
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000773

Length: 1,714

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III precursor [Homo sapiens]. 8160.0O
Contig/Assembly ProteinSERPINB3serpin B3 [Homo sapiens]. 2626e-70O
Contig/Assembly ProteinSERPINB1leukocyte elastase inhibitor [Homo sapiens]. 2573e-68O
Contig/Assembly ProteinSERPINB4serpin B4 [Homo sapiens]. 2565e-68O
Contig/Assembly ProteinSERPINB11serpin B11 [Homo sapiens]. 2464e-65O
Contig/Assembly ProteinSERPINB6serpin B6 [Homo sapiens]. 2365e-62O
Contig/Assembly ProteinSERPINB6serpin B6 [Homo sapiens]. 2365e-62O
Contig/Assembly ProteinSERPINB9serpin B9 [Homo sapiens]. 2296e-60O
Contig/Assembly ProteinSERPINB8serpin B8 isoform a [Homo sapiens]. 2281e-59O
Contig/Assembly ProteinSERPINB8serpin B8 isoform a [Homo sapiens]. 2281e-59O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSerpinc1antithrombin-III precursor [Mus musculus]. 7880.0O
Contig/Assembly ProteinSerpinb1aleukocyte elastase inhibitor A [Mus musculus]. 2581e-68O
Contig/Assembly ProteinSerpinb3bserine (or cysteine) proteinase inhibitor, clade b, member 3b [Mus musculus]. 2502e-66O
Contig/Assembly ProteinSerpinb3aserine peptidase inhibitor, clade B, member 3A [Mus musculus]. 2457e-65O
Contig/Assembly ProteinSerpinb6cserine proteinase inhibitor member 6C [Mus musculus]. 2434e-64O
Contig/Assembly ProteinSerpinb3dserpin B3 [Mus musculus]. 2357e-62O
Contig/Assembly ProteinSerpinb6bserine (or cysteine) proteinase inhibitor, clade B, member 6b [Mus musculus]. 2328e-61O
Contig/Assembly ProteinSerpinb3cserine (or cysteine) proteinase inhibitor, clade B, member 3C [Mus musculus]. 2312e-60O
Contig/Assembly ProteinSerpinb8serpin B8 isoform 1 [Mus musculus]. 2289e-60O
Contig/Assembly ProteinSerpinb1bleukocyte elastase inhibitor B [Mus musculus]. 2289e-60O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 2 [Canis familiaris]. 8240.0O
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 3 [Canis familiaris]. 7630.0O
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 1 [Canis familiaris]. 7120.0O
Contig/Assembly ProteinLOC483954PREDICTED: similar to Squamous cell carcinoma antigen 2 (SCCA-2) (Leupin) isoform 1 [Canis familiaris]. 2565e-68O
Contig/Assembly ProteinLOC483953PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11 [Canis familiaris]. 2412e-63O
Contig/Assembly ProteinLOC483954PREDICTED: similar to Squamous cell carcinoma antigen 2 (SCCA-2) (Leupin) isoform 3 [Canis familiaris]. 2396e-63O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 3 [Canis familiaris]. 2342e-61O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 4 [Canis familiaris]. 2312e-60O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 1 [Canis familiaris]. 2295e-60O
Contig/Assembly ProteinLOC488192PREDICTED: similar to Cytoplasmic antiproteinase 3 (CAP3) (CAP-3) (Protease inhibitor 9) (Serpin B9) isoform 5 [Canis familiaris]. 2281e-59O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III precursor [Bos taurus]. 8350.0O
Contig/Assembly ProteinLOC784575PREDICTED: serpin peptidase inhibitor, clade B like isoform 1 [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC786863PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC787285PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC787348PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinLOC787126PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinLOC786983PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinMGC159547PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinSERPINB4serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 [Bos taurus]. 2696e-72O
Contig/Assembly ProteinMGC159547PREDICTED: serpin peptidase inhibitor, clade B like isoform 1 [Bos taurus]. 2696e-72O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III [Sus scrofa]. 9190.0O
Contig/Assembly ProteinLOC100156623PREDICTED: serpin B11-like [Sus scrofa]. 2471e-65O
Contig/Assembly ProteinSERPINB8PREDICTED: serpin B8 [Sus scrofa]. 2363e-62O
Contig/Assembly ProteinSERPINB9serpin B9 [Sus scrofa]. 2263e-59O
Contig/Assembly ProteinSERPINB10PREDICTED: serpin B10 [Sus scrofa]. 2155e-56O
Contig/Assembly ProteinSERPINB7PREDICTED: serpin B7 isoform 2 [Sus scrofa]. 2118e-55O
Contig/Assembly ProteinSERPINB7PREDICTED: serpin B7 isoform 1 [Sus scrofa]. 2118e-55O
Contig/Assembly ProteinSERPINB2PREDICTED: plasminogen activator inhibitor 2 [Sus scrofa]. 2111e-54O
Contig/Assembly ProteinSERPINA3-2alpha-1-antichymotrypsin 2 [Sus scrofa]. 1924e-49O
Contig/Assembly ProteinSERPINI2PREDICTED: serpin I2 [Sus scrofa]. 1924e-49O

Assembly Members: 479      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010020G06LVR01_0020_G06.bBP446707 AK232333
LVRM10073E09LVRM1_0073_E09.bBP139688 AK394174


SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000773 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0020_G06.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_G11.b :
LVRM1_0028_F02.b :
LVRM1_0091_D12.b :
LVRM1_0073_E09.b :
LVRM1_0166_D06.b :
LVRM1_0015_G11.b :
LVRM1_0015_H12.b :
LVRM1_0148_A02.b :
LVRM1_0146_G10.b :
LVRM1_0113_C11.b :
LVRM1_0140_D11.b :
LVRM1_0098_D09.b :
LVR01_0093_E09.b :
LVRM1_0084_F11.b :
LVRM1_0003_A07.b :
LVRM1_0017_B06.b :
LVRM1_0110_A11.b :
LVRM1_0031_H09.b :
LVR01_0093_E10.b :
LVR01_0046_B04.b :
LVRM1_0181_F05.b :
LVRM1_0083_A01.b :
LVRM1_0087_F06.b :
LVR01_0047_A08.b :
LVRM1_0058_G03.b :
LVRM1_0093_E07.b :
LVRM1_0020_C05.b :
LVRM1_0136_A01.b :
LVRM1_0097_B02.b :
LVRM1_0171_H01.b :
LVRM1_0086_H02.b :
LVRM1_0091_E02.b :
LVRM1_0207_D01.b :
LVRM1_0136_H05.b :
LVRM1_0201_C12.b :
LVRM1_0165_C01.b :
LVRM1_0185_H06.b :
LVRM1_0097_H03.b :
LVRM1_0053_A02.b :
LVRM1_0025_D11.b :
LVRM1_0105_H06.b :
LVRM1_0162_F02.b :
LVRM1_0088_G12.b :
LVRM1_0149_B01.b :
LVRM1_0102_B06.b :
LVRM1_0201_H08.b :
LVRM1_0128_B02.b :
LVRM1_0181_D12.b :
LVRM1_0034_G03.b :
LVRM1_0155_H04.b :
