGGCACGCCAT*GTTTCGTGGATAA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0035_G03.b : CAGCTGAAC*GTGGGCAACGCCC*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0036_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAGGCTGCT*GGACAA
LVR01_0035_B11.b : CAGCTGAACCGTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAG
LVR01_0035_C09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGAAGCGGCTGAAGCTGCT*GGACAA
LVR01_0037_G08.b : CAGCTGAAC*GTGGGCCACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_G03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0103_A10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0036_H05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0035_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0038_D04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0033_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0071_A12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*TCGGCTGAAGCTGCT*GGACAA
LVR01_0103_A06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_F09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0047_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_A07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0039_E08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0004_A04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0020_F09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0086_G07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0093_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0041_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0085_E08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGACGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0025_C03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0039_E01.b : CAGCTGAAC*GTGGGCGACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0033_B09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0026_G03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_C03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0096_E10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_D11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_D04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0041_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0053_C09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0020_F05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0076_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0085_D11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0079_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0047_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0074_E07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0038_A10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_F03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0025_D04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0095_C07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0104_A12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGGTGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0031_H02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0026_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_G08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0028_D09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_G08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0013_E12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0038_A12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_C10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0039_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_B12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0104_B04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0025_A08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_H11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_H12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0082_H05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_H09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0012_E09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0040_G11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0079_C11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_C06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_G04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0093_H05.b : CAGCTGAAC*GTGGGCAACGCCT*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0061_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_E01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0022_D11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_D02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0061_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0038_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0056_G03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0028_A11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0098_D02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0086_D03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0068_C01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0021_F09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0031_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_G06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0028_E09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0005_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_F09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_G10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0045_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0086_C11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_E07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0082_E02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0082_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0040_D09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_B12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_D09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GTGGCTGAAGCTGCT*GGACAA
LVR01_0093_A12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_C10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0033_A05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0029_D02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0041_G04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0055_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0045_D04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_D03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0048_F06.b : CAGCTGAAC*GTGGGCGACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_H12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0084_H05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0008_G01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0040_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0021_D08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0104_F12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0059_D09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_B10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_H02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0044_G08.b : CAGCTGAAC*GTGGGCAACGCCG*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0004_B01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0012_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_A11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0053_B11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_E04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*AGACAA
LVR01_0043_G04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0050_F10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0053_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0060_C07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_C02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0092_B07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0048_F05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTCCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0042_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0095_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0087_C04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0028_E04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_H06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0059_G11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0015_C02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_E06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0003_B04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0028_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0031_B06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0049_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0049_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0087_B03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_C09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0008_E03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0010_E07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_C11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_B06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0049_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_H03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0017_G07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0093_B11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_B07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_H05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0044_G10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_A08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGGTGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0085_F05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0090_G05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0021_D10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0033_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_G11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0073_C07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0098_F09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0040_B05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0008_F04.b : CAGCTGGAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTACT*GGACAA
LVR01_0008_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0030_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_G02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0039_C04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0058_A07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0073_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_B09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGACTGAAGCTGCT*GGACGA
