[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000773

Length: 1,714

Sequence [FASTA format sequence]
TTAGCGGTGG ATCACTCGGC TCGTGCGTCG ATGAAGAACG CAGCTAGCTG CGAGAATTAA
TGTGAATTGC AGGACACATT GATCATCGAC ACTTCGAACG CACTTGCGGC CCCGGGTTCC
TCCCGGGGCT ACGCCTCTGG AACCTCAGTC AGATTTAGAT GAAAGAACCA GTTCAGAGGG
ATTGCCTCAG ACCACACTAT CTCCACTCGC CCAGACCTGT GGAAGATTAG CGACCATGTT
TTCCAGTGGG ATAGGAACTG TAGCTGCTAG AAAAAGGAGG GAGTGTCTTC TCTCCTTGCT
GATTATTGGC CTCTGGGGCT GTGTGACCTG TCATTGGAGC CCTGTGGAGG ACATCTGCAC
AGCCAAGCCT CGGGACATTC CCGTGAATCC CATGTGCATT TACCGTTCCC CAGAGAAGAA
GGCCACTGAG GGCGAGGGCT CAGAGCAGAA GATCCCTGAG GCCACCAACC GGCGGGTCTG
GGAACTGTCC AAGGCCAATT CCCACTTTGC CACCATCTTC TATCAGCACT TGGCAGACTC
CAAGAATGAC AATGACAACA TTTTCCTGTC ACCCCTGAGT ATCTCCACAG CTTTTGCTAT
GACCAAGCTG GGTGCCTGTG ACAACACCCT CAAGCAGCTG ATGGAGGTGT TTAAGTTTGA
TACCATCTCT GAGAAAACAT CTGATCAGGT CCACTTTTTC TTTGCCAAAC TGAACTGCCG
ACTCTATCGA AAAGCCAACA AATCCTCTGA GTTGGTGTCA GCCAACCGCC TTTTTGGAGA
CAAATCCCTT ACCTTCAATG AGACCTACCA GGAAATCAGT GAGGTGGTAT ATGGAGCCAA
GCTCCAGCCC CTGGACTTCA AGGAAAATGC AGAGCAGTCC AGAGGGATCA TCAACCAATG
GGTGTCCAAC AAGACTGAAG GGCGTATCAC TGATGTCATT CCCCCAGAAG CCATCAACGA
GCTCACTGTG CTGGTGCTGG TCAACACCAT TTACTTTAAG GGCCGGTGGA AGTCAAAGTT
CAGCTCTGAG AACACAAGGA AGGAACTTTT CTACAAGGCT AATGGGGAGT CGTGTTCAGT
ATCCATGATG TATCAGGAAA GCAAGTTTCG TTACCGGCGT GTAGCAGAAG GCACCCAGGT
GCTCGAGTTG CCCTTCAAGG GTGATGACAT CACCATGGTG CTCATCCTGC CCAAGCTCGA
GAAGAGCCTG GCCAAGGTGG AGCAGGAACT CACCCCGGAG GTGCTGCAGG AGTGGCTAGA
CGAGCTGGCA GACACCCTGC TGGTGGTCCA CATGCCCCGC TTCCGCATAG AGGACAGCTT
CAGCGTGAAG GAGCGGCTGC AAGACATGGG CCTTGAGGAC CTGTTCATCC CTGAGAAGGC
CAAGCTTCCA GGTATTGTTG CAGAAGGCCG GGATGACCTC TATGTCTCAG ATGCATTTCA
TAAGGCATTT CTTGAGGTAA ATGAGGAAGG CAGTGAAGCA GCAGCAAGTA CCACCATTGG
GATCGCTGGC CGTTCGCTGA ATCCCGCCAG AGTGACATTC AAGGCCAATA GGCCCTTCCT
GGTTCTTATA AGGGAAGTTG CTCTGAATAC TATTATCTTC ATGGGCAGAG TAGCCAACCC
TTGTTAAAGT GTTATTCTTT ATACTTCTTC CTATTTTGGT TTGTGAATAG AAGTAAAAAT
AAATACAACT ACTCCCATAA AAAAAAAAAA AAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III precursor [Homo sapiens]. 8160.0O
Contig/Assembly ProteinSERPINB3serpin B3 [Homo sapiens]. 2626e-70O
Contig/Assembly ProteinSERPINB1leukocyte elastase inhibitor [Homo sapiens]. 2573e-68O
Contig/Assembly ProteinSERPINB4serpin B4 [Homo sapiens]. 2565e-68O
Contig/Assembly ProteinSERPINB11serpin B11 [Homo sapiens]. 2464e-65O
Contig/Assembly ProteinSERPINB6serpin B6 [Homo sapiens]. 2365e-62O
Contig/Assembly ProteinSERPINB6serpin B6 [Homo sapiens]. 2365e-62O
Contig/Assembly ProteinSERPINB9serpin B9 [Homo sapiens]. 2296e-60O
Contig/Assembly ProteinSERPINB8serpin B8 isoform a [Homo sapiens]. 2281e-59O
Contig/Assembly ProteinSERPINB8serpin B8 isoform a [Homo sapiens]. 2281e-59O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSerpinc1antithrombin-III precursor [Mus musculus]. 7880.0O
Contig/Assembly ProteinSerpinb1aleukocyte elastase inhibitor A [Mus musculus]. 2581e-68O
Contig/Assembly ProteinSerpinb3bserine (or cysteine) proteinase inhibitor, clade b, member 3b [Mus musculus]. 2502e-66O
Contig/Assembly ProteinSerpinb3aserine peptidase inhibitor, clade B, member 3A [Mus musculus]. 2457e-65O
Contig/Assembly ProteinSerpinb6cserine proteinase inhibitor member 6C [Mus musculus]. 2434e-64O
Contig/Assembly ProteinSerpinb3dserpin B3 [Mus musculus]. 2357e-62O
Contig/Assembly ProteinSerpinb6bserine (or cysteine) proteinase inhibitor, clade B, member 6b [Mus musculus]. 2328e-61O
Contig/Assembly ProteinSerpinb3cserine (or cysteine) proteinase inhibitor, clade B, member 3C [Mus musculus]. 2312e-60O
Contig/Assembly ProteinSerpinb8serpin B8 isoform 1 [Mus musculus]. 2289e-60O
Contig/Assembly ProteinSerpinb1bleukocyte elastase inhibitor B [Mus musculus]. 2289e-60O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 2 [Canis familiaris]. 8240.0O
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 3 [Canis familiaris]. 7630.0O
Contig/Assembly ProteinLOC480066PREDICTED: similar to Antithrombin-III precursor (ATIII) isoform 1 [Canis familiaris]. 7120.0O
Contig/Assembly ProteinLOC483954PREDICTED: similar to Squamous cell carcinoma antigen 2 (SCCA-2) (Leupin) isoform 1 [Canis familiaris]. 2565e-68O
Contig/Assembly ProteinLOC483953PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11 [Canis familiaris]. 2412e-63O
Contig/Assembly ProteinLOC483954PREDICTED: similar to Squamous cell carcinoma antigen 2 (SCCA-2) (Leupin) isoform 3 [Canis familiaris]. 2396e-63O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 3 [Canis familiaris]. 2342e-61O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 4 [Canis familiaris]. 2312e-60O
Contig/Assembly ProteinLOC607205PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 8 isoform a isoform 1 [Canis familiaris]. 2295e-60O
Contig/Assembly ProteinLOC488192PREDICTED: similar to Cytoplasmic antiproteinase 3 (CAP3) (CAP-3) (Protease inhibitor 9) (Serpin B9) isoform 5 [Canis familiaris]. 2281e-59O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III precursor [Bos taurus]. 8350.0O
Contig/Assembly ProteinLOC784575PREDICTED: serpin peptidase inhibitor, clade B like isoform 1 [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC786863PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC787285PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2702e-72O
Contig/Assembly ProteinLOC787348PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinLOC787126PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinLOC786983PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinMGC159547PREDICTED: serpin peptidase inhibitor, clade B like [Bos taurus]. 2696e-72O
Contig/Assembly ProteinSERPINB4serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 4 [Bos taurus]. 2696e-72O
Contig/Assembly ProteinMGC159547PREDICTED: serpin peptidase inhibitor, clade B like isoform 1 [Bos taurus]. 2696e-72O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINC1antithrombin-III [Sus scrofa]. 9190.0O
Contig/Assembly ProteinLOC100156623PREDICTED: serpin B11-like [Sus scrofa]. 2471e-65O
Contig/Assembly ProteinSERPINB8PREDICTED: serpin B8 [Sus scrofa]. 2363e-62O
Contig/Assembly ProteinSERPINB9serpin B9 [Sus scrofa]. 2263e-59O
Contig/Assembly ProteinSERPINB10PREDICTED: serpin B10 [Sus scrofa]. 2155e-56O
Contig/Assembly ProteinSERPINB7PREDICTED: serpin B7 isoform 2 [Sus scrofa]. 2118e-55O
Contig/Assembly ProteinSERPINB7PREDICTED: serpin B7 isoform 1 [Sus scrofa]. 2118e-55O
Contig/Assembly ProteinSERPINB2PREDICTED: plasminogen activator inhibitor 2 [Sus scrofa]. 2111e-54O
Contig/Assembly ProteinSERPINA3-2alpha-1-antichymotrypsin 2 [Sus scrofa]. 1924e-49O
Contig/Assembly ProteinSERPINI2PREDICTED: serpin I2 [Sus scrofa]. 1924e-49O


Assembly Members: 479      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010017E10KDN01_0017_E10.bFS672488 
LVR010001G07LVR01_0001_G07.bBP446763 
LVR010003A08LVR01_0003_A08.bBP441487 
LVR010003D06LVR01_0003_D06.b  
LVR010003E07LVR01_0003_E07.bBP445000 
LVR010003F11LVR01_0003_F11.bBP446160 
LVR010004F03LVR01_0004_F03.bBP445580 
LVR010005E03LVR01_0005_E03.bBP444723 
LVR010008B06LVR01_0008_B06.bBP442252 
LVR010011D06LVR01_0011_D06.bBP444059 
LVR010012C03LVR01_0012_C03.bBP442943 
LVR010012D01LVR01_0012_D01.bBP443682 
LVR010012E03LVR01_0012_E03.bBP444728 
LVR010015B05LVR01_0015_B05.bBP442180 
LVR010019A03LVR01_0019_A03.bBP441110 
LVR010020G06LVR01_0020_G06.bBP446707 AK232333
LVR010025A09LVR01_0025_A09.bBP441581 
LVR010025B07LVR01_0025_B07.bBP442339 
LVR010029G01LVR01_0029_G01.bBP446327 
LVR010030B03LVR01_0030_B03.bBP442035 
LVR010030D04LVR01_0030_D04.bBP443925 
LVR010031B09LVR01_0031_B09.bBP442499 
LVR010033B01LVR01_0033_B01.bBP441883 
LVR010033F10LVR01_0033_F10.bBP446108 
LVR010034H02LVR01_0034_H02.bBP447314 
LVR010042D11LVR01_0042_D11.bBP444444 
LVR010044H12LVR01_0044_H12.bBP448102 
LVR010045C10LVR01_0045_C10.bBP443486 
LVR010046B04LVR01_0046_B04.bBP442128 
LVR010046G03LVR01_0046_G03.bBP446498 
LVR010046H06LVR01_0046_H06.bBP447636 
LVR010047A08LVR01_0047_A08.bBP441523 
LVR010048G04LVR01_0048_G04.bBP446577 
LVR010048G05LVR01_0048_G05.bBP446654 
LVR010048H12LVR01_0048_H12.bBP448105 
LVR010049E03LVR01_0049_E03.bBP444755 
LVR010053D01LVR01_0053_D01.bBP443718 
LVR010054G12LVR01_0054_G12.bBP447175 
LVR010058B03LVR01_0058_B03.bBP442061 
LVR010058H06LVR01_0058_H06.bBP447648 
LVR010059F09LVR01_0059_F09.bBP446055 
LVR010061C10LVR01_0061_C10.bBP443500 
LVR010065D12LVR01_0065_D12.bBP444541 
LVR010068B07LVR01_0068_B07.bBP442377 
LVR010068C02LVR01_0068_C02.bBP442914 
LVR010068F10LVR01_0068_F10.bBP446139 
LVR010068G07LVR01_0068_G07.bBP446809 
LVR010068G09LVR01_0068_G09.bBP446956 
LVR010071E07LVR01_0071_E07.bBP445039 
LVR010072C12LVR01_0072_C12.bBP443654 
LVR010073E12LVR01_0073_E12.bBP445404 
LVR010073H01LVR01_0073_H01.bBP447268 
LVR010078B06LVR01_0078_B06.bBP442307 
LVR010084G02LVR01_0084_G02.bCJ000156 
LVR010086C07LVR01_0086_C07.bCJ000285 
LVR010089C06LVR01_0089_C06.bCJ000535 
LVR010089C10LVR01_0089_C10.bCJ000539 
LVR010093E09LVR01_0093_E09.bBW962769 
LVR010093E10LVR01_0093_E10.bBW962770 
LVR010094E02LVR01_0094_E02.bCJ000953 
LVR010098G02LVR01_0098_G02.bBP446454 
LVR010101B06LVR01_0101_B06.bBP442317 
LVR010101E10LVR01_0101_E10.bBP445265 
LVR010103G08LVR01_0103_G08.bBP446900 
LVR010104B03LVR01_0104_B03.bBP442089 
LVR010104F03LVR01_0104_F03.bBP445650 
LVR010104G10LVR01_0104_G10.bBP447052 
LVRM10001D04LVRM1_0001_D04.bBP139016 
LVRM10002E06LVRM1_0002_E06.bBP139549 
LVRM10003A07LVRM1_0003_A07.bCJ000998 
LVRM10003F09LVRM1_0003_F09.bCJ001050 
LVRM10004C08LVRM1_0004_C08.bCJ001097 
LVRM10004C10LVRM1_0004_C10.bCJ001099 
LVRM10005F10LVRM1_0005_F10.bBP140163 
LVRM10006E06LVRM1_0006_E06.bBP139551 
LVRM10007D08LVRM1_0007_D08.bBP139179 
LVRM10008E09LVRM1_0008_E09.bBP139660 
LVRM10008G12LVRM1_0008_G12.bBP140709 
LVRM10008H11LVRM1_0008_H11.bBP141160 
LVRM10009A03LVRM1_0009_A03.bBP137564 
LVRM10009B12LVRM1_0009_B12.bBP138405 
LVRM10009C07LVRM1_0009_C07.bBP138655 
LVRM10009H08LVRM1_0009_H08.bBP141038 
LVRM10010F10LVRM1_0010_F10.bBP140168 
LVRM10010H07LVRM1_0010_H07.bBP140998 
LVRM10010H08LVRM1_0010_H08.bBP141039 
LVRM10011C07LVRM1_0011_C07.bBP450113 
LVRM10012E04LVRM1_0012_E04.bBP451583 
LVRM10014B11LVRM1_0014_B11.bBP449604 
LVRM10014D02LVRM1_0014_D02.bBP450615 
LVRM10015E05LVRM1_0015_E05.bBP451650 
LVRM10015G01LVRM1_0015_G01.bBP452982 
LVRM10015G11LVRM1_0015_G11.bBP453676 
LVRM10015H12LVRM1_0015_H12.bBP454583 
LVRM10016D06LVRM1_0016_D06.bBP450898 
LVRM10017A01LVRM1_0017_A01.bBP448150 
LVRM10017B06LVRM1_0017_B06.bBP449262 
LVRM10017B08LVRM1_0017_B08.bBP449397 
LVRM10017C02LVRM1_0017_C02.bBP449781 
LVRM10017D10LVRM1_0017_D10.bBP451186 
LVRM10018G09LVRM1_0018_G09.bBP453534 
LVRM10018H02LVRM1_0018_H02.bBP453881 
LVRM10019A01LVRM1_0019_A01.bBP137502 
LVRM10019A11LVRM1_0019_A11.bBP137879 
LVRM10019B08LVRM1_0019_B08.bBP138237 
LVRM10020B07LVRM1_0020_B07.bBP138194 
LVRM10020C01LVRM1_0020_C01.bBP138443 
LVRM10020C05LVRM1_0020_C05.bBP138576 
LVRM10020F02LVRM1_0020_F02.bBP139851 
LVRM10021C08LVRM1_0021_C08.bCJ001151 
LVRM10021D06LVRM1_0021_D06.bCJ001160 
LVRM10022C03LVRM1_0022_C03.bBP138502 
LVRM10022E03LVRM1_0022_E03.bBP139448 
LVRM10022F10LVRM1_0022_F10.bBP140170 
LVRM10023B02LVRM1_0023_B02.bBP137997 
LVRM10024A06LVRM1_0024_A06.bBP137682 
LVRM10024D06LVRM1_0024_D06.bBP139108 
LVRM10025D11LVRM1_0025_D11.bBP139307 
LVRM10026C08LVRM1_0026_C08.bBP138703 
LVRM10026E04LVRM1_0026_E04.bBP139489 
LVRM10026F03LVRM1_0026_F03.bBP139898 
LVRM10027A09LVRM1_0027_A09.bBP137806 
LVRM10027E08LVRM1_0027_E08.bBP139633 
LVRM10028F02LVRM1_0028_F02.bBP139857 
LVRM10029E10LVRM1_0029_E10.bBP139711 
LVRM10030D05LVRM1_0030_D05.bBP139072 
LVRM10030F05LVRM1_0030_F05.bBP139981 
LVRM10031F11LVRM1_0031_F11.bBP140218 
LVRM10031H09LVRM1_0031_H09.bBP141089 
LVRM10032B03LVRM1_0032_B03.bBP138041 
LVRM10032H08LVRM1_0032_H08.bBP141049 
LVRM10033E08LVRM1_0033_E08.bCJ001256 
LVRM10033H08LVRM1_0033_H08.bCJ001288 
LVRM10034B08LVRM1_0034_B08.bCJ001310 
LVRM10034C05LVRM1_0034_C05.bBW962819 
LVRM10034E10LVRM1_0034_E10.bCJ001346 
LVRM10034G03LVRM1_0034_G03.bCJ001360 
LVRM10034H01LVRM1_0034_H01.bCJ001368 
LVRM10035D04LVRM1_0035_D04.bCJ001414 
LVRM10035D10LVRM1_0035_D10.bCJ001418 
LVRM10037D04LVRM1_0037_D04.bCJ001582 
LVRM10037H03LVRM1_0037_H03.bCJ001624 
LVRM10038A02LVRM1_0038_A02.bCJ001634 
LVRM10038G04LVRM1_0038_G04.bCJ001698 
LVRM10039C01LVRM1_0039_C01.bCJ001737 
LVRM10040B07LVRM1_0040_B07.bCJ001813 
LVRM10040G09LVRM1_0040_G09.bCJ001860 
LVRM10041H01LVRM1_0041_H01.bCJ001948 
LVRM10041H08LVRM1_0041_H08.bCJ001954 
LVRM10042D09LVRM1_0042_D09.bCJ001995 
LVRM10042G12LVRM1_0042_G12.bCJ002031 
LVRM10043A10LVRM1_0043_A10.bCJ002052 
LVRM10043C01LVRM1_0043_C01.bCJ002064 
LVRM10043D02LVRM1_0043_D02.bCJ002075 
LVRM10044F12LVRM1_0044_F12.bCJ002187 
LVRM10045G02LVRM1_0045_G02.bBW962902 
LVRM10047F04LVRM1_0047_F04.bCJ002314 
LVRM10047G05LVRM1_0047_G05.bCJ002326 
LVRM10047H06LVRM1_0047_H06.bCJ002334 
LVRM10048E12LVRM1_0048_E12.bCJ002384 
LVRM10048G11LVRM1_0048_G11.bCJ002403 
LVRM10048H04LVRM1_0048_H04.bCJ002407 
LVRM10049C07LVRM1_0049_C07.bBP450120 
LVRM10049E07LVRM1_0049_E07.bBP451793 
LVRM10049F05LVRM1_0049_F05.bBP452446 
LVRM10050C12LVRM1_0050_C12.bBP450481 
LVRM10050D10LVRM1_0050_D10.bBP451189 
LVRM10050E10LVRM1_0050_E10.bBP451987 
LVRM10051C01LVRM1_0051_C01.bBP449721 
LVRM10051E11LVRM1_0051_E11.bBP452055 
LVRM10052C09LVRM1_0052_C09.bBP450267 
LVRM10053A02LVRM1_0053_A02.bBP137542 
LVRM10053B01LVRM1_0053_B01.bBP137966 
LVRM10053G06LVRM1_0053_G06.bBP140479 
LVRM10054C03LVRM1_0054_C03.bBP138511 
LVRM10054H02LVRM1_0054_H02.bBP140806 
LVRM10055G05LVRM1_0055_G05.bBP140443 
LVRM10055H07LVRM1_0055_H07.bBP141013 
LVRM10056F05LVRM1_0056_F05.bBP139987 
LVRM10057A01LVRM1_0057_A01.bBP137517 
LVRM10057F12LVRM1_0057_F12.bBP140264 
LVRM10058G03LVRM1_0058_G03.bBP140372 
LVRM10061D01LVRM1_0061_D01.bBP138920 
LVRM10061F09LVRM1_0061_F09.bBP140144 
LVRM10062A05LVRM1_0062_A05.bBP137658 
LVRM10062A06LVRM1_0062_A06.bBP137695 
LVRM10065F05LVRM1_0065_F05.bBP139994 
LVRM10065G07LVRM1_0065_G07.bBP140530 
LVRM10067B08LVRM1_0067_B08.bBP138261 
LVRM10067D04LVRM1_0067_D04.b  
LVRM10067G07LVRM1_0067_G07.bBP140532 
LVRM10068B04LVRM1_0068_B04.bBP138095 
LVRM10068B11LVRM1_0068_B11.bBP138389 
LVRM10068F10LVRM1_0068_F10.bBP140192 
LVRM10068G08LVRM1_0068_G08.bBP140574 
LVRM10069G02LVRM1_0069_G02.bBP453055 
LVRM10070B03LVRM1_0070_B03.bBP449070 
LVRM10072C11LVRM1_0072_C11.bBP450416 
LVRM10072G04LVRM1_0072_G04.bBP453188 
LVRM10073E09LVRM1_0073_E09.bBP139688 AK394174
LVRM10074A04LVRM1_0074_A04.bBP137628 
LVRM10074B08LVRM1_0074_B08.bBP138264 
LVRM10075C09LVRM1_0075_C09.bBP138767 
LVRM10075D08LVRM1_0075_D08.bBP139204 
LVRM10076B08LVRM1_0076_B08.bBP138266 
LVRM10076C12LVRM1_0076_C12.bBP138894 
LVRM10076G11LVRM1_0076_G11.bBP140697 
LVRM10076H05LVRM1_0076_H05.bBP140941 
LVRM10077C11LVRM1_0077_C11.bBP138853 
LVRM10077F10LVRM1_0077_F10.bBP140196 
LVRM10077G07LVRM1_0077_G07.bBP140537 
LVRM10078C03LVRM1_0078_C03.bBP138522 
LVRM10078D01LVRM1_0078_D01.bBP138932 
LVRM10078D05LVRM1_0078_D05.bBP139092 
LVRM10079A05LVRM1_0079_A05.bBP137668 
LVRM10079A11LVRM1_0079_A11.bBP137908 
LVRM10079B03LVRM1_0079_B03.bBP138059 
LVRM10079H06LVRM1_0079_H06.bBP140988 
LVRM10080E09LVRM1_0080_E09.bBP139695 
LVRM10081C05LVRM1_0081_C05.bBW962937 
LVRM10081F10LVRM1_0081_F10.bCJ002479 
LVRM10081G02LVRM1_0081_G02.bCJ002482 
LVRM10082C09LVRM1_0082_C09.bCJ002531 
LVRM10082G07LVRM1_0082_G07.bCJ002573 
LVRM10083A01LVRM1_0083_A01.bCJ002590 
LVRM10083G10LVRM1_0083_G10.bCJ002662 
LVRM10084D11LVRM1_0084_D11.bCJ002717 
LVRM10084F11LVRM1_0084_F11.bCJ002738 
LVRM10086H02LVRM1_0086_H02.bCJ002913 
LVRM10087F06LVRM1_0087_F06.bCJ002982 
LVRM10087G05LVRM1_0087_G05.bCJ002992 
LVRM10088G12LVRM1_0088_G12.bCJ003083 
LVRM10088H02LVRM1_0088_H02.bCJ003085 
LVRM10090G11LVRM1_0090_G11.bBW962984 
LVRM10091D12LVRM1_0091_D12.bCJ003295 
LVRM10091E02LVRM1_0091_E02.bCJ003297 
LVRM10092F12LVRM1_0092_F12.bBW962994 
LVRM10093A09LVRM1_0093_A09.bCJ003429 
LVRM10093E07LVRM1_0093_E07.bBW963009 
LVRM10093F11LVRM1_0093_F11.bCJ003477 
LVRM10093H10LVRM1_0093_H10.bCJ003496 
LVRM10094B05LVRM1_0094_B05.bBW963020 
LVRM10094G08LVRM1_0094_G08.bCJ003561 
LVRM10094H08LVRM1_0094_H08.bCJ003572 
LVRM10095B11LVRM1_0095_B11.bCJ003594 
LVRM10095E09LVRM1_0095_E09.bCJ003622 
LVRM10096A07LVRM1_0096_A07.bBW963043 
LVRM10096H05LVRM1_0096_H05.bBW963061 
LVRM10097B02LVRM1_0097_B02.bCJ003737 
LVRM10097C01LVRM1_0097_C01.bCJ003748 
LVRM10097H03LVRM1_0097_H03.bCJ003805 
LVRM10098D09LVRM1_0098_D09.bCJ003850 
LVRM10099D08LVRM1_0099_D08.bCJ003929 
LVRM10099D12LVRM1_0099_D12.bCJ003933 
LVRM10100A01LVRM1_0100_A01.bCJ003976 
LVRM10100C12LVRM1_0100_C12.bCJ004010 
LVRM10101D08LVRM1_0101_D08.bBP139209 
LVRM10102B06LVRM1_0102_B06.bBP138184 
LVRM10102D02LVRM1_0102_D02.bBP138974 
LVRM10103C02LVRM1_0103_C02.bBP449790 
LVRM10104E07LVRM1_0104_E07.bBP451800 
LVRM10104F01LVRM1_0104_F01.bBP452190 
LVRM10104G04LVRM1_0104_G04.bBP453190 
LVRM10104G08LVRM1_0104_G08.bBP453470 
LVRM10105H06LVRM1_0105_H06.bBP454165 
LVRM10105H12LVRM1_0105_H12.bBP454594 
LVRM10106C01LVRM1_0106_C01.bBP449730 
LVRM10106E04LVRM1_0106_E04.bBP451598 
LVRM10106E07LVRM1_0106_E07.bBP451802 
LVRM10106G12LVRM1_0106_G12.bBP453760 
LVRM10108F07LVRM1_0108_F07.bBP452589 
LVRM10109E04LVRM1_0109_E04.bBP451601 
LVRM10109E11LVRM1_0109_E11.bBP452066 
LVRM10110A11LVRM1_0110_A11.bBP448819 
LVRM10110G09LVRM1_0110_G09.bBP453550 
LVRM10111F10LVRM1_0111_F10.bBP452804 
LVRM10111G02LVRM1_0111_G02.bBP453064 
LVRM10112A08LVRM1_0112_A08.bBP448608 
LVRM10113C11LVRM1_0113_C11.bBP450427 
LVRM10113D11LVRM1_0113_D11.bBP451277 
LVRM10114B09LVRM1_0114_B09.bBP449487 
LVRM10114G06LVRM1_0114_G06.bBP453335 
LVRM10115C11LVRM1_0115_C11.bBP450429 
LVRM10115G02LVRM1_0115_G02.bBP453067 
LVRM10116C06LVRM1_0116_C06.bBP450070 
LVRM10117G11LVRM1_0117_G11.bBP453702 
LVRM10120G02LVRM1_0120_G02.bBP453072 
LVRM10121A08LVRM1_0121_A08.bBP448617 
LVRM10121C03LVRM1_0121_C03.bBP449870 
LVRM10121E11LVRM1_0121_E11.bBP452078 
LVRM10121G10LVRM1_0121_G10.bBP453633 
LVRM10121H09LVRM1_0121_H09.bBP454397 
LVRM10122G10LVRM1_0122_G10.bBP453634 
LVRM10123D10LVRM1_0123_D10.bBP451216 
LVRM10124E03LVRM1_0124_E03.bBP451546 
LVRM10124H10LVRM1_0124_H10.bBP454471 
LVRM10125A05LVRM1_0125_A05.bBP448422 
LVRM10125C10LVRM1_0125_C10.bBP450366 
LVRM10126A06LVRM1_0126_A06.bBP448489 
LVRM10126A11LVRM1_0126_A11.bBP448832 
LVRM10126E10LVRM1_0126_E10.bBP452012 
LVRM10127A10LVRM1_0127_A10.bBP448765 
LVRM10127G12LVRM1_0127_G12.bBP453779 
LVRM10127H09LVRM1_0127_H09.bBP454403 
LVRM10128A03LVRM1_0128_A03.bBP448293 
LVRM10128B02LVRM1_0128_B02.bBP449030 
LVRM10128F07LVRM1_0128_F07.bBP452608 
LVRM10128G05LVRM1_0128_G05.bBP453279 
LVRM10128G08LVRM1_0128_G08.bBP453494 
LVRM10129C02LVRM1_0129_C02.bBP449813 
LVRM10130D06LVRM1_0130_D06.bBP450933 
LVRM10131C10LVRM1_0131_C10.bBP450372 
LVRM10131E02LVRM1_0131_E02.bBP451492 
LVRM10131E10LVRM1_0131_E10.bBP452017 
LVRM10132C10LVRM1_0132_C10.bBP450373 
LVRM10132D11LVRM1_0132_D11.bBP451296 
LVRM10134B01LVRM1_0134_B01.bBP448967 
LVRM10134F10LVRM1_0134_F10.bBP452825 
LVRM10134G01LVRM1_0134_G01.bBP453017 
LVRM10135A04LVRM1_0135_A04.bBP448364 
LVRM10135D02LVRM1_0135_D02.bBP450655 
LVRM10136A01LVRM1_0136_A01.bBP448178 
LVRM10136A06LVRM1_0136_A06.bBP448498 
LVRM10136H05LVRM1_0136_H05.bBP454122 
LVRM10137B03LVRM1_0137_B03.bBP449103 
LVRM10139B08LVRM1_0139_B08.bBP449441 
LVRM10139H11LVRM1_0139_H11.bBP454559 
LVRM10140B08LVRM1_0140_B08.bBP449442 
LVRM10140C06LVRM1_0140_C06.bBP450092 
LVRM10140D11LVRM1_0140_D11.bBP451304 
LVRM10141C06LVRM1_0141_C06.bBP450093 
LVRM10141C10LVRM1_0141_C10.bBP450382 
LVRM10141D02LVRM1_0141_D02.bBP450661 
LVRM10142B06LVRM1_0142_B06.bBP449306 
LVRM10142H11LVRM1_0142_H11.bBP454562 
LVRM10143A12LVRM1_0143_A12.bBP448915 
LVRM10143D02LVRM1_0143_D02.bBP450663 
LVRM10144A08LVRM1_0144_A08.bBP448640 
LVRM10144B03LVRM1_0144_B03.bBP449110 
LVRM10145A09LVRM1_0145_A09.bBP448709 
LVRM10145F02LVRM1_0145_F02.bBP452292 
LVRM10146G10LVRM1_0146_G10.bBP453657 
LVRM10147E07LVRM1_0147_E07.bBP451836 
LVRM10147E09LVRM1_0147_E09.bBP451965 
LVRM10148A02LVRM1_0148_A02.bBP448240 
LVRM10149B01LVRM1_0149_B01.bBP448981 
LVRM10149B02LVRM1_0149_B02.bBP449047 
LVRM10150F10LVRM1_0150_F10.bBP452841 
LVRM10150G10LVRM1_0150_G10.bBP453661 
LVRM10152D08LVRM1_0152_D08.bBP451099 
LVRM10152F04LVRM1_0152_F04.bBP452429 
LVRM10153D05LVRM1_0153_D05.bBP450883 
LVRM10153D08LVRM1_0153_D08.bBP451100 
LVRM10153H01LVRM1_0153_H01.bBP453867 
LVRM10154B11LVRM1_0154_B11.bBP449658 
LVRM10155D03LVRM1_0155_D03.bBP450740 
LVRM10155H04LVRM1_0155_H04.bBP454072 
LVRM10156B11LVRM1_0156_B11.bBP449660 
LVRM10156G08LVRM1_0156_G08.bBP453521 
LVRM10157C03LVRM1_0157_C03.bBP449906 
LVRM10158G09LVRM1_0158_G09.bBP453597 
LVRM10159B03LVRM1_0159_B03.bBP449124 
LVRM10159C10LVRM1_0159_C10.bBP450398 
LVRM10159G12LVRM1_0159_G12.bBP453809 
LVRM10160G01LVRM1_0160_G01.bBP453040 
LVRM10161F01LVRM1_0161_F01.bBP452236 
LVRM10162B09LVRM1_0162_B09.bBP449533 
LVRM10162F02LVRM1_0162_F02.bBP452308 
LVRM10162F05LVRM1_0162_F05.bBP452503 
LVRM10163E02LVRM1_0163_E02.bCJ004101 
LVRM10163G07LVRM1_0163_G07.bCJ004126 
LVRM10164B05LVRM1_0164_B05.bCJ004154 
LVRM10164G06LVRM1_0164_G06.bBW963097 
LVRM10164G11LVRM1_0164_G11.bCJ004212 
LVRM10165C01LVRM1_0165_C01.bCJ004245 
LVRM10165C08LVRM1_0165_C08.bCJ004252 
LVRM10165D01LVRM1_0165_D01.bCJ004257 
LVRM10165E04LVRM1_0165_E04.bCJ004271 
LVRM10165E05LVRM1_0165_E05.bCJ004272 
LVRM10165F03LVRM1_0165_F03.bCJ004282 
LVRM10165G08LVRM1_0165_G08.bCJ004297 
LVRM10166C06LVRM1_0166_C06.bCJ004324 
LVRM10166D06LVRM1_0166_D06.bCJ004334 
LVRM10166F11LVRM1_0166_F11.bCJ004360 
LVRM10167C02LVRM1_0167_C02.bCJ004398 
LVRM10168C03LVRM1_0168_C03.bCJ004477 
LVRM10168D10LVRM1_0168_D10.bCJ004494 
LVRM10168G05LVRM1_0168_G05.bCJ004519 
LVRM10168H02LVRM1_0168_H02.bCJ004527 
LVRM10170C01LVRM1_0170_C01.bCJ004637 
LVRM10170F06LVRM1_0170_F06.bCJ004673 
LVRM10170G09LVRM1_0170_G09.bCJ004686 
LVRM10171H01LVRM1_0171_H01.bCJ004764 
LVRM10172A05LVRM1_0172_A05.bCJ004780 
LVRM10172C03LVRM1_0172_C03.bCJ004797 
LVRM10172C05LVRM1_0172_C05.bBW963146 
LVRM10172D01LVRM1_0172_D01.bCJ004806 
LVRM10172H09LVRM1_0172_H09.b  
LVRM10173D01LVRM1_0173_D01.bCJ004887 
LVRM10173F04LVRM1_0173_F04.bCJ004911 
LVRM10174G12LVRM1_0174_G12.bBW963162 
LVRM10175C02LVRM1_0175_C02.bCJ005036 
LVRM10175C03LVRM1_0175_C03.bCJ005037 
LVRM10175D06LVRM1_0175_D06.bCJ005050 
LVRM10176B11LVRM1_0176_B11.bCJ005095 
LVRM10177A10LVRM1_0177_A10.bCJ005174 
LVRM10177C11LVRM1_0177_C11.bBW963173 
LVRM10177H11LVRM1_0177_H11.bCJ005232 
LVRM10179C09LVRM1_0179_C09.bCJ005350 
LVRM10179E06LVRM1_0179_E06.bCJ005371 
LVRM10179E08LVRM1_0179_E08.bCJ005373 
LVRM10179E12LVRM1_0179_E12.bCJ005377 
LVRM10180A02LVRM1_0180_A02.bCJ005414 
LVRM10180C03LVRM1_0180_C03.bCJ005437 
LVRM10181A12LVRM1_0181_A12.bCJ005508 
LVRM10181D12LVRM1_0181_D12.bCJ005537 
LVRM10181F05LVRM1_0181_F05.bCJ005552 
LVRM10181F11LVRM1_0181_F11.bCJ005558 
LVRM10181H01LVRM1_0181_H01.bCJ005570 
LVRM10182B10LVRM1_0182_B10.bCJ005599 
LVRM10182E09LVRM1_0182_E09.bCJ005631 
LVRM10183F06LVRM1_0183_F06.bBW963212 
LVRM10184A05LVRM1_0184_A05.bCJ005741 
LVRM10184F04LVRM1_0184_F04.bCJ005793 
LVRM10184H02LVRM1_0184_H02.bCJ005814 
LVRM10185D01LVRM1_0185_D01.bCJ005857 
LVRM10185D09LVRM1_0185_D09.bCJ005865 
LVRM10185G08LVRM1_0185_G08.b  
LVRM10185H06LVRM1_0185_H06.bCJ005906 
LVRM10186C06LVRM1_0186_C06.bCJ005938 
LVRM10186D12LVRM1_0186_D12.bCJ005956 
LVRM10186G04LVRM1_0186_G04.bCJ005982 
LVRM10187A01LVRM1_0187_A01.bCJ005999 
LVRM10187C10LVRM1_0187_C10.bCJ006031 
LVRM10188C02LVRM1_0188_C02.bCJ006106 
LVRM10188F01LVRM1_0188_F01.bCJ006136 
LVRM10192A09LVRM1_0192_A09.bBW963255 
LVRM10192B03LVRM1_0192_B03.bCJ006338 
LVRM10192E09LVRM1_0192_E09.bCJ006372 
LVRM10192H08LVRM1_0192_H08.bCJ006402 
LVRM10194C04LVRM1_0194_C04.bCJ006495 
LVRM10194C06LVRM1_0194_C06.bCJ006496 
LVRM10195C06LVRM1_0195_C06.bCJ006582 
LVRM10195G02LVRM1_0195_G02.bCJ006622 
LVRM10196E07LVRM1_0196_E07.bCJ006688 
LVRM10196F01LVRM1_0196_F01.bCJ006694 
LVRM10197A07LVRM1_0197_A07.bCJ006727 
LVRM10197G01LVRM1_0197_G01.bBW963301 
LVRM10198F08LVRM1_0198_F08.bCJ006874 
LVRM10198G02LVRM1_0198_G02.bCJ006879 
LVRM10198H05LVRM1_0198_H05.bCJ006894 
LVRM10199B01LVRM1_0199_B01.bCJ006912 
LVRM10199G10LVRM1_0199_G10.bCJ006972 
LVRM10200A02LVRM1_0200_A02.bCJ006985 
LVRM10200F08LVRM1_0200_F08.bCJ007033 
LVRM10201B02LVRM1_0201_B02.bCJ007066 
LVRM10201B03LVRM1_0201_B03.bCJ007067 
LVRM10201C01LVRM1_0201_C01.bCJ007077 
LVRM10201C12LVRM1_0201_C12.bCJ007088 
LVRM10201F01LVRM1_0201_F01.bCJ007111 
LVRM10201H08LVRM1_0201_H08.bCJ007141 
LVRM10202C04LVRM1_0202_C04.bCJ007170 
LVRM10203B05LVRM1_0203_B05.bCJ007242 
LVRM10203B09LVRM1_0203_B09.bCJ007245 
LVRM10204B08LVRM1_0204_B08.bCJ007329 
LVRM10204D09LVRM1_0204_D09.bCJ007348 
LVRM10205C11LVRM1_0205_C11.bCJ007423 
LVRM10205H05LVRM1_0205_H05.b  
LVRM10205H09LVRM1_0205_H09.bCJ007471 
LVRM10206B02LVRM1_0206_B02.bCJ007482 
LVRM10206C09LVRM1_0206_C09.bCJ007496 
LVRM10206F01LVRM1_0206_F01.bCJ007522 
LVRM10206F05LVRM1_0206_F05.bCJ007526 
LVRM10206F11LVRM1_0206_F11.bCJ007532 
LVRM10206G12LVRM1_0206_G12.bCJ007542 
LVRM10207D01LVRM1_0207_D01.bCJ007587 
LVRM10207H02LVRM1_0207_H02.bCJ007631 
LVRM10208A08LVRM1_0208_A08.bCJ007648 
LVRM10208F10LVRM1_0208_F10.bCJ007708 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
742A03210.849BSAAA/K
G5700.151AAG/K


Alignment:      TOP

20110601C-000773 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0020_G06.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_G11.b :
LVRM1_0028_F02.b :
LVRM1_0091_D12.b :
LVRM1_0073_E09.b :
LVRM1_0166_D06.b :
LVRM1_0015_G11.b :
LVRM1_0015_H12.b :
LVRM1_0148_A02.b :
LVRM1_0146_G10.b :
LVRM1_0113_C11.b :
LVRM1_0140_D11.b :
LVRM1_0098_D09.b :
LVR01_0093_E09.b :
LVRM1_0084_F11.b :
LVRM1_0003_A07.b :
LVRM1_0017_B06.b :
LVRM1_0110_A11.b :
LVRM1_0031_H09.b :
LVR01_0093_E10.b :
LVR01_0046_B04.b :
LVRM1_0181_F05.b :
LVRM1_0083_A01.b :
LVRM1_0087_F06.b :
LVR01_0047_A08.b :
LVRM1_0058_G03.b :
LVRM1_0093_E07.b :
LVRM1_0020_C05.b :
LVRM1_0136_A01.b :
LVRM1_0097_B02.b :
LVRM1_0171_H01.b :
LVRM1_0086_H02.b :
LVRM1_0091_E02.b :
LVRM1_0207_D01.b :
LVRM1_0136_H05.b :
LVRM1_0201_C12.b :
LVRM1_0165_C01.b :
LVRM1_0185_H06.b :
LVRM1_0097_H03.b :
LVRM1_0053_A02.b :
LVRM1_0025_D11.b :
LVRM1_0105_H06.b :
LVRM1_0162_F02.b :
LVRM1_0088_G12.b :
LVRM1_0149_B01.b :
LVRM1_0102_B06.b :
LVRM1_0201_H08.b :
LVRM1_0128_B02.b :
LVRM1_0181_D12.b :
LVRM1_0034_G03.b :
LVRM1_0155_H04.b :
LVRM1_0153_H01.b :
LVRM1_0140_C06.b :
LVRM1_0017_B08.b :
LVRM1_0128_G08.b :
LVRM1_0153_D05.b :
LVRM1_0153_D08.b :
LVRM1_0109_E11.b :
LVRM1_0079_H06.b :
LVRM1_0125_A05.b :
LVRM1_0126_E10.b :
LVRM1_0011_C07.b :
LVRM1_0134_B01.b :
LVRM1_0112_A08.b :
LVRM1_0077_G07.b :
LVRM1_0030_D05.b :
LVR01_0003_E07.b :
LVR01_0065_D12.b :
LVR01_0033_F10.b :
LVR01_0003_F11.b :
LVR01_0086_C07.b :
LVR01_0033_B01.b :
LVR01_0025_A09.b :
LVR01_0058_B03.b :
LVR01_0029_G01.b :
LVRM1_0203_B09.b :
LVRM1_0029_E10.b :
LVRM1_0032_H08.b :
LVRM1_0077_F10.b :
LVRM1_0048_G11.b :
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b :
LVRM1_0101_D08.b :
LVR01_0073_H01.b :
LVR01_0103_G08.b :
LVRM1_0168_H02.b :
LVRM1_0024_A06.b :
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b :
LVRM1_0094_H08.b :
LVRM1_0172_C03.b :
LVRM1_0175_C03.b :
LVRM1_0093_A09.b :
LVRM1_0163_G07.b :
LVRM1_0186_C06.b :
LVRM1_0206_G12.b :
LVRM1_0040_G09.b :
LVRM1_0204_D09.b :
LVRM1_0084_D11.b :
LVRM1_0147_E09.b :
LVRM1_0127_A10.b :
LVRM1_0139_H11.b :
LVR01_0101_E10.b :
LVR01_0049_E03.b :
LVR01_0089_C10.b :
LVR01_0098_G02.b :
LVR01_0012_D01.b :
LVR01_0068_B07.b :
LVR01_0068_G09.b :
LVR01_0094_E02.b :
LVRM1_0187_A01.b :
LVRM1_0129_C02.b :
LVRM1_0027_E08.b :
LVRM1_0038_G04.b :
LVRM1_0094_G08.b :
LVRM1_0069_G02.b :
LVRM1_0132_D11.b :
LVRM1_0065_G07.b :
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b :
LVRM1_0049_C07.b :
LVRM1_0016_D06.b :
LVR01_0004_F03.b :
LVR01_0073_E12.b :
LVRM1_0184_F04.b :
LVRM1_0198_G02.b :
LVRM1_0048_E12.b :
LVRM1_0031_F11.b :
LVR01_0044_H12.b :
LVRM1_0131_C10.b :
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b :
LVRM1_0068_B11.b :
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b :
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b :
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b :
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b :
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b :
LVR01_0061_C10.b :
LVR01_0072_C12.b :
LVR01_0012_E03.b :
LVR01_0003_A08.b :
LVRM1_0005_F10.b :
LVRM1_0131_E02.b :
LVRM1_0134_G01.b :
LVRM1_0068_B04.b :
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b :
LVRM1_0163_E02.b :
LVRM1_0068_F10.b :
LVRM1_0054_C03.b :
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b :
LVRM1_0072_G04.b :
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b :
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b :
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b :
LVRM1_0164_G06.b :
LVRM1_0009_A03.b :
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b :
LVRM1_0126_A06.b :
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b :
LVRM1_0068_G08.b :
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b :
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b :
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b :
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b :
LVRM1_0145_A09.b :
LVRM1_0007_D08.b :
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b :
LVRM1_0078_D01.b :
LVRM1_0008_G12.b :
LVRM1_0009_H08.b :
LVRM1_0051_E11.b :
LVRM1_0021_D06.b :
LVRM1_0008_H11.b :
LVRM1_0143_D02.b :
LVRM1_0108_F07.b :
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b :
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b :
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b :
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b :
LVR01_0030_D04.b :
LVR01_0071_E07.b :
LVR01_0054_G12.b :
LVR01_0048_G05.b :
LVR01_0101_B06.b :
LVR01_0011_D06.b :
LVR01_0089_C06.b :
LVR01_0053_D01.b :
LVR01_0030_B03.b :
LVR01_0046_H06.b :
LVRM1_0096_H05.b :
LVRM1_0024_D06.b :
LVRM1_0177_C11.b :
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b :
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b :
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b :
LVR01_0084_G02.b :
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b :
LVR01_0008_B06.b :
LVR01_0104_B03.b :
LVR01_0012_C03.b :
LVRM1_0067_D04.b :
LVR01_0015_B05.b :
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b :
LVR01_0048_H12.b :
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b :
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b :
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : ........................TTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAG
---------+---------+---------+---------+---------+---------+ 36
LVR01_0020_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAG
LVRM1_0090_G11.b :
LVRM1_0028_F02.b :
LVRM1_0091_D12.b :
LVRM1_0073_E09.b :
LVRM1_0166_D06.b :
LVRM1_0015_G11.b :
LVRM1_0015_H12.b :
LVRM1_0148_A02.b :
LVRM1_0146_G10.b :
LVRM1_0113_C11.b :
LVRM1_0140_D11.b :
LVRM1_0098_D09.b :
LVR01_0093_E09.b :
LVRM1_0084_F11.b :
LVRM1_0003_A07.b :
LVRM1_0017_B06.b :
LVRM1_0110_A11.b :
LVRM1_0031_H09.b :
LVR01_0093_E10.b :
LVR01_0046_B04.b :
LVRM1_0181_F05.b :
LVRM1_0083_A01.b :
LVRM1_0087_F06.b :
LVR01_0047_A08.b :
LVRM1_0058_G03.b :
LVRM1_0093_E07.b :
LVRM1_0020_C05.b :
LVRM1_0136_A01.b :
LVRM1_0097_B02.b :
LVRM1_0171_H01.b :
LVRM1_0086_H02.b :
LVRM1_0091_E02.b :
LVRM1_0207_D01.b :
LVRM1_0136_H05.b :
LVRM1_0201_C12.b :
LVRM1_0165_C01.b :
LVRM1_0185_H06.b :
LVRM1_0097_H03.b :
LVRM1_0053_A02.b :
LVRM1_0025_D11.b : ccgcgccggggggcccggcc
LVRM1_0105_H06.b :
LVRM1_0162_F02.b :
LVRM1_0088_G12.b :
LVRM1_0149_B01.b :
LVRM1_0102_B06.b :
LVRM1_0201_H08.b :
LVRM1_0128_B02.b :
LVRM1_0181_D12.b :
LVRM1_0034_G03.b :
LVRM1_0155_H04.b :
LVRM1_0153_H01.b :
LVRM1_0140_C06.b :
LVRM1_0017_B08.b :
LVRM1_0128_G08.b :
LVRM1_0153_D05.b :
LVRM1_0153_D08.b :
LVRM1_0109_E11.b :
LVRM1_0079_H06.b :
LVRM1_0125_A05.b :
LVRM1_0126_E10.b :
LVRM1_0011_C07.b :
LVRM1_0134_B01.b :
LVRM1_0112_A08.b :
LVRM1_0077_G07.b :
LVRM1_0030_D05.b :
LVR01_0003_E07.b :
LVR01_0065_D12.b :
LVR01_0033_F10.b :
LVR01_0003_F11.b :
LVR01_0086_C07.b :
LVR01_0033_B01.b :
LVR01_0025_A09.b :
LVR01_0058_B03.b :
LVR01_0029_G01.b :
LVRM1_0203_B09.b :
LVRM1_0029_E10.b :
LVRM1_0032_H08.b :
LVRM1_0077_F10.b :
LVRM1_0048_G11.b :
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b :
LVRM1_0101_D08.b :
LVR01_0073_H01.b :
LVR01_0103_G08.b :
LVRM1_0168_H02.b :
LVRM1_0024_A06.b :
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b :
LVRM1_0094_H08.b :
LVRM1_0172_C03.b :
LVRM1_0175_C03.b :
LVRM1_0093_A09.b :
LVRM1_0163_G07.b :
LVRM1_0186_C06.b :
LVRM1_0206_G12.b :
LVRM1_0040_G09.b :
LVRM1_0204_D09.b :
LVRM1_0084_D11.b :
LVRM1_0147_E09.b :
LVRM1_0127_A10.b :
LVRM1_0139_H11.b :
LVR01_0101_E10.b :
LVR01_0049_E03.b :
LVR01_0089_C10.b :
LVR01_0098_G02.b :
LVR01_0012_D01.b :
LVR01_0068_B07.b :
LVR01_0068_G09.b :
LVR01_0094_E02.b :
LVRM1_0187_A01.b :
LVRM1_0129_C02.b :
LVRM1_0027_E08.b : cgcaaccacaccgaaccgcaaaac
LVRM1_0038_G04.b :
LVRM1_0094_G08.b :
LVRM1_0069_G02.b :
LVRM1_0132_D11.b :
LVRM1_0065_G07.b :
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b :
LVRM1_0049_C07.b :
LVRM1_0016_D06.b :
LVR01_0004_F03.b :
LVR01_0073_E12.b :
LVRM1_0184_F04.b :
LVRM1_0198_G02.b :
LVRM1_0048_E12.b :
LVRM1_0031_F11.b :
LVR01_0044_H12.b :
LVRM1_0131_C10.b :
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b :
LVRM1_0068_B11.b :
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b :
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b :
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b :
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b :
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b :
LVR01_0061_C10.b :
LVR01_0072_C12.b :
LVR01_0012_E03.b :
LVR01_0003_A08.b :
LVRM1_0005_F10.b :
LVRM1_0131_E02.b :
LVRM1_0134_G01.b :
LVRM1_0068_B04.b :
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b :
LVRM1_0163_E02.b :
LVRM1_0068_F10.b :
LVRM1_0054_C03.b :
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b :
LVRM1_0072_G04.b :
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b :
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b :
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b :
LVRM1_0164_G06.b :
LVRM1_0009_A03.b :
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b :
LVRM1_0126_A06.b :
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b :
LVRM1_0068_G08.b :
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b :
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b :
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b :
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b :
LVRM1_0145_A09.b :
LVRM1_0007_D08.b :
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b :
LVRM1_0078_D01.b :
LVRM1_0008_G12.b :
LVRM1_0009_H08.b :
LVRM1_0051_E11.b :
LVRM1_0021_D06.b :
LVRM1_0008_H11.b :
LVRM1_0143_D02.b :
LVRM1_0108_F07.b :
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b :
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b :
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b :
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b :
LVR01_0030_D04.b :
LVR01_0071_E07.b :
LVR01_0054_G12.b :
LVR01_0048_G05.b :
LVR01_0101_B06.b :
LVR01_0011_D06.b :
LVR01_0089_C06.b :
LVR01_0053_D01.b :
LVR01_0030_B03.b :
LVR01_0046_H06.b :
LVRM1_0096_H05.b :
LVRM1_0024_D06.b : cacagcaacag
LVRM1_0177_C11.b : nttgtcxxxxxxxxxxx
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b :
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b :
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b :
LVR01_0084_G02.b :
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b :
LVR01_0008_B06.b :
LVR01_0104_B03.b :
LVR01_0012_C03.b :
LVRM1_0067_D04.b :
LVR01_0015_B05.b :
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b :
LVR01_0048_H12.b :
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b :
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b :
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : AACGCAGCTAGCTGCGAGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCG
---------+---------+---------+---------+---------+---------+ 96
LVR01_0020_G06.b : AACGCAGCTAGCTGCGAGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCG
LVRM1_0090_G11.b : gtcxxxxxxxxxxxxxxxxx
LVRM1_0028_F02.b : cgttgacxxxxxxxxxxxxxxxxx
LVRM1_0091_D12.b : gtcxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_E09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_D06.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G11.b : ttgtcxxxxxxxx
LVRM1_0015_H12.b : ttgtcxxxxxxxx
LVRM1_0148_A02.b : tcagttgtcxxxx
LVRM1_0146_G10.b : cagttgtcx
LVRM1_0113_C11.b : nagttgtc
LVRM1_0140_D11.b : nagttgtcxxxx
LVRM1_0098_D09.b : gagtttgtcxx
LVR01_0093_E09.b : tggggggaactxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_F11.b : cgttgtcx
LVRM1_0003_A07.b : nagtt
LVRM1_0017_B06.b : cgttgtcx
LVRM1_0110_A11.b : nagttgtcxxxxxxxxxxxxx
LVRM1_0031_H09.b : nagttgtcx
LVR01_0093_E10.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B04.b : tgtttttnaagcttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_F05.b : gtcxx
LVRM1_0083_A01.b : tttgtcxx
LVRM1_0087_F06.b :
LVR01_0047_A08.b : ggggactcnagatgcttggtgxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_G03.b : cagttgtcxxx
LVRM1_0093_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_C05.b : cgttgacxx
LVRM1_0136_A01.b : tcgttgtcxx
LVRM1_0097_B02.b : ncgttgtcxx
LVRM1_0171_H01.b : ttgtcxx
LVRM1_0086_H02.b : cagttgtcxx
LVRM1_0091_E02.b : txxx
LVRM1_0207_D01.b :
LVRM1_0136_H05.b : nagtttgtcxx
LVRM1_0201_C12.b :
LVRM1_0165_C01.b : ccttgtcxx
LVRM1_0185_H06.b :
LVRM1_0097_H03.b : gagttgtcxx
LVRM1_0053_A02.b : agttgtcxx
LVRM1_0025_D11.b : gcggcgccaaccgcccccccccggcccaccggcccccccccccccggccgccgattgtcx
LVRM1_0105_H06.b : naatgtcxx
LVRM1_0162_F02.b : nagttgtcxx
LVRM1_0088_G12.b :
LVRM1_0149_B01.b : nagttgtcxx
LVRM1_0102_B06.b : cagtgtcxx
LVRM1_0201_H08.b :
LVRM1_0128_B02.b : nagttgtcxxx
LVRM1_0181_D12.b : ttgtcx
LVRM1_0034_G03.b : nagttgtcxx
LVRM1_0155_H04.b : cagtgtcxx
LVRM1_0153_H01.b : tcagtgtcxxxxxxxxxxxxxxx
LVRM1_0140_C06.b : agttgtcxx
LVRM1_0017_B08.b : ccgttgtcxx
LVRM1_0128_G08.b : nagttgtcxx
LVRM1_0153_D05.b : agttgtcxx
LVRM1_0153_D08.b : agttgtcxx
LVRM1_0109_E11.b : cagttgtcxxxx
LVRM1_0079_H06.b : gttgacxx
LVRM1_0125_A05.b : tagttgtacxxx
LVRM1_0126_E10.b : nagttgtcxx
LVRM1_0011_C07.b : cgttgtcxx
LVRM1_0134_B01.b : cagttgtcxx
LVRM1_0112_A08.b : nagtttgtcxxx
LVRM1_0077_G07.b : agttgacat
LVRM1_0030_D05.b : agttgtcxx