LVRM1_0153_H01.b :
LVRM1_0140_C06.b :
LVRM1_0017_B08.b :
LVRM1_0128_G08.b :
LVRM1_0153_D05.b :
LVRM1_0153_D08.b :
LVRM1_0109_E11.b :
LVRM1_0079_H06.b :
LVRM1_0125_A05.b :
LVRM1_0126_E10.b :
LVRM1_0011_C07.b :
LVRM1_0134_B01.b :
LVRM1_0112_A08.b :
LVRM1_0077_G07.b :
LVRM1_0030_D05.b :
LVR01_0003_E07.b :
LVR01_0065_D12.b :
LVR01_0033_F10.b :
LVR01_0003_F11.b :
LVR01_0086_C07.b :
LVR01_0033_B01.b :
LVR01_0025_A09.b :
LVR01_0058_B03.b :
LVR01_0029_G01.b :
LVRM1_0203_B09.b :
LVRM1_0029_E10.b :
LVRM1_0032_H08.b :
LVRM1_0077_F10.b :
LVRM1_0048_G11.b :
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b :
LVRM1_0101_D08.b :
LVR01_0073_H01.b :
LVR01_0103_G08.b :
LVRM1_0168_H02.b :
LVRM1_0024_A06.b :
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b :
LVRM1_0094_H08.b :
LVRM1_0172_C03.b :
LVRM1_0175_C03.b :
LVRM1_0093_A09.b :
LVRM1_0163_G07.b :
LVRM1_0186_C06.b :
LVRM1_0206_G12.b :
LVRM1_0040_G09.b :
LVRM1_0204_D09.b :
LVRM1_0084_D11.b :
LVRM1_0147_E09.b :
LVRM1_0127_A10.b :
LVRM1_0139_H11.b :
LVR01_0101_E10.b :
LVR01_0049_E03.b :
LVR01_0089_C10.b :
LVR01_0098_G02.b :
LVR01_0012_D01.b :
LVR01_0068_B07.b :
LVR01_0068_G09.b :
LVR01_0094_E02.b :
LVRM1_0187_A01.b :
LVRM1_0129_C02.b :
LVRM1_0027_E08.b :
LVRM1_0038_G04.b :
LVRM1_0094_G08.b :
LVRM1_0069_G02.b :
LVRM1_0132_D11.b :
LVRM1_0065_G07.b :
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b :
LVRM1_0049_C07.b :
LVRM1_0016_D06.b :
LVR01_0004_F03.b :
LVR01_0073_E12.b :
LVRM1_0184_F04.b :
LVRM1_0198_G02.b :
LVRM1_0048_E12.b :
LVRM1_0031_F11.b :
LVR01_0044_H12.b :
LVRM1_0131_C10.b :
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b :
LVRM1_0068_B11.b :
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b :
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b :
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b :
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b :
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b :
LVR01_0061_C10.b :
LVR01_0072_C12.b :
LVR01_0012_E03.b :
LVR01_0003_A08.b :
LVRM1_0005_F10.b :
LVRM1_0131_E02.b :
LVRM1_0134_G01.b :
LVRM1_0068_B04.b :
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b :
LVRM1_0163_E02.b :
LVRM1_0068_F10.b :
LVRM1_0054_C03.b :
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b :
LVRM1_0072_G04.b :
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b :
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b :
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b :
LVRM1_0164_G06.b :
LVRM1_0009_A03.b :
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b :
LVRM1_0126_A06.b :
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b :
LVRM1_0068_G08.b :
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b :
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b :
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b :
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b :
LVRM1_0145_A09.b :
LVRM1_0007_D08.b :
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b :
LVRM1_0078_D01.b :
LVRM1_0008_G12.b :
LVRM1_0009_H08.b :
LVRM1_0051_E11.b :
LVRM1_0021_D06.b :
LVRM1_0008_H11.b :
LVRM1_0143_D02.b :
LVRM1_0108_F07.b :
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b :
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b :
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b :
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b :
LVR01_0030_D04.b :
LVR01_0071_E07.b :
LVR01_0054_G12.b :
LVR01_0048_G05.b :
LVR01_0101_B06.b :
LVR01_0011_D06.b :
LVR01_0089_C06.b :
LVR01_0053_D01.b :
LVR01_0030_B03.b :
LVR01_0046_H06.b :
LVRM1_0096_H05.b :
LVRM1_0024_D06.b :
LVRM1_0177_C11.b :
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b :
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b :
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b :
LVR01_0084_G02.b :
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b :
LVR01_0008_B06.b :
LVR01_0104_B03.b :
LVR01_0012_C03.b :
LVRM1_0067_D04.b :
LVR01_0015_B05.b :
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b :
LVR01_0048_H12.b :
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b :
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b :
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : ........................TTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAG
---------+---------+---------+---------+---------+---------+ 36
LVRM1_0090_G11.b :
LVRM1_0028_F02.b :
LVRM1_0091_D12.b :
LVRM1_0073_E09.b :
LVRM1_0166_D06.b :
LVRM1_0015_G11.b :
LVRM1_0015_H12.b :
LVRM1_0148_A02.b :
LVRM1_0146_G10.b :
LVRM1_0113_C11.b :
LVRM1_0140_D11.b :
LVRM1_0098_D09.b :
LVR01_0093_E09.b :
LVRM1_0084_F11.b :
LVRM1_0003_A07.b :
LVRM1_0017_B06.b :
LVRM1_0110_A11.b :
LVRM1_0031_H09.b :
LVR01_0093_E10.b :
LVR01_0046_B04.b :
LVRM1_0181_F05.b :
LVRM1_0083_A01.b :
LVRM1_0087_F06.b :
LVR01_0047_A08.b :
LVRM1_0058_G03.b :
LVRM1_0093_E07.b :
LVRM1_0020_C05.b :
LVRM1_0136_A01.b :
LVRM1_0097_B02.b :
LVRM1_0171_H01.b :
LVRM1_0086_H02.b :
LVRM1_0091_E02.b :
LVRM1_0207_D01.b :
LVRM1_0136_H05.b :
LVRM1_0201_C12.b :
LVRM1_0165_C01.b :
LVRM1_0185_H06.b :
LVRM1_0097_H03.b :
LVRM1_0053_A02.b :
LVRM1_0025_D11.b : ccgcgccggggggcccggcc
LVRM1_0105_H06.b :
LVRM1_0162_F02.b :
LVRM1_0088_G12.b :
LVRM1_0149_B01.b :
LVRM1_0102_B06.b :
LVRM1_0201_H08.b :
LVRM1_0128_B02.b :
LVRM1_0181_D12.b :
LVRM1_0034_G03.b :
LVRM1_0155_H04.b :
LVRM1_0153_H01.b :
LVRM1_0140_C06.b :
LVRM1_0017_B08.b :
LVRM1_0128_G08.b :
LVRM1_0153_D05.b :
LVRM1_0153_D08.b :
LVRM1_0109_E11.b :
LVRM1_0079_H06.b :
LVRM1_0125_A05.b :
LVRM1_0126_E10.b :
LVRM1_0011_C07.b :
LVRM1_0134_B01.b :
LVRM1_0112_A08.b :
LVRM1_0077_G07.b :
LVRM1_0030_D05.b :
LVR01_0003_E07.b :
LVR01_0065_D12.b :
LVR01_0033_F10.b :
LVR01_0003_F11.b :
LVR01_0086_C07.b :
LVR01_0033_B01.b :
LVR01_0025_A09.b :
LVR01_0058_B03.b :
LVR01_0029_G01.b :
LVRM1_0203_B09.b :
LVRM1_0029_E10.b :
LVRM1_0032_H08.b :
LVRM1_0077_F10.b :