LVR01_0081_D03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_H08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0042_A09.b : CAGCTGAAC*GTGGGCAACGCCA*CGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_D06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0083_G07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0106_E04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0066_E07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0034_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0066_G06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_G06.b : CAGCTGAAC*GTGGGCAACGCCT*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0086_B01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_D11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0041_H09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0082_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0095_B09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0084_C07.b : CAGCTGAGC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0061_A07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0063_D07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0071_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0103_F01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_E01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0060_B07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0005_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0096_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0020_C01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0082_F05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0106_B04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0098_C03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0001_H09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0008_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0050_B05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0096_A01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0049_C07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0073_E11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0048_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0067_D08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0084_B07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0076_A10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0067_F11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0083_B03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_H06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_C09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0021_H08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_C01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0068_G12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0004_C02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0068_H03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_B09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0042_A04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0008_A04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0088_B02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0005_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0052_A01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0103_E02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0057_G04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_D05.b : TAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_B02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_H06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0048_E02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_G09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0074_B02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0098_G03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_A12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAGGCTGCT*GGACAA
LVR01_0078_F10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_B02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0040_H12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_B10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_B02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0079_F07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_G05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0005_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0045_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_H02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0100_G07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCCGAAGCTGCT*GGACAA
LVR01_0003_C01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGACGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0003_B01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_A07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0066_D08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_A03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0004_A06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_E04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_H09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0056_B07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0077_B04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0063_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0104_D08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0066_A05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0063_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0063_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0095_A06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0106_E12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0072_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0018_A08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGCGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0022_A05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0057_G01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTCCT*GGACAA
LVR01_0068_A04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_B03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0067_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_G03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0010_A05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_A05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_C12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_B05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0049_E09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0050_B08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0089_G02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_C05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0085_B03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0019_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0044_C02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0011_A04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0043_E01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0096_A09.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0046_A07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_C07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0102_C11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_E07.b : CAGCTGAAC*TTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0055_A11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_F05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0036_C11.b : CAGCTGAAC*GTGGGCAACGCCATTGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0073_G07.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0095_E08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0086_F12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0054_C06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0042_C03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0081_E04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0038_H03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0039_H12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0087_E10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_D03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_H10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0051_E10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0062_H08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0063_A10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0084_H01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0058_F03.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0009_H04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0016_A10.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0090_E12.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_A08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0068_A02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0101_F02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0094_A02.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0078_A06.b : CAGCTGAAC*GTGCGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0099_G05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0037_G06.b : CAGCTGAAC*TTGGGCAACGCCC*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0105_D01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0036_C09.b : CATCTGACC*GTGGGCAACGCCTATGTTCGTGGATGA*CCGGCTGAAGCTGCT*GGACAA
LVR01_0061_C08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
TES01_0067_G04.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
TES01_0096_F08.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0010_G05.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0050_B11.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0105_A01.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0065_B06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
LVR01_0066_D06.b : CAGCTGAAC*GTGGGCAACGCCA*TGTTCGTGGATGA*GCGGCTGAAGCTGCT*GGACAA
20110601C-000771 : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
---------+---------+---------+---------+---------+---------+ 647
LVR01_0020_F04.b : *GTTCGTCTCTAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAACT*T
LVR01_0052_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_F01.b : *GTTCGTC*CAAGATGCCC*GTGGGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_F06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0020_B06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_F04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_B04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_A09.b : *GTTCATC*CAAGATGCCC*GTGAGCTGTACT*TCTCCTAGGTCTT*CTCCATCAGCT*T
LVR01_0036_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_G12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0090_E01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0073_A06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_H08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0001_B01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0056_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0092_D02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0084_C09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
SPLT1_0013_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0005_D06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_E03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_F11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_H11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0091_B10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_E09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0004_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0002_C01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0104_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCAAGGTCTT*CTCCATCATCT*T
LVR01_0019_F11.b : *GTTCGTC*CAAGATGCCC*ATGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0045_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_D05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0025_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0043_G09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_H05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0092_D11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0001_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0096_G02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_E08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0021_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0097_B05.b : GTTTCGTCCCAATATGCCC*GTGAGCTGTACT*TCTCCcaaggtcttctccacagcctta
LVR01_0081_C02.b : *GTTCGTC*CAAAATGCCC*GTGACCTGTACT*Ttctccaaggtcttcctccctcacctt
LVR01_0035_G03.b : *GTTCGTCCCAAGATGCCC*GTGAGCTGTACC*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0036_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACTTTCTCCGAGGTCTC*CTCCATCAGCT*T
LVR01_0035_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACTTTCTCCGAGGTCTT*CTCCATCAACT*T
LVR01_0035_C09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_G08.b : *GTTCGTC*CCAGAAGCCC*GTGAGCTGTACT*TCTCCCAGGTCTT*CTCCATCAGCT*T
LVR01_0081_G03.b : *GTTCGTC*AAAGATGCCC*GTGAGCTGTACT*TCTCCCAGGTCTT*CTCCATCAGCT*T
LVR01_0103_A10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAACT*T
