[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000779

Length: 1,701

Sequence [FASTA format sequence]
ACTGGACTTA GCGCGGGGGC GGCTCTGGGA AGCTAAGGCG GCTGGCTGTT CGGGCGTCAG
AACCTGCCCG AGCGCTCGGA GGCTGCAGAC CTAGGCCCTC GGCGGCGGCG GCGGAGCGCG
GTGAATCTAG GATCCACCTG CCAAAAATGT GGCGGCTCTT GGCCACCCTC AGCTGCCTGG
TGCTGCTGAC CAGTGCCCGG GAGAGTCTGC ATTTCCAGCC TCTGTCGGAT GAGCTGGTCA
ATTTTATTAA CAAGCAAAAC ACTACGTGGA CGGCCGGACA CAATTTCTAC AATGTGGACC
TGAGCTACGT GAAGAAGCTC TGTGGCACCT TCCTGGGTGG ACCCAAGCTG CCCCAGAGAG
CTGCTTTTGC TGCGGACATG ATCCTGCCCA AAAGCTTCGA TGCCCGGGAA CAGTGGCCCA
ACTGCCCGAC CATCAAAGAG ATCAGAGACC AGGGCTCCTG TGGCTCCTGC TGGGCGTTTG
GGGCTGTGGA AGCCATCTCT GACCGGATCT GCATCCGCAG CAACGGGCGT GTCAACGTGG
AGGTGTCCGC TGAGGACATG CTCACCTGTT GTGGCGACGA GTGTGGGGAT GGCTGTAACG
GTGGCTTTCC CTCTGGAGCC TGGAACTTCT GGACAAAGAA GGGCCTGGTG TCCGGGGGCC
TCTATGACTC GCATGTGGGT TGCAGGCCCT ACTCCATCCC ACCTTGCGAA CACCACGTGA
ACGGCTCCCG GCCCCCGTGC ACTGGGGAGG GGGACACCCC CAAGTGCAGC AAGATCTGCG
AGCCTGGCTA CACCCCGTCC TACAAAGAAG ACAAGCACTT CGGATGCAGC TCCTACAGCA
TCTCTAGGAA CGAGAAGGAG ATCATGGCGG AGATCTACAA AAACGGCCCG GTCGAGGGGG
CCTTCACTGT GTACTCGGAC TTCCTGCAGT ATAAGTCTGG AGTGTACCAG CACGTCACAG
GAGACTTGAT GGGAGGCCAT GCCATCCGCA TCCTGGGCTG GGGAGTGGAG AATGGCACCC
CCTACTGGCT GGTCGGCAAC TCCTGGAACA CAGACTGGGG TGACAATGGC TTCTTTAAGA
TCCTCAGAGG ACAGGATCAC TGTGGCATCG AGTCAGAGAT CGTGGCTGGA ATCCCATGTA
CTCCCCATTT CTAGAAGTGC TGATCTGTTT GGCCGCCCCT GGGGCAGTTT TTCCCGCAGT
ATAGCCCTTG GGATTGGGGG TGTGATGGGG GGATAGGAAA TGTCTTTTAT TCTTTGAGTT
CAGATAAGAT GCAGGCGTTT TTAGACAGGC CTCAAGGACT GGGTCGGGCC AAGCCTCGTG
TCTGCCATCA GCACTGTCTT CCAAGGAGAC ACAGCTAAGG CCTGATCAGG GAATGGACCG
CTGTCACATC ACAAACACCA CAGAAGCCGC CGCTTCCGCC GCCACCCGGA GAACGCACCC
CTCCTCAGAC TAGCTGTGTC CTGGCCGGTC CCACTCACTT CTGCCACGCA CCCCCTCCAC
ACTCCAGGCG CATCGCCTAG GAGCAGAACA GAGACCCCAG CATTCGTAGG TTTTCCCAGA
CTGGAAGGCC GAGCTCCTAC CCTGGACAGA GCCCTTCTGA AGCAGCAGCT GCTAAACCTG
GAGGAAGTTG AAGAANGTCT GGGTGGCCCC TGGGAAAAAA GCACAGTCTG CCTGGGCCCC
GCATCTGTCG AGCTTTGCGG A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinCTSBcathepsin B preproprotein [Homo sapiens]. 566e-161O
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 3 [Homo sapiens]. 1412e-33O
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 1 precursor [Homo sapiens]. 1412e-33
Contig/Assembly ProteinTINAGL1tubulointerstitial nephritis antigen-like isoform 2 precursor [Homo sapiens]. 1391e-32
Contig/Assembly ProteinTINAGtubulointerstitial nephritis antigen [Homo sapiens]. 1374e-32
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 isoform a preproprotein [Homo sapiens]. 1097e-24


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCtsbcathepsin B preproprotein [Mus musculus]. 541e-154O
Contig/Assembly ProteinTinagtubulointerstitial nephritis antigen [Mus musculus]. 1399e-33
Contig/Assembly ProteinTinagl1tubulointerstitial nephritis antigen-like precursor [Mus musculus]. 1342e-31
Contig/Assembly ProteinTinagl1tubulointerstitial nephritis antigen-like precursor [Mus musculus]. 1342e-31
Contig/Assembly ProteinCtscdipeptidyl peptidase 1 preproprotein [Mus musculus]. 1029e-22
Contig/Assembly ProteinCtshpro-cathepsin H preproprotein [Mus musculus]. 94.42e-19O
Contig/Assembly ProteinCtsscathepsin S preproprotein [Mus musculus]. 85.99e-17O
Contig/Assembly ProteinCtsll3cathepsin L-like 3 [Mus musculus]. 85.12e-16O
Contig/Assembly ProteinBC051665hypothetical protein LOC218275 [Mus musculus]. 791e-14O
Contig/Assembly ProteinCtszcathepsin Z preproprotein [Mus musculus]. 78.22e-14O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC486077PREDICTED: similar to cathepsin B preproprotein [Canis familiaris]. 590e-168
Contig/Assembly ProteinLOC478155PREDICTED: similar to P3ECSL [Canis familiaris]. 1436e-34
Contig/Assembly ProteinLOC481848PREDICTED: similar to tubulointerstitial nephritis antigen [Canis familiaris]. 1412e-33
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 [Canis lupus familiaris]. 1082e-23
Contig/Assembly ProteinLOC478608PREDICTED: similar to Dipeptidyl-peptidase I precursor (DPP-I) (DPPI) (Cathepsin C) (Cathepsin J) (Dipeptidyl transferase), partial [Canis familiaris]. 1043e-22
Contig/Assembly ProteinLOC479065PREDICTED: similar to Cathepsin H precursor [Canis familiaris]. 1004e-21O
Contig/Assembly ProteinLOC611983PREDICTED: similar to Cathepsin Z precursor (Cathepsin X) (Cathepsin P) [Canis familiaris]. 84.33e-16
Contig/Assembly ProteinCTSScathepsin S precursor [Canis lupus familiaris]. 844e-16O
Contig/Assembly ProteinLOC476010PREDICTED: similar to Cathepsin F precursor (CATSF) [Canis familiaris]. 78.62e-14
Contig/Assembly ProteinCTSL2cathepsin L1 precursor [Canis lupus familiaris]. 77.44e-14O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B precursor [Bos taurus]. 614e-176O
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen-like 1-like [Bos taurus]. 1465e-35
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen-like 1 isoform 2 [Bos taurus]. 1465e-35
Contig/Assembly ProteinTINAGtubulointerstitial nephritis antigen [Bos taurus]. 1334e-31
Contig/Assembly ProteinCTSCdipeptidyl peptidase 1 [Bos taurus]. 1081e-23
Contig/Assembly ProteinCTSHpro-cathepsin H precursor [Bos taurus]. 92.88e-19O
Contig/Assembly ProteinCTSZcathepsin Z precursor [Bos taurus]. 85.51e-16O
Contig/Assembly ProteinCTSScathepsin S precursor [Bos taurus]. 821e-15O
Contig/Assembly ProteinCTSL1cathepsin L1 [Bos taurus]. 80.16e-15O
Contig/Assembly ProteinCTSL2cathepsin L2 precursor [Bos taurus]. 79.39e-15O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCTSBcathepsin B precursor [Sus scrofa]. 6610.0O
Contig/Assembly ProteinTINAGL1PREDICTED: tubulointerstitial nephritis antigen [Sus scrofa]. 1402e-33O
Contig/Assembly ProteinLOC100153159PREDICTED: tubulointerstitial nephritis antigen [Sus scrofa]. 1333e-31
Contig/Assembly ProteinLOC100522387PREDICTED: dipeptidyl peptidase 1-like [Sus scrofa]. 1081e-23
Contig/Assembly ProteinCTSHpro-cathepsin H precursor [Sus scrofa]. 997e-21O
Contig/Assembly ProteinLOC100153090PREDICTED: cathepsin S [Sus scrofa]. 842e-16O
Contig/Assembly ProteinLOC100627406PREDICTED: cathepsin S-like [Sus scrofa]. 842e-16O
Contig/Assembly ProteinCTSL1cathepsin L1 precursor [Sus scrofa]. 83.63e-16O
Contig/Assembly ProteinCTSZcathepsin Z [Sus scrofa]. 82.47e-16O
Contig/Assembly ProteinCTSFPREDICTED: cathepsin F [Sus scrofa]. 78.21e-14


Assembly Members: 189      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010008H03ADR01_0008_H03.bDB782271 
ADR010012C07ADR01_0012_C07.bDB782578 
ADR010019B07ADR01_0019_B07.bDB783147 
ADR010020F05ADR01_0020_F05.bDB783265 
ADR010031B12ADR01_0031_B12.bDB784217 
ADR010048D01ADR01_0048_D01.bDB785762 
ADR010059D09ADR01_0059_D09.bDB786755 
ADR010079C03ADR01_0079_C03.bDB788511 
BFLT10019G09BFLT1_0019_G09.bFS641569 
BFLT10022H11BFLT1_0022_H11.bFS641835 
BFLT10030G03BFLT1_0030_G03.bFS642472 
BFLT10035F07BFLT1_0035_F07.bFS642879 
BFLT10036G01BFLT1_0036_G01.bFS642960 
BFLT10099C05BFLT1_0099_C05.bFS647886 
BFLT10103F05BFLT1_0103_F05.bHX201997 
BMWN10073G08BMWN1_0073_G08.bHX210065 
CBLT10027C11CBLT1_0027_C11.bHX213741 
CBLT10047H06CBLT1_0047_H06.b  
CLNT10063C01CLNT1_0063_C01.bFS662005 
CLNT10092D01CLNT1_0092_D01.bFS663703 
DCI010021C12DCI01_0021_C12.bDB792160 
DCI010028F01DCI01_0028_F01.bDB792802 
DCI010045D03DCI01_0045_D03.bDB794198 
DCI010118A02DCI01_0118_A02.bDB799993 
HTMT10033E10HTMT1_0033_E10.bFS666624 
ILNT10064G06ILNT1_0064_G06.bHX231860 
ITT010008F03ITT01_0008_F03.bBW976736 
ITT010048B12ITT01_0048_B12.bBW980222 
ITT010063B06ITT01_0063_B06.bBW981575 
ITT010072F01ITT01_0072_F01.bBW982426 
ITT010076A09ITT01_0076_A09.bBW982729 
KDN010004B01KDN01_0004_B01.bFS671479 
KDN010004E01KDN01_0004_E01.b  
KDN010006A03KDN01_0006_A03.bFS671597 
KDN010007G05KDN01_0007_G05.bFS671742 
KDN010008B06KDN01_0008_B06.bFS671770 
KDN010009G09KDN01_0009_G09.bFS671891 
KDN010011B05KDN01_0011_B05.bFS671995 
KDN010012H06KDN01_0012_H06.bFS672134 
KDN010015E02KDN01_0015_E02.bFS672337 
KDN010015E11KDN01_0015_E11.bFS672345 
KDN010017D01KDN01_0017_D01.bFS672471 
KDN010021F06KDN01_0021_F06.bFS672781 
KDN010021F12KDN01_0021_F12.bFS672786 
KDN010025D08KDN01_0025_D08.bFS673082 
KDN010025E11KDN01_0025_E11.bFS673095 
KDN010026D08KDN01_0026_D08.b  
KDN010028F10KDN01_0028_F10.bFS673336 
KDN010031H05KDN01_0031_H05.bFS673596 
KDN010039G05KDN01_0039_G05.b  
KDN010040E11KDN01_0040_E11.b  
KDN010040F03KDN01_0040_F03.b  
KDN010043A07KDN01_0043_A07.bFS674166 
KDN010043B03KDN01_0043_B03.bFS674171 
KDN010046B05KDN01_0046_B05.bFS674366 
KDN010047E11KDN01_0047_E11.bFS674407 
KDN010049H11KDN01_0049_H11.b  
KDN010051G04KDN01_0051_G04.b  
KDN010054B01KDN01_0054_B01.bFS674716 
KDN010062F04KDN01_0062_F04.bFS675391 
KDN010067B05KDN01_0067_B05.bFS675757 
KDN010067G01KDN01_0067_G01.bFS675802 
KDN010071E04KDN01_0071_E04.bFS676092 
KDN010079B12KDN01_0079_B12.bFS676704 
KDN010082F01KDN01_0082_F01.bFS676966 
KDN010086A12KDN01_0086_A12.bFS677234 
KDN010086F02KDN01_0086_F02.bFS677275 
KDN010088A09KDN01_0088_A09.bFS677390 
KDN010094D09KDN01_0094_D09.bFS677916 
KDN010094G04KDN01_0094_G04.bFS677944 
KDN010096H10KDN01_0096_H10.bFS678118 AK393731
KDN010098A08KDN01_0098_A08.bFS678198 
KDN010099B12KDN01_0099_B12.bFS678289 
KDN010099D03KDN01_0099_D03.bFS678302 
KDN010100G05KDN01_0100_G05.bFS678417 
LNG010007A07LNG01_0007_A07.bBP433504 
LVR010036C01LVR01_0036_C01.bBP442809 AK232389
LVR010048C03LVR01_0048_C03.bBP442972 
LVR010050C03LVR01_0050_C03.bBP442974 
LVR010050H12LVR01_0050_H12.bBP448107 
LVR010063B05LVR01_0063_B05.bBP442221 
LVR010067C09LVR01_0067_C09.bBP443430 
LVR010083E08LVR01_0083_E08.bCJ000050 
LVR010086H02LVR01_0086_H02.bCJ000331 
LVR010091D10LVR01_0091_D10.bCJ000717 
LVR010098F04LVR01_0098_F04.bBP445719 
LVR010099F12LVR01_0099_F12.bBP446301 
LVRM10013C07LVRM1_0013_C07.bBP450114 
LVRM10019H03LVRM1_0019_H03.bBP140832 
LVRM10037A08LVRM1_0037_A08.bCJ001551 
LVRM10042H08LVRM1_0042_H08.bCJ002038 
LVRM10043G10LVRM1_0043_G10.bCJ002118 
LVRM10047C04LVRM1_0047_C04.bCJ002287 
LVRM10056E02LVRM1_0056_E02.bBP139423 
LVRM10056E05LVRM1_0056_E05.bBP139531 
LVRM10058B04LVRM1_0058_B04.bBP138087 
LVRM10058C10LVRM1_0058_C10.bBP138799 
LVRM10064F05LVRM1_0064_F05.bBP139993 
LVRM10072H12LVRM1_0072_H12.bBP454591 
LVRM10077F08LVRM1_0077_F08.bBP140115 
LVRM10122E10LVRM1_0122_E10.bBP452009 
LVRM10125B07LVRM1_0125_B07.bBP449358 
LVRM10127D10LVRM1_0127_D10.bBP451220 
LVRM10150A10LVRM1_0150_A10.bBP448786 
LVRM10174C11LVRM1_0174_C11.bCJ004966 
LVRM10189D03LVRM1_0189_D03.bCJ006199 
MLN010032B07MLN01_0032_B07.bCJ010111 
MLN010054H07MLN01_0054_H07.bCJ011917 
OVR010032E06OVR01_0032_E06.bBP143245 
OVR010033C02OVR01_0033_C02.bBP142188 
OVR010046C09OVR01_0046_C09.bBP142469 
OVR010059B10OVR01_0059_B10.bBW964854 
OVR010060H04OVR01_0060_H04.bBW965009 
OVR010080B06OVR01_0080_B06.bBW966665 
OVR010084B06OVR01_0084_B06.bBW966904 
OVR010091H12OVR01_0091_H12.bBW967500 
OVR010096A06OVR01_0096_A06.bBW967804 
OVR010096F07OVR01_0096_F07.b  
OVR010100C06OVR01_0100_C06.bBW968136 
OVRM10003E12OVRM1_0003_E12.bBP151038 AK234658
OVRM10039F04OVRM1_0039_F04.bBP459653 
OVRM10057F06OVRM1_0057_F06.bBP151688 
OVRM10057G08OVRM1_0057_G08.bBP153133 
OVRM10084C06OVRM1_0084_C06.bBP147954 
OVRM10107A11OVRM1_0107_A11.bBP145995 
OVRM10110B01OVRM1_0110_B01.bBP146210 
OVRM10113H12OVRM1_0113_H12.bBP154972 
OVRM10115G12OVRM1_0115_G12.bBP153644 
OVRM10118C01OVRM1_0118_C01.bBP147480 
OVRM10148A01OVRM1_0148_A01.bBP454664 
OVRM10179C01OVRM1_0179_C01.bCJ016134 
OVRM10194H08OVRM1_0194_H08.bBP461953 
OVRM10199B02OVRM1_0199_B02.bBP455690 
OVRT10005A04OVRT1_0005_A04.bFS686752 
OVRT10015F10OVRT1_0015_F10.bFS687649 
OVRT10034D12OVRT1_0034_D12.bFS689162 
OVRT10036B07OVRT1_0036_B07.bFS689312 
OVRT10038F03OVRT1_0038_F03.bFS689517 
OVRT10068C01OVRT1_0068_C01.bFS691954 
OVRT10070B08OVRT1_0070_B08.bFS692116 
OVRT10073D02OVRT1_0073_D02.bFS692346 
OVRT10095C10OVRT1_0095_C10.bFS694143 
PCT010007H05PCT01_0007_H05.b  
PCT010008F05PCT01_0008_F05.bFS695178 
PCT010014C05PCT01_0014_C05.bFS695567 
PCT010015E10PCT01_0015_E10.bFS695649 
PST010081A12PST01_0081_A12.bFS703209 
PST010098C02PST01_0098_C02.bFS704543 
PTG010031G03PTG01_0031_G03.bFS707163 
PTG010033E06PTG01_0033_E06.bFS707319 
PTG010074F05PTG01_0074_F05.bFS710718 
PTG010109G09PTG01_0109_G09.bFS713258 
SKNB10002H12SKNB1_0002_H12.bDB800202 
SKNB10008A06SKNB1_0008_A06.b  
SKNB10008B08SKNB1_0008_B08.b  
SKNB10062C01SKNB1_0062_C01.bDB803733 
SKNB10070D05SKNB1_0070_D05.bDB804250 
SKNB10089G01SKNB1_0089_G01.b  
SMG010001G11SMG01_0001_G11.bFS713548 
SMG010006H10SMG01_0006_H10.bFS713999 
SMG010023C09SMG01_0023_C09.bFS715263 
SMG010060C01SMG01_0060_C01.bFS718437 
SMG010062G07SMG01_0062_G07.bFS718655 
SPL010018E05SPL01_0018_E05.bBP158151 
SPL010026D06SPL01_0026_D06.bBP157834 
SPL010051E12SPL01_0051_E12.bCJ017620 
SPL010052G07SPL01_0052_G07.bCJ017731 
SPL010057F08SPL01_0057_F08.bCJ018165 
SPL010068F02SPL01_0068_F02.bCJ019151 
SPL010081F04SPL01_0081_F04.b  
SPL010084C10SPL01_0084_C10.bCJ020581 
SPL010092H12SPL01_0092_H12.bCJ021346 
SPLT10011A04SPLT1_0011_A04.bHX240018 
SPLT10014H11SPLT1_0014_H11.bHX240312 
SPLT10074G11SPLT1_0074_G11.bHX244986 
SPLT10083B04SPLT1_0083_B04.bHX245647 
SPLT10092C01SPLT1_0092_C01.bHX246358 
TCH010040E08TCH01_0040_E08.bCJ025432 
TCH010063A12TCH01_0063_A12.bCJ026901 
THY010062H02THY01_0062_H02.bBP168254 
THY010064D07THY01_0064_D07.bBP163749 
THY010066H07THY01_0066_H07.bBP168797 
THY010097B07THY01_0097_B07.bBP161276 
THY010205F10THY01_0205_F10.bBP166611 
UTR010014D02UTR01_0014_D02.bBP171019 
UTR010015G03UTR01_0015_G03.bBP172660 
UTR010022E08UTR01_0022_E08.bBP171827 
UTR010047D02UTR01_0047_D02.bBP171050 
UTR010088F03UTR01_0088_F03.bCJ038140 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
197C109300.832WSGCC/A
T2800.168GCT/A
536C76260.611WSAAC/N
T6500.389AAT/N
707C100130.790WSTGC/C
T3000.210TGT/C


Alignment:      TOP

20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0036_C01.b : ttttggggacctattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0047_H06.b : nttaagaggaacacgccgtaxxxxxxx
HTMT1_0033_E10.b : caggtaacgacgccgtxxxxxxxxxxxxxxxxxxxx
ADR01_0019_B07.b : aacaxxxxxxxxxx
LVRM1_0058_B04.b : aagttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_F05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D03.b : xxxxxxxxxxxxxxx
SMG01_0006_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0199_B02.b : cgttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_G08.b : ttgacxxxxxxxxxxxxxxxxxx
LVRM1_0019_H03.b : cgttgacxxxxxxxxxxxxxxxxxxxx
OVR01_0059_B10.b : ttgcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0109_G09.b : cggttgannnnnttggctaagcagcxxxxxxxxx
SPL01_0018_E05.b : caatctaggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_H04.b : nnnggcttggactatgacagtttgtacxxxxxxxxxxxxxxxxxxx
OVR01_0096_A06.b : gcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxx
SPL01_0084_C10.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_H07.b : tggggtggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0015_F10.b : nnnnccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_E06.b : ggggcctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_F10.b : cgctttttggtgactanntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_B05.b : cggcccaccaagcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_C02.b : gggggcttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0062_H02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_C10.b : nccgctttnnnnnnnnccgttagcgttcgxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_C01.b : nngggttatnnnnnggatxxxxxxxxxxxxxxx
TCH01_0063_A12.b : nnnggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0098_A08.b : nnnn
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : ttttggacggtacg
ADR01_0031_B12.b : nncctttnan
OVRT1_0073_D02.b : nggcgtttnnnnnnnccgttagcgnac
LVRM1_0122_E10.b : nagt
SKNB1_0008_A06.b :
LVRM1_0042_H08.b : ag
PTG01_0033_E06.b : ncccctaa
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b : ggcaxxxxxxxxxxxxxxxxx
ADR01_0048_D01.b :
BFLT1_0035_F07.b : nggatacgtca
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b : nnnnggttggactatna
SPL01_0057_F08.b : nnnnggctaggactatna
KDN01_0006_A03.b :
CLNT1_0092_D01.b : nntttccgtca
BFLT1_0030_G03.b : ggattcc
LVR01_0067_C09.b : gtgttaagaataaaacgcttagtgxxxxxxxxxx
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b : nnnnnnn
LVRM1_0174_C11.b : n
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b : nttttgctaggacttga
SPL01_0092_H12.b : ngggtgctaggactatnac
SPL01_0026_D06.b : ctttatggtgxxxxxxxxxxxxxx
PTG01_0031_G03.b :
UTR01_0015_G03.b : gggggccxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0062_G07.b : nnggc
UTR01_0088_F03.b : nnnnggctagtgacttnac
SPL01_0052_G07.b : nnnnggctaggactatnacx
LVR01_0050_C03.b : ggggtatttnntagctttgtgactxxxxxxx
MLN01_0054_H07.b : nnnttgctaggacttaaa
UTR01_0047_D02.b : ctxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_F02.b : nnnggctaggactatnac
CLNT1_0063_C01.b : nnnaacttc
LVR01_0098_F04.b : gcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_F03.b : nnnnccgtca
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b : nggactcgtta
BFLT1_0036_G01.b : gggatccgtca
LNG01_0007_A07.b : ggtttttttggcttagtgxxxxxxxxxxx
OVRT1_0068_C01.b : nggggttnnnnnnnnccgttc
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b : nnnggc
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : agg
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b : gggggta
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : ...........................ACTGGACTTAGCGCGGGGGCGGCTCTGGGAAGC
---------+---------+---------+---------+---------+---------+ 33
LVR01_0036_C01.b : xxxxxxxxxxxxxxxxxxxccttttctACTGGACTTAGCGCGGGGGCGGCTCTGGGAAGC
CBLT1_0047_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTTAGCGCGGGCCCGTATCTGGGAAGC
HTMT1_0033_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtACTTAGCGCGGGGGCGGCTCTGGGAAGC
ADR01_0019_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0064_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0047_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0189_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SMG01_0006_H10.b : nnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0199_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0072_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0057_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVRM1_0019_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0059_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
PTG01_0109_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SPL01_0018_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0060_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0096_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SPL01_0084_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0066_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRT1_0015_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0032_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0205_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
LVR01_0063_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVR01_0033_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
THY01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
OVRT1_0095_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
SMG01_0060_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
TCH01_0063_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAGCGCGGGGGCGGCTCTGGGAAGC
KDN01_0098_A08.b : ggctgcgttggctctggaaaaaaaaaaaaaaaacTTAGCGCGGGGGCGGCTCTGGGAAGC
SKNB1_0070_D05.b : nnnnggggatnnnnnnnnccaacgcgtccacggnaTAGCGCGGGGGCGGCTCTGGGAAGC
OVRM1_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGGGGGCGGCTCTGGGAAGC
KDN01_0021_F12.b : ttttttgctgcggtggctctggacttGCGCGGGGGCGGCTCTGGGAAGC
PST01_0081_A12.b : nnnactgcgttggctctggacttGCGCGGGGGCGGCTCTGGGAAGC
PST01_0098_C02.b : nnnnncctgcgttggctctggacttGCGCGGGGGCGGCTCTGGGAA*C
KDN01_0067_G01.b : nnnnggctacgtttgctatggaCGCGGGGGCGGCTCTGGGAAGC
SKNB1_0089_G01.b : nnnacttgctgcttgctctcgtctaggcgcGGGCGCCTCTGGGAAN*
BMWN1_0073_G08.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCGGCTCTGGGAAGC
ADR01_0031_B12.b : aaaactaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAAGC
OVRT1_0073_D02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGC
LVRM1_0122_E10.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGC
SKNB1_0008_A06.b : nnnncctcacggttgctacggctgggAGC
LVRM1_0042_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
PTG01_0033_E06.b : annnnggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
ADR01_0020_F05.b : caacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
SPLT1_0014_H11.b : nnnngggcaagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctg
ADR01_0048_D01.b : ttttaatatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
BFLT1_0035_F07.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0008_F05.b : nnnnccgagatnnnnnnnccagcgttgtgcacgg
TCH01_0040_E08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0057_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0006_A03.b : nttttgcttacggttgctatg
CLNT1_0092_D01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0030_G03.b : gttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0002_H12.b : tctcacgttggcact
KDN01_0026_D08.b : nncctcgctgtggctct
KDN01_0049_H11.b : gcgttggctct
KDN01_0007_G05.b : nnccctttnnnnnnncctgcgtttgctat
KDN01_0071_E04.b : tttcctgcggttgctat
KDN01_0099_D03.b : nnnnggctactgttgctat
KDN01_0043_A07.b : nttttactgcggtggctat
KDN01_0043_B03.b : nnnnnggccgcgtttgctat
KDN01_0062_F04.b : nnnncctgctgttgctct
KDN01_0082_F01.b : nnntttgctgagttggctat
KDN01_0096_H10.b : nntttcctgaggttggctct
KDN01_0040_E11.b : ttttcctgcggtggctat
KDN01_0008_B06.b : nncccgtttnnnnnnccctgcgttgtgctct
KDN01_0100_G05.b : nnnnngctgaggttgctat
SKNB1_0008_B08.b : nnnttcctcacgttggctct
KDN01_0015_E02.b : nncctttttnnnnnnncctgcggtggctct
KDN01_0094_D09.b : nnnnncctgctgttgctat
KDN01_0086_A12.b : nnnnnggctacggtggctat
PTG01_0074_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_G10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F08.b : gttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_E02.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0008_H03.b : nnttgtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_E12.b : cagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0031_G03.b : tttttttgctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0062_G07.b : gtattnnnnggctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0054_H07.b : cagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0063_C01.b : tgcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_F03.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0079_C03.b : aaaaanggataaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_A09.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_F03.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0072_F01.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0019_G09.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0036_G01.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0007_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_C01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0051_G04.b : cgctattaccagtacgttgtctac
KDN01_0004_B01.b : nccgattttnnnnntncctaaagtgtgcacg
KDN01_0004_E01.b : ncccgtccttnnnntntncctacgtngtgcacg
KDN01_0088_A09.b : ttttttgctgaggtggct
KDN01_0009_G09.b : nccgttnnnnnnncctacgtttgctct
KDN01_0025_E11.b : ttttgtggctgttgctat
KDN01_0039_G05.b : ttttcctacgtggct
KDN01_0025_D08.b : tttttcctgctgtggcta
SPL01_0081_F04.b : ttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0074_G11.b : nnnccgcggtagaggccgtagtattaaxxxxxxxxxxxxxxxxx
OVR01_0096_F07.b : xxxxxxxxxxxxxxxxxxxxx
SPLT1_0011_A04.b : nnnnggcgagtacacgccgtaxxxxxxxxxxxxxx
OVRT1_0005_A04.b : nccgtttnnnnnnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0092_C01.b : nnnggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0027_C11.b : tttttccaggtacacgxxxxxxxxxxxxxxxxx
OVRM1_0003_E12.b : agcttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_D10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0080_B06.b : nngggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_H08.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_E05.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0084_B06.b : gctttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_G12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_A11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0046_C09.b : catttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_H12.b : nttgtgctaggactatgacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_C09.b : nccgataannnnggactaagcagcggtaxxxxxxxxxx
UTR01_0022_E08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0001_G11.b : nnncccttaannnnatgaactacaxxxxxxxxxxxxxxxxx
ITT01_0063_B06.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxx
THY01_0097_B07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_C03.b : tcagggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_B07.b : nnnggcttttnngggnnccctcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_D09.b : nnnncccatgaacaxxxxxxxxxxxxxxxxxx
OVRT1_0070_B08.b : ncccttttnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0022_H11.b : gaactccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_B12.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
KDN01_0031_H05.b :
KDN01_0017_D01.b : nccg
LVRM1_0125_B07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0013_C07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_F06.b : xxxxxxxxxxxxxxxx
LVR01_0083_E08.b : attttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_H12.b : tgggcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0034_D12.b : nttctttnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0062_C01.b : nnnngc
KDN01_0094_G04.b :
PCT01_0015_E10.b : nnnnggc
KDN01_0021_F06.b :
PCT01_0014_C05.b : nnncccg
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxx
BFLT1_0099_C05.b : gattcgtttgcgnacgxxxxxxxxxxxxxxxxx
KDN01_0046_B05.b :
LVR01_0091_D10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0011_B05.b : cgcatgn
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
---------+---------+---------+---------+---------+---------+ 91
LVR01_0036_C01.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
CBLT1_0047_H06.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
HTMT1_0033_E10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0019_B07.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0058_B04.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0064_F05.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0047_C04.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0189_D03.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0006_H10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0199_B02.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0072_H12.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0057_G08.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0019_H03.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0059_B10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PTG01_0109_G09.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0018_E05.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0060_H04.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0096_A06.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0084_C10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
THY01_0066_H07.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0015_F10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0032_E06.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
THY01_0205_F10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0063_B05.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0033_C02.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
THY01_0062_H02.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0095_C10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0060_C01.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
TCH01_0063_A12.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0098_A08.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0070_D05.b : TA*GGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0039_F04.b : TAAAGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0021_F12.b : *AAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PST01_0081_A12.b : *AAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PST01_0098_C02.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0067_G01.b : *AAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0089_G01.b : TAAGGCGGCTGGCTGTTCCGGCGTCCGAACC*TGCCCCAGCGCTCG*GAGGCTGCAGACC
BMWN1_0073_G08.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0031_B12.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0073_D02.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0122_E10.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0008_A06.b : TA*GGCGGCTCGCTGTTCGGGCGTCAGAACC*TGCCCCCTACTACA*GAGGCTGNAGACC
LVRM1_0042_H08.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PTG01_0033_E06.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0020_F05.b : GAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPLT1_0014_H11.b : GAAGGCGGCTGGCTGTTCGGGCGTCAAAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0086_H02.b : GAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0048_D01.b : GAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0035_F07.b : TAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0150_A10.b : xAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PCT01_0008_F05.b : nAAGGCGGCTGGCTGTTCGGGCGTCA*AACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
TCH01_0040_E08.b : xAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0057_F08.b : xAAGGCGGCTGGCTGTTCGGGCGTCGGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0006_A03.b : gTAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
CLNT1_0092_D01.b : xTAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0030_G03.b : xAAGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0067_C09.b : xAAGGCGGCTGGTTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0002_H12.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0026_D08.b : ggAGGCGGCTGGCTGTTCAGGCGTCAAAACC*TGCCCGAGCGCTCG*GATGCTGCAGACC
KDN01_0049_H11.b : ggAGGCGGCTGGCTGT*CGGGCGTCAG*ACC*TGCCCGAGCGCTCG*GAGCCTTT*GACC
KDN01_0007_G05.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0071_E04.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0099_D03.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0043_A07.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0043_B03.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0062_F04.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0082_F01.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTCCATACC
KDN01_0096_H10.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0040_E11.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCATACA
KDN01_0008_B06.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0100_G05.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0008_B08.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GACCCTTAAAACC