LVRM1_0048_G11.b :
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b :
LVRM1_0101_D08.b :
LVR01_0073_H01.b :
LVR01_0103_G08.b :
LVRM1_0168_H02.b :
LVRM1_0024_A06.b :
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b :
LVRM1_0094_H08.b :
LVRM1_0172_C03.b :
LVRM1_0175_C03.b :
LVRM1_0093_A09.b :
LVRM1_0163_G07.b :
LVRM1_0186_C06.b :
LVRM1_0206_G12.b :
LVRM1_0040_G09.b :
LVRM1_0204_D09.b :
LVRM1_0084_D11.b :
LVRM1_0147_E09.b :
LVRM1_0127_A10.b :
LVRM1_0139_H11.b :
LVR01_0101_E10.b :
LVR01_0049_E03.b :
LVR01_0089_C10.b :
LVR01_0098_G02.b :
LVR01_0012_D01.b :
LVR01_0068_B07.b :
LVR01_0068_G09.b :
LVR01_0094_E02.b :
LVRM1_0187_A01.b :
LVRM1_0129_C02.b :
LVRM1_0027_E08.b : cgcaaccacaccgaaccgcaaaac
LVRM1_0038_G04.b :
LVRM1_0094_G08.b :
LVRM1_0069_G02.b :
LVRM1_0132_D11.b :
LVRM1_0065_G07.b :
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b :
LVRM1_0049_C07.b :
LVRM1_0016_D06.b :
LVR01_0004_F03.b :
LVR01_0073_E12.b :
LVRM1_0184_F04.b :
LVRM1_0198_G02.b :
LVRM1_0048_E12.b :
LVRM1_0031_F11.b :
LVR01_0044_H12.b :
LVRM1_0131_C10.b :
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b :
LVRM1_0068_B11.b :
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b :
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b :
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b :
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b :
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b :
LVR01_0061_C10.b :
LVR01_0072_C12.b :
LVR01_0012_E03.b :
LVR01_0003_A08.b :
LVRM1_0005_F10.b :
LVRM1_0131_E02.b :
LVRM1_0134_G01.b :
LVRM1_0068_B04.b :
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b :
LVRM1_0163_E02.b :
LVRM1_0068_F10.b :
LVRM1_0054_C03.b :
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b :
LVRM1_0072_G04.b :
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b :
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b :
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b :
LVRM1_0164_G06.b :
LVRM1_0009_A03.b :
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b :
LVRM1_0126_A06.b :
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b :
LVRM1_0068_G08.b :
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b :
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b :
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b :
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b :
LVRM1_0145_A09.b :
LVRM1_0007_D08.b :
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b :
LVRM1_0078_D01.b :
LVRM1_0008_G12.b :
LVRM1_0009_H08.b :
LVRM1_0051_E11.b :
LVRM1_0021_D06.b :
LVRM1_0008_H11.b :
LVRM1_0143_D02.b :
LVRM1_0108_F07.b :
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b :
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b :
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b :
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b :
LVR01_0030_D04.b :
LVR01_0071_E07.b :
LVR01_0054_G12.b :
LVR01_0048_G05.b :
LVR01_0101_B06.b :
LVR01_0011_D06.b :
LVR01_0089_C06.b :
LVR01_0053_D01.b :
LVR01_0030_B03.b :
LVR01_0046_H06.b :
LVRM1_0096_H05.b :
LVRM1_0024_D06.b : cacagcaacag
LVRM1_0177_C11.b : nttgtcxxxxxxxxxxx
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b :
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b :
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b :
LVR01_0084_G02.b :
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b :
LVR01_0008_B06.b :
LVR01_0104_B03.b :
LVR01_0012_C03.b :
LVRM1_0067_D04.b :
LVR01_0015_B05.b :
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b :
LVR01_0048_H12.b :
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b :
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b :
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 96
LVRM1_0090_G11.b : gtcxxxxxxxxxxxxxxxxx
LVRM1_0028_F02.b : cgttgacxxxxxxxxxxxxxxxxx
LVRM1_0091_D12.b : gtcxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_E09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_D06.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G11.b : ttgtcxxxxxxxx
LVRM1_0015_H12.b : ttgtcxxxxxxxx
LVRM1_0148_A02.b : tcagttgtcxxxx
LVRM1_0146_G10.b : cagttgtcx
LVRM1_0113_C11.b : nagttgtc
LVRM1_0140_D11.b : nagttgtcxxxx
LVRM1_0098_D09.b : gagtttgtcxx
LVR01_0093_E09.b : tggggggaactxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_F11.b : cgttgtcx
LVRM1_0003_A07.b : nagtt
LVRM1_0017_B06.b : cgttgtcx
LVRM1_0110_A11.b : nagttgtcxxxxxxxxxxxxx
LVRM1_0031_H09.b : nagttgtcx
LVR01_0093_E10.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B04.b : tgtttttnaagcttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_F05.b : gtcxx
LVRM1_0083_A01.b : tttgtcxx
LVRM1_0087_F06.b :
LVR01_0047_A08.b : ggggactcnagatgcttggtgxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_G03.b : cagttgtcxxx
LVRM1_0093_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_C05.b : cgttgacxx
LVRM1_0136_A01.b : tcgttgtcxx
LVRM1_0097_B02.b : ncgttgtcxx
LVRM1_0171_H01.b : ttgtcxx
LVRM1_0086_H02.b : cagttgtcxx
LVRM1_0091_E02.b : txxx
LVRM1_0207_D01.b :
LVRM1_0136_H05.b : nagtttgtcxx
LVRM1_0201_C12.b :
LVRM1_0165_C01.b : ccttgtcxx
LVRM1_0185_H06.b :
LVRM1_0097_H03.b : gagttgtcxx
LVRM1_0053_A02.b : agttgtcxx
LVRM1_0025_D11.b : gcggcgccaaccgcccccccccggcccaccggcccccccccccccggccgccgattgtcx
LVRM1_0105_H06.b : naatgtcxx
LVRM1_0162_F02.b : nagttgtcxx
LVRM1_0088_G12.b :
LVRM1_0149_B01.b : nagttgtcxx
LVRM1_0102_B06.b : cagtgtcxx
LVRM1_0201_H08.b :
LVRM1_0128_B02.b : nagttgtcxxx
LVRM1_0181_D12.b : ttgtcx
LVRM1_0034_G03.b : nagttgtcxx
LVRM1_0155_H04.b : cagtgtcxx
LVRM1_0153_H01.b : tcagtgtcxxxxxxxxxxxxxxx
LVRM1_0140_C06.b : agttgtcxx
LVRM1_0017_B08.b : ccgttgtcxx
LVRM1_0128_G08.b : nagttgtcxx
LVRM1_0153_D05.b : agttgtcxx
LVRM1_0153_D08.b : agttgtcxx
LVRM1_0109_E11.b : cagttgtcxxxx
LVRM1_0079_H06.b : gttgacxx
LVRM1_0125_A05.b : tagttgtacxxx
LVRM1_0126_E10.b : nagttgtcxx
LVRM1_0011_C07.b : cgttgtcxx