LVR01_0036_H05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0035_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0038_D04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0033_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0071_A12.b : AGTTCGTC*CGAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0103_A06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGACGTCTT*CTCCACCAGCT*T
LVR01_0054_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_F09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0047_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_A07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0039_E08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0004_A04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0020_F09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0086_G07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0093_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0041_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0085_E08.b : *GTTCGTC*CAAGATGCCC*GTAAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0025_C03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0039_E01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0033_B09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0026_G03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_C03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGATCTT*CTCCATCAGCT*T
LVR01_0034_F11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0096_E10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_D11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_D04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0041_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0053_C09.b : *GTTCGTC*CAAGATGCCC*GCGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0020_F05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0076_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0085_D11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0079_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0047_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0074_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0038_A10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_F03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0025_D04.b : *GTTCGTC*CAAGATGCCC*ATGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0095_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0104_A12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0031_H02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0026_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_G08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0028_D09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_G08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0013_E12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0038_A12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_C10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0039_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_B12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0104_B04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0025_A08.b : *ATTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_H11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_H12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0082_H05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0102_H09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0012_E09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0040_G11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_H01.b : *GTTCGTC*CAAGATGCCC*GTGTGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0079_C11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_C06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_G04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0093_H05.b : *GTTCTTC*CAAAATGCCC*GTGAGCTGTACT*TCTCCAAGGTCTT*CTCCATCACCT*T
LVR01_0102_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0061_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_E01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0022_D11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCCCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_F01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_D02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0061_F11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0038_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0056_G03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0028_A11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0098_D02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0086_D03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0068_C01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0021_F09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0031_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_G06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0028_E09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0005_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_F09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_G10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCC*T
LVR01_0045_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0086_C11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0082_E02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0082_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0040_D09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_B12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_D09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0093_A12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_C10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0033_A05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_C12.b : *GTTCGTC*CGAGATGCCC*GTGAGCTGTACT*ACTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0029_D02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0041_G04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0055_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0045_D04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_D03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0048_F06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_H12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0084_H05.b : *GTTCGTC*CAAGGTGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_G01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0040_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0021_D08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0104_F12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0059_D09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_B10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_H02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0044_G08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0004_B01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0012_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_A11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0053_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_E04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0043_G04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0050_F10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0053_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0060_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_C02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0092_B07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0048_F05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0042_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0095_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0102_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0087_C04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0028_E04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_H06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0059_G11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0015_C02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_E06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0003_B04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0028_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0031_B06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCC*T
LVR01_0049_F01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0049_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0087_B03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0102_C09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_E03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0010_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_C11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_B06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0049_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_H03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0017_G07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_F11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0093_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_B07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_H05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0044_G10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_A08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0085_F05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0090_G05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0021_D10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0033_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_G11.b : *GTTCATC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0073_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0098_F09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0040_B05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_F04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0030_F01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0102_G02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0039_C04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0058_A07.b : *GTTCGTC*CAAGATGCCC*GTGAGCCGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0073_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_B09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_D03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_H08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0042_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_D06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0083_G07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0106_E04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0066_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0034_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0066_G06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_G06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0086_B01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_D11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0041_H09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0082_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0095_B09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0084_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0061_A07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0063_D07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_F01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0071_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0103_F01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0011_E01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0060_B07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0005_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGCGGTCTT*CTCCATCAGCT*T