KDN01_0015_E02.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0094_D09.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0086_A12.b : ggAGGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PTG01_0074_F05.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0174_C11.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0043_G10.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0077_F08.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0056_E02.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0008_H03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0051_E12.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0092_H12.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0026_D06.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCCGCAGACC
PTG01_0031_G03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
UTR01_0015_G03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0062_G07.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
UTR01_0088_F03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0052_G07.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0050_C03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
MLN01_0054_H07.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCGGACC
UTR01_0047_D02.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0068_F02.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
CLNT1_0063_C01.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0098_F04.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0038_F03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0079_C03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0076_A09.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0008_F03.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0072_F01.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0019_G09.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0036_G01.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LNG01_0007_A07.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0068_C01.b : xxxGGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0051_G04.b : ggaaGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCGTGACCCTTAGAAGC
KDN01_0004_B01.b : gnaaGCGGCTGGCTGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0004_E01.b : tgaaGCGGCTGGCTGTTCGGGCGTCAAAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0088_A09.b : atatGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0009_G09.b : ggtaGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0025_E11.b : ggtaGCGGCTGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0039_G05.b : atggagcggcGGCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTCCTTACA
KDN01_0025_D08.b : tggaggcggctaCTGTTCGGGCGTC*GAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPL01_0081_F04.b : xxxxxxxxxxxxxTGTTCGGGCGTCAGAACCATGCCCGAGCGCTCG*GAGGCTGCAGACC
SPLT1_0074_G11.b : xxxxxxxxxxxxxgGTTCGGGCGTCAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0096_F07.b : xxxxxxxxxxxccttaaactactgGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCCTACC
SPLT1_0011_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxtgGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SPLT1_0092_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGAGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
CBLT1_0027_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxAGAACC*TGCCCGACCGTTCG*GAGGCTGCAGACC
OVRM1_0003_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0127_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0113_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0080_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0148_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0194_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0058_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0056_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0118_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0084_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0084_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0115_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0107_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0046_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVR01_0091_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0023_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
UTR01_0022_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxgGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SMG01_0001_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0063_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
THY01_0097_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0048_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0036_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ADR01_0059_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0070_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0022_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
ITT01_0048_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGAACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0031_H05.b : nctcgcgttggctatgggtcgACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0017_D01.b : ttttnnnnnnccatgcttgtgctcggagACC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0125_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVRM1_0013_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRM1_0057_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0083_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
LVR01_0050_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
OVRT1_0034_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
SKNB1_0062_C01.b : ggggnnnnncctcacgtttgctactggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0094_G04.b : nncctgcgttggctatggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PCT01_0015_E10.b : gtgtangnnnncctgcgtttgctctggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0021_F06.b : nnnnnnncctgcgttggctactggaaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
PCT01_0014_C05.b : tagannnnnncctgcgttgtgctctggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0099_B12.b : nnnnggctgcggtggctatggagaC*TGCCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0040_F03.b : nnnncctgctgtggctctggactgCCGAGCGCTCG*GAGGCTGCAGACC
KDN01_0079_B12.b : nnnggccgctgtggctctggagacctgCCGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0103_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCGCTCG*GAGGCTGCAGACC
BFLT1_0099_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCGCTCG*GAGGCTGCAGACC
KDN01_0046_B05.b : acctttAGACC
LVR01_0091_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACC
KDN01_0011_B05.b : nnnnncctgcgttggctctggattatgaccctggaacctgggagaaggagcgtcttaggg
ADR01_0012_C07.b : nnnnggtgaacaxx
PCT01_0007_H05.b : nnnccggactnnnnn
THY01_0064_D07.b : cttttgagtggcxx
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
---------+---------+---------+---------+---------+---------+ 147
LVR01_0036_C01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
CBLT1_0047_H06.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
HTMT1_0033_E10.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0019_B07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0058_B04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0064_F05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0047_C04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0189_D03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SMG01_0006_H10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0199_B02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0072_H12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0057_G08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0019_H03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0059_B10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PTG01_0109_G09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0018_E05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0060_H04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0096_A06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0084_C10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
THY01_0066_H07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0015_F10.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0032_E06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
THY01_0205_F10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAA*A
LVR01_0063_B05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0033_C02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
THY01_0062_H02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0095_C10.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SMG01_0060_C01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
TCH01_0063_A12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0098_A08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0070_D05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0039_F04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0021_F12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PST01_0081_A12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PST01_0098_C02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0067_G01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0089_G01.b : TAGGCCCTCCGCCGGCGCGGCGG***AGCGC*GGTGAATCTAGGATCCCCCTGCCAAAAA
BMWN1_0073_G08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0031_B12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0073_D02.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0122_E10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0008_A06.b : TAGGCCCTCGGCGGCGGCGGCCGTGAA**GA*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0042_H08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PTG01_0033_E06.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0020_F05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPLT1_0014_H11.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0086_H02.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0048_D01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0035_F07.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0150_A10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PCT01_0008_F05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
TCH01_0040_E08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0057_F08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0006_A03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
CLNT1_0092_D01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0030_G03.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0067_C09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0002_H12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0026_D08.b : TAAGCCCTCGGCGGCTGCGGCGG***ACCGC*GGCGAATCTAGGATCCACCTGCATAAAA
KDN01_0049_H11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0007_G05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0071_E04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0099_D03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0043_A07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0043_B03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0062_F04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0082_F01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0096_H10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0040_E11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0008_B06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0100_G05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0008_B08.b : TCGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTCTTTCTAGGATCCACCTGCCAAAAA
KDN01_0015_E02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0094_D09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0086_A12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PTG01_0074_F05.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0174_C11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0043_G10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0077_F08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0056_E02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0008_H03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0051_E12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0092_H12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0026_D06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PTG01_0031_G03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
UTR01_0015_G03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SMG01_0062_G07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
UTR01_0088_F03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0052_G07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0050_C03.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
MLN01_0054_H07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
UTR01_0047_D02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0068_F02.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
CLNT1_0063_C01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0098_F04.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0038_F03.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0079_C03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ITT01_0076_A09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ITT01_0008_F03.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ITT01_0072_F01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0019_G09.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0036_G01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LNG01_0007_A07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0068_C01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0051_G04.b : TGGGCCCTCGGGGGCGGCGGCGG***AGCGC*GGCCTTTCTAGGATCCACCTGCCAAAAA
KDN01_0004_B01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0004_E01.b : TAGGCCCTCGGCGGCGGCGGCGGA***GCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0088_A09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0009_G09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0025_E11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0039_G05.b : *AGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGCGAATCTAGGATCCACCTGCCAAAAA
KDN01_0025_D08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPL01_0081_F04.b : TATGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPLT1_0074_G11.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0096_F07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPLT1_0011_A04.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0005_A04.b : TACGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SPLT1_0092_C01.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
CBLT1_0027_C11.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0003_E12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0127_D10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0113_H12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0080_B06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0148_A01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0194_H08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0058_C10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0056_E05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0118_C01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0084_C06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0084_B06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0115_G12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0107_A11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0046_C09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVR01_0091_H12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SMG01_0023_C09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
UTR01_0022_E08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SMG01_0001_G11.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ITT01_0063_B06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
THY01_0097_B07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0048_C03.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0036_B07.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0059_D09.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0070_B08.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0022_H11.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
ITT01_0048_B12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0031_H05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0017_D01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0125_B07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVRM1_0013_C07.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRM1_0057_F06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0083_E08.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0050_H12.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
OVRT1_0034_D12.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
SKNB1_0062_C01.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0094_G04.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PCT01_0015_E10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0021_F06.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
PCT01_0014_C05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0099_B12.b : TAGGCCCTCGGCGGCCGCTGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0040_F03.b : TAGGCCCTCGGCGGCGGCGCCGT***AACGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0079_B12.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0103_F05.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
BFLT1_0099_C05.b : TAGGCCCTCGGCGGCGGCGGCGGCGGAGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0046_B05.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
LVR01_0091_D10.b : TAGGCCCTCGGCGGCGGCGGCGG***AGCGC*GGTGAATCTAGGATCCACCTGCCAAAAA
KDN01_0011_B05.b : tggctgagtttggggagtcagcgggctgtcCAGGTGAATCTAGGATCCACCTGCCAAAAA
ADR01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGGATCCACCTGCCAAAAA
PCT01_0007_H05.b : nactgcgttggcacggggcggcggcgcggacgcggtgaatctGGATCCACCTGCC*AAAA
THY01_0064_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0083_B04.b : nnccgcggtagaggccgtagtatt
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b : nnnaaactacctaaxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
---------+---------+---------+---------+---------+---------+ 206
LVR01_0036_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
CBLT1_0047_H06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
HTMT1_0033_E10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0019_B07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0058_B04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0064_F05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0047_C04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0189_D03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SMG01_0006_H10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0199_B02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0072_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0057_G08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0019_H03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0059_B10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
PTG01_0109_G09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPL01_0018_E05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0060_H04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
OVR01_0096_A06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SPL01_0084_C10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
THY01_0066_H07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0015_F10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0032_E06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
THY01_0205_F10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0063_B05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0033_C02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
THY01_0062_H02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0095_C10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SMG01_0060_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
TCH01_0063_A12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0098_A08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SKNB1_0070_D05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0039_F04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0021_F12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PST01_0081_A12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PST01_0098_C02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0067_G01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SKNB1_0089_G01.b : TGTGGCGGCTCTTGGCCCCCCCTCGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BMWN1_0073_G08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0031_B12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0073_D02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0122_E10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SKNB1_0008_A06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0042_H08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PTG01_0033_E06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0020_F05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPLT1_0014_H11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0086_H02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0048_D01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0035_F07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0150_A10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PCT01_0008_F05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
TCH01_0040_E08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPL01_0057_F08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAATGCCCGGGAGAGT
KDN01_0006_A03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
CLNT1_0092_D01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0030_G03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0067_C09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SKNB1_0002_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0026_D08.b : TGTGGCGGCTCTTGGCCACCCTCATC*TGCCTGGTGCTGCTGACCAGTGCTCGGAAGAGT
KDN01_0049_H11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0007_G05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0071_E04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0099_D03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0043_A07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0043_B03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0062_F04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0082_F01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0096_H10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0040_E11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0008_B06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0100_G05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SKNB1_0008_B08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0015_E02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0094_D09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0086_A12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PTG01_0074_F05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0174_C11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0043_G10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0077_F08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0056_E02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0008_H03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPL01_0051_E12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SPL01_0092_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPL01_0026_D06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
PTG01_0031_G03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
UTR01_0015_G03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAAAGT
SMG01_0062_G07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
UTR01_0088_F03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*CGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SPL01_0052_G07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0050_C03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
MLN01_0054_H07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
UTR01_0047_D02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SPL01_0068_F02.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
CLNT1_0063_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0098_F04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0038_F03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0079_C03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ITT01_0076_A09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ITT01_0008_F03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ITT01_0072_F01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0019_G09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0036_G01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LNG01_0007_A07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
OVRT1_0068_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0051_G04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGATGACCAGTGCCCGGGAGAGT
KDN01_0004_B01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0004_E01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0088_A09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0009_G09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0025_E11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0039_G05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
KDN01_0025_D08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SPL01_0081_F04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAATGACCGGGAGAGT
SPLT1_0074_G11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0096_F07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPLT1_0011_A04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0005_A04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPLT1_0092_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
CBLT1_0027_C11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0003_E12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0127_D10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0113_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0080_B06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
OVRM1_0148_A01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0194_H08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0058_C10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0056_E05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0118_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0084_C06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0084_B06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
OVRM1_0115_G12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0107_A11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0046_C09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVR01_0091_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SMG01_0023_C09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
UTR01_0022_E08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
SMG01_0001_G11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ITT01_0063_B06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
THY01_0097_B07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0048_C03.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0036_B07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0059_D09.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0070_B08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCTTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0022_H11.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ITT01_0048_B12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0031_H05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0017_D01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCTCGGGAGAGT
LVRM1_0125_B07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVRM1_0013_C07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRM1_0057_F06.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0083_E08.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0050_H12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
OVRT1_0034_D12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SKNB1_0062_C01.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0094_G04.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PCT01_0015_E10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0021_F06.b : TGTGGCGGCTCTTGGCCACCCTCAGCATGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PCT01_0014_C05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0099_B12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0040_F03.b : TGTGGCTTCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0079_B12.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0103_F05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
BFLT1_0099_C05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0046_B05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
LVR01_0091_D10.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
KDN01_0011_B05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
ADR01_0012_C07.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
PCT01_0007_H05.b : TGTGGCGGCTCTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
THY01_0064_D07.b : xxxxxxxxxxxTTGGCCACCCTCAGC*TGCCTGGTGCTGCTGACCAGTGCCCGGGAGAGT
SPLT1_0083_B04.b : tnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGCTGCTGACCAGTGCCCGGGAGAGT
ILNT1_0064_G06.b : nccgacggtacgaggccgtaxxxxxxxxxxxxxxx
KDN01_0067_B05.b :
OVR01_0100_C06.b : ngttagtgacttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F12.b : tgggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0032_B07.b : nnncccctcgggngggctggacttgacxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : aaaaanaccgat
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
---------+---------+---------+---------+---------+---------+ 265
LVR01_0036_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
CBLT1_0047_H06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
HTMT1_0033_E10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0019_B07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0058_B04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0064_F05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0047_C04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0189_D03.b : TTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SMG01_0006_H10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0199_B02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0072_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0057_G08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0019_H03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0059_B10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PTG01_0109_G09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0018_E05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0060_H04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0096_A06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0084_C10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