LVRM1_0134_B01.b : cagttgtcxx
LVRM1_0112_A08.b : nagtttgtcxxx
LVRM1_0077_G07.b : agttgacat
LVRM1_0030_D05.b : agttgtcxx
LVR01_0003_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D12.b : tgttctagctttcgtgxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F10.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_F11.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_C07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_B01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_A09.b : agtttxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_B03.b : gcatttgcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_B09.b :
LVRM1_0029_E10.b : cgttgtcxxx
LVRM1_0032_H08.b : nagttgtc
LVRM1_0077_F10.b : agt
LVRM1_0048_G11.b : t
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b : cgtt
LVRM1_0101_D08.b : nagtt
LVR01_0073_H01.b : gggctaxxxxxxxxxxxxxxxxxxxx
LVR01_0103_G08.b : gtgtttcaagcataggtgxxxxxxxxxxxxxxxx
LVRM1_0168_H02.b :
LVRM1_0024_A06.b : cgttg
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b : ttg
LVRM1_0094_H08.b :
LVRM1_0172_C03.b : caattg
LVRM1_0175_C03.b : aattg
LVRM1_0093_A09.b :
LVRM1_0163_G07.b : ttg
LVRM1_0186_C06.b : cgttg
LVRM1_0206_G12.b :
LVRM1_0040_G09.b : gagttgt
LVRM1_0204_D09.b :
LVRM1_0084_D11.b : agttg
LVRM1_0147_E09.b : nagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0127_A10.b : tagttg
LVRM1_0139_H11.b : tcagttg
LVR01_0101_E10.b : ctttttgctgxxxxxxxxxxxxxxxxxxx
LVR01_0049_E03.b : gggggttttttttagcttagtgxxxxxxxxxxxxxxxxx
LVR01_0089_C10.b : gcatttggtgaaxxxxxxxxxxxxxxxxxx
LVR01_0098_G02.b : ggccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_D01.b : tgtttgcggctttxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B07.b : ggcatttgggntgxxxxxxxxxxxxxxxxxxx
LVR01_0068_G09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_A01.b : gtt
LVRM1_0129_C02.b : ccgttg
LVRM1_0027_E08.b : gcaccacgcacgcggcgcagccccccgcccggcggccctcgccgcggcccgcagttgtcx
LVRM1_0038_G04.b : ncgttgtc
LVRM1_0094_G08.b :
LVRM1_0069_G02.b : nagtt
LVRM1_0132_D11.b : tcgttt
LVRM1_0065_G07.b : cxxxxxxxxxxx
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b : agt
LVRM1_0049_C07.b : tagttg
LVRM1_0016_D06.b : t
LVR01_0004_F03.b : ttttggtggactatanngacxxxxxx
LVR01_0073_E12.b : ttttggtgttatttagcttagtgxxxxxxxxxxxxxxxxx
LVRM1_0184_F04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_G02.b :
LVRM1_0048_E12.b : c
LVRM1_0031_F11.b : a
LVR01_0044_H12.b : gggcaxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_C10.b : n
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b : nagttg
LVRM1_0068_B11.b : xxx
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b : tttttttgtttttnccgtttagtgxxxxxxxxxxx
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b : cxx
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b : n
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b : c
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b : ttatggggaacatatataaaaaatt
LVR01_0061_C10.b : tgggcttagcttcxxxxxxxxxxxxxx
LVR01_0072_C12.b : tttttttttttttatagcttxxxxxxxxxxxxxxxx
LVR01_0012_E03.b : ggttttagcataxxxxxxxxxxxxxx
LVR01_0003_A08.b : gttaaccggggaactattagacagt
LVRM1_0005_F10.b : cxxx
LVRM1_0131_E02.b :
LVRM1_0134_G01.b : cc
LVRM1_0068_B04.b : xxx
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b : cxxx
LVRM1_0163_E02.b :
LVRM1_0068_F10.b : xx
LVRM1_0054_C03.b : n
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b : n
LVRM1_0072_G04.b : ta
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b : agttgacxx
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b : cxxx
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b : n
LVRM1_0164_G06.b :
LVRM1_0009_A03.b : cxx
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b : t
LVRM1_0126_A06.b : t
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b : xx
LVRM1_0068_G08.b : cx
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b : cx
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b : ttt
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b : na
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b : xxx
LVRM1_0145_A09.b :
LVRM1_0007_D08.b : x
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b : n
LVRM1_0078_D01.b :
LVRM1_0008_G12.b : xx
LVRM1_0009_H08.b : xx
LVRM1_0051_E11.b : n
LVRM1_0021_D06.b :
LVRM1_0008_H11.b : c
LVRM1_0143_D02.b :
LVRM1_0108_F07.b : na
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b : n
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b : n
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b : n
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b : atxx
LVR01_0030_D04.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E07.b : gctxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G12.b : ggcatttagtgxxxxxxxxxxxxx
LVR01_0048_G05.b : gggtgtctttcctgcttagtgxxxxxxxxxxxx
LVR01_0101_B06.b : ccaxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D06.b : gggtggggctttxxxxxxxxxxxxxxxxx
LVR01_0089_C06.b : gcatcxxxxxxxxxxxxxxxxxxxx
LVR01_0053_D01.b : ggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B03.b : atatggtgxxxxxxxxxxxxxx
LVR01_0046_H06.b : gctxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_H05.b :
LVRM1_0024_D06.b : gagggagacgcacggacaacaaacagcgccacgaaccgcacgcagagaagacggcaccgg
LVRM1_0177_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b : n
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b : ncgttg
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b : ggtgggtaaggctagtgacgtata
LVR01_0084_G02.b : gggcxxxxxxxxxxxxxx
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b : ccttttggtgga
LVR01_0008_B06.b : gagcaaatgtg
LVR01_0104_B03.b : ggtgtccccagctttgtg
LVR01_0012_C03.b : gagaaaaggcataxx
LVRM1_0067_D04.b :
LVR01_0015_B05.b : ctxxxxx
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b : gctttt
LVR01_0048_H12.b : cgctttt
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b : gctcct