LVR01_0003_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D12.b : tgttctagctttcgtgxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F10.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_F11.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_C07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_B01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_A09.b : agtttxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_B03.b : gcatttgcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_B09.b :
LVRM1_0029_E10.b : cgttgtcxxx
LVRM1_0032_H08.b : nagttgtc
LVRM1_0077_F10.b : agt
LVRM1_0048_G11.b : t
LVRM1_0185_D01.b :
LVRM1_0201_B02.b :
LVRM1_0172_D01.b : cgtt
LVRM1_0101_D08.b : nagtt
LVR01_0073_H01.b : gggctaxxxxxxxxxxxxxxxxxxxx
LVR01_0103_G08.b : gtgtttcaagcataggtgxxxxxxxxxxxxxxxx
LVRM1_0168_H02.b :
LVRM1_0024_A06.b : cgttg
LVRM1_0176_B11.b :
LVRM1_0045_G02.b :
LVRM1_0173_D01.b :
LVRM1_0207_H02.b :
LVRM1_0202_C04.b :
LVRM1_0184_H02.b : ttg
LVRM1_0094_H08.b :
LVRM1_0172_C03.b : caattg
LVRM1_0175_C03.b : aattg
LVRM1_0093_A09.b :
LVRM1_0163_G07.b : ttg
LVRM1_0186_C06.b : cgttg
LVRM1_0206_G12.b :
LVRM1_0040_G09.b : gagttgt
LVRM1_0204_D09.b :
LVRM1_0084_D11.b : agttg
LVRM1_0147_E09.b : nagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0127_A10.b : tagttg
LVRM1_0139_H11.b : tcagttg
LVR01_0101_E10.b : ctttttgctgxxxxxxxxxxxxxxxxxxx
LVR01_0049_E03.b : gggggttttttttagcttagtgxxxxxxxxxxxxxxxxx
LVR01_0089_C10.b : gcatttggtgaaxxxxxxxxxxxxxxxxxx
LVR01_0098_G02.b : ggccxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_D01.b : tgtttgcggctttxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B07.b : ggcatttgggntgxxxxxxxxxxxxxxxxxxx
LVR01_0068_G09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_A01.b : gtt
LVRM1_0129_C02.b : ccgttg
LVRM1_0027_E08.b : gcaccacgcacgcggcgcagccccccgcccggcggccctcgccgcggcccgcagttgtcx
LVRM1_0038_G04.b : ncgttgtc
LVRM1_0094_G08.b :
LVRM1_0069_G02.b : nagtt
LVRM1_0132_D11.b : tcgttt
LVRM1_0065_G07.b : cxxxxxxxxxxx
LVRM1_0170_F06.b :
LVRM1_0179_E08.b :
LVRM1_0020_B07.b : agt
LVRM1_0049_C07.b : tagttg
LVRM1_0016_D06.b : t
LVR01_0004_F03.b : ttttggtggactatanngacxxxxxx
LVR01_0073_E12.b : ttttggtgttatttagcttagtgxxxxxxxxxxxxxxxxx
LVRM1_0184_F04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_G02.b :
LVRM1_0048_E12.b : c
LVRM1_0031_F11.b : a
LVR01_0044_H12.b : gggcaxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_C10.b : n
LVRM1_0017_A01.b :
LVRM1_0104_G04.b :
LVRM1_0096_A07.b :
LVRM1_0164_G11.b :
LVRM1_0082_C09.b :
LVRM1_0205_H09.b :
LVRM1_0111_F10.b : nagttg
LVRM1_0068_B11.b : xxx
LVRM1_0018_G09.b :
LVRM1_0050_D10.b :
LVR01_0068_F10.b : tttttttgtttttnccgtttagtgxxxxxxxxxxx
LVRM1_0165_E05.b :
LVRM1_0010_H07.b :
LVRM1_0020_C01.b :
LVRM1_0010_F10.b : cxx
LVRM1_0076_H05.b :
LVRM1_0181_H01.b :
LVRM1_0104_E07.b :
LVRM1_0094_B05.b :
LVRM1_0043_C01.b :
LVRM1_0195_G02.b :
LVRM1_0181_A12.b :
LVRM1_0194_C06.b :
LVRM1_0198_H05.b :
LVRM1_0185_D09.b :
LVRM1_0075_D08.b :
LVRM1_0165_F03.b :
LVRM1_0192_B03.b :
LVRM1_0097_C01.b :
LVRM1_0106_E04.b :
LVRM1_0175_D06.b :
LVRM1_0188_F01.b :
LVRM1_0111_G02.b :
LVRM1_0103_C02.b :
LVRM1_0095_E09.b :
LVRM1_0179_E12.b :
LVRM1_0034_H01.b :
LVRM1_0177_A10.b :
LVRM1_0155_D03.b :
LVRM1_0014_D02.b :
LVRM1_0206_C09.b :
LVRM1_0206_F11.b :
LVRM1_0032_B03.b :
LVRM1_0004_C08.b :
LVRM1_0102_D02.b :
LVRM1_0099_D12.b :
LVRM1_0012_E04.b :
LVRM1_0049_F05.b : n
LVRM1_0035_D10.b :
LVRM1_0141_D02.b :
LVRM1_0021_C08.b :
LVRM1_0126_A11.b :
LVRM1_0080_E09.b :
LVRM1_0157_C03.b : c
LVRM1_0077_C11.b :
LVRM1_0122_G10.b :
LVRM1_0019_A11.b :
LVRM1_0162_B09.b :
LVRM1_0121_A08.b :
LVR01_0003_D06.b : ttatggggaacatatataaaaaatt
LVR01_0061_C10.b : tgggcttagcttcxxxxxxxxxxxxxx
LVR01_0072_C12.b : tttttttttttttatagcttxxxxxxxxxxxxxxxx
LVR01_0012_E03.b : ggttttagcataxxxxxxxxxxxxxx
LVR01_0003_A08.b : gttaaccggggaactattagacagt
LVRM1_0005_F10.b : cxxx
LVRM1_0131_E02.b :
LVRM1_0134_G01.b : cc
LVRM1_0068_B04.b : xxx
LVRM1_0197_G01.b :
LVRM1_0168_D10.b :
LVRM1_0062_A06.b : cxxx
LVRM1_0163_E02.b :
LVRM1_0068_F10.b : xx
LVRM1_0054_C03.b : n
LVRM1_0192_A09.b :
LVRM1_0055_H07.b :
LVRM1_0174_G12.b :
LVRM1_0135_A04.b : n
LVRM1_0072_G04.b : ta
LVRM1_0165_E04.b :
LVRM1_0053_G06.b :
LVRM1_0183_F06.b :
LVRM1_0173_F04.b :
LVRM1_0042_D09.b :
LVRM1_0076_C12.b :
LVRM1_0070_B03.b :
LVRM1_0180_C03.b :
LVRM1_0168_C03.b :
LVRM1_0201_C01.b :
LVRM1_0186_G04.b :
LVRM1_0170_C01.b :
LVRM1_0038_A02.b :
LVRM1_0204_B08.b :
LVRM1_0026_E04.b : agttgacxx
LVRM1_0015_G01.b :
LVRM1_0041_H01.b :
LVRM1_0128_A03.b :
LVRM1_0088_H02.b :
LVRM1_0197_A07.b :
LVRM1_0136_A06.b :
LVRM1_0062_A05.b : cxxx
LVRM1_0164_B05.b :
LVRM1_0208_A08.b :
LVRM1_0167_C02.b :
LVRM1_0206_F05.b :
LVRM1_0175_C02.b :
LVRM1_0184_A05.b :
LVRM1_0106_C01.b :
LVRM1_0145_F02.b : n
LVRM1_0164_G06.b :
LVRM1_0009_A03.b : cxx
LVRM1_0051_C01.b :
LVRM1_0115_G02.b :
LVRM1_0182_B10.b :
LVRM1_0041_H08.b :
LVRM1_0104_F01.b :
LVRM1_0100_C12.b :
LVRM1_0106_E07.b :
LVRM1_0116_C06.b :
LVRM1_0114_G06.b : t
LVRM1_0126_A06.b : t
LVRM1_0083_G10.b :
LVRM1_0165_G08.b :
LVRM1_0093_F11.b :
LVRM1_0187_C10.b :
LVRM1_0065_F05.b : xx
LVRM1_0068_G08.b : cx
LVRM1_0095_B11.b :
LVRM1_0198_F08.b :
LVRM1_0061_F09.b : cx
LVRM1_0192_H08.b :
LVRM1_0192_E09.b :
LVRM1_0047_H06.b :
LVRM1_0079_B03.b :
LVRM1_0056_F05.b : ttt
LVRM1_0034_B08.b :
LVRM1_0043_A10.b :
LVRM1_0166_F11.b :
LVRM1_0160_G01.b :
LVRM1_0042_G12.b :
LVRM1_0149_B02.b :
LVRM1_0015_E05.b :
LVRM1_0050_C12.b :
LVRM1_0033_E08.b :
LVRM1_0162_F05.b : na
LVRM1_0018_H02.b :
LVRM1_0078_C03.b :
LVRM1_0017_C02.b :
LVRM1_0177_H11.b :
LVRM1_0009_C07.b : xxx
LVRM1_0145_A09.b :
LVRM1_0007_D08.b : x
LVRM1_0144_B03.b :
LVRM1_0152_F04.b :
LVRM1_0127_H09.b : n
LVRM1_0078_D01.b :
LVRM1_0008_G12.b : xx
LVRM1_0009_H08.b : xx
LVRM1_0051_E11.b : n
LVRM1_0021_D06.b :
LVRM1_0008_H11.b : c
LVRM1_0143_D02.b :
LVRM1_0108_F07.b : na
LVRM1_0127_G12.b :
LVRM1_0123_D10.b :
LVRM1_0106_G12.b :
LVRM1_0130_D06.b : n
LVRM1_0022_C03.b :
LVRM1_0078_D05.b :
LVRM1_0120_G02.b : n
LVRM1_0033_H08.b :
LVRM1_0156_B11.b :
LVRM1_0019_A01.b :
LVRM1_0014_B11.b :
LVRM1_0154_B11.b :
LVRM1_0139_B08.b :
LVRM1_0159_G12.b : n
LVRM1_0019_B08.b :
LVRM1_0150_G10.b :
LVRM1_0017_D10.b :
LVRM1_0147_E07.b :
LVRM1_0006_E06.b : atxx
LVR01_0030_D04.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E07.b : gctxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G12.b : ggcatttagtgxxxxxxxxxxxxx
LVR01_0048_G05.b : gggtgtctttcctgcttagtgxxxxxxxxxxxx
LVR01_0101_B06.b : ccaxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D06.b : gggtggggctttxxxxxxxxxxxxxxxxx
LVR01_0089_C06.b : gcatcxxxxxxxxxxxxxxxxxxxx
LVR01_0053_D01.b : ggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B03.b : atatggtgxxxxxxxxxxxxxx
LVR01_0046_H06.b : gctxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_H05.b :
LVRM1_0024_D06.b : gagggagacgcacggacaacaaacagcgccacgaaccgcacgcagagaagacggcaccgg
LVRM1_0177_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_D02.b :
LVRM1_0037_D04.b :
LVRM1_0037_H03.b :
LVRM1_0185_G08.b :
LVRM1_0034_C05.b : n
LVRM1_0166_C06.b :
LVRM1_0200_A02.b :
LVRM1_0121_G10.b :
LVRM1_0199_B01.b : ncgttg
LVRM1_0026_C08.b :
LVRM1_0022_F10.b :
LVRM1_0061_D01.b :
LVRM1_0121_C03.b :
LVRM1_0010_H08.b :
LVRM1_0020_F02.b :
LVRM1_0026_F03.b :
LVRM1_0179_E06.b :
LVRM1_0203_B05.b :
LVRM1_0093_H10.b :
LVRM1_0099_D08.b :
LVRM1_0072_C11.b :
LVRM1_0152_D08.b :
LVRM1_0156_G08.b :
LVRM1_0158_G09.b :
LVRM1_0124_E03.b :
LVRM1_0001_D04.b :
LVR01_0104_G10.b : ggtgggtaaggctagtgacgtata
LVR01_0084_G02.b : gggcxxxxxxxxxxxxxx
LVRM1_0141_C06.b :
KDN01_0017_E10.b :
LVRM1_0131_E10.b :
LVRM1_0182_E09.b :
LVRM1_0039_C01.b :
LVRM1_0181_F11.b :
LVRM1_0143_A12.b :
LVRM1_0110_G09.b :
LVRM1_0040_B07.b :
LVRM1_0050_E10.b :
LVRM1_0121_E11.b :
LVRM1_0076_B08.b :
LVRM1_0027_A09.b :
LVRM1_0043_D02.b :
LVRM1_0172_A05.b :
LVRM1_0165_C08.b :
LVRM1_0054_H02.b :
LVRM1_0076_G11.b :
LVRM1_0057_A01.b :
LVRM1_0100_A01.b :
LVRM1_0206_F01.b :
LVRM1_0196_F01.b :
LVRM1_0196_E07.b :
LVRM1_0201_F01.b :
LVRM1_0053_B01.b :
LVRM1_0195_C06.b :
LVRM1_0201_B03.b :
LVRM1_0022_E03.b :
LVRM1_0113_D11.b :
LVRM1_0075_C09.b :
LVRM1_0092_F12.b :
LVRM1_0105_H12.b :
LVRM1_0186_D12.b :
LVRM1_0117_G11.b :
LVRM1_0125_C10.b :
LVRM1_0003_F09.b :
LVRM1_0128_G05.b :
LVRM1_0034_E10.b :
LVRM1_0030_F05.b :
LVRM1_0140_B08.b :
LVRM1_0141_C10.b :
LVR01_0042_D11.b : ccttttggtgga
LVR01_0008_B06.b : gagcaaatgtg
LVR01_0104_B03.b : ggtgtccccagctttgtg
LVR01_0012_C03.b : gagaaaaggcataxx
LVRM1_0067_D04.b :
LVR01_0015_B05.b : ctxxxxx
LVRM1_0047_F04.b :
LVRM1_0081_F10.b :
LVRM1_0002_E06.b :
LVR01_0059_F09.b : gctttt
LVR01_0048_H12.b : cgctttt
LVRM1_0205_H05.b :
LVRM1_0208_F10.b :
LVRM1_0081_C05.b :
LVRM1_0134_F10.b :
LVRM1_0159_B03.b :
LVRM1_0055_G05.b :
LVRM1_0188_C02.b :
LVRM1_0048_H04.b :
LVRM1_0074_A04.b :
LVRM1_0081_G02.b :
LVRM1_0168_G05.b :
LVRM1_0170_G09.b :
LVRM1_0067_B08.b :
LVRM1_0165_D01.b :
LVRM1_0047_G05.b :
LVRM1_0121_H09.b :
LVR01_0104_F03.b : gctcct
LVR01_0068_C02.b :
LVRM1_0200_F08.b :
LVRM1_0180_A02.b :
LVRM1_0087_G05.b :
LVRM1_0132_C10.b :
LVRM1_0057_F12.b :
LVRM1_0206_B02.b :
LVRM1_0172_C05.b : cx
LVRM1_0067_G07.b :
LVRM1_0035_D04.b :
LVRM1_0109_E04.b :
LVRM1_0124_H10.b :
LVRM1_0079_A05.b :
LVRM1_0008_E09.b :
LVRM1_0161_F01.b :
LVRM1_0159_C10.b :
LVRM1_0009_B12.b :
LVRM1_0142_B06.b :
LVRM1_0052_C09.b :
LVRM1_0150_F10.b :
LVRM1_0142_H11.b :
LVRM1_0049_E07.b :
LVR01_0001_G07.b :
LVR01_0031_B09.b :
LVR01_0048_G04.b :
LVR01_0058_H06.b :
LVR01_0078_B06.b :
LVR01_0046_G03.b :
LVR01_0068_G07.b :
LVRM1_0104_G08.b :
LVR01_0025_B07.b :
LVR01_0005_E03.b :
LVRM1_0205_C11.b :
LVRM1_0082_G07.b :
LVRM1_0179_C09.b :
LVRM1_0114_B09.b :
LVRM1_0004_C10.b :
LVRM1_0194_C04.b :
LVR01_0019_A03.b :
LVR01_0045_C10.b :
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : AACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTCTGGAACCTCAGTCAGATTT
---------+---------+---------+---------+---------+---------+ 156
LVR01_0020_G06.b : AACGCACTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGT*****CTGAGCGTCGCTT
LVRM1_0090_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0028_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0091_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgaGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0073_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgaGCCTCTGGAACCTCAGTCAGATTT
LVRM1_0166_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxcgagtttgttggcctaCTGGAACCTCAGTCAGATTT
LVRM1_0015_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCAGTCAGATTT
LVRM1_0015_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTCAGTCAGATTT
LVRM1_0148_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0146_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGAGTCAGATTT
LVRM1_0113_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0140_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGTCAGATTT
LVRM1_0098_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0093_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0084_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0003_A07.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0017_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVRM1_0110_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcctactggAGTCAGATTT
LVRM1_0031_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0093_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCAGATTT
LVR01_0046_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactggaAGTCAGATTT
LVRM1_0181_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0087_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0047_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0058_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0093_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtccGTCAAATTT
LVRM1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0136_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0097_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0171_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0086_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0091_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0207_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0136_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0201_C12.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0165_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0185_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0097_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0053_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0025_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0105_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0162_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0088_G12.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0149_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0102_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0201_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0128_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0181_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0034_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0155_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0140_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0017_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0128_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0153_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0109_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0079_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0125_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0126_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0011_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0134_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0112_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0077_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVRM1_0030_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0003_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0065_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0033_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0003_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0033_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0025_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0058_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAGATTT
LVR01_0029_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGATTT
LVRM1_0203_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtggCAGATTT
LVRM1_0029_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcCAGATTT
LVRM1_0032_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTT
LVRM1_0077_F10.b : tgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGATTT
LVRM1_0048_G11.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0185_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggAGATTT
LVRM1_0201_B02.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0172_D01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVRM1_0101_D08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVR01_0073_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATTT
LVR01_0103_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggAGATTT
LVRM1_0168_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0024_A06.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0176_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0045_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0173_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0207_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0202_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0184_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0094_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0172_C03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0175_C03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0163_G07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0186_C06.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0206_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0040_G09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcGATTT
LVRM1_0204_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0084_D11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0147_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0127_A10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0139_H11.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0101_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0049_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0089_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0098_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0012_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0068_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0068_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVR01_0094_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATTT
LVRM1_0187_A01.b : tgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG
LVRM1_0129_C02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcATTT
LVRM1_0027_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtcacATTT
LVRM1_0038_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtccATTT
LVRM1_0094_G08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGG
LVRM1_0069_G02.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggtaCTGG
LVRM1_0132_D11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0065_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggttTTT
LVRM1_0170_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0179_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVRM1_0020_B07.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTT
LVRM1_0049_C07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTTT
LVRM1_0016_D06.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVR01_0004_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVR01_0073_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTT
LVRM1_0184_F04.b : xxxxxxxxxxxxxxxxxxxxtccttcccccacctgagcctctggaacctcagtcagatTT
LVRM1_0198_G02.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0048_E12.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0031_F11.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
LVR01_0044_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
LVRM1_0131_C10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0017_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0104_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0096_A07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtG
LVRM1_0164_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0082_C09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0205_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0111_F10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatcT
LVRM1_0068_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0018_G09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0050_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0068_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0165_E05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_H07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_C01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_H05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_E07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_G02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_D08.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_F03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_B03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E04.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_G02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_C02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E12.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_A10.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_D03.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_C08.b : ccttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_F05.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_C08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_E09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C03.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C11.b : agttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_G10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_A08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D06.b : tgtgcaaaaaacacagcgggtatcggtccggagttcttctagcactgttgtgcctcctgg
LVR01_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_E02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_G01.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVRM1_0068_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_D10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_C03.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_A09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_G12.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_A04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_G04.b : gttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_F06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_D09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_C12.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_H01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_A06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_A08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_A05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_C01.b : tcatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_F02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_G02.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_B10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_H08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_F01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E07.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_C06.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A06.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_G10.b : ccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_G08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_B11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_H08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_E09.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_H06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_B03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_F05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_B08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_A10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_F11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_G01.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_E05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_E08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_F05.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_H02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_H11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_H09.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_D06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_H11.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_F07.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_G12.b : ncctgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_D06.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D05.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G02.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_H08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_B11.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_B11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_G12.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_B08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_D10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_H05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_D06.b : acattgtcacacagcagctgggtacggtcctcxxxxxxxxxxxxxxxxxxxxxxxxxxxg
LVRM1_0177_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactgg
LVRM1_0135_D02.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_G08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_C05.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVRM1_0166_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_A02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_B01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcc
LVRM1_0026_C08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_F10.b : agttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_C03.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_H08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_F02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_F03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D08.b : agttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_G08.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_E03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_D04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G10.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0017_E10.b : tttttttcctacggtggc
LVRM1_0131_E10.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_B07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_B08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A09.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_A05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_H02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_G11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_C06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_E03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_D11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_C09.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_H12.b : caatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_G11.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_C10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_D11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_F04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_F09.b : ggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_H12.b : ggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_F10.b : xxxxxxxxx
LVRM1_0081_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_B03.b : ccgncaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_C02.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_H04.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_A04.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_G02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_G05.b : xxxxxxxxxxxxxxxxxxx
LVRM1_0170_G09.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_B08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_G05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_H09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F03.b : ccatgcatagtgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_C02.b : ggcattagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_F08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_A02.b : ttgtcxxxxxxxxxxxxxx
LVRM1_0087_G05.b : xxxxxxxxxxxx
LVRM1_0132_C10.b : ccgttgtcxxxxxxxxxxxxxxxxx
LVRM1_0057_F12.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0206_B02.b : xxxxxxxxx
LVRM1_0172_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_D04.b : gagttgtcxxxxxxxxxxxxxxxx
LVRM1_0109_E04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_H10.b : nagtttgtcxxxxxxxxxxxxxxxxx
LVRM1_0079_A05.b : cgttgaataaagxxxxxxxx
LVRM1_0008_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_F01.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0159_C10.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0009_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_B06.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0052_C09.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0150_F10.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0142_H11.b : caattgtcxxxxxxxxxxxxxxxx
LVRM1_0049_E07.b : nagttgtcxxxxxxxxxxxxxxxxx
LVR01_0001_G07.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_B09.b : catttagatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G04.b : gggttttttttcggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_H06.b : ggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B06.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_G03.b : cctataggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_G07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_G08.b : nagttgtcxxxxxxxx
LVR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_E03.b : gggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_C11.b :
LVRM1_0082_G07.b : ttgtcxxxxxxxxx
LVRM1_0179_C09.b : agttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_B09.b : caattgtcxxxxxxxxxx
LVRM1_0004_C10.b : cgtttgtxxxxxxxxx
LVRM1_0194_C04.b :
LVR01_0019_A03.b : gcatataxxxxxxxxxxxxxxxxx
LVR01_0045_C10.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A08.b :
LVRM1_0137_B03.b :
LVRM1_0172_H09.b :
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
---------+---------+---------+---------+---------+---------+ 212
LVR01_0020_G06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0090_G11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0028_F02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0091_D12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0073_E09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0166_D06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0015_G11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0015_H12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0148_A02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0146_G10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0113_C11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0140_D11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0098_D09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0093_E09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0084_F11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0003_A07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0017_B06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0110_A11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0031_H09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0093_E10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0046_B04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0181_F05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0083_A01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0087_F06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0047_A08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCGGACCACACTATCTCCACTCGCCC
LVRM1_0058_G03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0093_E07.b : AGATGAAAGAACCAG*TTCAAAGGGATTGC***CTCAAACCACACTATCTCCACTCGCCC
LVRM1_0020_C05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0136_A01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0097_B02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0171_H01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0086_H02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0091_E02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0207_D01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0136_H05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_C12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_C01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0185_H06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0097_H03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0053_A02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0025_D11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0105_H06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0162_F02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0088_G12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0149_B01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0102_B06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_H08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0128_B02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0181_D12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACTCTATCTCCACTCGCCC
LVRM1_0034_G03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0155_H04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0153_H01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACTACACTATCTCCACTCGCCC
LVRM1_0140_C06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0017_B08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0128_G08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0153_D05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0153_D08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0109_E11.b : AGATAAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0079_H06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0125_A05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0126_E10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0011_C07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0134_B01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0112_A08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0077_G07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0030_D05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0003_E07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0065_D12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0033_F10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0003_F11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0086_C07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0033_B01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0025_A09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0058_B03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0029_G01.b : AGATGAGAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0203_B09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0029_E10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0032_H08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0077_F10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0048_G11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0185_D01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_B02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0172_D01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0101_D08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0073_H01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0103_G08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0168_H02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0024_A06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0176_B11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0045_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0173_D01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0207_H02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0202_C04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0184_H02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0094_H08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0172_C03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0175_C03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0093_A09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0163_G07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0186_C06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0206_G12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0040_G09.b : AGATGAAAGAACCAG*TTCAGAGGGATCGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0204_D09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0084_D11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0147_E09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0127_A10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0139_H11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0101_E10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0049_E03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0089_C10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0098_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0012_D01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0068_B07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0068_G09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0094_E02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0187_A01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0129_C02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0027_E08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0038_G04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0094_G08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0069_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0132_D11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0065_G07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0170_F06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0179_E08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0020_B07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0049_C07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0016_D06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0004_F03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0073_E12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0184_F04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0198_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0048_E12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0031_F11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0044_H12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCATACCACACTATCTCCACTCGCCC
LVRM1_0131_C10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0017_A01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0104_G04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0096_A07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0164_G11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0082_C09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0205_H09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0111_F10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0068_B11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0018_G09.b : AGATGAAAGAACCAG*TCCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0050_D10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0068_F10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_E05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0010_H07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0020_C01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0010_F10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0076_H05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0181_H01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0104_E07.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0094_B05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0043_C01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0195_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0181_A12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0194_C06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0198_H05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0185_D09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0075_D08.b : AGATGAAAGAACCAG*CTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_F03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0192_B03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0097_C01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0106_E04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0175_D06.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0188_F01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0111_G02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0103_C02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0095_E09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0179_E12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0034_H01.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0177_A10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0155_D03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0014_D02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0206_C09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0206_F11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0032_B03.b : AGATCAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0004_C08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0102_D02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0099_D12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0012_E04.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0049_F05.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0035_D10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0141_D02.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0021_C08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0126_A11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0080_E09.b : AGATGAAAGAACCAG*TCCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0157_C03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0077_C11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0122_G10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0019_A11.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0162_B09.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_A08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0003_D06.b : AGATGAAAGAACCCG*GTGAGAGGGATTGC***CTCAGACCGCACTATCTCCACTCGCCC
LVR01_0061_C10.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0072_C12.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0012_E03.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0003_A08.b : AGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0005_F10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0131_E02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0134_G01.b : gGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0068_B04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0197_G01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0168_D10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0062_A06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0163_E02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0068_F10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0054_C03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0192_A09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0055_H07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0174_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0135_A04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0072_G04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_E04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0053_G06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0183_F06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0173_F04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0042_D09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0076_C12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0070_B03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0180_C03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0168_C03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_C01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0186_G04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0170_C01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0038_A02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0204_B08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0026_E04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0015_G01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0041_H01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0128_A03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0088_H02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0197_A07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0136_A06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0062_A05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0164_B05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACTCTATCTCCACTCGCCC
LVRM1_0208_A08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0167_C02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0206_F05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0175_C02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0184_A05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0106_C01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0145_F02.b : gGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0164_G06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0009_A03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0051_C01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0115_G02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0182_B10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0041_H08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0104_F01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0100_C12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0106_E07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0116_C06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0114_G06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0126_A06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0083_G10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_G08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0093_F11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0187_C10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0065_F05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0068_G08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0095_B11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0198_F08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0061_F09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0192_H08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0192_E09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0047_H06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0079_B03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0056_F05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0034_B08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0043_A10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0166_F11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0160_G01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0042_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0149_B02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0015_E05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0050_C12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0033_E08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0162_F05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0018_H02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0078_C03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0017_C02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0177_H11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0009_C07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0145_A09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0007_D08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0144_B03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0152_F04.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0127_H09.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0078_D01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0008_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0009_H08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0051_E11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0021_D06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0008_H11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0143_D02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0108_F07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0127_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0123_D10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0106_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0130_D06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0022_C03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0078_D05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0120_G02.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0033_H08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0156_B11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0019_A01.b : tGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0014_B11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0154_B11.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0139_B08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0159_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0019_B08.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0150_G10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0017_D10.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0147_E07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0006_E06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0030_D04.b : xGATGAAAGAACCAG*TTCAGAGGGACTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0071_E07.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0054_G12.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0048_G05.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0101_B06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0011_D06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0089_C06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0053_D01.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0030_B03.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0046_H06.b : xGATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0096_H05.b : xcATGAAAGAACCAGGTTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0024_D06.b : acATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0177_C11.b : aaATGAAAGAACCAT*TTCAAAGGGATTGC***CTCAAACCACACTATCTCCACTCGCCC
LVRM1_0135_D02.b : atATGAAAGAACCGG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0037_D04.b : xcATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0037_H03.b : tcATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0185_G08.b : aaATGACATAACCAA*TTCATACGGATTGC***CTCATACCACACTATCTCCACTCGCCC
LVRM1_0034_C05.b : taATGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0166_C06.b : xxxTGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0200_A02.b : atcTGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_G10.b : xtcTGAAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0199_B01.b : tactggAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0026_C08.b : xxgatgAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0022_F10.b : xxgatgAAGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0061_D01.b : xxxxxxxgGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_C03.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0010_H08.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0020_F02.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0026_F03.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0179_E06.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0203_B05.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0093_H10.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0099_D08.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0072_C11.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0152_D08.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0156_G08.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0158_G09.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0124_E03.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0001_D04.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0104_G10.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0084_G02.b : xxxxxxxxGAACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0141_C06.b : xxxxxxxxggACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
KDN01_0017_E10.b : tcgagataagACCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0131_E10.b : xxxxxxtggctGGAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0182_E09.b : xxxxxxxxxxxCCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0039_C01.b : xxxxxxxxxxxCCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0181_F11.b : xxxxxxxxxxxGGAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0143_A12.b : xxxxxxxxxxxCCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0110_G09.b : xxxxcccctctGGAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0040_B07.b : xxxxxxxxxxxxCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0050_E10.b : xxxxxxxxxxxxCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_E11.b : xxxxxxxxxxxxCAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0076_B08.b : xxxxxxxxxxxxxAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0027_A09.b : xxxxxxxxxxxxxAG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0043_D02.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0172_A05.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_C08.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CCCAGACCACACTATCTCCACTCGCCC
LVRM1_0054_H02.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0076_G11.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0057_A01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0100_A01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0206_F01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0196_F01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0196_E07.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_F01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0053_B01.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0195_C06.b : xxxxxxxxxxxxxxG*TTCGGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0201_B03.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0022_E03.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0113_D11.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGCTGGCTCAGACCACACTATCTCCACTCGCCC
LVRM1_0075_C09.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0092_F12.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0105_H12.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0186_D12.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0117_G11.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0125_C10.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0003_F09.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0128_G05.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0034_E10.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0030_F05.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0140_B08.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0141_C10.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0042_D11.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0008_B06.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0104_B03.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0012_C03.b : xxxxxxxxxxxxxxG*TTCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0067_D04.b : xxxxxxxxxxxxxxxxTTCAAAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0015_B05.b : xxxxxxxxxxxxxxxxggCAGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0047_F04.b : xxxxxxxxxxxxxxxxxxxxGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0081_F10.b : xxxxxxxxxxxxxxxxxxxxGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0002_E06.b : xxxxxxxxxxxxxxxxxxxxGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0059_F09.b : xxxxxxxxxxxxxxxxxxxxGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0048_H12.b : xxxxxxxxxxxxxxxxxxxxGAGGGATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0205_H05.b : xgatcagagaacctgttcaccatGGATTGC***CTCAGACCGCACTATCTCCACTCTCCC
LVRM1_0208_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0081_C05.b : xxxxxxxxxxxxxxxxxxxxxxxgaATTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0134_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0159_B03.b : xxxxxxxxxxxxxxxxxxxxxxxtggTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0055_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0188_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0048_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0074_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0081_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0168_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0170_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0067_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0165_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0047_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0121_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0104_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVR01_0068_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0200_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcTGC***CTCAGACCACACTATCTCCACTCGCCC
LVRM1_0180_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGAGACCACACTATCTCCACTCGCCC
LVRM1_0087_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0132_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACCATCTCCACTCGCCC
LVRM1_0057_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0206_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0172_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0067_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0035_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0109_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0124_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0079_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0008_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0161_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0159_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0009_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0142_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0052_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0150_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0142_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0001_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0031_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0048_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0058_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0078_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0046_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVR01_0068_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCACACTATCTCCACTCGCCC
LVRM1_0104_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCACACTATCTCCACTCGCCC
LVR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACACTATCTCCACTCGCCC
LVR01_0005_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACACTATCTCCACTCGCCC
LVRM1_0205_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTATCTCCACTCGCCC
LVRM1_0082_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0179_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0114_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0004_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTATCTCCACTCGCCC
LVRM1_0194_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgg
LVR01_0019_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_H09.b : cagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_B02.b :
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b :
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
---------+---------+---------+---------+---------+---------+ 271
LVR01_0020_G06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0090_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0028_F02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0091_D12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0073_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0166_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0015_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0015_H12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0148_A02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0146_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0113_C11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0140_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0098_D09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0093_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0084_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0003_A07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0017_B06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0110_A11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0031_H09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0093_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0046_B04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0181_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0083_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0087_F06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0047_A08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0058_G03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0093_E07.b : AAACCT*GTGGAAAATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAAA
LVRM1_0020_C05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0136_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0097_B02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0171_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0086_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0091_E02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0207_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0136_H05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0201_C12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0185_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0097_H03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0053_A02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0025_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0105_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0162_F02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0088_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0149_B01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0102_B06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACCGTAGCTGCTAGA
LVRM1_0201_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0128_B02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0181_D12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0034_G03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0155_H04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0153_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0140_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0017_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0128_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0153_D05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0153_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0109_E11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0079_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0125_A05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0126_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0011_C07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGGACTGTAGCTGCTAGA
LVRM1_0134_B01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0112_A08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0077_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0030_D05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0003_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0065_D12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0033_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0003_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0086_C07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0033_B01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0025_A09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0058_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0029_G01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0203_B09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0029_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0032_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0077_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0048_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0185_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0201_B02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0172_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0101_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0073_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAAA
LVR01_0103_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0168_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0024_A06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0176_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0045_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0173_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0207_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0202_C04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0184_H02.b : AGACCT*GTGGAAGATTAGCGACCAGGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0094_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0172_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0175_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0093_A09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0163_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0186_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0206_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0040_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0204_D09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0084_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0147_E09.b : AGACCT*GTGGAAGGTTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0127_A10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0139_H11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0101_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0049_E03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0089_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0098_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGG
LVR01_0012_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0068_B07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0068_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0094_E02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0187_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0129_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0027_E08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0038_G04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0094_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0069_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0132_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0065_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0170_F06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0179_E08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0020_B07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0049_C07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0016_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0004_F03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0073_E12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0184_F04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0198_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0048_E12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0031_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0044_H12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0131_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0017_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0104_G04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0096_A07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0164_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0082_C09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0205_H09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0111_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0068_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0018_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0050_D10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0068_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_E05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0010_H07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0020_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTACA
LVRM1_0010_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0076_H05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0181_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0104_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0094_B05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0043_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0195_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0181_A12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0194_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0198_H05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0185_D09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0075_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_F03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0192_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0097_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0106_E04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0175_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACCGTAGCTGCTAGA
LVRM1_0188_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0111_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0103_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0095_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0179_E12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0034_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0177_A10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0155_D03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0014_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0206_C09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0206_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0032_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0004_C08.b : AGACCT*GTGGAAGACTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0102_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0099_D12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0012_E04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0049_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0035_D10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0141_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0021_C08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0126_A11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0080_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0157_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0077_C11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0122_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0019_A11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0162_B09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0121_A08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0003_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAAA
LVR01_0061_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0072_C12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0012_E03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0003_A08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0005_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0131_E02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0134_G01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0068_B04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0197_G01.b : AGACCT*GTGGAAGATCAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0168_D10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0062_A06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0163_E02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0068_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0054_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0192_A09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0055_H07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0174_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0135_A04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0072_G04.b : AGACCT*GTGGAAGGTTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_E04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0053_G06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0183_F06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0173_F04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0042_D09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0076_C12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0070_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0180_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0168_C03.b : AGATCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0201_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0186_G04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0170_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0038_A02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0204_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0026_E04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0015_G01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0041_H01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0128_A03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0088_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0197_A07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0136_A06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0062_A05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0164_B05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0208_A08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0167_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTGGA
LVRM1_0206_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0175_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0184_A05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0106_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0145_F02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0164_G06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0009_A03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0051_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0115_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0182_B10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0041_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0104_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0100_C12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0106_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0116_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0114_G06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0126_A06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0083_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0093_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0187_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0065_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0068_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0095_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0198_F08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0061_F09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0192_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0192_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0047_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0079_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0056_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0034_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0043_A10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0166_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0160_G01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0042_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0149_B02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0015_E05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTTCCTGCTAGA
LVRM1_0050_C12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0033_E08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0162_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0018_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0078_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0017_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0177_H11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0009_C07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0145_A09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0007_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0144_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0152_F04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0127_H09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0078_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0008_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0009_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0051_E11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0021_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0008_H11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0143_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0108_F07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCGGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0127_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0123_D10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0106_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0130_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0022_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0078_D05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0120_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0033_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTCTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0156_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0019_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCCAGA
LVRM1_0014_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0154_B11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0139_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0159_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0019_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0150_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0017_D10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0147_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0006_E06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0030_D04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0071_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0054_G12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0048_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0101_B06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0011_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0089_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0053_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0030_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0046_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0096_H05.b : AGACCT*GTGGAAGATTATCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0024_D06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0177_C11.b : AAACCT*GTGGAAAATTACCGACCATG*TTTCCAGTGGGATAGGAACTGTACCTGCTAAA
LVRM1_0135_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0037_D04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0037_H03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0185_G08.b : AGACCTCGTGGAAGATTACCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAAA
LVRM1_0034_C05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0166_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0200_A02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGTGATAGGAACTGTAGCTGCTAGA
LVRM1_0121_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0199_B01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0026_C08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0022_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0061_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAAGAACTGTAGCTGCTAGA
LVRM1_0121_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0010_H08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0020_F02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0026_F03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0179_E06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0203_B05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0093_H10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0099_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0072_C11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0152_D08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0156_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0158_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGGACTGTAGCTGCTAGA
LVRM1_0124_E03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0001_D04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0104_G10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0084_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0141_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
KDN01_0017_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0131_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0182_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0039_C01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0181_F11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0143_A12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0110_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0040_B07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0050_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0121_E11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0076_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0027_A09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0043_D02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0172_A05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_C08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0054_H02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0076_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0057_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0100_A01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0206_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0196_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0196_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0201_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0053_B01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0195_C06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0201_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0022_E03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0113_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0075_C09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0092_F12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0105_H12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTACTAGA
LVRM1_0186_D12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0117_G11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0125_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0003_F09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0128_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0034_E10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0030_F05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0140_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGCGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0141_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGCAGCTGCTAGA
LVR01_0042_D11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0008_B06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0104_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0012_C03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0067_D04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0015_B05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0047_F04.b : AGACCA*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0081_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0002_E06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0059_F09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0048_H12.b : AGACCT*GTGGAAGACTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0205_H05.b : ATACCT*GTGGAACATTACCTACCATGTTTTCCACTGGGATACGAACTGTACCTGCTACA
LVRM1_0208_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0081_C05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0134_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0159_B03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0055_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0188_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0048_H04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0074_A04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0081_G02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0168_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0170_G09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0067_B08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0165_D01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0047_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0121_H09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0104_F03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0068_C02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0200_F08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0180_A02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0087_G05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0132_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0057_F12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0206_B02.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0172_C05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0067_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0035_D04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0109_E04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0124_H10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0079_A05.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0008_E09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0161_F01.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0159_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0009_B12.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0142_B06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0052_C09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0150_F10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0142_H11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0049_E07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0001_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0031_B09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0048_G04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0058_H06.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0078_B06.b : GGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0046_G03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0068_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0104_G08.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0025_B07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0005_E03.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0205_C11.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0082_G07.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0179_C09.b : AGACCT*GTGGAAGATTAGCGACCGTGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0114_B09.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0004_C10.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0194_C04.b : AGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0019_A03.b : xGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVR01_0045_C10.b : xGACCT*GTGGAAGATTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0144_A08.b : xxxxxxxxxxxxxxxgTAGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0137_B03.b : xxxxxxxxxxxxxxxxxxGCGACCATGTTTTCCAGTGGGATAGGAACTGTAGCTGCTAGA
LVRM1_0172_H09.b : xxxxxxxxxxxxxxxxgcgaccatgattttccagcTGGGATAAGAACTGTAGCTGCTAGA
LVRM1_0023_B02.b : cgtggacacggacCTGTAGCTGCTAGA
LVRM1_0128_F07.b :
LVRM1_0079_A11.b :
LVRM1_0074_B08.b :
LVRM1_0044_F12.b :
LVRM1_0199_G10.b : gcgttgtcxxxxxx
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
---------+---------+---------+---------+---------+---------+ 330
LVR01_0020_G06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0090_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0028_F02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0091_D12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0073_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0166_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0015_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0015_H12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0148_A02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0146_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0113_C11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0140_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0098_D09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0093_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0084_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0003_A07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0017_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0110_A11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0031_H09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0093_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0046_B04.b : AAA*AGGAGGGAGAGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0181_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0083_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0087_F06.b : AAA*AGGGGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0047_A08.b : GAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0058_G03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0093_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0020_C05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0136_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0097_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0171_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0086_H02.b : AAA*AGGAGGGAGTGTCTTCCCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0091_E02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0207_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0136_H05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_C12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0185_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0097_H03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0053_A02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0025_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0105_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0162_F02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0088_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0149_B01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0102_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0128_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0181_D12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0034_G03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0155_H04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0153_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0140_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0017_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0128_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0153_D05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0153_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0109_E11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0079_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0125_A05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0126_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0011_C07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0134_B01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0112_A08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0077_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0030_D05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0003_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0065_D12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0033_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0003_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTTGCCTCTGGGGCTGTGTGACCTG
LVR01_0086_C07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0033_B01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0025_A09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0058_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0029_G01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTTTGGGGCTGTGTGACCTG
LVRM1_0203_B09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTGTTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0029_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0032_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0077_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0048_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0185_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0172_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0101_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0073_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0103_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0168_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0024_A06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0176_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0045_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0173_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0207_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0202_C04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0184_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0094_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0172_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0175_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0093_A09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0163_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0186_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0040_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0204_D09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0084_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0147_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0127_A10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0139_H11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0101_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0049_E03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0089_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0098_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0012_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0068_B07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0068_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0094_E02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0187_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0129_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0027_E08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0038_G04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0094_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0069_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0132_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0065_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0170_F06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0179_E08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0020_B07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0049_C07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0016_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0004_F03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0073_E12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0184_F04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0198_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0048_E12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0031_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0044_H12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0131_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0017_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0104_G04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0096_A07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0164_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGACTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0082_C09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0205_H09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0111_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0068_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0018_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0050_D10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0068_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_E05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0010_H07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0020_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0010_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0076_H05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0181_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0104_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0094_B05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0043_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0195_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0181_A12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0194_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0198_H05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0185_D09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0075_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_F03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0192_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0097_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0106_E04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0175_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0188_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0111_G02.b : AAA*GGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0103_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0095_E09.b : AAA*AGGAGGGAGTGTCTTCCCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0179_E12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0034_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0177_A10.b : AAA*AGGAGGGGGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0155_D03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0014_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_C09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0032_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0004_C08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0102_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0099_D12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0012_E04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0049_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0035_D10.b : AAA*AGGAGGGAATGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0141_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0021_C08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0126_A11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0080_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0157_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0077_C11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0122_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0019_A11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0162_B09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0121_A08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0003_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0061_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0072_C12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0012_E03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0003_A08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0005_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0131_E02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0134_G01.b : AAA*AGGAGGGAGTGTCTTCTCTCCCTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0068_B04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0197_G01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0168_D10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0062_A06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0163_E02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0068_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0054_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGATCTG
LVRM1_0192_A09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCAGGGGCTGTGTGACCTG
LVRM1_0055_H07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0174_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0135_A04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0072_G04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_E04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0053_G06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0183_F06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0173_F04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0042_D09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0076_C12.b : AAA*AGGAGGGGGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0070_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0180_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0168_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0186_G04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0170_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0038_A02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0204_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0026_E04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0015_G01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0041_H01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0128_A03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0088_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0197_A07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0136_A06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0062_A05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0164_B05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0208_A08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0167_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCCG
LVRM1_0175_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0184_A05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0106_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0145_F02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0164_G06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0009_A03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0051_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGCGTGACCTG
LVRM1_0115_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0182_B10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0041_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0104_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0100_C12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0106_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0116_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0114_G06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0126_A06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0083_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0093_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0187_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0065_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0068_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0095_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0198_F08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0061_F09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0192_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0192_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0047_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0079_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0056_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0034_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0043_A10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0166_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0160_G01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0042_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0149_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0015_E05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0050_C12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0033_E08.b : AAG*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0162_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0018_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0078_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0017_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0177_H11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0009_C07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0145_A09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0007_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0144_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0152_F04.b : AAA*AGGAGGGAGTGTCTTCTCTCCCTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0127_H09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0078_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0008_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0009_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0051_E11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGCGTGACCTG
LVRM1_0021_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0008_H11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0143_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0108_F07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0127_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0123_D10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0106_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0130_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0022_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0078_D05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0120_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0033_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0156_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0019_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0014_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0154_B11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0139_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0159_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0019_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0150_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0017_D10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0147_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0006_E06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0030_D04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0071_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0054_G12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0048_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0101_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0011_D06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0089_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0053_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0030_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0046_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0096_H05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0024_D06.b : AAA*AGGGGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0177_C11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0135_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0037_D04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0037_H03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0185_G08.b : AAA*ACGACGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0034_C05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0166_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0200_A02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0121_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0199_B01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0026_C08.b : AAA*AGGAGGGAGTGTCTTCTCCCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0022_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCCGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0061_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0121_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0010_H08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0020_F02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0026_F03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0179_E06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0203_B05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0093_H10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0099_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0072_C11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0152_D08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0156_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0158_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0124_E03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0001_D04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0104_G10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0084_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0141_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
KDN01_0017_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0131_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0182_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0039_C01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0181_F11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0143_A12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0110_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0040_B07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0050_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0121_E11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0076_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0027_A09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0043_D02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0172_A05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_C08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0054_H02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0076_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0057_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0100_A01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0196_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0196_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0053_B01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0195_C06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0201_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0022_E03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0113_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0075_C09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0092_F12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0105_H12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0186_D12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0117_G11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0125_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0003_F09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0128_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0034_E10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0030_F05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0140_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0141_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0042_D11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGTCCTG
LVR01_0008_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0104_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0012_C03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0067_D04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0015_B05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0047_F04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0081_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0002_E06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0059_F09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0048_H12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0205_H05.b : AAA*AGGACGGAGTGTCTTCACTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0208_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0081_C05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0134_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0159_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0055_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0188_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0048_H04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0074_A04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0081_G02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0168_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0170_G09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0067_B08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0165_D01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0047_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0121_H09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0104_F03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0068_C02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0200_F08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0180_A02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0087_G05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0132_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0057_F12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0206_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0172_C05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0067_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0035_D04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0109_E04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0124_H10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0079_A05.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0008_E09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0161_F01.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0159_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0009_B12.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0142_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0052_C09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0150_F10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0142_H11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0049_E07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0001_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0031_B09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0048_G04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0058_H06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0078_B06.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0046_G03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0068_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0104_G08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0025_B07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0005_E03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0205_C11.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0082_G07.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0179_C09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0114_B09.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0004_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0194_C04.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0019_A03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVR01_0045_C10.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0144_A08.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTTTGGGGCTGTGTGACCTG
LVRM1_0137_B03.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0172_H09.b : AAATAGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0023_B02.b : AAA*AGGAGGGAGTGTCTTCTCTCCTTGCTGATTATTGGCCTCTGGGGCTGTGTGACCTG
LVRM1_0128_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_A11.b : acgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_B08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_F12.b : t
LVRM1_0199_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggatctggcagttc
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
---------+---------+---------+---------+---------+---------+ 390
LVR01_0020_G06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0090_G11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0028_F02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0091_D12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0073_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0166_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0015_G11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0015_H12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAACCTCGGGACATTCCCGTGAATCC
LVRM1_0148_A02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0146_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0113_C11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0140_D11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0098_D09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0093_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0084_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0003_A07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0017_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0110_A11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0031_H09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0093_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0046_B04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0181_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0083_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0087_F06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0047_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAATCCTCGGGACATTCCCGTGAATCC
LVRM1_0058_G03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0093_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0020_C05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0136_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0097_B02.b : TCATTGGGGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0171_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0086_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0091_E02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0207_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0136_H05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_C12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATCCCCGTGAATCC
LVRM1_0185_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0097_H03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0053_A02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0025_D11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGAGAATCC
LVRM1_0105_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0162_F02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0088_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0149_B01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0102_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0128_B02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0181_D12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0034_G03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0155_H04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0153_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0140_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0017_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0128_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0153_D05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0153_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0109_E11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0079_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0125_A05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0126_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0011_C07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0134_B01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0112_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0077_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0030_D05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0003_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0065_D12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0033_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0003_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0086_C07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0033_B01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0025_A09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0058_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0029_G01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0203_B09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0029_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0032_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0077_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0048_G11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0185_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_B02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0172_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0101_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0073_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0103_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0168_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0024_A06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0176_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0045_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0173_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0207_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0202_C04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0184_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0094_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0172_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0175_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0093_A09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0163_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0186_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0040_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0204_D09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0084_D11.b : TCATTGGAGCCCTGTGGAGGACATCTACACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0147_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0127_A10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0139_H11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0101_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0049_E03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0089_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0098_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0012_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0068_B07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0068_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0094_E02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0187_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0129_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0027_E08.b : TCATTGGAGCCCTGTGGAGGACATCTGCGCAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0038_G04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0094_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0069_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0132_D11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0065_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0170_F06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0179_E08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0020_B07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0049_C07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0016_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0004_F03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0073_E12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0184_F04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0198_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0048_E12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0031_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0044_H12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0131_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0017_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0104_G04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0096_A07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0164_G11.b : TCATTGGGGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0082_C09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0205_H09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0111_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0068_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0018_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0050_D10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0068_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_E05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0010_H07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0020_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCGAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0010_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0076_H05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0181_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0104_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0094_B05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0043_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0195_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0181_A12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0194_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0198_H05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0185_D09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0075_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_F03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0192_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0097_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0106_E04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0175_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0188_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0111_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0103_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0095_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0179_E12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0034_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0177_A10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0155_D03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0014_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_C09.b : TCATTGGAGCC**GTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0032_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0004_C08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0102_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0099_D12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0012_E04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0049_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0035_D10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0141_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0021_C08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0126_A11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0080_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0157_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0077_C11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0122_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0019_A11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0162_B09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0121_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0003_D06.b : TCGTTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0061_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0072_C12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0012_E03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0003_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAACCC
LVRM1_0005_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0131_E02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0134_G01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0068_B04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0197_G01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0168_D10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0062_A06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0163_E02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0068_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0054_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0192_A09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0055_H07.b : TCATCGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0174_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0135_A04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0072_G04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_E04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0053_G06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0183_F06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0173_F04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0042_D09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0076_C12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0070_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0180_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0168_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0186_G04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0170_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0038_A02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0204_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0026_E04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0015_G01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0041_H01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0128_A03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0088_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0197_A07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0136_A06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0062_A05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0164_B05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0208_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0167_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0175_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0184_A05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0106_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0145_F02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATACCCGTGAATCC
LVRM1_0164_G06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0009_A03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0051_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0115_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0182_B10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0041_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0104_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0100_C12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0106_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0116_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0114_G06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0126_A06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0083_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0093_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0187_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0065_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0068_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0095_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0198_F08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0061_F09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0192_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0192_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0047_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0079_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0056_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0034_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0043_A10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0166_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0160_G01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0042_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0149_B02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0015_E05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0050_C12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0033_E08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0162_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0018_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0078_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0017_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0177_H11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0009_C07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0145_A09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0007_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0144_B03.b : TTATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0152_F04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0127_H09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0078_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0008_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0009_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0051_E11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0021_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0008_H11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0143_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0108_F07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0127_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0123_D10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0106_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0130_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0022_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0078_D05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0120_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0033_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0156_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0019_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0014_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0154_B11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0139_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0159_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0019_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0150_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0017_D10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0147_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0006_E06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0030_D04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0071_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0054_G12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0048_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0101_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0011_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0089_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0053_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0030_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0046_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0096_H05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0024_D06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0177_C11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0135_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0037_D04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0037_H03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0185_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0034_C05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0166_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0200_A02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0121_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0199_B01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0026_C08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0022_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0061_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0121_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0010_H08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0020_F02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0026_F03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0179_E06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0203_B05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0093_H10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0099_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0072_C11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0152_D08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0156_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0158_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0124_E03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0001_D04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0104_G10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0084_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0141_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
KDN01_0017_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0131_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0182_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0039_C01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0181_F11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0143_A12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0110_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0040_B07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0050_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0121_E11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0076_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0027_A09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0043_D02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACACTCCCGTGAATCC
LVRM1_0172_A05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_C08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0054_H02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0076_G11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0057_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0100_A01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0196_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0196_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0053_B01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0195_C06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0201_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0022_E03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0113_D11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0075_C09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0092_F12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0105_H12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0186_D12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0117_G11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0125_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0003_F09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0128_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0034_E10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0030_F05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0140_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0141_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0042_D11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0008_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0104_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0012_C03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0067_D04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0015_B05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0047_F04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0081_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0002_E06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0059_F09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0048_H12.b : TCATTGGAGCCCTGTGGAGGACATCTGTACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0205_H05.b : TCCTTGGAGCCCTGTGGATGACATCTGCGCAGCCTAGCCTCCGGACATTCCCGTGAATCC
LVRM1_0208_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0081_C05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0134_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0159_B03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0055_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0188_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0048_H04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0074_A04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0081_G02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0168_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0170_G09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0067_B08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0165_D01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0047_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGTCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0121_H09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACACTCCCGTGAATCC
LVR01_0104_F03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0068_C02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0200_F08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0180_A02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0087_G05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0132_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0057_F12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0206_B02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0172_C05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0067_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0035_D04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0109_E04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0124_H10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0079_A05.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0008_E09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0161_F01.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0159_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0009_B12.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0142_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0052_C09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0150_F10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0142_H11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0049_E07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0001_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0031_B09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0048_G04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0058_H06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0078_B06.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0046_G03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0068_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0104_G08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0025_B07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0005_E03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0205_C11.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0082_G07.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0179_C09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0114_B09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0004_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0194_C04.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0019_A03.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVR01_0045_C10.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0144_A08.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0137_B03.b : TCATTGGAGCCCTGTGGAGGACATATGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0172_H09.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0023_B02.b : TCATTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0128_F07.b : xxxTTGGAGCCCTGTGGAGGACATCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0079_A11.b : xxxxxxxxxxxxxxxxxxxxxCATCTGCACAGCCNAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0074_B08.b : xxxxxxxxxxxxxxxxxxxxxxxTCTGCACAGCCAAGCCTCGGGACATTCCCGTGAATCC
LVRM1_0044_F12.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCC
LVRM1_0199_G10.b : agagggattgcctcagaccacactatctccactcgcccagacctgtggaagattagcgaC
LVRM1_0115_C11.b :
LVR01_0034_H02.b :
20110601C-000773 : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
---------+---------+---------+---------+---------+---------+ 450
LVR01_0020_G06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0090_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0028_F02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0091_D12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0073_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0166_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0015_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0015_H12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0148_A02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0146_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0113_C11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0140_D11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0098_D09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0093_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0084_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0003_A07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0017_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0110_A11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0031_H09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0093_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0046_B04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0181_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0083_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0087_F06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0047_A08.b : CATGTGCATTTACCGTTCCCCAGAGAACAAGGCCACTGAGGGCGAGGGCTCAGAGCAAAA
LVRM1_0058_G03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0093_E07.b : CATGTGCATTTACCGTTCCCCAAAAAAAAAGGCCACTGAGGGCGAGGGCTCAAAGCAAAA
LVRM1_0020_C05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0136_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0097_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0171_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0086_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0091_E02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0207_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0136_H05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_C12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0185_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0097_H03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0053_A02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0025_D11.b : CATGTGCATTTACCGTTCCCCAGAGAATAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0105_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0162_F02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0088_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0149_B01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0102_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0128_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0181_D12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0034_G03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0155_H04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0153_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0140_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0017_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0128_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCAAGGGCTCAGAGCAGAA
LVRM1_0153_D05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0153_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGGGGGCGAGGGCTCAGAGCAGAA
LVRM1_0109_E11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0079_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0125_A05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0126_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCTGAGCAGAA
LVRM1_0011_C07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0134_B01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0112_A08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0077_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0030_D05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0003_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0065_D12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0033_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0003_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0086_C07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0033_B01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0025_A09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0058_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0029_G01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0203_B09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0029_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0032_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0077_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0048_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0185_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0172_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0101_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0073_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0103_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0168_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0024_A06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0176_B11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0045_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0173_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0207_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0202_C04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0184_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0094_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0172_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0175_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0093_A09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0163_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0186_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_G12.b : CATGTGCATTTACCGCTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0040_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0204_D09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAG*GCTCAGAGCAGAA
LVRM1_0084_D11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0147_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0127_A10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0139_H11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0101_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0049_E03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0089_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0098_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0012_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0068_B07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0068_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0094_E02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0187_A01.b : CATGTACATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0129_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0027_E08.b : CATGTGCATTTACCGTTCCCCAGACAAGAAGGTCACTGACGGTGAGGGCTCAGAGCAGAA
LVRM1_0038_G04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0094_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0069_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0132_D11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0065_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0170_F06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0179_E08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0020_B07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0049_C07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0016_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0004_F03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0073_E12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0184_F04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0198_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0048_E12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0031_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0044_H12.b : CATGTGCATTTACCGTTCCCCAAAGAAGAAGGCCACTGAGGGCGAGGGCTCAAAGCATAA