THY01_0066_H07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0015_F10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0032_E06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
THY01_0205_F10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0063_B05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0033_C02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
THY01_0062_H02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0095_C10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SMG01_0060_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
TCH01_0063_A12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0098_A08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0070_D05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0039_F04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0021_F12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PST01_0081_A12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PST01_0098_C02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0067_G01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0089_G01.b : CTGCATTTCCCGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BMWN1_0073_G08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0031_B12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0073_D02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0122_E10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0008_A06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0042_H08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PTG01_0033_E06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0020_F05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPLT1_0014_H11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0086_H02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0048_D01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0035_F07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0150_A10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PCT01_0008_F05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
TCH01_0040_E08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0057_F08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0006_A03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
CLNT1_0092_D01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0030_G03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0067_C09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0002_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0026_D08.b : CTGCATTTCCAGCCTCTG*TCAGATGAGCTGGTCAATTTTATTAACAAGGAAAACACTAC
KDN01_0049_H11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0007_G05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0071_E04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0099_D03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0043_A07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0043_B03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0062_F04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0082_F01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0096_H10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAGACACTAC
KDN01_0040_E11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAAGGGTATTAACAAGCAAAACACTAC
KDN01_0008_B06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0100_G05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0008_B08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0015_E02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0094_D09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0086_A12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PTG01_0074_F05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0174_C11.b : CTGCATTGCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0043_G10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0077_F08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0056_E02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0008_H03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0051_E12.b : CTGCATTTCCAGCCTCTG*TCCGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0092_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0026_D06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PTG01_0031_G03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
UTR01_0015_G03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SMG01_0062_G07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
UTR01_0088_F03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCTATTTTATTAACAAGCAAAACACTAC
SPL01_0052_G07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0050_C03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
MLN01_0054_H07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
UTR01_0047_D02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0068_F02.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTACTAACAAGCAAAACACTAC
CLNT1_0063_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0098_F04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0038_F03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0079_C03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ITT01_0076_A09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ITT01_0008_F03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ITT01_0072_F01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0019_G09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0036_G01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LNG01_0007_A07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0068_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0051_G04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGGGAGTTTTATTAACCAGCAAAACACTAC
KDN01_0004_B01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0004_E01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0088_A09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0009_G09.b : CTGTATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0025_E11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0039_G05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTGATTAACAAGCAAAACACTAC
KDN01_0025_D08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPL01_0081_F04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPLT1_0074_G11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0096_F07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPLT1_0011_A04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0005_A04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPLT1_0092_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
CBLT1_0027_C11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0003_E12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0127_D10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0113_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0080_B06.b : CTGCATTTCCAGCCCCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0148_A01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0194_H08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0058_C10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0056_E05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0118_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0084_C06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0084_B06.b : CTGCATTTCCAGCCCCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0115_G12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0107_A11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0046_C09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVR01_0091_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SMG01_0023_C09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
UTR01_0022_E08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SMG01_0001_G11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ITT01_0063_B06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
THY01_0097_B07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0048_C03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0036_B07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0059_D09.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0070_B08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0022_H11.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ITT01_0048_B12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0031_H05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0017_D01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0125_B07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVRM1_0013_C07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRM1_0057_F06.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0083_E08.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
LVR01_0050_H12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
OVRT1_0034_D12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SKNB1_0062_C01.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0094_G04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PCT01_0015_E10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0021_F06.b : CTGCATTTCCAGCCTCTGATCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PCT01_0014_C05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0099_B12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0040_F03.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0079_B12.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0103_F05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
BFLT1_0099_C05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0046_B05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGGCAATTTTATTAACAAGCAAAACACTAC
LVR01_0091_D10.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0011_B05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ADR01_0012_C07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
PCT01_0007_H05.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
THY01_0064_D07.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
SPLT1_0083_B04.b : CTGCATTTCCAGCCTCTG*TCGGATGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
ILNT1_0064_G06.b : xxxxxxxxxxxxxxxxxxxxxxxtTGAGCTGGTCAATTTTATTAACAAGCAAAACACTAC
KDN01_0067_B05.b : nnnnncctgcgttggcctggatgactggtcATTTTATTAC**AGCAAAACACTAC
OVR01_0100_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTATTAACAAGCAAAACACTAC
LVR01_0099_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTATTAACAAGCAAAACACTAC
MLN01_0032_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATTAACAAGCAAAACACTAC
KDN01_0028_F10.b : tttttggctgcgttggctacggcaaaACTAC
KDN01_0054_B01.b : cgttggctatggcaacCTAC
KDN01_0012_H06.b : nccgtttannnnncctgcgttggcacggact
DCI01_0021_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b : gag
OVRM1_0179_C01.b :
DCI01_0118_A02.b : acaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
---------+---------+---------+---------+---------+---------+ 324
LVR01_0036_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
CBLT1_0047_H06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
HTMT1_0033_E10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0019_B07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0058_B04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0064_F05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0047_C04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0189_D03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SMG01_0006_H10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0199_B02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0072_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0057_G08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0019_H03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0059_B10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PTG01_0109_G09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0018_E05.b : GTGGACGGCTGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0060_H04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0096_A06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0084_C10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
THY01_0066_H07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0015_F10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0032_E06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
THY01_0205_F10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0063_B05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0033_C02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
THY01_0062_H02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0095_C10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SMG01_0060_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
TCH01_0063_A12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0098_A08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0070_D05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0039_F04.b : GTGGACGGCCGGACACAATTTCTACCATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0021_F12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PST01_0081_A12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PST01_0098_C02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0067_G01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0089_G01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BMWN1_0073_G08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0031_B12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0073_D02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0122_E10.b : GTGGACGGCCGGACACAATTTTTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0008_A06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0042_H08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PTG01_0033_E06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0020_F05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPLT1_0014_H11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0086_H02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0048_D01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0035_F07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0150_A10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PCT01_0008_F05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
TCH01_0040_E08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0057_F08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0006_A03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
CLNT1_0092_D01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0030_G03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0067_C09.b : GTGGACGGCTGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0002_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0026_D08.b : TTGGACGGCCGGACACAATTTCTACTATGTGGACCTGAGCTACATGAAGAAGCTC*TGTG
KDN01_0049_H11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0007_G05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0071_E04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0099_D03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0043_A07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCCC*TGTG
KDN01_0043_B03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0062_F04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0082_F01.b : GTGGGCGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0096_H10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0040_E11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0008_B06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0100_G05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0008_B08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0015_E02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0094_D09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0086_A12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PTG01_0074_F05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0174_C11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0043_G10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0077_F08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0056_E02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0008_H03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCCC*TGTG
SPL01_0051_E12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0092_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0026_D06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PTG01_0031_G03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
UTR01_0015_G03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SMG01_0062_G07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
UTR01_0088_F03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0052_G07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0050_C03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
MLN01_0054_H07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
UTR01_0047_D02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0068_F02.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
CLNT1_0063_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0098_F04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0038_F03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0079_C03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ITT01_0076_A09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ITT01_0008_F03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACTTGAAGAAGCTC*TGTG
ITT01_0072_F01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0019_G09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0036_G01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LNG01_0007_A07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0068_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0051_G04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGCG
KDN01_0004_B01.b : GTGGACGGCCGGACACAATTTCCACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0004_E01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0088_A09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0009_G09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0025_E11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0039_G05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0025_D08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPL01_0081_F04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPLT1_0074_G11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0096_F07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPLT1_0011_A04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0005_A04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPLT1_0092_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
CBLT1_0027_C11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0003_E12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGAGAAGAAGCTC*TGTG
LVRM1_0127_D10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0113_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0080_B06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0148_A01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0194_H08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0058_C10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0056_E05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0118_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0084_C06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0084_B06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0115_G12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0107_A11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0046_C09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0091_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SMG01_0023_C09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
UTR01_0022_E08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SMG01_0001_G11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ITT01_0063_B06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
THY01_0097_B07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0048_C03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0036_B07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0059_D09.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0070_B08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0022_H11.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ITT01_0048_B12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0031_H05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTGCGTGAAGAAGCTC*TGTG
KDN01_0017_D01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0125_B07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVRM1_0013_C07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRM1_0057_F06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0083_E08.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0050_H12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVRT1_0034_D12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SKNB1_0062_C01.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0094_G04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PCT01_0015_E10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTTAGCTACGTGAAGAAGCTC*TGTG
KDN01_0021_F06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACATGAAGAAGCTCGTGTG
PCT01_0014_C05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0099_B12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0040_F03.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0079_B12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0103_F05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
BFLT1_0099_C05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0046_B05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0091_D10.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0011_B05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ADR01_0012_C07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
PCT01_0007_H05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
THY01_0064_D07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
SPLT1_0083_B04.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
ILNT1_0064_G06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0067_B05.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
OVR01_0100_C06.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
LVR01_0099_F12.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
MLN01_0032_B07.b : GTGGACGGCCGGACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0028_F10.b : GTGGACGGCCGGACACAATTTCTACA*TGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0054_B01.b : GTGGACGGCCGGACACAATTTCTACA*TGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0012_H06.b : cntggacGCCGGACACAATTTCTACA*TGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
DCI01_0021_C12.b : xxxxxxxxxxxxACACAATTTCTACAATGTGGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0047_E11.b : ccctttGACCTGAGCTACGTGAAGAAGCTC*TGTG
KDN01_0015_E11.b : ncccttttnnnnnccctgcgttggctctggagtgagAGCTC*TGTG
LVRM1_0037_A08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTG
OVRM1_0179_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0118_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0086_F02.b :
DCI01_0028_F01.b : nnnaaacatactaaxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
---------+---------+---------+---------+---------+---------+ 384
LVR01_0036_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
CBLT1_0047_H06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
HTMT1_0033_E10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0019_B07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0058_B04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0064_F05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0047_C04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0189_D03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SMG01_0006_H10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0199_B02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0072_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0057_G08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0019_H03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0059_B10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PTG01_0109_G09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0018_E05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0060_H04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0096_A06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0084_C10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
THY01_0066_H07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0015_F10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0032_E06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
THY01_0205_F10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0063_B05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0033_C02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
THY01_0062_H02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0095_C10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SMG01_0060_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
TCH01_0063_A12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0098_A08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0070_D05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0039_F04.b : GCACCTTCCTGGGTGGACCCTAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0021_F12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PST01_0081_A12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PST01_0098_C02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0067_G01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0089_G01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BMWN1_0073_G08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0031_B12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0073_D02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0122_E10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0008_A06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0042_H08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PTG01_0033_E06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0020_F05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPLT1_0014_H11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0086_H02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0048_D01.b : GCACCTTCCTGGGTGGACCCAAGCTGTCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0035_F07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0150_A10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PCT01_0008_F05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
TCH01_0040_E08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0057_F08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0006_A03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
CLNT1_0092_D01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0030_G03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0067_C09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0002_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0026_D08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCATAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0049_H11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0007_G05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0071_E04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0099_D03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0043_A07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0043_B03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0062_F04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0082_F01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0096_H10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0040_E11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0008_B06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0100_G05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0008_B08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0015_E02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0094_D09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0086_A12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PTG01_0074_F05.b : GCACCTTCCTGGGTGGNACCAAGCTNGCCCAGAGAGCTGCTTTTGCTGCNGACATGATCC
LVRM1_0174_C11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0043_G10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0077_F08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0056_E02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0008_H03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0051_E12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0092_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0026_D06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PTG01_0031_G03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
UTR01_0015_G03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SMG01_0062_G07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTT*GCTGCGGACATGATCC
UTR01_0088_F03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0052_G07.b : GCACCTTCCTGGGTGGACCCAGGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0050_C03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
MLN01_0054_H07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
UTR01_0047_D02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0068_F02.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
CLNT1_0063_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0098_F04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0038_F03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0079_C03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ITT01_0076_A09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ITT01_0008_F03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ITT01_0072_F01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0019_G09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0036_G01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LNG01_0007_A07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0068_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0051_G04.b : GCATCTTCCTGGGTGGACCCAACCTGCCCCAGAGAGCTGCTATTGCTGCGGACATGATCC
KDN01_0004_B01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0004_E01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0088_A09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0009_G09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0025_E11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0039_G05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0025_D08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPL01_0081_F04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPLT1_0074_G11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0096_F07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPLT1_0011_A04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0005_A04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPLT1_0092_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
CBLT1_0027_C11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0003_E12.b : GCACCTTCCTGGGCGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0127_D10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0113_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0080_B06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCCGACATGATCC
OVRM1_0148_A01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0194_H08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGGGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0058_C10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0056_E05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0118_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0084_C06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0084_B06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0115_G12.b : GCACCTCCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0107_A11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0046_C09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0091_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SMG01_0023_C09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
UTR01_0022_E08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SMG01_0001_G11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ITT01_0063_B06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
THY01_0097_B07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0048_C03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0036_B07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0059_D09.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0070_B08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0022_H11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ITT01_0048_B12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0031_H05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0017_D01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0125_B07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0013_C07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAAAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0057_F06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0083_E08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0050_H12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRT1_0034_D12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SKNB1_0062_C01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0094_G04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PCT01_0015_E10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0021_F06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PCT01_0014_C05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0099_B12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0040_F03.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0079_B12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0103_F05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
BFLT1_0099_C05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0046_B05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVR01_0091_D10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0011_B05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ADR01_0012_C07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
PCT01_0007_H05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
THY01_0064_D07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
SPLT1_0083_B04.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
ILNT1_0064_G06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0067_B05.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVR01_0100_C06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCCTTTGCTGCGGACATGATCC
LVR01_0099_F12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
MLN01_0032_B07.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0028_F10.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0054_B01.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0012_H06.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
DCI01_0021_C12.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0047_E11.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0015_E11.b : GCACCTTCCTGGGTGGACCC*AGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
LVRM1_0037_A08.b : GCACCTTCCTGGGTGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
OVRM1_0179_C01.b : xxxxxxxxxxxxxxGGACCCAAGCTGCCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
DCI01_0118_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCCAGAGAGCTGCTTTTGCTGCGGACATGATCC
KDN01_0086_F02.b :
DCI01_0028_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b :
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
---------+---------+---------+---------+---------+---------+ 443
LVR01_0036_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCACAGAGATC
CBLT1_0047_H06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
HTMT1_0033_E10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0019_B07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0058_B04.b : TGCCCAAAAGCTTCT*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCTTATAGATC
LVRM1_0064_F05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0047_C04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0189_D03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SMG01_0006_H10.b : TGCCCCAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGGCCGACCATCAAAGAGATC
OVRM1_0199_B02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0072_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0057_G08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0019_H03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCANAGAGATC
OVR01_0059_B10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PTG01_0109_G09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0018_E05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0060_H04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0096_A06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0084_C10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
THY01_0066_H07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0015_F10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0032_E06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
THY01_0205_F10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0063_B05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0033_C02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
THY01_0062_H02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0095_C10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SMG01_0060_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
TCH01_0063_A12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0098_A08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0070_D05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0039_F04.b : TGTCCAAAAGCTTCA*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAGAGAGATC
KDN01_0021_F12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PST01_0081_A12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PST01_0098_C02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0067_G01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0089_G01.b : TGCTCAAAAGCTTCC*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BMWN1_0073_G08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0031_B12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0073_D02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0122_E10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0008_A06.b : TGCCCAAAAGCTTCG*ATGCTTTTTT*CAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0042_H08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCATAGAGATC
PTG01_0033_E06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0020_F05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPLT1_0014_H11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0086_H02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0048_D01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0035_F07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0150_A10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PCT01_0008_F05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
TCH01_0040_E08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0057_F08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0006_A03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
CLNT1_0092_D01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0030_G03.b : TGCCCAAAAGCTTCG*ATGCCCGAGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0067_C09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0002_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0026_D08.b : TGCCCAAAAGCTTCG*ATGCCCGGCAACAGTGGCCCAACTGCCCGAACATCAAAGAGATC
KDN01_0049_H11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0007_G05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0071_E04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0099_D03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0043_A07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0043_B03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0062_F04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0082_F01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0096_H10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0040_E11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0008_B06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0100_G05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0008_B08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGTTTTAACTGCCCGACCATCAAAGAGATC
KDN01_0015_E02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0094_D09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0086_A12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PTG01_0074_F05.b : CTGCCCAAAGCTTCG*ATGCCCGGNAACAGTGGCCCNACTGGCCCGACATCAAAGAGATC
LVRM1_0174_C11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0043_G10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0077_F08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0056_E02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAATGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0008_H03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0051_E12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0092_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0026_D06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PTG01_0031_G03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
UTR01_0015_G03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SMG01_0062_G07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
UTR01_0088_F03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0052_G07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0050_C03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
MLN01_0054_H07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
UTR01_0047_D02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0068_F02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
CLNT1_0063_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0098_F04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0038_F03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0079_C03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ITT01_0076_A09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ITT01_0008_F03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ITT01_0072_F01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0019_G09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0036_G01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LNG01_0007_A07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0068_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0051_G04.b : TGCCCAAAAGCTTCGTATGCCCGGGAACAGTGGTCCAACTGCCCGACCATCAAAGAGATC
KDN01_0004_B01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0004_E01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0088_A09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0009_G09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0025_E11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0039_G05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0025_D08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPL01_0081_F04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAATGGCCCAACTGCCCGACCATCAAAGAGATC
SPLT1_0074_G11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0096_F07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPLT1_0011_A04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0005_A04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPLT1_0092_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
CBLT1_0027_C11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0003_E12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGTCCGACCATTACAGAGATC
LVRM1_0127_D10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0113_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0080_B06.b : TGCCCAAAAGCTTCC*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0148_A01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0194_H08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0058_C10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0056_E05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0118_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0084_C06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0084_B06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0115_G12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0107_A11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0046_C09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0091_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SMG01_0023_C09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
UTR01_0022_E08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SMG01_0001_G11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ITT01_0063_B06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
THY01_0097_B07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0048_C03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0036_B07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0059_D09.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0070_B08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0022_H11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ITT01_0048_B12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0031_H05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0017_D01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0125_B07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0013_C07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0057_F06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0083_E08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0050_H12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRT1_0034_D12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
SKNB1_0062_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0094_G04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PCT01_0015_E10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0021_F06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PCT01_0014_C05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0099_B12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0040_F03.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0079_B12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0103_F05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
BFLT1_0099_C05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0046_B05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0091_D10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0011_B05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ADR01_0012_C07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
PCT01_0007_H05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
THY01_0064_D07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACGGTGGCCCAACTGCCCGACCATCAAAGAGATC
SPLT1_0083_B04.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
ILNT1_0064_G06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0067_B05.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVR01_0100_C06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVR01_0099_F12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
MLN01_0032_B07.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0028_F10.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0054_B01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0012_H06.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
DCI01_0021_C12.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0047_E11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0015_E11.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
LVRM1_0037_A08.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
OVRM1_0179_C01.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
DCI01_0118_A02.b : TGCCCAAAAGCTTCG*ATGCCCGGGAACAGTGGCCCAACTGCCCGACCATCAAAGAGATC
KDN01_0086_F02.b : nttttttnnnnnnncctgcgggtgctcggcataagagat
DCI01_0028_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
---------+---------+---------+---------+---------+---------+ 502
LVR01_0036_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
CBLT1_0047_H06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
HTMT1_0033_E10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0019_B07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0058_B04.b : TTAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0064_F05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0047_C04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0189_D03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SMG01_0006_H10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTNGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0199_B02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0072_H12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0057_G08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0019_H03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0059_B10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PTG01_0109_G09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0018_E05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0060_H04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0096_A06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0084_C10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
THY01_0066_H07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0015_F10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0032_E06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
THY01_0205_F10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0063_B05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0033_C02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
THY01_0062_H02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0095_C10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SMG01_0060_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
TCH01_0063_A12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0098_A08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SKNB1_0070_D05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0039_F04.b : GGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGCGGAAGCCATCCCTGA
KDN01_0021_F12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PST01_0081_A12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PST01_0098_C02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0067_G01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SKNB1_0089_G01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BMWN1_0073_G08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0031_B12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0073_D02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0122_E10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SKNB1_0008_A06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0042_H08.b : AGAGACCACGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAACCATCTCTGA
PTG01_0033_E06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0020_F05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPLT1_0014_H11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0086_H02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0048_D01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0035_F07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0150_A10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PCT01_0008_F05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
TCH01_0040_E08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0057_F08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0006_A03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
CLNT1_0092_D01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0030_G03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0067_C09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCACCTCTGA
SKNB1_0002_H12.b : AGAGACCAGGGCTCCTGTGCGCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0026_D08.b : AAAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGACTGTGGAAGCCATCTCTGA
KDN01_0049_H11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0007_G05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0071_E04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0099_D03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0043_A07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0043_B03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0062_F04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0082_F01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0096_H10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0040_E11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0008_B06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0100_G05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SKNB1_0008_B08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0015_E02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0094_D09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0086_A12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PTG01_0074_F05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAACCCATCTCTGA
LVRM1_0174_C11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0043_G10.b : AGAGGCCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0077_F08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0056_E02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0008_H03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0051_E12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0092_H12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0026_D06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PTG01_0031_G03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
UTR01_0015_G03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SMG01_0062_G07.b : AGAGACCAGGGCCCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
UTR01_0088_F03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0052_G07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0050_C03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
MLN01_0054_H07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
UTR01_0047_D02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0068_F02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
CLNT1_0063_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0098_F04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0038_F03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0079_C03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ITT01_0076_A09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ITT01_0008_F03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ITT01_0072_F01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0019_G09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0036_G01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LNG01_0007_A07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0068_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0051_G04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAATCCATCTCTGA
KDN01_0004_B01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0004_E01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0088_A09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0009_G09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0025_E11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0039_G05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0025_D08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPL01_0081_F04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPLT1_0074_G11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0096_F07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPLT1_0011_A04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0005_A04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPLT1_0092_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
CBLT1_0027_C11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0003_E12.b : AGAGACCAGGGCTCCTGCG*GCTCCTGCTGGGCGCTCGGGGATGAGGACGGCACCTCTGA
LVRM1_0127_D10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0113_H12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0080_B06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGACGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0148_A01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0194_H08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0058_C10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0056_E05.b : AGAGACCAGGGCTCCTCTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0118_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0084_C06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0084_B06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGACGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0115_G12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0107_A11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0046_C09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0091_H12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SMG01_0023_C09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
UTR01_0022_E08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SMG01_0001_G11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ITT01_0063_B06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
THY01_0097_B07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0048_C03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0036_B07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0059_D09.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0070_B08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0022_H11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ITT01_0048_B12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0031_H05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0017_D01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0125_B07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0013_C07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0057_F06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0083_E08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0050_H12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRT1_0034_D12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SKNB1_0062_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0094_G04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PCT01_0015_E10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0021_F06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PCT01_0014_C05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0099_B12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0040_F03.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0079_B12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0103_F05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
BFLT1_0099_C05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0046_B05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0091_D10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0011_B05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ADR01_0012_C07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
PCT01_0007_H05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
THY01_0064_D07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
SPLT1_0083_B04.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
ILNT1_0064_G06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0067_B05.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVR01_0100_C06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVR01_0099_F12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
MLN01_0032_B07.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0028_F10.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0054_B01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0012_H06.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
DCI01_0021_C12.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0047_E11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0015_E11.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
LVRM1_0037_A08.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0179_C01.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
DCI01_0118_A02.b : AGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
KDN01_0086_F02.b : cGAGACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
DCI01_0028_F01.b : xxxxACCAGGGCTCCTGTG*GCTCCTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
OVRM1_0110_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxTGCTGGGCGTTTGGGGCTGTGGAAGCCATCTCTGA
DCI01_0045_D03.b :
UTR01_0014_D02.b :
20110601C-000779 : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
---------+---------+---------+---------+---------+---------+ 562
LVR01_0036_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACTTGTAGGTGTCCGCTGAGGACATGCT
CBLT1_0047_H06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
HTMT1_0033_E10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0019_B07.b : CCGGATCTGCTTCCGCAGCAACGGGCGTGTCATTGTGGAAGTGTCCCCTGAGGACATGCT
LVRM1_0058_B04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCTACGTGGAGGTGTCCGCTGATGAAATGCT
LVRM1_0064_F05.b : CCGGATCTGCATTCGCAGCAACGGGCGTGCCAACGTGGAGGTGTTCGCTGATGACATGCT
LVRM1_0047_C04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0189_D03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SMG01_0006_H10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTTCACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0199_B02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0072_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0057_G08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0019_H03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0059_B10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
PTG01_0109_G09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0018_E05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0060_H04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0096_A06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0084_C10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
THY01_0066_H07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0015_F10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0032_E06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
THY01_0205_F10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0063_B05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0033_C02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
THY01_0062_H02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0095_C10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SMG01_0060_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