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b : cx
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 156
LVRM1_0090_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0028_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0091_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgaGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0073_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgaGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0166_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxcgagtttgttggcctaCTGGAACCTCAGTCAGATTT
LVRM1_0015_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCAGTCAGATTT
LVRM1_0015_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCAGTCAGATTT
LVRM1_0148_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0146_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGAGTCAGATTT
LVRM1_0113_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0140_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0098_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0093_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0084_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0003_A07.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0017_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0110_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcctactggAGTCAGATTT
LVRM1_0031_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0093_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0046_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactggaAGTCAGATTT
LVRM1_0181_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0087_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0047_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0058_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0093_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtccGTCAAATTT
LVRM1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0136_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0097_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0171_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0086_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0091_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0207_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0136_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0201_C12.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0165_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0185_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0097_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0053_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0025_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0105_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0162_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0088_G12.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0149_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0102_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0201_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0128_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0181_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0034_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0155_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0140_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0017_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0128_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0109_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0079_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0125_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0126_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0011_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0134_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0112_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0030_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0003_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0065_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0033_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0003_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0025_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0058_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGATTT
LVRM1_0203_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtggCAGATTT
LVRM1_0029_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcCAGATTT
LVRM1_0032_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTT
LVRM1_0077_F10.b : tgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTT
LVRM1_0048_G11.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0185_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggAGATTT
LVRM1_0201_B02.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0172_D01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0101_D08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVR01_0073_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVR01_0103_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggAGATTT
LVRM1_0168_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0024_A06.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0176_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0045_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0173_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0207_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0202_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0184_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0094_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0172_C03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0175_C03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0163_G07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0186_C06.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0206_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0040_G09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcGATTT
LVRM1_0204_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0084_D11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0147_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0127_A10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0139_H11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0101_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0049_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0089_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0098_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0012_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0068_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0068_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0094_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0187_A01.b : tgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG
LVRM1_0129_C02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcATTT
LVRM1_0027_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtcacATTT
LVRM1_0038_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtccATTT
LVRM1_0094_G08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG
LVRM1_0069_G02.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggtaCTGG
LVRM1_0132_D11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0065_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggttTTT
LVRM1_0170_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0179_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0020_B07.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTT
LVRM1_0049_C07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTTT
LVRM1_0016_D06.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVR01_0004_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVR01_0073_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVRM1_0184_F04.b : xxxxxxxxxxxxxxxxxxxxtccttcccccacctgagcctctggaacctcagtcagatTT
LVRM1_0198_G02.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0048_E12.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0031_F11.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
LVR01_0044_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0131_C10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0017_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0104_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0096_A07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtG
LVRM1_0164_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0082_C09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0205_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0111_F10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatcT
LVRM1_0068_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0018_G09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0050_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0068_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0165_E05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_H07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_C01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_H05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_E07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_G02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_D08.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_F03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_B03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E04.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_G02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_C02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E12.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_A10.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_D03.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_C08.b : ccttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_F05.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_C08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_E09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C03.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C11.b : agttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_G10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_A08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D06.b : tgtgcaaaaaacacagcgggtatcggtccggagttcttctagcactgttgtgcctcctgg
LVR01_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_E02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_G01.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVRM1_0068_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_D10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_C03.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_A09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_G12.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_A04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_G04.b : gttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_F06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_D09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_C12.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_H01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_A06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_A08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_A05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_C01.b : tcatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_F02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_G02.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_B10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_H08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_F01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E07.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_C06.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A06.