LVRM1_0131_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0017_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0104_G04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0096_A07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0164_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0082_C09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0205_H09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0111_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0068_B11.b : CATGTGCATTTACCGTTCCCCATAGAAGAAGGCCACTGAGGGCGAGGGCTCATAGCATAA
LVRM1_0018_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0050_D10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0068_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_E05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0010_H07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0020_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0010_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0076_H05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0181_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0104_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGACCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0094_B05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0043_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0195_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0181_A12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0194_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0198_H05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0185_D09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0075_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_F03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0192_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0097_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0106_E04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0175_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0188_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0111_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0103_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0095_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0179_E12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0034_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0177_A10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0155_D03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0014_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_C09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0032_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0004_C08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0102_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0099_D12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0012_E04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0049_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0035_D10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0141_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0021_C08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0126_A11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0080_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0157_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0077_C11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0122_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0019_A11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0162_B09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0121_A08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0003_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCTCTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0061_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0072_C12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0012_E03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0003_A08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0005_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0131_E02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0134_G01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0068_B04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCATAGCAGAA
LVRM1_0197_G01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0168_D10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0062_A06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0163_E02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0068_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0054_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0192_A09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0055_H07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0174_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0135_A04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0072_G04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCATAGCAGAA
LVRM1_0165_E04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0053_G06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0183_F06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0173_F04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0042_D09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0076_C12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0070_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0180_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0168_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0186_G04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0170_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0038_A02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0204_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0026_E04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0015_G01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0041_H01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0128_A03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0088_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0197_A07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0136_A06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0062_A05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0164_B05.b : CATGTGCATTTACCGTTCCCCAGGGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0208_A08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0167_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0175_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0184_A05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0106_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0145_F02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0164_G06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0009_A03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0051_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0115_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0182_B10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0041_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0104_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0100_C12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0106_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0116_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0114_G06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0126_A06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0083_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0093_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0187_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0065_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0068_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0095_B11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0198_F08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0061_F09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0192_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0192_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0047_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0079_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0056_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0034_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAAAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0043_A10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0166_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0160_G01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0042_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0149_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0015_E05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0050_C12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0033_E08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0162_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0018_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0078_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0017_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0177_H11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0009_C07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0145_A09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0007_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0144_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0152_F04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0127_H09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0078_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0008_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0009_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0051_E11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0021_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0008_H11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0143_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0108_F07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0127_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0123_D10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0106_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0130_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0022_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0078_D05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0120_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0033_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0156_B11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0019_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0014_B11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0154_B11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0139_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0159_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0019_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0150_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0017_D10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0147_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0006_E06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0030_D04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0071_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0054_G12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0048_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0101_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0011_D06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0089_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0053_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0030_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0046_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0096_H05.b : CATGTGCATTTACCGTTCCCCATATAAGAAGGCCACTGACGGCGAGGGCTCATAGCAGGA
LVRM1_0024_D06.b : CATGTGCAGTTACCGTTCCCCAGAGAAGAAGGCCACTGAAGACCAGGGCTCAGAGCAGAA
LVRM1_0177_C11.b : CATGTGCATTTACCGTTCCCCAAAAAAAAAGGCCACTGAGGGCGAGGGCTCAAAGCAAAA
LVRM1_0135_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0037_D04.b : CATGTGCATTTACCGTTCCCCAGAGAAGTAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0037_H03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0185_G08.b : CATGTGCATTTACCGTTCCCCACATAATAAGGCCACTGAGGGCGAGGGCTCACAGCAGAA
LVRM1_0034_C05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0166_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0200_A02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0121_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0199_B01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0026_C08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0022_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0061_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCATAGCAGAA
LVRM1_0121_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0010_H08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0020_F02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0026_F03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0179_E06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0203_B05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0093_H10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0099_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0072_C11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0152_D08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0156_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0158_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGGGGGCGAGGGCTCAGAGCAGAA
LVRM1_0124_E03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0001_D04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0104_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0084_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0141_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
KDN01_0017_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0131_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0182_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0039_C01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0181_F11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0143_A12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0110_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0040_B07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACCGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0050_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCCCAGAGCAGAA
LVRM1_0121_E11.b : CATGTGCATTCACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0076_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0027_A09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAAAGCAGAA
LVRM1_0043_D02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0172_A05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_C08.b : CATGTGCATTTACCGTTCCCTAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0054_H02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGACTCAGAGCAGAA
LVRM1_0076_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0057_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0100_A01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0196_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0196_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0053_B01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0195_C06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0201_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0022_E03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0113_D11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0075_C09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0092_F12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0105_H12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0186_D12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0117_G11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0125_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0003_F09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0128_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0034_E10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0030_F05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0140_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0141_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0042_D11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0008_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0104_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0012_C03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0067_D04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCATAA
LVR01_0015_B05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0047_F04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0081_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0002_E06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0059_F09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0048_H12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0205_H05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAACGCCACTGAGGGCGAGGGCTCATAGCAAAA
LVRM1_0208_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0081_C05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0134_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0159_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0055_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0188_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0048_H04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0074_A04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0081_G02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0168_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0170_G09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0067_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0165_D01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0047_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0121_H09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0104_F03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0068_C02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0200_F08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTTAGAGCAGAA
LVRM1_0180_A02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0087_G05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0132_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0057_F12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0206_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0172_C05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0067_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0035_D04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0109_E04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0124_H10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0079_A05.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0008_E09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0161_F01.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0159_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0009_B12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0142_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0052_C09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0150_F10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0142_H11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0049_E07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0001_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0031_B09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0048_G04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0058_H06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0078_B06.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0046_G03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0068_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0104_G08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0025_B07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0005_E03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0205_C11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0082_G07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0179_C09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0114_B09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0004_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0194_C04.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0019_A03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVR01_0045_C10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0144_A08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0137_B03.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0172_H09.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0023_B02.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0128_F07.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0079_A11.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0074_B08.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0044_F12.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0199_G10.b : CATGTGCATTTACCGTTCCCCAGAGAAGAAGGCCACTGAGGGCGAGGGCTCAGAGCAGAA
LVRM1_0115_C11.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_H02.b :
20110601C-000773 : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
---------+---------+---------+---------+---------+---------+ 509
LVR01_0020_G06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0090_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGACCAATTCCCACTTTG
LVRM1_0028_F02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0091_D12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0073_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0166_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0015_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0015_H12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0148_A02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0146_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0113_C11.b : GA*CCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0140_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0098_D09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0093_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCT*AGGCCAATTCCCACTTTG
LVRM1_0084_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0003_A07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0017_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0110_A11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0031_H09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0093_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0046_B04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0181_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCC*AGGCCAATTCCCACTTTG
LVRM1_0083_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0087_F06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0047_A08.b : GATCCCTGAGGCCACCAACCGTCGGGATTGGGAACTGTCCACAGGCCAATTCCCACTTTG
LVRM1_0058_G03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0093_E07.b : AATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0020_C05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0136_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0097_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0171_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0086_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0091_E02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0207_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0136_H05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_C12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0185_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0097_H03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGTCCAATTCCCACTTTG
LVRM1_0053_A02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0025_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0105_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0162_F02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTTCA*AGGCCAATTCCCACTTTG
LVRM1_0088_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0149_B01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0102_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0128_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0181_D12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0034_G03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0155_H04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0153_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0140_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAGCTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0017_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0128_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0153_D05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0153_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0109_E11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0079_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0125_A05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0126_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0011_C07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0134_B01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0112_A08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0077_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0030_D05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0003_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0065_D12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0033_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0003_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0086_C07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0033_B01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0025_A09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0058_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0029_G01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0203_B09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0029_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0032_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0077_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0048_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0185_D01.b : GATCCCTGAGGCTACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0172_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0101_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0073_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0103_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0168_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0024_A06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0176_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0045_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0173_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0207_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0202_C04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0184_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0094_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0172_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0175_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0093_A09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0163_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0186_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0040_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0204_D09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0084_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0147_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0127_A10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0139_H11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0101_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0049_E03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0089_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0098_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0012_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0068_B07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0068_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0094_E02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0187_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0129_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0027_E08.b : GATCCCTGAGGCCACCAACCTGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0038_G04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0094_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0069_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0132_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0065_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0170_F06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0179_E08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0020_B07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0049_C07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0016_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0004_F03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0073_E12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0184_F04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0198_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0048_E12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0031_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0044_H12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0131_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0017_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0104_G04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0096_A07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0164_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0082_C09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0205_H09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0111_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0068_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0018_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0050_D10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0068_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_E05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCT*AGGCCAATTCCCACTTTG
LVRM1_0010_H07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0020_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0010_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0076_H05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0181_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTTCA*AGGCCAATTCCCACTTTG
LVRM1_0104_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0094_B05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0043_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0195_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0181_A12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0194_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0198_H05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0185_D09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0075_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_F03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0192_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0097_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0106_E04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0175_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCATTTTG
LVRM1_0188_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0111_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0103_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0095_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0179_E12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0034_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0177_A10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0155_D03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0014_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_C09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0032_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGACCA*AGGCCAATTCCCACTTTG
LVRM1_0004_C08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0102_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0099_D12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0012_E04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0049_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0035_D10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0141_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0021_C08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0126_A11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0080_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0157_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0077_C11.b : GATCCCTGAGGCCACCAACCGGCGGGCCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0122_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0019_A11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0162_B09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0121_A08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0003_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0061_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0072_C12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0012_E03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0003_A08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0005_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTTCA*AGGCCAATTCCCACTTTG
LVRM1_0131_E02.b : GATCCCTGAGGCCACCAACCGGCTGGTCTGGGAACTGTCCA*AGGTCAATTCCCACTTTG
LVRM1_0134_G01.b : GATCCCTGAGGTCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0068_B04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0197_G01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0168_D10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0062_A06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0163_E02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0068_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0054_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0192_A09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0055_H07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0174_G12.b : GATCCCTGAGGCCACCACCGGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0135_A04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0072_G04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCATTTTG
LVRM1_0165_E04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0053_G06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0183_F06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0173_F04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0042_D09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0076_C12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0070_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0180_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0168_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0186_G04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0170_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0038_A02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0204_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0026_E04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0015_G01.b : GATCCCTGAGGCCACCGACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0041_H01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0128_A03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0088_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0197_A07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0136_A06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0062_A05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0164_B05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0208_A08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0167_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0175_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0184_A05.b : GATTCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0106_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0145_F02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0164_G06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0009_A03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0051_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0115_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0182_B10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0041_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0104_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0100_C12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0106_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0116_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0114_G06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0126_A06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0083_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0093_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0187_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0065_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0068_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0095_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0198_F08.b : GATCCCTGAGGCCATCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCATTTTG
LVRM1_0061_F09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0192_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0192_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0047_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0079_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0056_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0034_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0043_A10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0166_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0160_G01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0042_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0149_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0015_E05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCTCACTTTG
LVRM1_0050_C12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0033_E08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0162_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0018_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0078_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0017_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0177_H11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0009_C07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0145_A09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0007_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0144_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0152_F04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0127_H09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0078_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0008_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0009_H08.b : GATCCCTGAGGCCGCCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0051_E11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0021_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0008_H11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0143_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0108_F07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0127_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0123_D10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0106_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0130_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0022_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0078_D05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0120_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0033_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0156_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0019_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0014_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0154_B11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0139_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0159_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0019_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0150_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0017_D10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0147_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0006_E06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0030_D04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0071_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0054_G12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0048_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0101_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0011_D06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0089_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0053_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0030_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0046_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0096_H05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0024_D06.b : GATCCCTGAGGCCACCAAGCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0177_C11.b : AATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0135_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0037_D04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0037_H03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0185_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0034_C05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0166_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0200_A02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0121_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0199_B01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0026_C08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0022_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0061_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0121_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0010_H08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0020_F02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0026_F03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0179_E06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0203_B05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0093_H10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0099_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0072_C11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0152_D08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0156_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0158_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0124_E03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0001_D04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0104_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0084_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0141_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
KDN01_0017_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0131_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0182_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0039_C01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0181_F11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0143_A12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0110_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0040_B07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0050_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0121_E11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0076_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0027_A09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0043_D02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0172_A05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_C08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0054_H02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0076_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0057_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0100_A01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0196_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0196_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0053_B01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0195_C06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0201_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0022_E03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0113_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0075_C09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0092_F12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0105_H12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0186_D12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0117_G11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0125_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0003_F09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0128_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0034_E10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0030_F05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0140_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0141_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0042_D11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0008_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0104_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0012_C03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0067_D04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0015_B05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0047_F04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0081_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0002_E06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0059_F09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0048_H12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0205_H05.b : CATCCCTGACGCCTCCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0208_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0081_C05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0134_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0159_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0055_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0188_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0048_H04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0074_A04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0081_G02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0168_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0170_G09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0067_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0165_D01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0047_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0121_H09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0104_F03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0068_C02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0200_F08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGCCCA*AGGCCAATTCCCACTTTG
LVRM1_0180_A02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0087_G05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0132_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0057_F12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0206_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0172_C05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAAC*GTCCA*AGGCCAATTCCCACTTTG
LVRM1_0067_G07.b : TATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0035_D04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0109_E04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0124_H10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0079_A05.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0008_E09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0161_F01.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0159_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0009_B12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0142_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0052_C09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0150_F10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0142_H11.b : GATCCCCGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0049_E07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0001_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0031_B09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0048_G04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0058_H06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0078_B06.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0046_G03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0068_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0104_G08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0025_B07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0005_E03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0205_C11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0082_G07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0179_C09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0114_B09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0004_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0194_C04.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0019_A03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0045_C10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0144_A08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0137_B03.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0172_H09.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0023_B02.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0128_F07.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0079_A11.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0074_B08.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0044_F12.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0199_G10.b : GATCCCTGAGGCCACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVRM1_0115_C11.b : xxxxxxxxxxxggACCAACCGGCGGGTCTGGGAACTGTCCA*AGGCCAATTCCCACTTTG
LVR01_0034_H02.b :
20110601C-000773 : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
---------+---------+---------+---------+---------+---------+ 568
LVR01_0020_G06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0090_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0028_F02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0091_D12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0073_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0166_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0015_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0015_H12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0148_A02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0146_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0113_C11.b : CCACCATCTTCTATCAACACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0140_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0098_D09.b : CCACCATCTTCTATCACCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0093_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0084_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0003_A07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0017_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0110_A11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0031_H09.b : CCACCATCTTCTATCAGCACTTGACAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0093_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0046_B04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0181_F05.b : CCACCATCTTCTATGAGCACTTGCGAGACTCCGAGAATGACAATGGCAAGTT*TTTCCTG
LVRM1_0083_A01.b : CCACCATCTTCTATCANCACTTGGCAAACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0087_F06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0047_A08.b : CCACCATCTGCTATCAGCACTTGGCAAACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0058_G03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0093_E07.b : CCACCATCTTCTATCAGCACTTGGCAAACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0020_C05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0136_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0097_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0171_H01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0086_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0091_E02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0207_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0136_H05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_C12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_C01.b : CCACCATCTTCTATCAGCACTTGGCAAACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0185_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0097_H03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0053_A02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0025_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0105_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0162_F02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0088_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0149_B01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0102_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAGCAT*TTTCCTG
LVRM1_0128_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0181_D12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0034_G03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0155_H04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0153_H01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0140_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0017_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0128_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0153_D05.b : CCACCATCTTCTATCAGCACTGGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0153_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0109_E11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0079_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0125_A05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0126_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0011_C07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0134_B01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0112_A08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0077_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0030_D05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0003_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0065_D12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0033_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0003_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0086_C07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0033_B01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0025_A09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0058_B03.b : CCACCATCTTCTATCAGCACTGGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0029_G01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0203_B09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0029_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0032_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0077_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCNAGAATGACAATGACNACAT*TTTCCTG
LVRM1_0048_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0185_D01.b : CCACCATCTCCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0172_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0101_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATAACAATGACAACAT*TTTCCTG
LVR01_0073_H01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0103_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0168_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACGATGACAACAT*TTTCCTG
LVRM1_0024_A06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0176_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0045_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0173_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0207_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0202_C04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0184_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0094_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0172_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0175_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0093_A09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0163_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0186_C06.b : CCATCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0040_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0204_D09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0084_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0147_E09.b : CCACCATCTTCTATCAGCGCTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0127_A10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0139_H11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0101_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0049_E03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0089_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0098_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0012_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0068_B07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0068_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0094_E02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0187_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0129_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0027_E08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0038_G04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0094_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0069_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0132_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCTTGAATGACGCTGGCAACCT*CTTCCTG
LVRM1_0065_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0170_F06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAACGACAACAT*TTTCCTG
LVRM1_0179_E08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0020_B07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0049_C07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0016_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0004_F03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0073_E12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0184_F04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0198_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0048_E12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0031_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0044_H12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACATCTTTCCTG
LVRM1_0131_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0017_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0104_G04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0096_A07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0164_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0082_C09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0205_H09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0111_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0068_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0018_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0050_D10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0068_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_E05.b : CCACCATCTTCTATCAGCACTTGGGAGACTCCAAGAATGACTATGACAACAT*TTTCCTG
LVRM1_0010_H07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0020_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0010_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0076_H05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0181_H01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0104_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0094_B05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0043_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0195_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0181_A12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0194_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0198_H05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0185_D09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0075_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_F03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0192_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0097_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0106_E04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0175_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0188_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0111_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0103_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0095_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0179_E12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0034_H01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0177_A10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAACGACAATGACAACAT*TTTCCTG
LVRM1_0155_D03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0014_D02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_C09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0032_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0004_C08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0102_D02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0099_D12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0012_E04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0049_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0035_D10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0141_D02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0021_C08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0126_A11.b : CCACCATCTTCTATCAAGACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0080_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCNAGAATGACAATGACNACAT*TTTCCTG
LVRM1_0157_C03.b : CCACCATCTTCTATCAGCACTTGGCGGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0077_C11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCNAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0122_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0019_A11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0162_B09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0121_A08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAGCAT*TTTCCTG
LVR01_0003_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0061_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0072_C12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0012_E03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0003_A08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0005_F10.b : CCACCATCTTTTATCAACACTTGGCAGACTCCCAGAATGACTATGACAACAT*TTTTCTT
LVRM1_0131_E02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCTAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0134_G01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGATCACAT*TTTCCTG
LVRM1_0068_B04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0197_G01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0168_D10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0062_A06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0163_E02.b : CCGCCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0068_F10.b : CCACCATCTTCTATCAGCACTTGGCGGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0054_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0192_A09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0055_H07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0174_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0135_A04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0072_G04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_E04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0053_G06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0183_F06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0173_F04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0042_D09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0076_C12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0070_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0180_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0168_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0186_G04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0170_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0038_A02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0204_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0026_E04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0015_G01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0041_H01.b : CCACCATCTTCTATCAGCACTTGGCAGGCCCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0128_A03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0088_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0197_A07.b : CCACCATCATCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0136_A06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0062_A05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0164_B05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0208_A08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0167_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0175_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0184_A05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0106_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0145_F02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0164_G06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0009_A03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0051_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGGATGACAATGACAACAT*TTTCCTG
LVRM1_0115_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0182_B10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0041_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0104_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0100_C12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0106_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0116_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0114_G06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0126_A06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0083_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0093_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0187_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0065_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0068_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0095_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0198_F08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0061_F09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAGGAATGACAATGACAACAT*TTTCCTG
LVRM1_0192_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0192_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0047_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0079_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0056_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0034_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0043_A10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0166_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0160_G01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0042_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0149_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0015_E05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0050_C12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0033_E08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0162_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0018_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0078_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0017_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0177_H11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0009_C07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0145_A09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0007_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0144_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0152_F04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0127_H09.b : CCACCATCTTCTATCAGCACCTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0078_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0008_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0009_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0051_E11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGGATGACAATGACAACAT*TTTCCTG
LVRM1_0021_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0008_H11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0143_D02.b : CCACCATCTTCTATCAACACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0108_F07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0127_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0123_D10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0106_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0130_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0022_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0078_D05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0120_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0033_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0156_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0019_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0014_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0154_B11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0139_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0159_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0019_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0150_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0017_D10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0147_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0006_E06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0030_D04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0071_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0054_G12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0048_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0101_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0011_D06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0089_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0053_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0030_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0046_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0096_H05.b : CTACCATCTTCTATCAGCGCTTGGCAGACTTCTAGAATGACGATGACAACAT*TTTCCTG
LVRM1_0024_D06.b : CCACCATCTTCTATCGGCGCTTGGCAGACTCCAAGAATGGGGGTGGCAACAT*TTTCCTG
LVRM1_0177_C11.b : CCACCATCTTCTATCAGCACTTGGCAAACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0135_D02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0037_D04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0037_H03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0185_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0034_C05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0166_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0200_A02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0121_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0199_B01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0026_C08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0022_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0061_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACTACAT*TTTCCTG
LVRM1_0121_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCNCAGAATGACAATGACGACAT*TTTCCTG
LVRM1_0010_H08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0020_F02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0026_F03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTTCTG
LVRM1_0179_E06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0203_B05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0093_H10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0099_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0072_C11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0152_D08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0156_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0158_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0124_E03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0001_D04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0104_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0084_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0141_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
KDN01_0017_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0131_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACTT*TTTCCTG
LVRM1_0182_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0039_C01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0181_F11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0143_A12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0110_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0040_B07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0050_E10.b : TCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0121_E11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0076_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0027_A09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0043_D02.b : CCACCATCTTCTATCAACACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0172_A05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCGGGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_C08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0054_H02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0076_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCNAGAATGACAATGACNACAT*TTTCCTG
LVRM1_0057_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACACCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0100_A01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0196_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0196_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0053_B01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0195_C06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0201_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0022_E03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0113_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0075_C09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0092_F12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0105_H12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0186_D12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0117_G11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0125_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0003_F09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0128_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0034_E10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0030_F05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0140_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0141_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0042_D11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0008_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0104_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0012_C03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0067_D04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0015_B05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCCAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0047_F04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0081_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0002_E06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0059_F09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0048_H12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0205_H05.b : CCACCATCTTCTATCAGCACTTGGCATACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0208_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0081_C05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0134_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0159_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0055_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0188_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0048_H04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0074_A04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0081_G02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0168_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0170_G09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0067_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0165_D01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0047_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0121_H09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0104_F03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0068_C02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0200_F08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0180_A02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0087_G05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0132_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0057_F12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0206_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0172_C05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0067_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0035_D04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAAAGACAATGACAACAT*TTTCCTG