TCH01_0063_A12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0098_A08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0070_D05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0039_F04.b : CTGGATCTGCATCCGCAGCAACGGGCGTGTCAACATAGAAGTGTCCGCTGAGGACATtgc
KDN01_0021_F12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
PST01_0081_A12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
PST01_0098_C02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0067_G01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0089_G01.b : CCGGATCTGCATCCGCATCAACGGGCGTGTCCACGTGCAGGTGTCCGCTGAGGACATGCT
BMWN1_0073_G08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0031_B12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0073_D02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0122_E10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0008_A06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0042_H08.b : CCGGATCTGCATCCGCAACAACGGACATGTCAACCTGGCAGTGTCCGCATAAGACATGCT
PTG01_0033_E06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0020_F05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPLT1_0014_H11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0086_H02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0048_D01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0035_F07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0150_A10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
PCT01_0008_F05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
TCH01_0040_E08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGGGGTGTCCGCTGAGGACATGCT
SPL01_0057_F08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0006_A03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
CLNT1_0092_D01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0030_G03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0067_C09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0002_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0026_D08.b : CCGGATCTGCATCCGCAGCATCGGGCGTGTCAATGTGCAGGTGTCAGCTGAGGACATGCT
KDN01_0049_H11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0007_G05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0071_E04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0099_D03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0043_A07.b : CCGGATCTGCATCTGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0043_B03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0062_F04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0082_F01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCC
KDN01_0096_H10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0040_E11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0008_B06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGCGGAGGTGTCCGCTGAGGACATGCT
KDN01_0100_G05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0008_B08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0015_E02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0094_D09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0086_A12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
PTG01_0074_F05.b : CGGGATCTGCATCCGCAACAACGGGCGTGTCAACGTGaaaggtgtccctgaagaatgctc
LVRM1_0174_C11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0043_G10.b : CCGGATCTGCATCCGCAGGCACGGGCGTGTCAACGTGGAGGTGTCCGCTGAAGACATGCT
LVRM1_0077_F08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0056_E02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0008_H03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0051_E12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0092_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0026_D06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
PTG01_0031_G03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
UTR01_0015_G03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SMG01_0062_G07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
UTR01_0088_F03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0052_G07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0050_C03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
MLN01_0054_H07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
UTR01_0047_D02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0068_F02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
CLNT1_0063_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0098_F04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0038_F03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0079_C03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ITT01_0076_A09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
ITT01_0008_F03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ITT01_0072_F01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0019_G09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0036_G01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LNG01_0007_A07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0068_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0051_G04.b : CCGGATCTGCGTCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0004_B01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0004_E01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0088_A09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0009_G09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0025_E11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0039_G05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0025_D08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPL01_0081_F04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
SPLT1_0074_G11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0096_F07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPLT1_0011_A04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0005_A04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPLT1_0092_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
CBLT1_0027_C11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0003_E12.b : CCGGctcggcatacgtagcctccctccgtgtcgcgcggaggtcgcccgctcggacgtgca
LVRM1_0127_D10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0113_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0080_B06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0148_A01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0194_H08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0058_C10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0056_E05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0118_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0084_C06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0084_B06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0115_G12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0107_A11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0046_C09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0091_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SMG01_0023_C09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
UTR01_0022_E08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SMG01_0001_G11.b : CCGGATCTGCATCTGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ITT01_0063_B06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
THY01_0097_B07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0048_C03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0036_B07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0059_D09.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0070_B08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0022_H11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ITT01_0048_B12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0031_H05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0017_D01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0125_B07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0013_C07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0057_F06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0083_E08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0050_H12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRT1_0034_D12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SKNB1_0062_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0094_G04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
PCT01_0015_E10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0021_F06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
PCT01_0014_C05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0099_B12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0040_F03.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0079_B12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0103_F05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
BFLT1_0099_C05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0046_B05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0091_D10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACACGCT
KDN01_0011_B05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
ADR01_0012_C07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
PCT01_0007_H05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
THY01_0064_D07.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
SPLT1_0083_B04.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
ILNT1_0064_G06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0067_B05.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
OVR01_0100_C06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
LVR01_0099_F12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
MLN01_0032_B07.b : CCGGATCTGCATCCGCAGCAATGGGCGTGTCAATGTGGAGGTGTCCGCTGGGGACATGCT
KDN01_0028_F10.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0054_B01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0012_H06.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
DCI01_0021_C12.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0047_E11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0015_E11.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
LVRM1_0037_A08.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0179_C01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
DCI01_0118_A02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
KDN01_0086_F02.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAATGTGGAGGTGTCCGCTGAGGACATGCT
DCI01_0028_F01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
OVRM1_0110_B01.b : CCGGATCTGCATCCGCAGCAACGGGCGTGTCAACGTGGAGGTGTCCGCTGAGGACATGCT
DCI01_0045_D03.b : nnttttcatatctaaxxx
UTR01_0014_D02.b :
20110601C-000779 : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
---------+---------+---------+---------+---------+---------+ 621
LVR01_0036_C01.b : CACCTGTTGTGGCGACTAGTGTGGGGATGGCTGTAACGGTGGCTTTCCCCTCTGGAACCT
CBLT1_0047_H06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
HTMT1_0033_E10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0019_B07.b : CACCTGTTGTGGCcaactagtggtggggatggctgtaaccggtggctttccctccgggaa
LVRM1_0058_B04.b : CACCTGTTGTGGCTACGAGTGTGGcggatggccgttacgtgggtctctcccctggatcct
LVRM1_0064_F05.b : CACCTGTTGTGGCCACNAGTGTGGTGATGGCTGCTACGTTGGCTGTTCCctttcagcctt
LVRM1_0047_C04.b : CACCTGTTGTGGCGACAAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAACCT
LVRM1_0189_D03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SMG01_0006_H10.b : CACCTGTTGTGGCNACAATTGTGGGGATGGGCTGTACCGTGGCTTTCCC*TCTGGAGC*T
OVRM1_0199_B02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0072_H12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTTCC*TCTGGAGCCT
OVRM1_0057_G08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0019_H03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0059_B10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PTG01_0109_G09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0018_E05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGAAGCCT
OVR01_0060_H04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0096_A06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0084_C10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
THY01_0066_H07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0015_F10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0032_E06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
THY01_0205_F10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0063_B05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0033_C02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
THY01_0062_H02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0095_C10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SMG01_0060_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
TCH01_0063_A12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0098_A08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0070_D05.b : CACCTGTTGTGGCGACGAGGGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0039_F04.b : tcacctggtccggcgaccactgtcggcacggccgtcacggtggctctccctttggcagcc
KDN01_0021_F12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PST01_0081_A12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PST01_0098_C02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0067_G01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0089_G01.b : CACCTGTTGTGGCCACGAGTGTGCTCATCTCTGTAACGCTTGCTTTCCC*TCTCCAACCT
BMWN1_0073_G08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0031_B12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0073_D02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0122_E10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0008_A06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0042_H08.b : CAacatgtgtggcgacaaaagtgatggatggcagcacgcggcgagatgccacatgaatga
PTG01_0033_E06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0020_F05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPLT1_0014_H11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0086_H02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0048_D01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0035_F07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0150_A10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PCT01_0008_F05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
TCH01_0040_E08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0057_F08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0006_A03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
CLNT1_0092_D01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0030_G03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0067_C09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0002_H12.b : CACCTGTTGTGGCGACAAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0026_D08.b : CACCTGTTGTGGCAACGAGTGTGCGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0049_H11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0007_G05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0071_E04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0099_D03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0043_A07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0043_B03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0062_F04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0082_F01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0096_H10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0040_E11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0008_B06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0100_G05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0008_B08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0015_E02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0094_D09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0086_A12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PTG01_0074_F05.b : ccctgtttgtgcacaaagtgggggatggctttaacgggggctttccctctggaactggaa
LVRM1_0174_C11.b : CACCctggtggcaaagagggaggggaaattcgggaaagttagacttccttcccggaacct
LVRM1_0043_G10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAACCT
LVRM1_0077_F08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0056_E02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0008_H03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTTCC*TCTGGAGCCT
SPL01_0051_E12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0092_H12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0026_D06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PTG01_0031_G03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
UTR01_0015_G03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SMG01_0062_G07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
UTR01_0088_F03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0052_G07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0050_C03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
MLN01_0054_H07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
UTR01_0047_D02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0068_F02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
CLNT1_0063_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0098_F04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0038_F03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0079_C03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ITT01_0076_A09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ITT01_0008_F03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ITT01_0072_F01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCCTTCCC*TCTGGAGCCT
BFLT1_0019_G09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0036_G01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LNG01_0007_A07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0068_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0051_G04.b : CACCTGTTGTGGCGACTAGTGCGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAACCT
KDN01_0004_B01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0004_E01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0088_A09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0009_G09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0025_E11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0039_G05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0025_D08.b : CACCTGTTGTGGCGACGAGTATGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPL01_0081_F04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTTACGGAGGCTTTCCC*TCTGGAGCCT
SPLT1_0074_G11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0096_F07.b : CACCTGTTGTGGCGACAAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPLT1_0011_A04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0005_A04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPLT1_0092_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
CBLT1_0027_C11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0003_E12.b : tacccgctgcggcgactagtgtggcgatggccgcatcgacggttgaatctccggagcctg
LVRM1_0127_D10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0113_H12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0080_B06.b : CACCTGTTGTGGCGACCAGTGTGGGGATGGCTGTAACCGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0148_A01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0194_H08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0058_C10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0056_E05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0118_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCC
OVRM1_0084_C06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0084_B06.b : CACCTGTTGTGGCGACCAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0115_G12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0107_A11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0046_C09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0091_H12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SMG01_0023_C09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
UTR01_0022_E08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SMG01_0001_G11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ITT01_0063_B06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
THY01_0097_B07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0048_C03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0036_B07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0059_D09.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0070_B08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0022_H11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ITT01_0048_B12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0031_H05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0017_D01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0125_B07.b : CACCTGTTGTGGCGACCAATGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0013_C07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0057_F06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0083_E08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0050_H12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRT1_0034_D12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SKNB1_0062_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0094_G04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PCT01_0015_E10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0021_F06.b : CACCTGTTGTGGCGACTAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PCT01_0014_C05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0099_B12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0040_F03.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0079_B12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0103_F05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
BFLT1_0099_C05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0046_B05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0091_D10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0011_B05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ADR01_0012_C07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
PCT01_0007_H05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
THY01_0064_D07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
SPLT1_0083_B04.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
ILNT1_0064_G06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0067_B05.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVR01_0100_C06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVR01_0099_F12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
MLN01_0032_B07.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0028_F10.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0054_B01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0012_H06.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
DCI01_0021_C12.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0047_E11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0015_E11.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
LVRM1_0037_A08.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0179_C01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
DCI01_0118_A02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
KDN01_0086_F02.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
DCI01_0028_F01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
OVRM1_0110_B01.b : CACCTGTTGTGGCGACGAGTGTGGGGATGGCTGTAACGGTGGCTTTCCC*TCTGGAGCCT
DCI01_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_D02.b :
20110601C-000779 : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
---------+---------+---------+---------+---------+---------+ 678
LVR01_0036_C01.b : GGAACCTTCTGGACAAAAGAAGGGCCTGGTGTCCGGGGGGCctcttgacttcgcatgtgg
CBLT1_0047_H06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
HTMT1_0033_E10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ADR01_0019_B07.b : cctggaacttctggaaaaaaaagggcctgggtgtccggggggccttttataatcccctgg
LVRM1_0058_B04.b : gcaacttccggtacaaaaaaggtccggggttcggtgtgccctatagctttccgttgtggt
LVRM1_0064_F05.b : caaactttggactatgaaggcttcggggctctcgtcgtcgtatctttacgatgttcctag
LVRM1_0047_C04.b : GGAACTTTCGGGCA**AAAAAGGACCTGATGTCCGGCGCCCCCTATAAATCGCATGTGA*
LVRM1_0189_D03.b : GGAAC*TTCTGGACA*AAGAAAGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGA*
SMG01_0006_H10.b : GGAACTTCTGGGACA**AGAAGGGCCTGGTGTTCGGGGGCCTCTATGACTCCAAGGGGG*
OVRM1_0199_B02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0072_H12.b : GGAAC*TTCTGGG*ACAAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0057_G08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0019_H03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGNGGCCTCTATGACTCGCATGTGG*
OVR01_0059_B10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGGCTCTATGACTCGCATGTGG*
PTG01_0109_G09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0018_E05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0060_H04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0096_A06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0084_C10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
THY01_0066_H07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0015_F10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0032_E06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
THY01_0205_F10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0063_B05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0033_C02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
THY01_0062_H02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0095_C10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SMG01_0060_C01.b : GNAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
TCH01_0063_A12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0098_A08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0070_D05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGGG
OVRM1_0039_F04.b : ggaacttctgccatatgtacggcctggcggtcgggggcccccagcgattcttcctcgagt
KDN01_0021_F12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PST01_0081_A12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PST01_0098_C02.b : GGAAC*TTCTGGACA*AAGAGGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0067_G01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0089_G01.b : GGAAC*TTCTGtacccaccttggctcgctgtctccgatcctccaccactcgtcctcactt
BMWN1_0073_G08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ADR01_0031_B12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0073_D02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0122_E10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0008_A06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0042_H08.b : tgaaacctgcttaacccataaacgaaatgaattgccagcgcccaccctgagatttagcgc
PTG01_0033_E06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGNGGCCTCTATGACTCGCATGTGG*
ADR01_0020_F05.b : GAAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGGG
SPLT1_0014_H11.b : GGAAC*TTCTGGACA*AAGAAGGGGCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0086_H02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTTTATGACTCGCATGTGG*
ADR01_0048_D01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0035_F07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0150_A10.b : GGAAC*TTCTGGACA*AAGAANGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PCT01_0008_F05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
TCH01_0040_E08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0057_F08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0006_A03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
CLNT1_0092_D01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0030_G03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0067_C09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0002_H12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGTCTCCATGACTCGCATGTGG*
KDN01_0026_D08.b : GAAAC*TTCTGGACA*AAGAAAGTCCTGGTGTCCGGGAGACTCTATGACTCGCATGTGA*
KDN01_0049_H11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0007_G05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0071_E04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0099_D03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0043_A07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0043_B03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0062_F04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0082_F01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0096_H10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0040_E11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0008_B06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0100_G05.b : GGAAC*TTCCGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0008_B08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGTCTCCATGACTCGCATGTGG*
KDN01_0015_E02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0094_D09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0086_A12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PTG01_0074_F05.b : cttctgaaaaaaaagggccggggtccggggggcccttaaaccccaaggggttgtggggcc
LVRM1_0174_C11.b : ggaacttcctgactaaaaagggcctggttgtacgggggcctccaagtatacccagggggg
LVRM1_0043_G10.b : GGAAC*TTCTGCACA*AAGAAGGGCCTGGTGTCGAGGGGCCaactatataaccgaagaga
LVRM1_0077_F08.b : GGAAC*TTCTGGACA*CAGAAGGGCCTGGTGTTCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0056_E02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGNGGCCTCTATGACTCGCATGTGG*
ADR01_0008_H03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0051_E12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0092_H12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0026_D06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PTG01_0031_G03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
UTR01_0015_G03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SMG01_0062_G07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
UTR01_0088_F03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0052_G07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0050_C03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
MLN01_0054_H07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
UTR01_0047_D02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0068_F02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
CLNT1_0063_C01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0098_F04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0038_F03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ADR01_0079_C03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ITT01_0076_A09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ITT01_0008_F03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ITT01_0072_F01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0019_G09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0036_G01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LNG01_0007_A07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0068_C01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0051_G04.b : GGAAC*TTCTGGACAAAGGAAGGCCCTGGAGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0004_B01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0004_E01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0088_A09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0009_G09.b : GGAAC*TTCTGGACA*AAGGAGGGCCTGGTGTCCGGGGGCCCCTATGACTCGCATGTGG*
KDN01_0025_E11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0039_G05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0025_D08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPL01_0081_F04.b : GGAAC*TTCTGGACA*AAAAAAGGCCTGGTGTCCGGCGGCCTCTATGACTCGCATGTGA*