LVR01_0096_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0020_C01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0082_F05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0106_B04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0098_C03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0001_H09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0050_B05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0096_A01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0049_C07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0073_E11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0048_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0067_D08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0084_B07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0076_A10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*C
LVR01_0067_F11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0083_B03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_H06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGCGGTCTT*CTCCATCAGCT*T
LVR01_0011_C09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0021_H08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_C01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0068_G12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0004_C02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0068_H03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_B09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0042_A04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0008_A04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0088_B02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0005_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0052_A01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0103_E02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0057_G04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_D05.b : *GTTCGTC*CAAGGTGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_B02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_H06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0048_E02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0011_G09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0074_B02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0098_G03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_A12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_F10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0011_B02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0040_H12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_B10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_B02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0079_F07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_G05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0005_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0045_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_H02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0100_G07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0003_C01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0003_B01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_A07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0066_D08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_A03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0004_A06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_E04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_H09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0056_B07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0077_B04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0063_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0104_D08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0066_A05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0063_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0063_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0095_A06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0106_E12.b : *GTTCGTC*TAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0072_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0018_A08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAACT*T
LVR01_0022_A05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0057_G01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0068_A04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_B03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0067_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0011_G03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0010_A05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_A05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0102_C12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_B05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0049_E09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0050_B08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0089_G02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_C05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0085_B03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0019_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0044_C02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0011_A04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0043_E01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0096_A09.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0046_A07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_C07.b : *TTTCGTC*CAAGATGCCC*Gcgcagctgtacttctcccagggtctctcccatcagcttt
LVR01_0102_C11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_E07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0055_A11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_F05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTTCT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0036_C11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTTTCTCCATCAGCTTT
LVR01_0073_G07.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0095_E08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0086_F12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0054_C06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0042_C03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0081_E04.b : *GTTCGTC*CAGGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0038_H03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0039_H12.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0087_E10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_D03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_H10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0051_E10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0062_H08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0063_A10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0084_H01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0058_F03.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0009_H04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0016_A10.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0090_E12.b : *GTTCGTC*CAAGATGCCC*GTGTGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_A08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0068_A02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0101_F02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0094_A02.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0078_A06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0099_G05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0037_G06.b : *GTACGTC*CAAGATGCCCCGTGAGCTGTACT*TCTCCGAGGACTT*CTCCcatcaactt
LVR01_0105_D01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0036_C09.b : *GTTCGTC*CCAGATGCCC*GTGAGCTGTATT*TCTCCTAGGTCTT*CTCCATCAGCT*T
LVR01_0061_C08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
TES01_0067_G04.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
TES01_0096_F08.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0010_G05.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0050_B11.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0105_A01.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0065_B06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
LVR01_0066_D06.b : *GTTCGTC*CAAGATGCCC*GTGAGCTGTACT*TCTCCGAGGTCTT*CTCCATCAGCT*T
20110601C-000771 : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
---------+---------+---------+---------+---------+---------+ 701
LVR01_0020_F04.b : TATGGACTCC*GATGCTGCCCGTAGAG*TTCATC*AACAAC*TATGTGAATAATA*AAAC
LVR01_0052_E07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_F06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0020_B06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_F04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_B04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_A09.b : TAAAGACTCC*CATGCTGCC*GTACAG*TTCATC*AACAAC*TATGTGAACAATA*AGAC
LVR01_0036_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAGTTTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_G12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0090_E01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0073_A06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_H08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0001_B01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0056_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0092_D02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0084_C09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AGCAAC*TATGTGAAGAATA*AGAC
SPLT1_0013_A09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0005_D06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_E03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_H11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0091_B10.b : TAAGGACTCC*CATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_E09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_B11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0004_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0002_C01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0104_B11.b : TAAGGACTCC*GATGCTGCC*TTACAG*TTCATC*AACAAC*TATGTGAAGAATA*AAAC
LVR01_0019_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATCCAACAGC*TATGTGAAGAATA*AGAC
LVR01_0045_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_D05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0025_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0043_G09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_H05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0092_D11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0001_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0096_G02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_E08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0021_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0097_B05.b : aagactccgaatgctgccgtagagttcatcttcaactatgtgaagaaaaagaaccctggg
LVR01_0081_C02.b : taagggactccgaatcctcccgtaaaaattcttcaaccaactttgtgaaaaaaaaaaaac
LVR01_0035_G03.b : TAAAGACTCC*GATGCTGCC*GTATAG*TTCATC*AACAAC*TTTGTGAAGAATA*AGAC
LVR01_0036_A09.b : CAAGGACTCC*GATGCTGCCCTATAAT*TCCATC*AACAACCTATGTAAAGAATA*AGAC
LVR01_0035_B11.b : TAAGGACTCC*CATGCTGCC*GTAAAG*TTCATC*CCAAAC*TATGTGAAAAATA*ACAC
LVR01_0035_C09.b : TAAGGACTCC*GATGCTGCC*TTAGAGTTTCATC*AACAAC*TATGTGAAGAATA*TGAC
LVR01_0037_G08.b : TAAGGACTCC*GATGCTGCC*CTAAAG*TTCATC*AACAAC*TATGTGAAGAATA*AAAC
LVR01_0081_G03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0103_A10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0036_H05.b : TAAGGACTCC*GATGCTGCC*GTAAAG*TTCATC*AACCAC*TATGTGAAGAATA*AGAA
LVR01_0035_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATAAAGAC
LVR01_0038_D04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0033_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0071_A12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0103_A06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_F07.b : TAAGGACTCC*GATGCTGCC*GTAAAG*TTCATC*CACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_F09.b : TAAAGACTCC*GATGCTGCC*GTAGAGTTTCATC*AACCAC*TATGTGAAGAATA*AGAC