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_G10.b : ccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_G08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_B11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_H08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_E09.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_H06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_B03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_F05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_B08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_A10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_F11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_G01.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_E05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_E08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_F05.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_H02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_H11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_H09.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_D06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_H11.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_F07.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_G12.b : ncctgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_D06.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D05.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G02.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_H08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_B11.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_B11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_G12.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_B08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_D10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_H05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_D06.b : acattgtcacacagcagctgggtacggtcctcxxxxxxxxxxxxxxxxxxxxxxxxxxxg
LVRM1_0177_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactgg
LVRM1_0135_D02.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_G08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_C05.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVRM1_0166_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_A02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_B01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcc
LVRM1_0026_C08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_F10.b : agttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_C03.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_H08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_F02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_F03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D08.b : agttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_G08.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_E03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_D04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G10.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_E10.b : tttttttcctacggtggc
LVRM1_0131_E10.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_B07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_B08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A09.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_A05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_H02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_G11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_C06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_E03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_D11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_C09.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_H12.b : caatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_G11.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_C10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_D11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_F04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_F09.b : ggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_H12.b : ggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_F10.b : xxxxxxxxx
LVRM1_0081_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_B03.b : ccgncaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_C02.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_H04.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_A04.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_G02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_G05.b : xxxxxxxxxxxxxxxxxxx
LVRM1_0170_G09.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_B08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_G05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_H09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F03.b : ccatgcatagtgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_C02.b : ggcattagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_F08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_A02.b : ttgtcxxxxxxxxxxxxxx
LVRM1_0087_G05.b : xxxxxxxxxxxx
LVRM1_0132_C10.b : ccgttgtcxxxxxxxxxxxxxxxxx
LVRM1_0057_F12.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0206_B02.b : xxxxxxxxx
LVRM1_0172_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_D04.b : gagttgtcxxxxxxxxxxxxxxxx
LVRM1_0109_E04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_H10.b : nagtttgtcxxxxxxxxxxxxxxxxx
LVRM1_0079_A05.b : cgttgaataaagxxxxxxxx
LVRM1_0008_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_F01.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0159_C10.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0009_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_B06.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0052_C09.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0150_F10.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0142_H11.b : caattgtcxxxxxxxxxxxxxxxx