SPLT1_0074_G11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0096_F07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPLT1_0011_A04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0005_A04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPLT1_0092_C01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
CBLT1_0027_C11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0003_E12.b : tatctctcgtacttcgacggcccctgctttcgtttgctcnccatattctctcccgggatg
LVRM1_0127_D10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0113_H12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0080_B06.b : GGAAC*TTCTGGACA*AAGAAAGGCCTGGTGTCCGGGGGCCTCTATGACTTGCATGTGG*
OVRM1_0148_A01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0194_H08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0058_C10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0056_E05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0118_C01.b : TGGAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACACGCATGTGG*
OVRM1_0084_C06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0084_B06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGGCTCTATGACTCGCATGTGG*
OVRM1_0115_G12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0107_A11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0046_C09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0091_H12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SMG01_0023_C09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
UTR01_0022_E08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SMG01_0001_G11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ITT01_0063_B06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
THY01_0097_B07.b : GGAAC*TGCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0048_C03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0036_B07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGAGGCCTCTATGACTCGCATGTGG*
ADR01_0059_D09.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0070_B08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0022_H11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ITT01_0048_B12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0031_H05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0017_D01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0125_B07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGGGTCCGGGGGCCTCTATGACTCGCATGTGGG
LVRM1_0013_C07.b : GGAAC*TTCTGGACA*AAGAAG*GCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0057_F06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0083_E08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0050_H12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRT1_0034_D12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SKNB1_0062_C01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0094_G04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PCT01_0015_E10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0021_F06.b : GAAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PCT01_0014_C05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0099_B12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0040_F03.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0079_B12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0103_F05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
BFLT1_0099_C05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0046_B05.b : GAAAC*TTCTGGACA*AAGAACGGCCTGGTGTCCGGGGGCCTCTAAGACTCGCATGTGG*
LVR01_0091_D10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGGCTCGCATGTGG*
KDN01_0011_B05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ADR01_0012_C07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
PCT01_0007_H05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
THY01_0064_D07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
SPLT1_0083_B04.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
ILNT1_0064_G06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0067_B05.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVR01_0100_C06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVR01_0099_F12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
MLN01_0032_B07.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0028_F10.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0054_B01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0012_H06.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
DCI01_0021_C12.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0047_E11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0015_E11.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
LVRM1_0037_A08.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0179_C01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGAGGCCTCTATGACTCGCATGTGG*
DCI01_0118_A02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
KDN01_0086_F02.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
DCI01_0028_F01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
OVRM1_0110_B01.b : GGAAC*TTCTGGACA*AAGAAGGGCCTGGTGTCCGGGGGCCTCTATGACTCGCATGTGG*
DCI01_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_D02.b : gggtgcacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000779 : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
---------+---------+---------+---------+---------+---------+ 735
LVR01_0036_C01.b : gtttgcgggccctactccatcccaccttgtgaacacccgtgaaatcgctcccggcccccc
CBLT1_0047_H06.b : GTTGCAGGCCCTACT*CCTTCCCACCTTGTGAACACCACGTGAT*CGGCTCCCGG*CCCC
HTMT1_0033_E10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0019_B07.b : gggtttgcaggccctattccctcccacctggcaaaaacctgtgaaacggttcccggcccc
LVRM1_0058_B04.b : gtcgggctattccattaca
LVRM1_0064_F05.b : tgactcgagtgtgtatccgttgtgctccactcggtttctggtgtccgtccccgcgtcttc
LVRM1_0047_C04.b : GTTGCggggccaacacgaaccaccttgtgaacacaacccgaaagcttcccgcacccc
LVRM1_0189_D03.b : GTTGCAGGCCCTACT*CCATCCCACttgggaagacacgtgaacggtcccggccccgt
SMG01_0006_H10.b : TTTGCAGGCCtactccctccaacctgggaaacccacttgaacgggtcccggccccgtgga
OVRM1_0199_B02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTTCCGG*CC
LVRM1_0072_H12.b : GGTGCAGGCCCTACT*CCATCCCCACTTTGCGACACCACGTGAA*CGGGTCCCGG*CCCC
OVRM1_0057_G08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0019_H03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGC*CCCC
OVR01_0059_B10.b : GTTGCAGGCCCTACT*CCCTCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PTG01_0109_G09.b : GGTGCAGGGCCTACT*CCATCCCACCTTGCGAACACCACGTGGA*CGGGCTCCCG*GCCC
SPL01_0018_E05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0060_H04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0096_A06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0084_C10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
THY01_0066_H07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0015_F10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0032_E06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
THY01_0205_F10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0063_B05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0033_C02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
THY01_0062_H02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0095_C10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CACT
SMG01_0060_C01.b : GTTGCAAGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
TCH01_0063_A12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0098_A08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SKNB1_0070_D05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0039_F04.b : cgtttgttctattcctatccaccattcgatcacctactgaaatatgtacctgtgacaccc
KDN01_0021_F12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PST01_0081_A12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PST01_0098_C02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0067_G01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SKNB1_0089_G01.b : tgcccgccccacttcccccccccttcgatcagcccttaaaccagtccccaccccccgctc
BMWN1_0073_G08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0031_B12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0073_D02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0122_E10.b : GTTGCAGGCCCTACT*CCATCCCACCTTTCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SKNB1_0008_A06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0042_H08.b : aaagtaagcgaccgcgcacaaaccacatagtaagtatattataataccgaatcaaacaca
PTG01_0033_E06.b : GTTGCANGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0020_F05.b : TTGGCAGCCCTTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCCG*GCCC
SPLT1_0014_H11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGGGAACACCACGTGAA*ACGCTCCCGG*CCCC
LVR01_0086_H02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0048_D01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0035_F07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0150_A10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCNGACACCACGTGAA*CGGCTCCCGG*CCCC
PCT01_0008_F05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
TCH01_0040_E08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0057_F08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0006_A03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
CLNT1_0092_D01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0030_G03.b : GTTGCAGGCCCTACT*CCATCCCACCTCGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0067_C09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SKNB1_0002_H12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGGA*CGGCTCCCGGGCCCC
KDN01_0026_D08.b : GTTGCATGCCCTACT*CCATCCCACCTTGCGAACACCACATGAA*CTGCTCCCGG*CCCC
KDN01_0049_H11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0007_G05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0071_E04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0099_D03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0043_A07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0043_B03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0062_F04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0082_F01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0096_H10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0040_E11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0008_B06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0100_G05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SKNB1_0008_B08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0015_E02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0094_D09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0086_A12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PTG01_0074_F05.b : caatccctcccccccttggaaacccccgtgaaggggccccggcccccgtgcgcggggggg
LVRM1_0174_C11.b : gttgaggccccgactcgccgaatgttgccaacacgatgtcccccctccccagcattacgg
LVRM1_0043_G10.b : gtcgcatgcactagccgatgcacctttaagaaagccagcgacggaagacgagccagngga
LVRM1_0077_F08.b : GTTGCAGGNCCTACT*CCATCCCACCTTGCGAACACCACGTGTA*CGGCTCCCGG*CCCC
LVRM1_0056_E02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCNGACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0008_H03.b : GTTGCAGGCCCTACT*CCATCCCAC*TTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0051_E12.b : GTTGCAAGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0092_H12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0026_D06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PTG01_0031_G03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
UTR01_0015_G03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SMG01_0062_G07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
UTR01_0088_F03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0052_G07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0050_C03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
MLN01_0054_H07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
UTR01_0047_D02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0068_F02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
CLNT1_0063_C01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0098_F04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0038_F03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0079_C03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ITT01_0076_A09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ITT01_0008_F03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ITT01_0072_F01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0019_G09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0036_G01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
LNG01_0007_A07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0068_C01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0051_G04.b : GTTGCAGGCCCGACT*CCATCCCGCCTTGCGAACACTACGTGAA*CGGCTCCCGG*CCCC
KDN01_0004_B01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0004_E01.b : GTTGCANGCCCTACT*CCATCCCCACTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0088_A09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0009_G09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0025_E11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0039_G05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0025_D08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPL01_0081_F04.b : GTTGCAGGACCTACT*CCATCCCACCTTGCGAACACCAAGTGAA*CGGCTCCCTG*CCTG
SPLT1_0074_G11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0096_F07.b : GTTGCCGGCCCTACTTCCATCTCACCTTGCGAACACCACGTGAA*CGGCTCCCCG*CCCC
SPLT1_0011_A04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0005_A04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPLT1_0092_C01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
CBLT1_0027_C11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0003_E12.b : acggccccccttccgcccctcatgtgttcgcctcgtctacgtactccgacccactcgcac
LVRM1_0127_D10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0113_H12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0080_B06.b : GGTGCAGGGCCTACT*CCCTCCCCCCTTGGGAACACCACGTGAA*AGGGTCCCGG*GCCC
OVRM1_0148_A01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CTCC
OVRM1_0194_H08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGGCCCCC
LVRM1_0058_C10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCGG***CCC
LVRM1_0056_E05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0118_C01.b : GTTGCAGGGCCTACT*CCATCC*ACCTTGCGGACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0084_C06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0084_B06.b : GTTGCAAGCCCTACT*CCATCCCACCTTGCGAA*ATCACGTGAA*AGGCTCCCGG*CCCC
OVRM1_0115_G12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCTGG*CCCC
OVRM1_0107_A11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCC*GG*CCCC
OVR01_0046_C09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0091_H12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SMG01_0023_C09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
UTR01_0022_E08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SMG01_0001_G11.b : GTTGCANGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ITT01_0063_B06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
THY01_0097_B07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0048_C03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0036_B07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0059_D09.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0070_B08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0022_H11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ITT01_0048_B12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0031_H05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0017_D01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0125_B07.b : GTTGCAAGCCTTACT*CCATCCCACCTTGCGAACACTACGTGAAACGGCTCCCGG*GCAC
LVRM1_0013_C07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCAGACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0057_F06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0083_E08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0050_H12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRT1_0034_D12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCGCGTGAA*CGGCTCCCGG*CCCC
SKNB1_0062_C01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0094_G04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PCT01_0015_E10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0021_F06.b : GTTGCACGCCCTACT*CCATCCCACCTTGCGAACACCACATGAA*CGGCTCCCGG*CCCC
PCT01_0014_C05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0099_B12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0040_F03.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0079_B12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0103_F05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
BFLT1_0099_C05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0046_B05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0091_D10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0011_B05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
ADR01_0012_C07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
PCT01_0007_H05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
THY01_0064_D07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
SPLT1_0083_B04.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
ILNT1_0064_G06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0067_B05.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVR01_0100_C06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVR01_0099_F12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGTGAACACCACGTGAA*CGGCTCCCGG*CCCC
MLN01_0032_B07.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0028_F10.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0054_B01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0012_H06.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
DCI01_0021_C12.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0047_E11.b : GTTGCAAGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0015_E11.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
LVRM1_0037_A08.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0179_C01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
DCI01_0118_A02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
KDN01_0086_F02.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
DCI01_0028_F01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
OVRM1_0110_B01.b : GTTGCAGGCCCTACT*CCATCCCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
DCI01_0045_D03.b : xxxxxxxxxxxxxxxxxxxxxxCACCTTGCGAACACCACGTGAA*CGGCTCCCGG*CCCC
UTR01_0014_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGTGAA*CGGCTCCCGG*CCCC
20110601C-000779 : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
---------+---------+---------+---------+---------+---------+ 789
LVR01_0036_C01.b : gtgcactgggggaggggaactccccccacttgcaccacgatttgcgagcctggcttacac
CBLT1_0047_H06.b : *GTGCTCTGGGG**AGGGGGA*CACCCCCATGTGC*Actaggtttgcccaccctggctgc
HTMT1_0033_E10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0019_B07.b : cttgtcaggtggaggggggaacccccctatttactagaatttttgaaacctgtttacccc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b : gtaacgtgccgatacacgtctcgcaccgctatccagtagatcgcgttt
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ctggggaggggaaccccccaagggacaaaatttgggaacctggttaacccccgcctaaaa
OVRM1_0199_B02.b :
LVRM1_0072_H12.b : CGTG
OVRM1_0057_G08.b : CGTGCACTGGGG**AAGGGGA**CACCCCAAGTGC*AGCAAGATt
LVRM1_0019_H03.b : GTGCAATTGNNG**GAGGGGGACACCCCCAAGGGC*AGCAAGATC
OVR01_0059_B10.b : CGTGCACTGGGG**GGGGGGAACACCCCCAATTGC*ACCAAGATC*TGtgaggcctggtt
PTG01_0109_G09.b : CGTGCACTGGGG**AGGGGGA**CACCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0018_E05.b : CGTGCACTGGGG**AGGGGGA**CACCCCAAGTGC*AGCAAGATC*TGCGA*GCCCTGCT
OVR01_0060_H04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0096_A06.b : CGTGCACTGGGG**GAGGGGGACACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0084_C10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
THY01_0066_H07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0015_F10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0032_E06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
THY01_0205_F10.b : CGTGCACTGGGG**GAGGGGGACACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0063_B05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0033_C02.b : CGTGCACTGGGG**AGGGGGA*CACCCCGCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
THY01_0062_H02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0095_C10.b : GG********GG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SMG01_0060_C01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
TCH01_0063_A12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGNCAGATC*TGCGA*GCCTGGCT
KDN01_0098_A08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0070_D05.b : CGTGCCTGGGGGGAAAGGGGAACACCCCCCAGTGC*AGCAAGATC*TGCCA*GCCTGGCT
OVRM1_0039_F04.b : gtccgagggtttgcgaacctctccctttctctaccaa
KDN01_0021_F12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PST01_0081_A12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PST01_0098_C02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0067_G01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0089_G01.b : cctgtgcccgttatccgcccccgacccctccccattctcccacccccctctccctcacga
BMWN1_0073_G08.b : CGTGCACTGGGG**GAGGGGGACACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0031_B12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0073_D02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0122_E10.b : CGTGCACTGGGG**GAGGGGGACACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0008_A06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0042_H08.b : tagactggaaaacgacaataccgcgttggctataaatagaccgcaccacttg
PTG01_0033_E06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0020_F05.b : CGTGCACGGGGG**AGGGGGAACACCCCCAAATGC*ACCAAGAatttgcaaccctggctt
SPLT1_0014_H11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0086_H02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0048_D01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0035_F07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0150_A10.b : GTGCCACTGGGA**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PCT01_0008_F05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
TCH01_0040_E08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGGTC*TGCGA*GCCTGGCT
SPL01_0057_F08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0006_A03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
CLNT1_0092_D01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0030_G03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0067_C09.b : CGTGCACTNGGGG*AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0002_H12.b : CGTGCACTGGGG**GAGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGAAGCCTGGCT
KDN01_0026_D08.b : CGTGCACTGGAG**AGGGGGA*CACCCCCGAGTGCTAGCAAGATC*TGCAA*GCCTGACT
KDN01_0049_H11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0007_G05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0071_E04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0099_D03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0043_A07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0043_B03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0062_F04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0082_F01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0096_H10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0040_E11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0008_B06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0100_G05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0008_B08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0015_E02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0094_D09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0086_A12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PTG01_0074_F05.b : ggggacccccccatgtggaaaaaattttggaagcggggtaccccccccctaaaaaaaaaa
LVRM1_0174_C11.b : ttgtgtggaaacgtggactttgaccccgcgtcgtgcccgaatcgc
LVRM1_0043_G10.b : agggggaagggcgaaatatagcttacacctacgcgcttgtataag
LVRM1_0077_F08.b : CGTGCACTGCGG**AAGGCGA*CACCTCCCACTGC*Aattacatctgccagcctcgctac
LVRM1_0056_E02.b : CGTGCACTGGGG**GAGGGGA*CACCTCCAAGCGC*AGCCAGATCc
ADR01_0008_H03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAATTGC*AACAAGATC*TGCGA*GCCTGCCT
SPL01_0051_E12.b : CGTGCACTGGGG**AGGGGGGACACCCCCAAGTGC*AGCCAGAAT*TGCGAAGCCTGGCT
SPL01_0092_H12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0026_D06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PTG01_0031_G03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
UTR01_0015_G03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SMG01_0062_G07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
UTR01_0088_F03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0052_G07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0050_C03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
MLN01_0054_H07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
UTR01_0047_D02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0068_F02.b : CGTGCACTGGGGG*AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
CLNT1_0063_C01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0098_F04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0038_F03.b : CGTGCACTGGGA**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0079_C03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ITT01_0076_A09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ITT01_0008_F03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ITT01_0072_F01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0019_G09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0036_G01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LNG01_0007_A07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0068_C01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0051_G04.b : CGTGCACTGGGG**AGGGGGACACCCCCAGTGCAtttagatctgcagcctggccacaccc
KDN01_0004_B01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0004_E01.b : CGTGCACGGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0088_A09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0009_G09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0025_E11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0039_G05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0025_D08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPL01_0081_F04.b : CGTGCTCTGAGG**AGGGGGA*GATCCCCAAGTGC*ATTCAGATC*TGGGA*GCCTGGAT
SPLT1_0074_G11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0096_F07.b : CGTGCATTGGGG**AGGGGGA*CACCCCCAAGTGC*ACCAAGATT*TGCGA*GCCTGGgt
SPLT1_0011_A04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0005_A04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPLT1_0092_C01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
CBLT1_0027_C11.b : CGTGCACTGGGG**AGGGGGAACCCCCCC*AGTGC*AGCAAGATC*TGCGA*GCCCGGCT
OVRM1_0003_E12.b : cggcccgccccttgttctcaatttttagcccaaacatcccgccgctctttctctttctta
LVRM1_0127_D10.b : CGTGCAACTGGGGAAGGGGGaacacccccagtgtatcaaaatctgctagccgggcttaca
OVRM1_0113_H12.b : CGTGCACTGTGG**GGGGGGA*AACCCCCTAATGC*ACCAAGATC*Tcctaccctggttc
OVR01_0080_B06.b : CGTGCACTGGGG**AGGGGGACCCCCCCAAGTGgcacaaaatttgggagccttggttacc
OVRM1_0148_A01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGG
OVRM1_0194_H08.b : GTTGCACTGGAGG*AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0058_C10.b : CGTGCACTGGGG**GAGGGGGACACCCCCA*GTGC*AGCAAGATCTTGCGA*GCCTGGCT
LVRM1_0056_E05.b : CGTGCACTGGGG**AGGGGGA*CATCCCCAAATGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRM1_0118_C01.b : CTTGCACTGGGG**GAGGGGGACACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRM1_0084_C06.b : CGTGCACTGGGG**AGGGGGA**CACCCCAAGTGC*AGCAAGATC*TGCGA*AGCTGGCT
OVR01_0084_B06.b : C*TGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*ACCTGGTT
OVRM1_0115_G12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCCAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRM1_0107_A11.b : CGTGCACTTGGGG*AGGGGGA**CACCCCNAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0046_C09.b : CGTGCACTGGGG**AGGGGGAACACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0091_H12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SMG01_0023_C09.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
UTR01_0022_E08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SMG01_0001_G11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ITT01_0063_B06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
THY01_0097_B07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0048_C03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0036_B07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0059_D09.b : CGTGCACTGGGGG*AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0070_B08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0022_H11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ITT01_0048_B12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGAAC*TGCGA*GCCTGGCT
KDN01_0031_H05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0017_D01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0125_B07.b : CGTGCACTGGGGT*AGGGGGAAACCCCCCAagcgcagcaagaatttgcggaacctgtgtt
LVRM1_0013_C07.b : CGTGGCACTGGG**GAGGGGGAAAACCCCGAGTGA*GGCAAGATC*GGCGA*ACCTGGCT
OVRM1_0057_F06.b : CGTGCACTGNGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0083_E08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0050_H12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRT1_0034_D12.b : CGTGCACTGGGG**GAGGGGGGCACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SKNB1_0062_C01.b : CGTGCCTGGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0094_G04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PCT01_0015_E10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0021_F06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGAT
PCT01_0014_C05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0099_B12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0040_F03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0079_B12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0103_F05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
BFLT1_0099_C05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0046_B05.b : CGTGCACTGGGT**AGGGGGACTCCCCCCAGTGCC*AGCAAGATC*TGCGA*GCCTGTCT
LVR01_0091_D10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0011_B05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ADR01_0012_C07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
PCT01_0007_H05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
THY01_0064_D07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
SPLT1_0083_B04.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
ILNT1_0064_G06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0067_B05.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVR01_0100_C06.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVR01_0099_F12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
MLN01_0032_B07.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0028_F10.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0054_B01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0012_H06.b : CGTGCACTGGGG**AGGGGA**CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