LVR01_0047_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_A07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0039_E08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0004_A04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0020_F09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACGAC*TATGTGAAGAATA*AGAC
LVR01_0086_G07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0093_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAAAATA*AGAC
LVR01_0041_F08.b : TAAGGACTCC*GATGCTGCC*GTAAAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0085_E08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0025_C03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0039_E01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATAAAGAC
LVR01_0033_B09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0026_G03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_C03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_F08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0096_E10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0019_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_D11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0019_D04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_F07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0041_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0053_C09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0020_F05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0076_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATN*NCACAC*TATGTGAAGAATA*AGAC
LVR01_0085_D11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0079_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AAACAC*TATGTGAAGAATA*AGAC
LVR01_0047_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0074_E07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0038_A10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_F03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0025_D04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0095_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0104_A12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0031_H02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0026_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_G08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0028_D09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_G08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATAAAGAC
LVR01_0013_E12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0038_A12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_C10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0039_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_B12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0104_B04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0025_A08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_H11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_H12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0082_H05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0102_H09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0012_E09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0040_G11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0079_C11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_C06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_G04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0093_H05.b : TAAGGACTCC*AATGCTGCC*GTAAAG*TTCATC*AACAAT*TATGTGAAAAATA*AAAC
LVR01_0102_F08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0061_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_E01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0022_D11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_D02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0061_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0038_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_F08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAGGAATA*AGAC
LVR01_0056_G03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0019_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0028_A11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_F08.b : TAAGGACTCC*GATGCTGCC*GTAAAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0098_D02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0086_D03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0068_C01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0021_F09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0031_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_G06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0028_E09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0005_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_F09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_G10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0045_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0086_C11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_E07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0082_E02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0082_H01.b : TAAGGACTCC*GTTGCTGCC*GTAGAG*TTCATC*AANCAC*TATGTGAAGAATAAAGAC
LVR01_0040_D09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_B12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_D09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0093_A12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_C10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0033_A05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0029_D02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0041_G04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0055_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0045_D04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_D03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0048_F06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTTATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_H12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0084_H05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_G01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*GACAAC*TATGTGAAGAATA*AGAC
LVR01_0040_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0021_D08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0104_F12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0059_D09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_B10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_H02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0044_G08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0004_B01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0012_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_A11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0053_B11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAGGAATA*AGAC
LVR01_0019_E04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0043_G04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0050_F10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0053_A09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0060_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_C02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0092_B07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0048_F05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0042_F07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0095_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0102_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0087_C04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0028_E04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_H06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0059_G11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0015_C02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_E06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0003_B04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0028_F07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0031_B06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0049_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0049_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0087_B03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGGAGAATA*AGAC
LVR01_0102_C09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_E03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0010_E07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_C11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_B06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0049_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_H03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0017_G07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0093_B11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCACC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_B07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0019_H05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0044_G10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_A08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0085_F05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0090_G05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0021_D10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0033_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_G11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0073_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0098_F09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0040_B05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_F04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_F08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0030_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0102_G02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0039_C04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0058_A07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0073_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_B09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AANCAC*TATGTGAAGAATA*AGAC
LVR01_0081_D03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_H08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0042_A09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_D06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0083_G07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0106_E04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0066_E07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0034_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0066_G06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_G06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0086_B01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_D11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0041_H09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0082_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0095_B09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0084_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0061_A07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0063_D07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0071_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0103_F01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_E01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0060_B07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0005_F07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0096_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0020_C01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0082_F05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0106_B04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0098_C03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0001_H09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0050_B05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0096_A01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0049_C07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0073_E11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0048_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0067_D08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0084_B07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0076_A10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0067_F11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCACC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0083_B03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_H06.b : TAACGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_C09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0021_H08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_C01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0068_G12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0004_C02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0068_H03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_B09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0042_A04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0008_A04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0088_B02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0005_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0052_A01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0103_E02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0057_G04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_D05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_B02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_H06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0048_E02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_G09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0074_B02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0098_G03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_A12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_F10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_B02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0040_H12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_B10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_A09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_B02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0079_F07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_G05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0005_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0045_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_H02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0100_G07.b : TAAGGACTCC*GATGCCGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0003_C01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0003_B01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_A07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0066_D08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_A03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0004_A06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_E04.b : TAAGGACTCC*GATGCTACC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_H09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0056_B07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0077_B04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0063_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0104_D08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0066_A05.b : TAAGGATTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0063_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0063_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0095_A06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0106_E12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0072_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0018_A08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0022_A05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0057_G01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0068_A04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_B03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0067_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_G03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0010_A05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_A05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0102_C12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_B05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0049_E09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0050_B08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0089_G02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_C05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0085_B03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0019_A09.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0044_C02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0011_A04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0043_E01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0096_A09.b : TGAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0046_A07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_C07.b : aaagactccaatgcccccctatagatcatcaccaattctctgaaaaataaagaccaatgg
LVR01_0102_C11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_E07.b : TAAGGACTCC*GATGCTGCC*ATAGAG*TTCATC*AACAAC*AATGTGAAGAATA*AGAC
LVR01_0055_A11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_F05.b : TAAGGACTCC*GATGCTGCC*GTATAG*TTCATC*AACCAC*TATGTGAAGAATA*AGAC
LVR01_0036_C11.b : TAACGACTCCCGATGCTGCC*GTATAGTTTCATC*AACAAC*TATTTGAAGAATA*ATAC
LVR01_0073_G07.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0095_E08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0086_F12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0054_C06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0042_C03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0081_E04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*CATGTGAAGAATA*AGAC
LVR01_0038_H03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0039_H12.b : TAAGGATTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0087_E10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_D03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_H10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0051_E10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0062_H08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0063_A10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0084_H01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0058_F03.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0009_H04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0016_A10.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0090_E12.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_A08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0068_A02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0101_F02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0094_A02.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0078_A06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0099_G05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0037_G06.b : taaggaactccgatgctgccctaacatttcatctacaactttgtgaaaaaataacaccta
LVR01_0105_D01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0036_C09.b : TATGGACTCC*GATGCTtcccgtaggatttcatcaaacactctgtgaaagaataagacct
LVR01_0061_C08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
TES01_0067_G04.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
TES01_0096_F08.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0010_G05.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0050_B11.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0105_A01.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0065_B06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
LVR01_0066_D06.b : TAAGGACTCC*GATGCTGCC*GTAGAG*TTCATC*AACAAC*TATGTGAAGAATA*AGAC
20110601C-000771 : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
---------+---------+---------+---------+---------+---------+ 754
LVR01_0020_F04.b : CCAAGGGGAAAAATTGTGG*ATTTGTccataccaactttctcccggaaacccgtcctggt
LVR01_0052_E07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCCTC*CTGG
LVR01_0018_F01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0052_F06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0020_B06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0101_F04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0072_B04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0037_A09.b : C**AATGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0036_H01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0077_G12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0090_E01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0073_A06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0077_H08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0001_B01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0056_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0072_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0092_D02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0084_C09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
SPLT1_0013_A09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAA*CAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0005_D06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0089_E03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0018_F11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGGTA*CCGTC*CTGG
LVR01_0077_H11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0091_B10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0062_E09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0099_B11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0004_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0002_C01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0101_D01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0104_B11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTT*CCCGGATT*ACGTC*CTTG
LVR01_0019_F11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAAC*ACTTTCC*CCCGGATA*CCGTC*CTGG
LVR01_0045_C07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_D05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0025_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0043_G09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0065_H05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0092_D11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0001_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0096_G02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0018_E08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0078_B08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_A03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0021_H01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0097_B05.b : gaaaaattgttggatttgttcaaacatctttcccccggatacctccatggatttggttaa
LVR01_0081_C02.b : caagggggaaaaaattggggattttttttcaaaccacttttccccccggaaacccccgcc
LVR01_0035_G03.b : CA*AGGGGGAAAATTGTGG*ATTTGTTTCAACAAC*TTTC*CCCcgaaacccgtccttgg
LVR01_0036_A09.b : CAAGGGGGAAAATTGTGGA*ATTTTTTCAACCACT*TTTC*CCCGGAAA*CCGTC*CTGG
LVR01_0035_B11.b : CA*AGGGGAAAATTTGTGG*ATTTGTTTCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0035_C09.b : C**CAAGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATT*CCGTC*CTGG
LVR01_0037_G08.b : C**AAGGGGAAAATTGTGGAATTTGTTCCAACAACTTTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_G03.b : C**AAGGG*AAAATTGTGGGATTGTTTCAACAAC***TTT*CCCGGATA*CCGTC*CTGG
LVR01_0103_A10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0036_H05.b : C**AAGGGGAAAATTTGTGGATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTTG
LVR01_0035_H10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACCAACTTTC*CCCGGATA*CCGTC*CTGG
LVR01_0038_D04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0033_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTNCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0071_A12.b : CA*AGGGGAAAAATTGTGG*ATTTGTTCAGACAAC*TTTC*CCCGGTAA*CCGTC*CTGG