LVRM1_0049_E07.b : nagttgtcxxxxxxxxxxxxxxxxx
LVR01_0001_G07.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_B09.b : catttagatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G04.b : gggttttttttcggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_H06.b : ggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_G03.b : cctataggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_G07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_G08.b : nagttgtcxxxxxxxx
LVR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_E03.b : gggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_C11.b :
LVRM1_0082_G07.b : ttgtcxxxxxxxxx
LVRM1_0179_C09.b : agttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_B09.b : caattgtcxxxxxxxxxx
LVRM1_0004_C10.b : cgtttgtxxxxxxxxx
LVRM1_0194_C04.b :
LVR01_0019_A03.b : gcatataxxxxxxxxxxxxxxxxx
LVR01_0045_C10.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 212
LVRM1_0205_H05.b : xgatcagagaacctgttcaccatGGATTGC***CTCAGACCGCACTATCTCCACTCTCCC
LVRM1_0208_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0081_C05.b : xxxxxxxxxxxxxxxxxxxxxxxgaATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0134_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0159_B03.b : xxxxxxxxxxxxxxxxxxxxxxxtggTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0055_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0188_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0048_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0081_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0168_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0170_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0067_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0047_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0068_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0200_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0180_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGAGACCACACTATCTCCACTCGCCC
LVRM1_0087_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0132_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACCATCTCCACTCGCCC
LVRM1_0057_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0206_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0172_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0067_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0035_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0109_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0124_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0079_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0008_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0161_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0159_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0009_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0142_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0052_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0150_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0142_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0001_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0031_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0048_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0058_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0078_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0046_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0068_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0104_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCACACTATCTCCACTCGCCC
LVR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACACTATCTCCACTCGCCC
LVR01_0005_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACACTATCTCCACTCGCCC
LVRM1_0205_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTATCTCCACTCGCCC
LVRM1_0082_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0179_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0114_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0004_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0194_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgg
LVR01_0019_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_H09.b : cagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 271
LVRM1_0172_H09.b : xxxxxxxxxxxxxxxxgcgaccatgattttccagcTGGGATAAGAACTGTAGCTGCTAGA
LVRM1_0023_B02.b : cgtggacacggacCTGTAGCTGCTAGA
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b : gcgttgtcxxxxxx
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 330
LVRM1_0128_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_A11.b : acgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_B08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_F12.b : t
LVRM1_0199_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggatctggcagttc
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 390
LVRM1_0044_F12.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCC
LVRM1_0199_G10.b : agagggattgcctcagaccacactatctccactcgcccagacctgtggaagattagcgaC
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 450
LVRM1_0115_C11.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 509
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 568
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 625
LVRM1_0181_F05.b : TCATCCCT*GACTATCCCCACAGC*TTTTtgctatcaccaaccagggtgacccgcgacat
LVRM1_0132_D11.b : TCACCTTT*GTATATCTCCACCGC*TTTTGCTtatgaccaaactgggctgtctgtggcta
LVRM1_0005_F10.b : GCACCCCctgactactcccacacttttgcttctaccaagctgagtgcctgttattactct
LVRM1_0131_E10.b : TCACCCCT*GAGTACCTCCCCAGC*CTTTtgctatgacccaacttggccttctgtgactt
LVR01_0034_H02.b :
---------+---------+---------+---------+---------+---------+ 682
LVRM1_0181_F05.b : caccttcaaaacggctggaggcaggtgttctgactttaacaccgacccatcaaagcaaag
LVRM1_0083_A01.b : ACTCT*GTAGCAGC*TGcagcacggagttgagtgcgatgccagcacggacaccaaccctg