DCI01_0021_C12.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0047_E11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0015_E11.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
LVRM1_0037_A08.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRM1_0179_C01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
DCI01_0118_A02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
KDN01_0086_F02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
DCI01_0028_F01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
OVRM1_0110_B01.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
DCI01_0045_D03.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
UTR01_0014_D02.b : CGTGCACTGGGG**AGGGGGA*CACCCCCAAGTGC*AGCAAGATC*TGCGA*GCCTGGCT
20110601C-000779 : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
---------+---------+---------+---------+---------+---------+ 844
LVR01_0036_C01.b : cccttccctacaaaaaagaaaaccccattttccgctgcactctcttcagccttcctctag
CBLT1_0047_H06.b : ctcccttttttcaaataaaaaaagcaagtccgaaggagcttccaacaccttcttttgtaa
HTMT1_0033_E10.b : ACACCCCCGTC*TACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATCCTC
ADR01_0019_B07.b : cgttcttaaataaaaaaaagtctttgtaatgcgcttcataatattctcttgaaaaaaaag
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : aaaaaaaaaccatttgaagggattccccaaaatttctaggaacaaaaggaaatttggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : taccccccgtccctactaagaaaaacaaaccctttcggaatgtcggctccttctgccttt
PTG01_0109_G09.b : ACCCCCC*GTCCTACAAAGAA**ACAAGCACTTCGGATG*GAGC*TCCTcagcatctctt
SPL01_0018_E05.b : ACACCCC*GTCCTACCAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0060_H04.b : ACACCCC*GTCCTACCAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0096_A06.b : ACACCCC*GTCCTTCAAAAAA*AAACAGCACTTTCGATG*CAGC*TCCCTACGCATC*TC
SPL01_0084_C10.b : TCACCCC*GTCCTAC*AAGGA*GACAAGCACTTCGGAAT*GCGC*TCCTACAGCCTC*TC
THY01_0066_H07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0015_F10.b : ACACCCC*GTCCTTACAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0032_E06.b : ACACCCCCGTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
THY01_0205_F10.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0063_B05.b : ACACCCC*GTCCTAC*AAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0033_C02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
THY01_0062_H02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0095_C10.b : ACACCCC*GTCCTACAAAGAA*GACA*GCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SMG01_0060_C01.b : ACACCCC*GTCCTAACAAAGA*GAACAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
TCH01_0063_A12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0098_A08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SKNB1_0070_D05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRM1_0039_F04.b :
KDN01_0021_F12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PST01_0081_A12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PST01_0098_C02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0067_G01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SKNB1_0089_G01.b : cctaaccacaccccgtcgttttgtctctacatccctcttcttcccccccccccttctcct
BMWN1_0073_G08.b : ACCCCCC*GTCCTACAAAGAA*AACAC*CACGTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0031_B12.b : ACACCCC*GTCCTACAAAGAG*AACA*GCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0073_D02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVRM1_0122_E10.b : ACACCCC*G
SKNB1_0008_A06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVRM1_0042_H08.b :
PTG01_0033_E06.b : ACACCCC*GTCCTACAAAGAA*GAACAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0020_F05.b : caccccgttctaacaaaaaaaaaaacactttcggaagcaccttctaaagcattctttgga
SPLT1_0014_H11.b : ACACCCC*GTCCTACAAGAAA*AACAA*CACTTCGGATG*CAGC*TCCTAAAGCATC*TC
LVR01_0086_H02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0048_D01.b : GCACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0035_F07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVRM1_0150_A10.b : ACCCCCC*GTC*TACAAAGAA*GACAAGCACTTCG
PCT01_0008_F05.b : ACACCCC*GTCCTACAAAGAA*GAACAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
TCH01_0040_E08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SPL01_0057_F08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCCGATG*CAGC*TCCTACAGCATC*TC
KDN01_0006_A03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
CLNT1_0092_D01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0030_G03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0067_C09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SKNB1_0002_H12.b : ACACCCCGTCCCTACAAagaagaacaagcccctttcggaatggcagctcctaaagcattc
KDN01_0026_D08.b : ACACCCC*GTCCTAACTACAA*GACAAGCACTTCGTATG*CAGC*TCCTATTGCATC*TC
KDN01_0049_H11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0007_G05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0071_E04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0099_D03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0043_A07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0043_B03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0062_F04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0082_F01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0096_H10.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0040_E11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0008_B06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0100_G05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SKNB1_0008_B08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0015_E02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0094_D09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0086_A12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PTG01_0074_F05.b : aaaaactcttggaaggggcccctccaccattctctctaaaaaaaaagaaagatttgtggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b : cc
LVRM1_0056_E02.b :
ADR01_0008_H03.b : ACACCCC*GTCtacaaagagaacaacacttcgaatggcacttctacgcttctctaggaac
SPL01_0051_E12.b : ACACCCC*GTCCTACAAAagaagaaaaaccccttcgggatgcagcttccttcagcatctt
SPL01_0092_H12.b : ACACCCC*GTCCTAACAAGAA*Agacaagcactttcggatgcagcctcctacagcatctc
SPL01_0026_D06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCA
PTG01_0031_G03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
UTR01_0015_G03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SMG01_0062_G07.b : ACACCCC*GTCCTACAAAGAA*GACNAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
UTR01_0088_F03.b : ACACCCC*GTCCTACAAAGAA*GAACAGCACTTCNGATG*CAGC*TCCTACAGCATC*TC
SPL01_0052_G07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0050_C03.b : ACACTCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
MLN01_0054_H07.b : ACACCCC*GTCCTACAAAGAA*GACGAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
UTR01_0047_D02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SPL01_0068_F02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TTCTACAGCATC*TC
CLNT1_0063_C01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0098_F04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0038_F03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0079_C03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ITT01_0076_A09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ITT01_0008_F03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ITT01_0072_F01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0019_G09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0036_G01.b : ACACCCC*GTCCTACAA*GAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LNG01_0007_A07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0068_C01.b : ACACCCC*GTCCCTACAAGAA*GACAAGCACTTCNGATG*CAGC*TCCTACAGCATC*TC
KDN01_0051_G04.b : cgtcctacaagagagaaaagtactttggattgcagctcctttagcatttcttggaacgga
KDN01_0004_B01.b : ACACCCC*GTCCTACAAAGAA*GACNAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0004_E01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0088_A09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0009_G09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0025_E11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0039_G05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0025_D08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SPL01_0081_F04.b : AAACACC*GTCCTAATAAGAA*GACCAGCgccttggattgcgatcctccggcttctctag
SPLT1_0074_G11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0096_F07.b : atccccccttcctaacaaaaaataaaaacccttctggatgcaatcttcctactgctttct
SPLT1_0011_A04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0005_A04.b : ACACCCC*GTCCTACAAAGAA*GAACAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SPLT1_0092_C01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
CBLT1_0027_C11.b : ACACCCC*GTCCTACAAAGAA*AACAAGCACTTCGGAAG*CAGCTTCCTACAGCATC*TC
OVRM1_0003_E12.b : cacacatcctttattccatcacttcatccccattcctcc
LVRM1_0127_D10.b : ccccgcttacataggagaaaagctctttcggatgcacttcctcn
OVRM1_0113_H12.b : ctctccctcctattaacacgacatgcactccttatgca
OVR01_0080_B06.b : ccccgtccttacaaaaaaaaaaaccaccttggaatggagctcctacgccatcttcttggg
OVRM1_0148_A01.b :
OVRM1_0194_H08.b : ACA
LVRM1_0058_C10.b : ACACtcgtcctacaaaa
LVRM1_0056_E05.b : ACACCC
OVRM1_0118_C01.b : ACACCCC*GTCCTACAAAGAAn
OVRM1_0084_C06.b : ACAC*CC*GTCCTACAAAGAA*GAtagcacttcggatgcn
OVR01_0084_B06.b : ACACCCC*GTCCTACAAAaaaaaaaaacattttggatggagcttcctctgcctcctcttg
OVRM1_0115_G12.b : ACACTCC*GTCCTAC*AAGAA*GATCAGCACTTCTGATG*CAc
OVRM1_0107_A11.b : ACACCCC*GTCCTACAAAGA**GACAAGCACTTCGGATG*CAGC*TCCTACn
OVR01_0046_C09.b : ACACCCCCGTCCTACAAAGAA*GACAAGCACTTCGGATGGCAGC*TCCTAACGCATTCTC
OVR01_0091_H12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SMG01_0023_C09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
UTR01_0022_E08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SMG01_0001_G11.b : ACACCCC*GTCCTACAAAGAA*AAAAAGCA*TTCGGATG*CAGC*TCCTACAGCATC*TC
ITT01_0063_B06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
THY01_0097_B07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0048_C03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0036_B07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0059_D09.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0070_B08.b : ACACCCC*GTCCTANCAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0022_H11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ITT01_0048_B12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0031_H05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0017_D01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVRM1_0125_B07.b : accccccgctcccactaaaaaaaccagncctttccgtatgtatn
LVRM1_0013_C07.b : ACACgcgtgcctagagagagacatgcacttcggatgc
OVRM1_0057_F06.b : ACACCTC*GTCCTAC*AAGAT*GACAAGCAt
LVR01_0083_E08.b : ACACCCC*GTCCTACAAAGAAAGACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0050_H12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRT1_0034_D12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCTTACAGCATC*TC
SKNB1_0062_C01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0094_G04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PCT01_0015_E10.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0021_F06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PCT01_0014_C05.b : ACACCCC*GTCCTACAAAGAA*GACNAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0099_B12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0040_F03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0079_B12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0103_F05.b : ACACCCC*GTCCTACAAAGAA*AAACAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
BFLT1_0099_C05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0046_B05.b : ACACCCC*GGCCTAACAATAA*AACAAGCACTTTCGATG*CAGCTTCCTACAGCATC*TC
LVR01_0091_D10.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0011_B05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ADR01_0012_C07.b : ACACCCC*CGTCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
PCT01_0007_H05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
THY01_0064_D07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
SPLT1_0083_B04.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
ILNT1_0064_G06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0067_B05.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVR01_0100_C06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVR01_0099_F12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
MLN01_0032_B07.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0028_F10.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0054_B01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0012_H06.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
DCI01_0021_C12.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0047_E11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAAC*TCCTACATCATC*TC
KDN01_0015_E11.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
LVRM1_0037_A08.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRM1_0179_C01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
DCI01_0118_A02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
KDN01_0086_F02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
DCI01_0028_F01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
OVRM1_0110_B01.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
DCI01_0045_D03.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
UTR01_0014_D02.b : ACACCCC*GTCCTACAAAGAA*GACAAGCACTTCGGATG*CAGC*TCCTACAGCATC*TC
20110601C-000779 : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
---------+---------+---------+---------+---------+---------+ 897
LVR01_0036_C01.b : gaaacgaaaagggaaaaatcatggtcggaaaatctacaaaaacgggccccggtcacaagg
CBLT1_0047_H06.b : cgagaaggagattctggcccgaattctacaaaactggtcccggtttggggtggcctctcc
HTMT1_0033_E10.b : TAGGAACGAG**AAGGAATTCTGGGCGGAGAT*CTACAAAAATGGCCC**GGTCGAAG*G
ADR01_0019_B07.b : aatttctgggaaaatttataaaattccccggccagggggcctctccttgtatcccgattc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : aaatttacaaaaggcccgggcaaggggctttccggggatccccactcccgcgaaaaatcg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : tttttggaaccagataggggaatttgtgtcggaaaattttctataaccggccccggtcct
PTG01_0109_G09.b : gggacgaaaaagaaatcttggcggaaatttccaaaaacggccggtcaggggggccttcct
SPL01_0018_E05.b : TAGGAACGAG*AAAGAAATCATGGCGGAA**ATCTACAAA
OVR01_0060_H04.b : TAGGAACAAA*AAGGAGATCTTGGCGGAA*AATCTCAAAAAAGGGCCCGGTCcaaggggg
OVR01_0096_A06.b : TGGGAACGAG*AAGGAGATCCTGGGGGAAGATTCTTCAAAAACGGCCC**GGTCGAGG*G
SPL01_0084_C10.b : TTGGAACGAG*AAGGAAATCCTGGCGGAA**ATTTTCAAAAACCGCCC**GGGCGAAG*G
THY01_0066_H07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC**GGGTCGAG*G
OVRT1_0015_F10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCCCGG**TCGAA*G
OVR01_0032_E06.b : TAGGAACGAAGAAAGAGATCATGGCGGGAGATTCTACAAAAACGGCCCCGGGTCGAGG*G
THY01_0205_F10.b : TAGGAACGAG*AAGGAGATCATGGCCGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
LVR01_0063_B05.b : TAGGAACGAG*AAGGAGATCATGGCGGAA**ATCTACAAAAACGGCCCCG***TCGAG*G
OVR01_0033_C02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGGCC***GGTCGAG*G
THY01_0062_H02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
OVRT1_0095_C10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
SMG01_0060_C01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAACGGCCC****GGTCGAG*G
TCH01_0063_A12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0098_A08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACGAAAACGGCCC***GGTCGAG*G
SKNB1_0070_D05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
OVRM1_0039_F04.b :
KDN01_0021_F12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
PST01_0081_A12.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
PST01_0098_C02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0067_G01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
SKNB1_0089_G01.b : ggctccccctcggtatccctccccccatagcccccctcccctcccaccctcacttccccc
BMWN1_0073_G08.b : TAGGAACGAG*GAGGAaaatctggccggaaatcttaaaaaacggcccggtcggagggggc
ADR01_0031_B12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
OVRT1_0073_D02.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
LVRM1_0042_H08.b :
PTG01_0033_E06.b : TAGGAACGAG*AAAGAAATCATGGCGGAG**ATCTACAAAAATNCCC****GGTCGAG*G
ADR01_0020_F05.b : accaaaaaggaaatcttggcggaaatttacaaaaactgcccggtcgaagggggctttcct
SPLT1_0014_H11.b : TAGGAACGAA*AAGGGAATTCTGGGGGAA**ATTTAACAAAATGGGCCC**GGTCAAG*G
LVR01_0086_H02.b : TAGGAACGAG*AAAGAGATCATGGGCGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
ADR01_0048_D01.b : TAGGAACGAA*AAGGAGATCATGGCGGAA**ATCTACAAAAACGGCCC***CGTCGAA*G
BFLT1_0035_F07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGCCCC***GGTCGAG*G
LVRM1_0150_A10.b :
PCT01_0008_F05.b : TAGGAACGAG*AANGAGATCATGGNCGAG**ATCTACAAAACGGCCC*****GGTCGA*G
TCH01_0040_E08.b : TAGGAACGAG*AAAGAAATCATGGCGGAG**ATCTACAAAAACGGCCCG**GTTCGAG*G
SPL01_0057_F08.b : TAGGAACCAG*AAGGAGATCATGGCGGAA**ATCCACAAAAACCGCCC***GGTCGAG*G
KDN01_0006_A03.b : TAGGAACGAG*AAAGAGATCATGGNCGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
CLNT1_0092_D01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCG***GGTCGAA*G
BFLT1_0030_G03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAA*G
LVR01_0067_C09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAGGG
SKNB1_0002_H12.b : tttttgggaaccgaaaaaggagaatcttgggcggaaaaattttaccaaaaaacgggcccc
KDN01_0026_D08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACGAAAACGGCCC***GTGCTAC*G
KDN01_0049_H11.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAA*G
KDN01_0007_G05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0071_E04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0099_D03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0043_A07.b : TAGGAACGAG*AANGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0043_B03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0062_F04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0082_F01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTANCAAAACGGCCC***GGTCGAG*G
KDN01_0096_H10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0040_E11.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0008_B06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0100_G05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
SKNB1_0008_B08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
KDN01_0015_E02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0094_D09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0086_A12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
PTG01_0074_F05.b : gaaaaaatccaaaagggccccgcggggagggggccctccgggtgtcacccatctcccccg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : aaaaggaaattctggcggaaatcaccaaaacggcccgtcaaggggcctttccgggacacc
SPL01_0051_E12.b : ctagggaacgagaaaggagaatcttgggccggaagatctacaataaacgggccccgggtc
SPL01_0092_H12.b : ttgggaaccaggaaggaaatcctgggcgggaaattctacaaaaaaccggcccgggtccaa
SPL01_0026_D06.b :
PTG01_0031_G03.b : TAGGAACAAG*AAGG*GATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
UTR01_0015_G03.b : TAGGAACGAG*AAGGAGATCATGGGCGGAG*ATCTACAAAAACGGCCC***GGTCGA
SMG01_0062_G07.b : TAGGAACGAG**AGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GTTCGAG*G
UTR01_0088_F03.b : TAGGAAACGA*GAGGAGATCATGGCGGAA**ATCTACAAAAACCGCCC***GGTCCAG*G
SPL01_0052_G07.b : TAGGAACGAG*AAGGAAATCATGGCGGAA**ATCTACAAAAACGGCCC***GGTCGAAGG
LVR01_0050_C03.b : TAGGAACGAG*AAGGAAATCATGGCGGAG**ATCTACAAAAAGGGCCC***GGTCGAG*G
MLN01_0054_H07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGCCC****GGTCGAG*G
UTR01_0047_D02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGGCCC**GGTCGAG*G
SPL01_0068_F02.b : TAGGAACGAG*AAGGAGATCCTGGCGGAG**ATCTACAAAACGGGCCC***GGTCGAG*G
CLNT1_0063_C01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
LVR01_0098_F04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCCC**GTTCGAG*G
OVRT1_0038_F03.b : TAGGAACGGA*GAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
ADR01_0079_C03.b : TAGGAACGAG*AAGGAGATCATGACGGAG**ATCTACAAAAACGGCC****GGTCGAG*G
ITT01_0076_A09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
ITT01_0008_F03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAGAAACGGCCC***GGTCGAG*G
ITT01_0072_F01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
BFLT1_0019_G09.b : TAGGAACGAG*AAGGAGATCATGGCCGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
BFLT1_0036_G01.b : TAGGAACGAG*AAGGAGATCATGGGCGAG**ATCTACAAAAATGGGCC***GGTCGAG*G
LNG01_0007_A07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCG**GNTCGAG*G
OVRT1_0068_C01.b : TAGGAACGAG*AAGGAGATCATGGGCGAG**ATCTACAAAATGGGCC****GGTCGAG*G
KDN01_0051_G04.b : aaaggagatcttggccggaaatctacaaaaacggaaccgttcaagggggctttcatgtgg
KDN01_0004_B01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0004_E01.b : TAGGAACGAA*GAAGAGATCATGGCGGAG**ATCTAACAAAACGGGCC***CGTCGAG*G
KDN01_0088_A09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0009_G09.b : TAGGAACGAG*AAGGAGATCATGGGCGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0025_E11.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0039_G05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAAACGGCCC**GGTCGAG*G
KDN01_0025_D08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAA*G
SPL01_0081_F04.b : gaagagtagggaatcattgcggaaatctatcaaaaaccgggcggccgaggggggccttcc
SPLT1_0074_G11.b : TAGGAACGAG*AAAGAGATCATGGCGGAA**ATCTACAAAATGGCCC****GGTCGA**G
OVR01_0096_F07.b : ttaggaaacaaaaagggaaatcttgggcggaaaatctaacaaaaactgtctcggatcaag
SPLT1_0011_A04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACCAAAATGCCCC***GGTCGAG*G
OVRT1_0005_A04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
SPLT1_0092_C01.b : TAGGAACGAG*AAAGAGATCATGGCCGAA**ATCTACAAAAATGGCCC***GGTCGAG*G
CBLT1_0027_C11.b : TAGGAACCAG*AAGGAGATTCTGGCGGAA**ATCTACAAAAAGGCCC****GGTCCAG*G
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : accaaaaaggagaattctggggcggaaattttcaaaaaacgggtcccgtcgaggggggcc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : gaaataaaaagaaaatatgggcgtaaatcttcaaaaaacggccccggttaaagggggcct
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : TTGGAACGAG*AAGGAGATCATGGGCGGAGATCCTACAAAAACGGCCC***GGGCGAG*G
OVR01_0091_H12.b : TAGAAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
SMG01_0023_C09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCC****GGTCGAA*G
UTR01_0022_E08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
SMG01_0001_G11.b : TTGGAACGAA*AAGGA*ATCATGGCGGAAA*ATTTACAAAAACGGCC****GGTCAAG*G
ITT01_0063_B06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
THY01_0097_B07.b : TAGGAACGAG*AAGGAGATCATGGCGGAA**ATCTACAAAAACGGCCC***GGTCGAG*G
LVR01_0048_C03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
OVRT1_0036_B07.b : TAGGAACGAG*AAGGAGATCATGGGCGAG**ATCTACAAAAATGGCCG***GGTCGAG*G
ADR01_0059_D09.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
OVRT1_0070_B08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
BFLT1_0022_H11.b : TAGGAACGAG*AAGGAGATCATGGNCGAG**ATCTACAAAAATGGCCCG**GTTCGAG*G
ITT01_0048_B12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0031_H05.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGTCGAG*G
KDN01_0017_D01.b : TAGGAACGAG*AAGGAGATCNATGGCGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAACGGCCCC**GGCCAAG*G
LVR01_0050_H12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
OVRT1_0034_D12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGGCC**GGGTCGAA*G
SKNB1_0062_C01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0094_G04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
PCT01_0015_E10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0021_F06.b : TAGGAACGAG*AACGAGATCATGGCGGAC**ATCTACAAGAACGGCCC***GGTCGAG*G
PCT01_0014_C05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0099_B12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0040_F03.b : TAGGAACGAA*AAGGAGATCATGGCGGAG**ATCTACNAAAACGGCCC***GGTTGAG*G
KDN01_0079_B12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
BFLT1_0103_F05.b : TAGGAACGAA*GAGGAGATCATGGCGGAG**ATCTACAAAAATGGGCC***GGTCGAG*G
BFLT1_0099_C05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAATGGCCC****GGTCGAG*G
KDN01_0046_B05.b : TAGGAACGAG*AAGGATATCATGGCGGAA**ATCTACAAAAACTGGCCC**GGTCGAG*G
LVR01_0091_D10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0011_B05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAACGGCCC****GGTCGAG*G
ADR01_0012_C07.b : TAGGAACGAG*AAGGAGATCATGGNCGAG**ATCTACAAAAACGCCC****GGTCGAG*G
PCT01_0007_H05.b : TAGGAACGAG*AAGGAGATCATGGNCGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
THY01_0064_D07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
SPLT1_0083_B04.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
ILNT1_0064_G06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
KDN01_0067_B05.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
OVR01_0100_C06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACCAAAACGGCCC***GGTCGAG*G
LVR01_0099_F12.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAATGGCCC***GGTCGAG*G
MLN01_0032_B07.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0028_F10.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0054_B01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0012_H06.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
DCI01_0021_C12.b : TAGGAACGAG*AAAGAGATCATGGCGGAG**ATCTACAAAAACCGCCC***GGTCGAG*G
KDN01_0047_E11.b : TAGGAACGAG*AATGAGATCATGGCGGAT**ATCTACAAAAACGGCCC***GGTCGAG*T
KDN01_0015_E11.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
LVRM1_0037_A08.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
OVRM1_0179_C01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
DCI01_0118_A02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
KDN01_0086_F02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
DCI01_0028_F01.b : TAGGAACGAG*AAGGAGATCATGGGCGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
OVRM1_0110_B01.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
DCI01_0045_D03.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
UTR01_0014_D02.b : TAGGAACGAG*AAGGAGATCATGGCGGAG**ATCTACAAAAACGGCCC***GGTCGAG*G
20110601C-000779 : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
---------+---------+---------+---------+---------+---------+ 954
LVR01_0036_C01.b : gggccctatctggtgttactcagaatttcccggcaaatataacctcggggggtcgacccc
CBLT1_0047_H06.b : gtggtacctcggaatccctgtattaaaagccgggaagtgtcccgcctctccgccaggaaa
HTMT1_0033_E10.b : GGCCCTTCCTGG*GTACCTCGGA*CTTCCTGCAGTAAAAGTCTGG*GGTGTACCACCACc
ADR01_0019_B07.b : tgttaaaaattttcggagtggtcccacccctcataaaaattttggggaggcttttctctt
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggggggcccccccccccccggaaattttggggagccccccccccccccccgggggggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : aaggggggcccctcctacggggttaccccggaactttccttgctatatataaatttggtg
PTG01_0109_G09.b : gggtctccgaactcccggagtataaatctggatggcccacccctcccagagaacttgttg
SPL01_0018_E05.b :
OVR01_0060_H04.b : ctttcactggggacctcggaacttccggcagtataagcctgggagggtacccgccccgtc
OVR01_0096_A06.b : GGCCTTtcacggggtactccggaatttccggcagtataagttctgggggggacccacccc
SPL01_0084_C10.b : GGGCCTTCcctggggtctccggacttcccggcaatatagattgggatggtacctccccgg
THY01_0066_H07.b : GGGGCTTCACTG*TGTACTCcggacttcctgcagtataaagtctggagttgtaccaacca
OVRT1_0015_F10.b : GGGCCTTCCCTG*TGTACTCGGA*CTTCCTGGCGTATAAGTCTGGgatgtcccaccaggt
OVR01_0032_E06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTtggagggtaccaccccg
THY01_0205_F10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AATGTACCAGCACG
LVR01_0063_B05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCCGCCCG
OVR01_0033_C02.b : GGGCCTTTCCTG*GGTACTCGGA*CTTTCTGCAGAATAATTCTGG*AGGGGACCACCACG
THY01_0062_H02.b : GGGGCTTCACTG*TGTACTCGGA*CTTTCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
OVRT1_0095_C10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATNAGTCTGG*GAGTGTACAGCACG
SMG01_0060_C01.b : GGGGCTTCACTG*GGTACTCGGA*CTTCCTGCAGTATAATTCTGG*AGTGGACCACC*CG
TCH01_0063_A12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACC
KDN01_0098_A08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SKNB1_0070_D05.b : GGGCCTTCACTG*TGTACTCGGA*CTTTCTGCAGTATAAGTCTGG*AATGTACCAACACG
OVRM1_0039_F04.b :
KDN01_0021_F12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTANTAGTCTGG*AGTGTACCAGCACG
PST01_0081_A12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGGGAGTGTACCACCACG
PST01_0098_C02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0067_G01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SKNB1_0089_G01.b : cccacctcccccttcccccttaaacaatcccccccaccccccccctctcaccagaacttt
BMWN1_0073_G08.b : ctccctggggtatccgacttcctgcattaaagttcgggagggacccccccttcacaggaa
ADR01_0031_B12.b : GGGGCCTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTAC*AGCACG
OVRT1_0073_D02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCANTATAAGTCTGG*AGTGTACCA*CACG
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
LVRM1_0042_H08.b :
PTG01_0033_E06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCATTATAAtctggagtgtaccacacgtca
ADR01_0020_F05.b : gggttatcggactttccggctataaagtttggaatgtgaccacccctcccaggaaacttg
SPLT1_0014_H11.b : GGGCCTTCccggggtacccggatttctggcataaaaatctggggtggaacccccccctcc
LVR01_0086_H02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAATCTGG*ANTGTACCAGCACG
ADR01_0048_D01.b : GGGCCTTCACTG*GGTACTCGGA*CTTCCTGCAGTATAT*TCTGG*AGTGTACCACCACG
BFLT1_0035_F07.b : GGGCCTTCACTG*TGTACTCCGA*CTTTCTGCANTATAAGTCTGG*AGTGTACCAGCCCT
LVRM1_0150_A10.b :
PCT01_0008_F05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCtgcagtatagtctggatgtacagcacgtcaca
TCH01_0040_E08.b : GGGCCTTCACTG*TGgtacctcgacttcccgcaaataaaagtctggaatgtacccacccg
SPL01_0057_F08.b : GGGCCTTCCCTG*TGTACTCCGA*CTTCCTGCAtattaagccgggaatggacccgccccg
KDN01_0006_A03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
CLNT1_0092_D01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAATTCTGG*AGTGTACAA*CACG
BFLT1_0030_G03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAGGTCTGA*AGTGTACCAGCACG
LVR01_0067_C09.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACAAGCACG
SKNB1_0002_H12.b : cggtccgagggggggcctttcacctgggggtaactccggaaactttcctgggaagttata
KDN01_0026_D08.b : GAGCCTTCACTG*TGTACTCAGA*CTTCATGCAGTATAATTCTGG*ACTGTACCTGCACG
KDN01_0049_H11.b : GGGCCTTCACTG*GGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AATGTACCAGCACG
KDN01_0007_G05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0071_E04.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0099_D03.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0043_A07.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0043_B03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0062_F04.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0082_F01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0096_H10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0040_E11.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0008_B06.b : GGGCCTTCACTG*TGTGCTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0100_G05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SKNB1_0008_B08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0015_E02.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0094_D09.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0086_A12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
PTG01_0074_F05.b : aaaaaaaaggggggggggccccccccccccacaaaaaatttgggggggggcccccccccc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : gaactccggcattaaaattctggatgtaccacccgttcaaggaaattgatgggaggcctg
SPL01_0051_E12.b : gaaaggggggccctttccctggtggtactcgggaatttcctgccagtataaaaaattcgg
SPL01_0092_H12.b : ggggggccttcccctggtggtactccggactttcctggcaagaataaagttttgggaatg