LVR01_0103_A06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0054_F07.b : C**AAGGGGAAAATTGTGGATTTGTTTCAAACAACTTTCC*CCCGGATA*CCGTC*CTGG
LVR01_0037_F09.b : C**AAGGGGAAAATTGTGG*ATTTTTTCAAACAAC*TTTT*CCCCGATA*CCGTC*CTGG
LVR01_0047_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATACCCGTC*CTGG
LVR01_0037_A07.b : C**AAGGGGAAAATTTGTGGATTTGTTCAAACAACTTTTC*CCCGGATA*CCGTC*CTGG
LVR01_0039_E08.b : C**CAGGGGAAAATTGTGG*ATTTTTTCCAACAACTTTTC*CCCGGATA*CCGTC*CTGG
LVR01_0004_A04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0020_F09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0086_G07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0093_E11.b : C**AAGGGGAAAGTTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0041_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0085_E08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0025_C03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0039_E01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0033_B09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0026_G03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0037_C03.b : C**CAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_F11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0094_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0096_E10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0019_B08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0065_D11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0019_D04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0054_C05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0089_F07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0041_C08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0053_C09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0020_F05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0076_H01.b : C**AAGGGGAAAAATGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0085_D11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0079_H04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAA*CAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0047_D01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0016_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0054_A03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0074_E07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0038_A10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0052_F03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0025_D04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAACTTTCC*CCCGGATA*CCGTC*CTGG
LVR01_0095_C07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0104_A12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0031_H02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0026_C08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_G08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0028_D09.b : C**AAGGGGAAAATTGTGG*ATTTGTTTCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0062_G08.b : C**AAGGGGAAAATTGTGG*ATTTGTTTCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0013_E12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0038_A12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_C10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0037_C05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0039_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_B12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0104_B04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0025_A08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_H11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_H12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0082_H05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0102_H09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0012_E09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0040_G11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_H01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_E11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0079_C11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0062_C06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0062_G04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0093_H05.b : C**AAGGGAAAAATTTGTGAATTTGTTCAAACAAT*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0102_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0061_E11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0094_E01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0022_D11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0052_F01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_D02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0061_F11.b : C**AAGGGGAAGATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0038_C08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0065_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0056_G03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0019_H10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0028_A11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0054_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0098_D02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0086_D03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0068_C01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0021_F09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0031_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0094_G06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0028_E09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAGACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0005_C08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_F09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0077_G10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0045_E11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0086_C11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0018_E07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0082_E02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0082_H01.b : C***AGGNNGAAATTGTGG*ATTTGTTCAA*CAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0040_D09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_B12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0101_D09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0093_A12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0009_C10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0033_A05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0089_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0029_D02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0041_G04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0055_H10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0045_D04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0016_D03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0048_F06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0018_H12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0084_H05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0008_G01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0040_F02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0021_D08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0104_F12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0059_D09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_B10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_H02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0044_G08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0004_B01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_E11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0012_E11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0089_A11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0053_B11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0019_E04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0043_G04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0050_F10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0053_A09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0060_C07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0054_C02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0092_B07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0048_F05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0042_F07.b : T**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0095_C08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGCC*CTGG
LVR01_0102_D01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0087_C04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0028_E04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0052_H06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0059_G11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0015_C02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0089_E06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0003_B04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0028_F07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0031_B06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0049_F01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCNAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_D01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0049_H04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0087_B03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0102_C09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0008_E03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0010_E07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0016_C11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0094_B06.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0049_F02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0062_H03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0017_G07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0077_F11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTCCCCCGGATA*CCGTC*CTGG
LVR01_0093_B11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0009_B07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0009_F02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTCCCCCGGATA*CCGTC*CTGG
LVR01_0019_H05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0044_G10.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0051_A08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0085_F05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0090_G05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_A03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0021_D10.b : C**AAGGGGAAAATTGTGG*ATTTGTTNCAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0033_C12.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0034_G11.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0073_C07.b : C**AAGGGGAAAATTGTGG*ACTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0098_F09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0040_B05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0101_H04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0008_F04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0008_F08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0030_F01.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0102_G02.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0039_C04.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0058_A07.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0073_C05.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0078_B09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACA*C*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0081_D03.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0101_H08.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01_0042_A09.b : C**AAGGGGAAAATTGTGG*ATTTGTTCAAACAAC*TTTC*CCCGGATA*CCGTC*CTGG
LVR01