LVRM1_0109_E04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0124_H10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0079_A05.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0008_E09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0161_F01.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0159_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0009_B12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0142_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0052_C09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0150_F10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0142_H11.b : CC*CCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0049_E07.b : CCACCATCTTCTATCAGCACTTGGCAGACCCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0001_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0031_B09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0048_G04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0058_H06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0078_B06.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0046_G03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0068_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0104_G08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0025_B07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAGTGACAATGACAACAT*TTTCCTG
LVR01_0005_E03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0205_C11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0082_G07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0179_C09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0114_B09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAAAATGACAATGACAACAT*TTTCCTG
LVRM1_0004_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0194_C04.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0019_A03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0045_C10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0144_A08.b : CCACCATCTTCTATCAGCACTCGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0137_B03.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0172_H09.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0023_B02.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0128_F07.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0079_A11.b : CCACCATCTTCTATTAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0074_B08.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0044_F12.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0199_G10.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVRM1_0115_C11.b : CCACCATCTTCTATCAGCACTTGGCAGACTCCAAGAATGACAATGACAACAT*TTTCCTG
LVR01_0034_H02.b :
20110601C-000773 : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
---------+---------+---------+---------+---------+---------+ 625
LVR01_0020_G06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0090_G11.b : TCACCCCT*GAATATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0028_F02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0091_D12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0073_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0166_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0015_G11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0015_H12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0148_A02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0146_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0113_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0140_D11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0098_D09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0093_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0084_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0003_A07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0017_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0110_A11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0031_H09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0093_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0046_B04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0181_F05.b : TCATCCCT*GACTATCCCCACAGC*TTTTtgctatcaccaaccagggtgacccgcgacat
LVRM1_0083_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCACGCT*GGGTGCCTGTGACGAC
LVRM1_0087_F06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0047_A08.b : TCACCCCT*GAGTATCTCCACAGCCTTCTGCTATGACCAATCT*GGGTGCCAGTGACAAC
LVRM1_0058_G03.b : TCACCCCT*GAGTATCTCCGCAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0093_E07.b : TCCCCCCC*GAGTATCTCCACAGC*TTTTGCTATGACCAACCT*GGGTGCCTGTGACAAC
LVRM1_0020_C05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0136_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGCGCCTGTGACAAC
LVRM1_0097_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0171_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0086_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0091_E02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0207_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0136_H05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCNAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_C12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0165_C01.b : TCACCCCTGAAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0185_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0097_H03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0053_A02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0025_D11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAACT*GGGTGCCTGTGACAAC
LVRM1_0105_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0162_F02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0088_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0149_B01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0102_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0128_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0181_D12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0034_G03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0155_H04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0153_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0140_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0017_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0128_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0153_D05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0153_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0109_E11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0079_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0125_A05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0126_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0011_C07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0134_B01.b : TCGCCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0112_A08.b : TCACCCCT*GAGCATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0077_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0030_D05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0003_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0065_D12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0033_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0003_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0086_C07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0033_B01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0025_A09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0058_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0029_G01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0203_B09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0029_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0032_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0077_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0048_G11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACTAC
LVRM1_0185_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0172_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0101_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0073_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0103_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0168_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0024_A06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0176_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0045_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0173_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0207_H02.b : TCACCCCT*GAGTATCTCTACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0202_C04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGCGACAAC
LVRM1_0184_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0094_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0172_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0175_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0093_A09.b : TCACCCCT*GAGTACCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0163_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0186_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0040_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0204_D09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0084_D11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0147_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0127_A10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0139_H11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0101_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0049_E03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0089_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0098_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0012_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0068_B07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0068_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0094_E02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0187_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0129_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0027_E08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0038_G04.b : TCACCCCT*GAGCATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0094_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0069_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0132_D11.b : TCACCTTT*GTATATCTCCACCGC*TTTTGCTtatgaccaaactgggctgtctgtggcta
LVRM1_0065_G07.b : T**CCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0170_F06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0179_E08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0020_B07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0049_C07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0016_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0004_F03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0073_E12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0184_F04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0198_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0048_E12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0031_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0044_H12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0131_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACTAC
LVRM1_0017_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0104_G04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0096_A07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0164_G11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0082_C09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0205_H09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0111_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0068_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0018_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0050_D10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0068_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0165_E05.b : TCACCCCT*GAGTATCTCCGCACC*TTTTGCTATGAACAAGCT*GGGTGCGTGTGACACC
LVRM1_0010_H07.b : TCACCCCT*GTGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0020_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0010_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0076_H05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0181_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCA*GCT*GGGTGCCTGTGACAAC
LVRM1_0104_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0094_B05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0043_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0195_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0181_A12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0194_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0198_H05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0185_D09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0075_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0165_F03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0192_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0097_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0106_E04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0175_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGGCCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0188_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0111_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0103_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0095_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0179_E12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0034_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0177_A10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0155_D03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0014_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_C09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0032_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0004_C08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0102_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0099_D12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0012_E04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0049_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0035_D10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0141_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0021_C08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0126_A11.b : TCACCCCT*GAGTATCTCCACAGC*TCTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0080_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0157_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0077_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0122_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0019_A11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0162_B09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0121_A08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0003_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACCAC
LVR01_0061_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0072_C12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0012_E03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0003_A08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0005_F10.b : GCACCCCctgactactcccacacttttgcttctaccaagctgagtgcctgttattactct
LVRM1_0131_E02.b : TCACCCCT*GAGTAGCTCCACTGC*CTTTGCTATGATCAATCT*GGGAGCCTGTGACAAC
LVRM1_0134_G01.b : TTACCCCT*GAGTATCTCCACAGC*TTTTGCTATTACCAAGCT*GGGTGCCTGTTGCAAT
LVRM1_0068_B04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0197_G01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0168_D10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACGAC
LVRM1_0062_A06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0163_E02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGCGACAAC
LVRM1_0068_F10.b : TCACCCCT*GAGTATCTTCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0054_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0192_A09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0055_H07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0174_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0135_A04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0072_G04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACTAC
LVRM1_0165_E04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0053_G06.b : TCACCCCTTGAGTATCTCCACAGC*TTTTGCTATGACCAAGCTGGGGTGCCTGTGACAAC
LVRM1_0183_F06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0173_F04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTACGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0042_D09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0076_C12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0070_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0180_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0168_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0186_G04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0170_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0038_A02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0204_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0026_E04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0015_G01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0041_H01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0128_A03.b : TCACCCCT*GAGTATCTCCTCAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0088_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0197_A07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0136_A06.b : TCACCCCT*GAGTATCCCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0062_A05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0164_B05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0208_A08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0167_C02.b : TCACCCCT*GAGTATCACCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0175_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0184_A05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0106_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0145_F02.b : TCACCCCT*GAGTATCTCCATAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0164_G06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTACCTGTGACAAC
LVRM1_0009_A03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0051_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTGTGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0115_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0182_B10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0041_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0104_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0100_C12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0106_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0116_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0114_G06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0126_A06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0083_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0165_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0093_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0187_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0065_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0068_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0095_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0198_F08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0061_F09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0192_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0192_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0047_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0079_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0056_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0034_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0043_A10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0166_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0160_G01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0042_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0149_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0015_E05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0050_C12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0033_E08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0162_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0018_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0078_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0017_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0177_H11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0009_C07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0145_A09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0007_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0144_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0152_F04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0127_H09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0078_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0008_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0009_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0051_E11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTGTGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0021_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0008_H11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0143_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0108_F07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0127_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0123_D10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0106_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0130_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0022_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0078_D05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0120_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0033_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0156_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0019_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0014_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0154_B11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0139_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0159_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0019_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0150_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0017_D10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0147_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0006_E06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0030_D04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0071_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0054_G12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0048_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0101_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTGTGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0011_D06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0089_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0053_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0030_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0046_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0096_H05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCACTCT*GGGTGCCTGTGACAAC
LVRM1_0024_D06.b : TGACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTAACGAC
LVRM1_0177_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGAACAC
LVRM1_0135_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0037_D04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0037_H03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0185_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0034_C05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0166_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0200_A02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0121_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0199_B01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0026_C08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0022_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0061_D01.b : TCACCCCT*GAGTATCTGCACAGC*TCTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0121_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGATTAC
LVRM1_0010_H08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0020_F02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0026_F03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0179_E06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0203_B05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0093_H10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0099_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0072_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0152_D08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0156_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0158_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0124_E03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0001_D04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0104_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0084_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0141_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
KDN01_0017_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0131_E10.b : TCACCCCT*GAGTACCTCCCCAGC*CTTTtgctatgacccaacttggccttctgtgactt
LVRM1_0182_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0039_C01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGGCAAC
LVRM1_0181_F11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0143_A12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0110_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0040_B07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0050_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0121_E11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0076_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCCATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0027_A09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0043_D02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAGC
LVRM1_0172_A05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAACCT*GGGTGCCTGTGACAAC
LVRM1_0165_C08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0054_H02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0076_G11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0057_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0100_A01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0196_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0196_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0053_B01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0195_C06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0201_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0022_E03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0113_D11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0075_C09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0092_F12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0105_H12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0186_D12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0117_G11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0125_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0003_F09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0128_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0034_E10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0030_F05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0140_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0141_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0042_D11.b : TCACCCCCTGAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0008_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0104_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0012_C03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0067_D04.b : TCACCCCT*GAGTATCTGCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0015_B05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0047_F04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0081_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0002_E06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0059_F09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0048_H12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0205_H05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAACCT*GGGTGCCTGTGACAAC
LVRM1_0208_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0081_C05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0134_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0159_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0055_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0188_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0048_H04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0074_A04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0081_G02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0168_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0170_G09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0067_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0165_D01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0047_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0121_H09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0104_F03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0068_C02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0200_F08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0180_A02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0087_G05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0132_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0057_F12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0206_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0172_C05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0067_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0035_D04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0109_E04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0124_H10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0079_A05.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0008_E09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0161_F01.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0159_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0009_B12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0142_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0052_C09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0150_F10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0142_H11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0049_E07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0001_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0031_B09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0048_G04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0058_H06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0078_B06.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0046_G03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0068_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0104_G08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0025_B07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0005_E03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0205_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0082_G07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0179_C09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0114_B09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0004_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0194_C04.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0019_A03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0045_C10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0144_A08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0137_B03.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0172_H09.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0023_B02.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0128_F07.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0079_A11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0074_B08.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0044_F12.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0199_G10.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVRM1_0115_C11.b : TCACCCCT*GAGTATCTCCACAGC*TTTTGCTATGACCAAGCT*GGGTGCCTGTGACAAC
LVR01_0034_H02.b :
20110601C-000773 : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
---------+---------+---------+---------+---------+---------+ 682
LVR01_0020_G06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0090_G11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTATAGTTTGATACCATCTCTGACAAGACATCT
LVRM1_0028_F02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0091_D12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0073_E09.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0166_D06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0015_G11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0015_H12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0148_A02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0146_G10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0113_C11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0140_D11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0098_D09.b : ACCCT*CAAGCAGC*TGATGGGGGTG*TTTAAGTTTGATACCATCTCTGAANAAACATCT
LVR01_0093_E09.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0084_F11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0003_A07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0017_B06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0110_A11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0031_H09.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0093_E10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0046_B04.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0181_F05.b : caccttcaaaacggctggaggcaggtgttctgactttaacaccgacccatcaaagcaaag
LVRM1_0083_A01.b : ACTCT*GTAGCAGC*TGcagcacggagttgagtgcgatgccagcacggacaccaaccctg
LVRM1_0087_F06.b : ACCCT*ACAGCAGC*TGATGGAAGTG*TTTAAGTTCGAGACCATCCCTGAAACCACCCCC
LVR01_0047_A08.b : GCCCT*CAAGCAGC*TGATGGAAGTG*TTTAACTTTGATCCCTTCTCTGAAATAACATCT
LVRM1_0058_G03.b : ACCCT*CAAGCATC*TGATGGAGGTG*TTTAATTTTGATACCATCTCTGAGAAAA*ATCT
LVRM1_0093_E07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0020_C05.b : ACCCT*CAAGCAGC*TGATGCAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0136_A01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0097_B02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0171_H01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0086_H02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0091_E02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0207_D01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0136_H05.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0201_C12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0165_C01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0185_H06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0097_H03.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0053_A02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0025_D11.b : ACCCT*CAAACAGC*TGATGGAGGTG*TTTAAGCTTGATACCATCTCTGAGAAAATATCT
LVRM1_0105_H06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCC
LVRM1_0162_F02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0088_G12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0149_B01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCACCTCTGAGAAAACATCT
LVRM1_0102_B06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0201_H08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0128_B02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0181_D12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0034_G03.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0155_H04.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0153_H01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0140_C06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCCGAGAAAACATCT
LVRM1_0017_B08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0128_G08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0153_D05.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACGTCT
LVRM1_0153_D08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0109_E11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0079_H06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0125_A05.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0126_E10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0011_C07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0134_B01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0112_A08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0077_G07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0030_D05.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0003_E07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0065_D12.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0033_F10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0003_F11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0086_C07.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0033_B01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0025_A09.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0058_B03.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0029_G01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0203_B09.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0029_E10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0032_H08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0077_F10.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0048_G11.b : ACCCT*CAAGCAGC*TGATGGACGTG*TTTAAGTTTGATACCGTCTCTGAGAAAACATCT
LVRM1_0185_D01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0201_B02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0172_D01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0101_D08.b : ACCCT*CAAGCTGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0073_H01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVR01_0103_G08.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0168_H02.b : ACCCT*CAAGCGAC*TGATGGAGGTG*TTTAAGGTTGAT*CCATCTCTGAGAGA*CGTCT
LVRM1_0024_A06.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0176_B11.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTGAGAAAACATCT
LVRM1_0045_G02.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCGTCTCTGAGAAAACATCT
LVRM1_0173_D01.b : ACCCT*CAAGCAGC*TGATGGAGGTG*TTTAAGTTTGATACCATCTCTG