SPL01_0026_D06.b :
PTG01_0031_G03.b : GGGCCTCCA*TG*TGTACTCGAA*CTTCtgcagtaaaatctggatggaccacacgtcaca
UTR01_0015_G03.b :
SMG01_0062_G07.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGAATAAtctggaatgtacagcacgtca
UTR01_0088_F03.b : GGGCCTTCCCTG*TGTACTCGGG*CTTCCTGCcagtataagtctggaatgtaccgccccc
SPL01_0052_G07.b : GGGCCTTCACTG*TGTACTCGGA*ATTCCTGCcgaataagcctgggagggtaccgccccg
LVR01_0050_C03.b : GGGGCCTTCCTG*TGTACTCGGA*CTTTCTGCAGTATAAGTtctgaagtgtaccaccacg
MLN01_0054_H07.b : GGGCCT*CACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAcacgt
UTR01_0047_D02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAaccac
SPL01_0068_F02.b : GGGGCCTTCCTG*TGTACTCGGA*CTTCCTGCATTATAAGTCTGG*AGTGTACCAGCCCG
CLNT1_0063_C01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
LVR01_0098_F04.b : GGGCCTTCACTG*TGTACTCGGAACTTCCTGCAGTATAAGTtctgaattgtaccagcacg
OVRT1_0038_F03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTTACCCAGCACG
ADR01_0079_C03.b : GGGCC*TCACTG*TGTACTCGGACTTCCCTGCAGTAT*AGTCTGG*AGTGTACCAGCACG
ITT01_0076_A09.b : GGGCCT*CACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCANCACG
ITT01_0008_F03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
ITT01_0072_F01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
BFLT1_0019_G09.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGA*AGTGTACCAACACG
BFLT1_0036_G01.b : GGGC*TTCACTG*TGTACTCGGA*CTTCCTGCAGTATAATTCTGG*AGTGTAC*AGCACG
LNG01_0007_A07.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
OVRT1_0068_C01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAATATAAGTCTGG*AGTGTACCAGCACG
KDN01_0051_G04.b : tactccggacttcctggcgatttagtcttggagggtatccccacgtctacatgaaaactt
KDN01_0004_B01.b : GGGGCTTCACTG*TGTACTCGGA*ACTCCTGCAGTATAAATCTGG*AATGAACCACCACG
KDN01_0004_E01.b : GGGCCCTCACTGTGTAACTCGGA*CTTCCTGCAATATAATTCTGG*ATGGTACCACCCCG
KDN01_0088_A09.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0009_G09.b : GGGCCTTCACTG*TGTACTNCGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0025_E11.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0039_G05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAATCTGG*AGTGTACCAGCACG
KDN01_0025_D08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SPL01_0081_F04.b : tgtggcctggcctgttccgctcaattttgacaggaaacattgcaaaattcccaaccgaat
SPLT1_0074_G11.b : GGGCCTTCACTG*TGTACCTCGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCACCCCG
OVR01_0096_F07.b : aggggcctttccttggggaccccggaacttcctggccgtttaaattcttggaaggtgacc
SPLT1_0011_A04.b : GGGCTTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AATGTACCACCACC
OVRT1_0005_A04.b : GGGC*TTCACTG*TGTACTCGGA*CNTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SPLT1_0092_C01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCACCCCG
CBLT1_0027_C11.b : GGGCCTTCAtggggtcccggatttcctgcaatataattcggagtgtacccacccgtccca
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : tcttcttgtgtaactccgacccttcctcccgcgataaactttggggggggttcaaccccc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : cctttgggtacctcggactttcctgcaaatataaatcttgggaggtttccttcccacgtc
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : GGGCCTTtccctggggtacttcggaaccttcctggcagaataagtctggaagtggaccag
OVR01_0091_H12.b : GGGCCTTCACTG*TGTACctcggacttcttgcaatataaatctggaagtgtaccagcccg
SMG01_0023_C09.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAGtctggagtgtaccacccgtcc
UTR01_0022_E08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCA
SMG01_0001_G11.b : GGGCCTTCACTG*TGTATTCCGA*CTTCCTGCATTAAAAGTTTGG*AAGGTACCAcccgt
ITT01_0063_B06.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
THY01_0097_B07.b : GGGCCCTCCCTG*TGTACTCCGA*CTTCCTGCAGTATAAGTCTGG*GATGAACCAGCACT
LVR01_0048_C03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCATTATAAGTCTGG*AGTGTACCAACACG
OVRT1_0036_B07.b : GGGCCTTCACTG*TGTACTC*GA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
ADR01_0059_D09.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
OVRT1_0070_B08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
BFLT1_0022_H11.b : GGGCTTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAACACG
ITT01_0048_B12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0031_H05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGA*AGTGTACCAGCACG
KDN01_0017_D01.b : GGGGCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : GGGCCTTCACTGGTGTACTCGGA*CTTCCTGGCGTATAAGTCTGG*AGTGGACCACCCCG
LVR01_0050_H12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AATGTACCAGCACG
OVRT1_0034_D12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAATATAAGTCTGG*AGTGT*CCAGCACG
SKNB1_0062_C01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0094_G04.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAGGTCTGG*AGTGTACCAGCACG
PCT01_0015_E10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0021_F06.b : GGACCTTCACTG*TGTACTGCGA*CTTGCTGCAGTATAAGTCTGT*AGTGTACCAGCACG
PCT01_0014_C05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAGGTCTGG*AGTGTACCAGCACG
KDN01_0099_B12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0040_F03.b : GGGCCTTCACTG*TGTACTCGGA*CTTTCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0079_B12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAGGTCTGG*AGTGTACCAGCACG
BFLT1_0103_F05.b : GGGCCTTCACTG*TGTACTCGAA*CTcccgcgttataattcggaatggacaacacgtcaa
BFLT1_0099_C05.b : GGGCC*TCACTG*TGTACTCGGG*ACTCCTGCAGTATAAGTCTGA*AGTGTACCACCACG
KDN01_0046_B05.b : GGGGCTTCccttgtgttctcggactccctgcataatattctggagtgtacccacacgttc
LVR01_0091_D10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAATATAAGTCTGG*AGTGTACCACCACG
KDN01_0011_B05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
ADR01_0012_C07.b : GGGCCTTCACTG*TGTACTCGGA*CTTTCTGCAGTATAAGTCTGG*AATGTACCAGCACG
PCT01_0007_H05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
THY01_0064_D07.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
SPLT1_0083_B04.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
ILNT1_0064_G06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0067_B05.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
OVR01_0100_C06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
LVR01_0099_F12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
MLN01_0032_B07.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0028_F10.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0054_B01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0012_H06.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
DCI01_0021_C12.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAATCTGG*AGTGTACCAGCCCG
KDN01_0047_E11.b : GGGCCTTCACTG*TTTACTCGGA*CTTCCTGCAATATAAGTCTGGAGTTGTACCCTCACG
KDN01_0015_E11.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
LVRM1_0037_A08.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
OVRM1_0179_C01.b : GGGCCTTCGCTG*TGTACTCGGA*CTTCCTGCAGTATAACTCTGG*ACTGTACCAGCACG
DCI01_0118_A02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
KDN01_0086_F02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
DCI01_0028_F01.b : GGGCC*TCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*ATTGTACCACCACG
OVRM1_0110_B01.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
DCI01_0045_D03.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
UTR01_0014_D02.b : GGGCCTTCACTG*TGTACTCGGA*CTTCCTGCAGTATAAGTCTGG*AGTGTACCAGCACG
20110601C-000779 : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
---------+---------+---------+---------+---------+---------+ 1010
LVR01_0036_C01.b : cacccccctcccctggcaaaccttcactgtgcaaggcccccttccctctcttcctatctc
CBLT1_0047_H06.b : cttgtgtggaggccctttctacttccctcttgtgtcggaggaattaagatgtaccctcct
HTMT1_0033_E10.b : tccccgggaaattggtggggggccatgcctcccgcttctggggtggggagtggaaaatgg
ADR01_0019_B07.b : cctcctcgggttgggaagaggaaaagaccccccttgtgtgggttctaattctcaaaacac
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggaaaaaggcccccctcgggggggggggatttttggaaaaaaaaggggggaaaggggttt
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : aggttttctcccccacctctctttgggggaaatcttactggggggaagtctagtgctctt
PTG01_0109_G09.b : gggggcctggcatccccatcttgggctgggaaaggaaaaaggcccccctagggttgggcg
SPL01_0018_E05.b :
OVR01_0060_H04.b : ccaggggaactttttggggaggccctggcccttctcccattctgtggggtgggggaaggg
OVR01_0096_A06.b : cttcccagggaaaacttgaaggggagggccatggccctccccccttcctgggcgctggga
SPL01_0084_C10.b : tcccaggaaaacttgttggggagggcctggcctatcgccatccctgggcttgggggaggg
THY01_0066_H07.b : cgtcccaggaaaacttgatggggaggcccttgcccttccccattccggggcttgggggag
OVRT1_0015_F10.b : cccagagactttgtggggaggcctgccatccccttctggggctgggaagtgaaaatggcc
OVR01_0032_E06.b : tcacaggagaatttgatggggagggcctgcccttcccccttcctggggctgggggagggg
THY01_0205_F10.b : TCCCAGGgagactggatgggaagccctgccatccgccatcctgggctgggggaatgggaa
LVR01_0063_B05.b : TCCCAGGAaaacttgatgggaaggccatgccctccgcatccttgggctggggaatgggaa
OVR01_0033_C02.b : TCACAGGAGA*CTTtgatgggaggccctgccctcccccttcctggggtggggaagggaaa
THY01_0062_H02.b : TCACAGGAGA*CCTGATGGGAGGCCctggcattccgcctcctggggctggggaatgga
OVRT1_0095_C10.b : TCACAAGAGA*CTTGAT*GGGAGGC*ATGCCATCC*GCATCCTGGctgggaagggaagat
SMG01_0060_C01.b : TCCCAGGAGA*CTTGAT*GGGAGGC*CATGCATCC*GCATTCTGGGCTGGGG*AAGTGAA
TCH01_0063_A12.b : GTCCAGGAGA*CCTGATGGGGAGCC*ATGCCCTCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0098_A08.b : TCACAGGAGA*CTTGATGGGAGGC**ATGCCATCC*GCATCCTGGGCTGGGG*A*GTGAA
SKNB1_0070_D05.b : TCACAGGAAA*CTTGATGGGAAGGC*CTGCCATCCcatcctgggctgggaaaatggaaaa
OVRM1_0039_F04.b :
KDN01_0021_F12.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
PST01_0081_A12.b : TCACAGGAGA*CTTGATGGGAAGGC*ATGCCATCC*GCATCCTGGGCTGGGGAAGGGGAG
PST01_0098_C02.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0067_G01.b : TCACAGGAGA*CTTGATGGGAAGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
SKNB1_0089_G01.b : gaccgcctgccttctcccctccttcctccttcctactccccctccacacccacttcccct
BMWN1_0073_G08.b : acttgatgggagggcctggcctccccatccgtggctggggagggaaaaggcccccccttt
ADR01_0031_B12.b : TCCCAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
OVRT1_0073_D02.b : TCACAAGAGA*CTTGATGGGAGGGC*ATGCCATCC*GCATCCTGGGCTGGGA*AGTGGAG
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : TCACAGGAGA*CTTGATGGGAGGCC*CTGCCATCC*GCATCCTGGGCTGGGGGAGTGGAA
LVRM1_0042_H08.b :
PTG01_0033_E06.b : cagaagacttgatgggagccatgccatcgcatctgggctggggaatgaaaatggcccccc
ADR01_0020_F05.b : agggggggccagccctctccctcctgggcggggaatggaaaaaggacccccctaagggtg
SPLT1_0014_H11.b : cagaaaatttagggggaggcctgcccttccccatccgggggtgggggaatgaaaaagggg
LVR01_0086_H02.b : TCACAAGAAA*CTTGATGGGGAGCC*CTGCCCTCC*CCATTCTGGGgctggggagtggga
ADR01_0048_D01.b : TCACAAGAGA*CTTGATGGAAGGCC**TGCCATCC*GCATCCTGGGCTGGGG*ATTGGAA
BFLT1_0035_F07.b : TCCCA*GAGA*CTTGATGGGAGGCC*ATGCCATCC*CCATC*TGGGCTGGGG*ATTGAAA
LVRM1_0150_A10.b :
PCT01_0008_F05.b : gagactgatgggagccatgccatcgcatcctggctgggaatgaagatggcacccctactg
TCH01_0040_E08.b : ttcccaggagaactttgaggggaaggcctgcccatccgcatccctgggctgggggaaggg
SPL01_0057_F08.b : tcccagaagaattgatggggagggcttggccatcccgctccctgggctggggaaagtgga
KDN01_0006_A03.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
CLNT1_0092_D01.b : TCACAAGAGA*CTTGATGGGAGGGC*ATGCCATCC*GCATCCTGGGCTGGGG*ATGGAAG
BFLT1_0030_G03.b : TCCCAGGAAA*ACTGATGGGAGGCC*ATGCCTCCC*GCATCCTGGGCTGGGG*AATGGAA
LVR01_0067_C09.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AAGTGAG
SKNB1_0002_H12.b : aaaatctcggggaggggggacccccccccccgttccccagaggaaaaaccttttaagggg
KDN01_0026_D08.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGGCAACC*GCATCCcgtgctgcgtatggaaaa
KDN01_0049_H11.b : TCACAGGAAAACTGGATGGGAGGGCATGGCCATCG*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0007_G05.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0071_E04.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0099_D03.b : TCACANGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGA*
KDN01_0043_A07.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCG*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0043_B03.b : TCACAGGAGA*CTTGATGGGGAGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0062_F04.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0082_F01.b : TCACAGGAGA*CTTGATGGGGAGCC*ATGCCATCN*GCATCCTGGGCTGGGG*AGTGGA*
KDN01_0096_H10.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0040_E11.b : TCACAGGAGA*CTTGATGGGGAGGGCATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0008_B06.b : TCACANGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0100_G05.b : TCACAGGAGA*CTTGATGGGAGG*C*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
SKNB1_0008_B08.b : TCACAGGAGA*CTTGATGGGAGGCCATGGCCATCC*GCATCCGGGGCTGGGG*AGTGGAG
KDN01_0015_E02.b : TCACAGGAGA*CTTTGATGGNAGCC*ATGCCCATC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0094_D09.b : TCACANGAGA*CTTGATGGNNAGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0086_A12.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
PTG01_0074_F05.b : ccccccccctgggggggggagaaaaaaaaacccccccccggggggggggggccccccccc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : ccctcccatccgggctggggaaggaaaaaggacccccaacgggtggggcgaatccgggaa
SPL01_0051_E12.b : ggaatgggtacccatccacggttcactagggaaaaattttggttgggggaggggcctatt
SPL01_0092_H12.b : ggaaccacgcaccgctcccccgggaaaaacttttgatgggggagggccctgtgcccaatc
SPL01_0026_D06.b :
PTG01_0031_G03.b : gaaaattgatgggaggccatgcttccccttctgggttgggaatgaaaatgccacccctta
UTR01_0015_G03.b :
SMG01_0062_G07.b : caggaaactgatgggaggcatgccatcccatcctgggctgggaatggaaaatggcacccc
UTR01_0088_F03.b : ttccaggaaactttgatgggagggcatggccatcccgcaccctggggctggggaatggaa
SPL01_0052_G07.b : tcccaggaaaattgaatgggaaggccatgcccttccccattcctggggcggggggaaggg
LVR01_0050_C03.b : tcccaggaaaacttgatgggagggcctggccaccccattcctgggctgggggagtgggaa
MLN01_0054_H07.b : cacagaagacttgatggaggcatgccatcgcatcctgggctgggaagggaaaatggcccc
UTR01_0047_D02.b : gtcacaggaaactttgatgggaaggcctggccctccgcatcctgggctgggggagatgga
SPL01_0068_F02.b : TCACcagaaaactgatggggagccctggcctcccgcatcctgggctggggaagtgaaaaa
CLNT1_0063_C01.b : TCACAGGAGA*CTTtgatggaggccattgcatcgcatcctgggctggggaagtgagaatg
LVR01_0098_F04.b : gtcacaggaaaacttgatgggagggcatggccctccccatccctgggctgggggaggtgg
OVRT1_0038_F03.b : TCACCAGGAAACTTGATGGGNAGCC*ATGCCATTC*GCATCCTGGGCTGGGG*AATGGAG
ADR01_0079_C03.b : TCACAGGAGA*CTTGATGGGAGGGC*ATGGCATCC*GCATCCTGGGCTGGGG*AGTGGAG
ITT01_0076_A09.b : TCACAGGAGA*CTTGATGGGNAGGC*ATGCCATCC*CCATCCTGGGCTGGGG*AGTGGAG
ITT01_0008_F03.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
ITT01_0072_F01.b : TCACAGGAGA*CTTGATGGGGAGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
BFLT1_0019_G09.b : TCACAGGAGA*TTGAATGGGA*GCC*CTGCATTCC*GCATCCTGGGCTGGGG*AG*GGAA
BFLT1_0036_G01.b : TCACAGGAGA*CTTGAGGGGAGGCC**TGCCATCC*GCATCCGGGGCTGGGA*AGTGGAA
LNG01_0007_A07.b : TCACAGGAGA*CTTGATGGGAGGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
OVRT1_0068_C01.b : TCACAGGAAA*ACTGATGGGAGGCC*ATGCCATCC*GCATCCTGGCCTGGGG*AGTGAAA
KDN01_0051_G04.b : gatgtgtagcccttgcattccgcattcggagctggggaatgggataaggtccccccctta
KDN01_0004_B01.b : TCCAAAGAAA*CTTGATGGGGAGCCAATGCCATCC*GCATCTTGGGCTGGGGgaatgaaa
KDN01_0004_E01.b : TCCCGGAAAA*CTTGATGGGAAGCC*ATGCCTTCC*GCATCCTGGGCTGGGG*Attgaaa
KDN01_0088_A09.b : TCACAGGAGA*CTTGATGGGAGGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0009_G09.b : TCACAGGAGA*CTCGATGGGGAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0025_E11.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0039_G05.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGA*AGTGAAA
KDN01_0025_D08.b : TCACAGGAGA*CTTGATGGGAGGNC*ATGCCATC**GCATCCTGGGCTGGGG*AGTGGAG
SPL01_0081_F04.b : ctgttaggaatggaaaataatccccccggattcattaggttccccggaaattgaaggccc
SPLT1_0074_G11.b : TCCCAGGAGA*CTTGATGGGGAGGCCATG*CATCC*GCATTCTGGGCTGGGG*AATGGAA
OVR01_0096_F07.b : caaccaccttcacatgaaaaacttgttgtgggagggcccttgtcctatcccctcaacttt
SPLT1_0011_A04.b : TCCCAAGGAGACTTTGATGGGAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AATGGAA
OVRT1_0005_A04.b : TCACAGGAGA*CTTGATGGGNAGGC*ATGNNCATC*GCATCCTGGGCTGGGG*AGTGAAG
SPLT1_0092_C01.b : TCACAGGAAA*CTTGATGGGGAGGC**CTGCATCC*GCATCCTGGGCTGGGG*A**TGGA
CBLT1_0027_C11.b : gggaacttttatgggaagccatgccatccccatcctggggtgggaattgaaaaaggcacc
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gtcaccgggaaacttttgtggggggggcatgcccccctcccattcttgggtcgggggggg
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : cccgggagaatttgatggtgagggcctggtcattctcttttcttgttgttttggaatgga
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : cacgtccccaggaaaacttgatgggaagccatgccctcccgcatcctgggcttggggaag
OVR01_0091_H12.b : tcccaaggagacttgtatgggaggccatgccctccgcattcctgggcctggggaaatgga
SMG01_0023_C09.b : cagaaacttgatgggagccatgccatccgcatcctgggctgggaagtggaaaaggcaccc
UTR01_0022_E08.b :
SMG01_0001_G11.b : cacggaaactttgaaggaagccatgccatccccttccggggttgggaaatgaaaatggga
ITT01_0063_B06.b : TCACAGGAGA*CTTGATGGGGAGGC*ATGCCATCN*GCATCCTGGGCTGGGG*AGTGGAG
THY01_0097_B07.b : TCACAGGAAA*CTTGAAGGGAAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AATGGAA
LVR01_0048_C03.b : TCACAAGAAA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCGGGGCTGGGG*AATGGAA
OVRT1_0036_B07.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCAATCC*GCATCCTGGGCTGGGG*AGTGGAG
ADR01_0059_D09.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
OVRT1_0070_B08.b : TCACAGGAGA*CTTGATGGGGAGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
BFLT1_0022_H11.b : TCACAGGAAA*CTGGATGGGAGGGC*ATGGCATCC*GCATCCGGGGCTGGGGAATTGAAA
ITT01_0048_B12.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0031_H05.b : TCACAGGAGA*CTTGATGGGAAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTN*AA
KDN01_0017_D01.b : TCACAGGAGA*CTTGATGGNAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGAAG
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : TCACAagaaaacttgatggggaggccttgcccttccccatccctgggctggggaagtgga
LVR01_0050_H12.b : TCCCAGGAAA*CTTGATGGGAAGCC*ATGCCTTCC*GCATCCTGGGCTGGGG*Aagtgga
OVRT1_0034_D12.b : TCCCAAGAAA*CTTGATGGGAGGGC*ATGCCATCG*GCATCCTGGGCTGGGG*AATGGAA
SKNB1_0062_C01.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCgcatctggggctgggnaaatggaaga
KDN01_0094_G04.b : TCACAGGAGA*CTTGAGGGNAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
PCT01_0015_E10.b : TCACAGGAGA*CTTGATGGGGGGC**ATGCCATCC*CCATCCTGGGCTGGGG*A**TGGA
KDN01_0021_F06.b : TCACAGGAGA*CTTGATGGCAGGTC*ATGCCATCC*GCATCCTGTGCTGCGG*AGTGTAG
PCT01_0014_C05.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGGAAGTGAAG
KDN01_0099_B12.b : TCACAGGAGA*CTTGATGGGGAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0040_F03.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0079_B12.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
BFLT1_0103_F05.b : ggaaacttgatgggaggcctgccatcccatcctgggtggggaatgaaaagggaccccctt
BFLT1_0099_C05.b : TCACAGGAGA*CTTTGAGGGGAGCC*ATGGCATCC*GCATTCTGGGCTTGGG*AGTGGAA
KDN01_0046_B05.b : caagaaattgatgggaggctagcctaccctacctgagttgggaagggaaaatggcacccc
LVR01_0091_D10.b : TCACAGGAAA*ATTGATGGGAGGCC*ATGCCCTCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0011_B05.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGGAAGTGGAG
ADR01_0012_C07.b : TCACAGGAGA*CTTGATGGGAAGGC*CTGCCATTC*GCATTCTGGGCTGGGG*AGTAAGA
PCT01_0007_H05.b : TCACAGGAGA*CTTGACGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
THY01_0064_D07.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGNGCTGGGG*AGTGGAG
SPLT1_0083_B04.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
ILNT1_0064_G06.b : TCACAGGAGA*CTTGATGGGGAGGC*ATGCCATCC*GCATCCTGGCCTGGGG*ATTGGAG
KDN01_0067_B05.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
OVR01_0100_C06.b : TTCCAGGAGA*CTTGAAGGGAAGCC*ATGCCATCCCGCATCCTGGGCTGGGG*AGTGGAG
LVR01_0099_F12.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGNGCTGGGG*AGTGGAG
MLN01_0032_B07.b : TCACAGGAGA*CTTGATGGGTAGGC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0028_F10.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0054_B01.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
KDN01_0012_H06.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
DCI01_0021_C12.b : TCACAAGAGA*CTTGATGGGGAGGC*CTGCCTTCC*GCATCCTGGGCTGGGG*AGTGGAA
KDN01_0047_E11.b : TCTCCAGGATACTTGATGGGAGGCC*ATGCCTTCC*TCATCCTGGGCTGGGG*AGTGGAG
KDN01_0015_E11.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
LVRM1_0037_A08.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGGA
OVRM1_0179_C01.b : TCACAAGAGA*CTTGATGGGACGCC*ATGCCATCC*GCATCCTGAGCTGGGG*AAGGGAA
DCI01_0118_A02.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGNGCTGGGG*AGTGGAG
KDN01_0086_F02.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
DCI01_0028_F01.b : TCCCAGGAGA*CTTGA*GGGAAGGC*ATGTCATCC*GCATCCTGGGCTGGGG*AGTGAAG
OVRM1_0110_B01.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
DCI01_0045_D03.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCCATCC*GCATCCTGGGCTGGGG*AGTGGAG
UTR01_0014_D02.b : TCACAGGAGA*CTTGATGGGAGGCC*ATGCTATCC*GCATCCTGGGCTGGGG*AGTGGAG
20110601C-000779 : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
---------+---------+---------+---------+---------+---------+ 1068
LVR01_0036_C01.b : cctcggccggccgataattgggaaaaaaaagcgtttacccctcccttatatatgtttttt
CBLT1_0047_H06.b : tcccggccgggctggaatctccgttaataaaaacggcggtcgcaaatggctttgtttcaa
HTMT1_0033_E10.b : ccccccttctgggttggtcggcacctctggaaacaaaaatgggggggaaaggcttttttt
ADR01_0019_B07.b : attgggggaaatagtttttttaaaatcctaagaaagatactcggtacttcagcaaaataa
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : tttaaacccccaaaaagaaaaatcgggggccaacaaaaaaaggggggggccccaccctcc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : tcctacaatcctgtggggccttggtggaattttgtataaattagtccctcctccctacct
PTG01_0109_G09.b : gaaactctggaaacaaacggggggaaaagggttcttaaaatccccaaagacaggttcccg
SPL01_0018_E05.b :
OVR01_0060_H04.b : aaaaaatggccacccccctattgggctggggtgggcaaccttcctggaaaacacaaaact
OVR01_0096_A06.b : aatggaaaaaatggcaccccccttcctgggcggggtcgggcaacctcctgggaa
SPL01_0084_C10.b : ggataatgggccacccccctaatgggttggtctgggcatctcctggaaaaaagaagtggg
THY01_0066_H07.b : tggaaaa
OVRT1_0015_F10.b : cccctacgggctggcggcgactccggaaaacagacgggggtgaaaaggccttcttaaaat
OVR01_0032_E06.b : ggagaagggacccccccttactggtctgggccgggaaactccccggaaaccccaaaacgg
THY01_0205_F10.b : aatggcccccccctactggcctgggtcggccacttccgggaacccaaaccgggggtgaac
LVR01_0063_B05.b : aatggcacccccctactggcttgggtccggcaactccctgggaaccccaaactggggggt
OVR01_0033_C02.b : aatgggccccccccttcgggtttgggccggaaattcccggaaacaccaaatggggggtgg
THY01_0062_H02.b :
OVRT1_0095_C10.b : gccccccctactggctggtcggcactcctggacaccgactggggggaaatggcttcttaa
SMG01_0060_C01.b : AATGGGAC*CCCCTAtgggtgggccggaactcctggaaccagaacggggtgaacatggct
TCH01_0063_A12.b : AATGGCAC*CCCCTACTGCCTGGTCGGgcaactcctgggaccccgaactggggggacatg
KDN01_0098_A08.b : GATGGCAC*CCCCTACTGGCTGGTCGGCActctgaaacacagatggggtgacatggcttc
SKNB1_0070_D05.b : tgccacccccactggctggccgcaactccggaaaccaaaccggggtgacaatgccttctt
OVRM1_0039_F04.b :
KDN01_0021_F12.b : AATGCACC*CCtactgcctggtcggcactcctgaaacacgactggggtgacaatggcttc
PST01_0081_A12.b : AATGGCCC*CCCCTACGGGCTGGTCGGCAACCCCTGGAAagcaaaacggggggaacaatg
PST01_0098_C02.b : AATGGCAC*CCCCTACTGGCTGGTCGGGCACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0067_G01.b : ATGG**CA*CCCCTACTGGCTGGTCGGCAACTCCTGaacacagactggggtgacatggct
SKNB1_0089_G01.b : ccccccctcgcccgcccctcaattcccccctcagaaggccttcttcccccccctttcctg
BMWN1_0073_G08.b : gggtgggtcgcaacccgggaaacaagcggggggaaaatgctttttaaattccaaaggaag
ADR01_0031_B12.b : AATGGCCC*CCCCatggctgggccggcaatcccggaaaccaaactggggggaaaaggggt
OVRT1_0073_D02.b : AAT*GCCC*CCCCTACTGGCtggcggcaactcctggaacaaaactgggtgaacagggctc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : AATGGCAC*CCCCTACTtggctggtcggcaaactcctggaacacagaaccggggggaaca
LVRM1_0042_H08.b :
PTG01_0033_E06.b : taatggtgggcggaactcctgaaacaaactgggggaaatggttctttaaatcctcaaaga
ADR01_0020_F05.b : gttggcaatccttgaaaaccaaacggggtgaaaagtgcttctttaaaatcccaaagaaag
SPLT1_0014_H11.b : cccccctttgggggggtggggaaaccccggaaaaaaaaacggggggaaaaagggctcttt
LVR01_0086_H02.b : aaatggcacccccctctgggctgggtcgcaaactcccgggaaaaccaaacggggggggga
ADR01_0048_D01.b : ATGGCACC*CCtactggctggccgcaatccgggaacaagactggggggaaatggctcttt
BFLT1_0035_F07.b : AATGGCAC*CCCCTAATGGCTGGTCCGCAACTCCTGGAACCC*GAACGGGGTGA*CAATG
LVRM1_0150_A10.b :
PCT01_0008_F05.b : ctggtcgcactctgaaaacgactgggtgacatggctctttagatctcaaagcagatcctg
TCH01_0040_E08.b : agaaatggccccccctacttggctggtgcgggaactctccggaaaacacagactgggggg
SPL01_0057_F08.b : aaatggccccccccctatggggtggggtggggaactccctgggaacaccaaacgtggggg
KDN01_0006_A03.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCTTGAAACACAactggggtgacatggct
CLNT1_0092_D01.b : ATGGCCCC*CCtactggcgggcggcaattcctgaacacgactgggggacaatggctccta
BFLT1_0030_G03.b : AA*GGCAC*CCCCTACTGGGTGTTCGGAAACTCCggaaaacagacggggggacaagggtt
LVR01_0067_C09.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCC
SKNB1_0002_H12.b : ggggaggggccatgggcctattcccccaaattccctgggggccttggggggaaagatggg
KDN01_0026_D08.b : tgccaccccctactggatggtcgaaagtcctggaacacccactgtggtgaaatgccctct
KDN01_0049_H11.b : AATTGCCC*CCCCTACTGGCTGGgccggaacttcctggaaaacaaacgggggtgaaaagg
KDN01_0007_G05.b : ATGGCACC*CCtactggctgggtcgcactcctgaacacagactgggtgacatggctcntt
KDN01_0071_E04.b : AAT*GCAA*CCCCTACTGGCTGGTCGGCActcctggaacacgactgggtgacaatgcttc
KDN01_0099_D03.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAcacagactggggtgacatggct
KDN01_0043_A07.b : AATGGGCA*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAtgg
KDN01_0043_B03.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAtgg
KDN01_0062_F04.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAAC*CAGACTGGGGTGA*CAATG
KDN01_0082_F01.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCTTGGAACACAAACGGGGGTGA*CCATG
KDN01_0096_H10.b : GATGGCAC*CCCCTACTGCCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0040_E11.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAAACTGGGGTGA*CAATG
KDN01_0008_B06.b : AATGGCAC*CCCCTACTGGCTGGTCNNGCACTCCTGGAACACAGACTGGGGGTG*ACATG
KDN01_0100_G05.b : AATGGCAC*CCCCTACTGGCTGGTCCGCAACTCTTGNAACACAGACTGGGGTGA*CCATG
SKNB1_0008_B08.b : AATGGCAC*CCCCTACTGGCTGGTCGGCCACTCCTGGAACCCAGACTGGGGTGAACAATG
KDN01_0015_E02.b : AATGGCAC*CCCCTACTGGCTGGTCGGGCACTCCTG*AACACAGACTGGGGTGA*CNATG
KDN01_0094_D09.b : AATGGCAC*CCCCTACTGGCTGGNTCGGCACTCCTGGAACACAGACTGGGGTGA*ACATG
KDN01_0086_A12.b : AATGGCAA*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CNATG
PTG01_0074_F05.b : gaaaaaaaaggggggggggggatgtgttttttaataacaaaaaaaaaaagagggtgtggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : caaaaagggggaacaaaggctttttaaaatccaaaaaagggtcatggggctcaaattaaa
SPL01_0051_E12.b : ggcccatccccgcaatttccttggggacctggggggaaaattgggataaata
SPL01_0092_H12.b : ccgccattt
SPL01_0026_D06.b :
PTG01_0031_G03.b : tggctgtcggaaatcctgaaaacaaaaggggggaaaagggctccttaaaaccccaaagaa
UTR01_0015_G03.b :
SMG01_0062_G07.b : taagggtggtcggaaactctggaacaaaacggggtggacatgcttctttaaatacccaaa
UTR01_0088_F03.b : aatggcaccccctactggctggggtcggaactccgggaaaccaaaagggggggaaaatgg
SPL01_0052_G07.b : aaaaagggacccccccctaatgtgcgggtccgggaaattccctggaaaaacaaaacgggg
LVR01_0050_C03.b : aagggccccccccactggccggggccggcaacctcctggaaaaacaaaacggggggtgaa
MLN01_0054_H07.b : cccactggctgggcgcaattcctggacaagacggggtggaaatgggttctttaaatcctc
UTR01_0047_D02.b : gaaatggcacccccctactggctgggtcgggaacttcctgggaaacccaaactgggggtt
SPL01_0068_F02.b : tggcacccctactggctgg
CLNT1_0063_C01.b : ccacccctactggctggtcgcacctctggaacccagactgggntgacaaggcttccttag
LVR01_0098_F04.b : aaaaagggccccccccttctgggcttggtcgggcaactccctggaacccccaaaactggg
OVRT1_0038_F03.b : AATGGCAC*CCCttaatggcgggtccggcaactccggaaaccaaactgggggtgaaatgg
ADR01_0079_C03.b : AATGGCA**CCCCTACTGGCTGGTCGcaacttctggaaccagactggggtgacatggctt
ITT01_0076_A09.b : AAT*GCAC*CCCCTACTGGCTGGTCGccactcctggacacagactggggtgacatggctt
ITT01_0008_F03.b : AATGGCAC*CCC*TACTGGCTGGTCNGCAAttctggaaccagactggggtgacatggctt
ITT01_0072_F01.b : AA*GGCCA*CCCCTACTGGCTGGTCCGCAATTCCTGaacacaaactggggtgacattggc
BFLT1_0019_G09.b : AAATGCAC*CCCCTACTGGCtgttcggcaattccctggaaccaaaaggggggaacaaggc
BFLT1_0036_G01.b : AAGGCAAC*CCCCTACTGGCGGGTCGcaactcctggaaacaaaactggggggacatggct
LNG01_0007_A07.b : AATGGCAC*CCCCTACTGGCTGGgtcgggcactccctggaacaccgactgggggtggaca
OVRT1_0068_C01.b : AATGGCAC*CCCCTACGGGCTGGTCCGGCACTCCTGaaaaaaaactggggtgaacatggg
KDN01_0051_G04.b : tgaaatgggcggccatatctcggaaacacaagacggggggaacatgggttttatttaaaa
KDN01_0004_B01.b : aatggcaccccctaatggtgggccggaacatcctgaaaaaaaacgggggtgaaatggctt
KDN01_0004_E01.b : aaggcccccctaatggttggccggaaatcctgaaaaaaaaactgggtgaaaaaggcttct
KDN01_0088_A09.b : AAT*GCAC*CCCCTACTGGCTGGTCGGCActcctggaacaagactggggtgacatggctt
KDN01_0009_G09.b : AATGGCAC*CCCCTACTGGCTGGGTCGGCACTCCTGGAACACAGACTGGGGTGA*CAtgg
KDN01_0025_E11.b : AATGGCAC*CCCCTACTGGCTGGTCGGCA*CTCCCTGAACACAGACTGGGGTGA*ACATG
KDN01_0039_G05.b : ATGGCACC*CCtactggctggtcggaaatcctgaaaacagactgggtgacaatggcttct
KDN01_0025_D08.b : AATGGCAC*CCCCTACTGGCTGGTtcgcactcctggacacagactggggtgacatggctt
SPL01_0081_F04.b : aaactccccccctggcagaaagcccttttaaccaaggagcctgctaaacttggaggaaag
SPLT1_0074_G11.b : AAT*GCAC*CCCCTAATGGCTGTTCGGgcactcctggaaaacaaacggggggaacatggc
OVR01_0096_F07.b : tttgtctttggggaagtggaacaaagggcccccccccacattggcccgggtgttgtacac
SPLT1_0011_A04.b : AATGGCCA*CCCCTAATGGCcgggtcggcaactctgggaaaaaaaagggggtggacaagg
OVRT1_0005_A04.b : ATGGCACC*CCtactggctggntcgcactcctggacccngactggggtgacaatgcttct
SPLT1_0092_C01.b : AAATGGAC*CCCCTACTGGCTGGTCGGCAactcctgaacaaaaagggggtgaaatggctc
CBLT1_0027_C11.b : cccttactggctggttggaacacccgggaaacaaaacggggggaacaaggcctctttaaa
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gggagaaatggcccccccccactcggggggggggggaaaatcttcggggaaaacaaagag
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : aaaaataccttcccccttcttggcggtggtggggactactctgtgaaaaataaaatggag
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : ggaaaatgggccccccccaactgggtgggccgggaaattcccggaaaacccgaacggggg
OVR01_0091_H12.b : aaaatggccaccccccctcgtggctgggtccggcaactccttggaaaaaaagaaagtggg
SMG01_0023_C09.b : cctactggctggccggaaattctgaaaacaaaatggggggaaaatggtttcttaaatcct
UTR01_0022_E08.b :
SMG01_0001_G11.b : ccccccacggctggtccgcaatcctggaacaaaagggggggaaaagggctttttaaatcc
ITT01_0063_B06.b : A*TGGCAC*CCCCTACTGGCTGGTCGGCActcctgaacacagactggggtgacatggctt
THY01_0097_B07.b : AAatggcaccccctaactggttggtctggcactcctggaaaaaaaaactggggtgaaaaa
LVR01_0048_C03.b : gaatggcacccccctatggctgggccgcaattcctggaaacccaaaacgggggtgacaat
OVRT1_0036_B07.b : AATGGCAC*CCCTACTGGCtgttccggcactcctggaccacgaactggggtgacatggct
ADR01_0059_D09.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAAGG
OVRT1_0070_B08.b : AATGGCAC*CCCCTACTGGCTGGTCNGCAACTCCTGGAACACAGACTGGGGTGA*CAtgg
BFLT1_0022_H11.b : AATGGAAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAAAACAGAATGGGGTGA*CAATG
ITT01_0048_B12.b : AATGGGCA*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*ACATG
KDN01_0031_H05.b : AAAGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGAAACACAaatggggtgacaatgct
KDN01_0017_D01.b : AAATGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : gaatgggcaccccccttactggcctgggtcgggcaactccctggaaaaaacaaactgggg
LVR01_0050_H12.b : gaatgggacct
OVRT1_0034_D12.b : AATGGCAC*CCCtaatggctggttcgcactcctggaaaacgaatggggggaacatgcctt
SKNB1_0062_C01.b : tggcancccctactggctggtncgcactcctgnaacacnactggggtgacatggcttctt
KDN01_0094_G04.b : AATG*CAC*CCCCTACTGGCTGGTCGGCActtctggaaccagactggggtgacaatgctt
PCT01_0015_E10.b : AAATGGCA*CCCCTACTGGCTGGTCGGCActcctgaacacagactggggtgacatggctt
KDN01_0021_F06.b : CATGTCAC*CACCTACTGGCTGGTCGGCAACTCCTAGAACAagactggtgtgaccatagc
PCT01_0014_C05.b : AATGGCAC*CCCCTACTGGCTGGTCGGCACTTCTTGNAAACCAGACTGGGGGGA*CNATG
KDN01_0099_B12.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0040_F03.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0079_B12.b : AATGGCAC*CCCCTACTGGCTGGNNTCGCACTCCTG*AACACAGACTGGGGTGA*CAATG
BFLT1_0103_F05.b : atggcggtcggaaatccctgaaaaaaacaggggggaaatggttccttaaatccccaagga
BFLT1_0099_C05.b : AAATGCAC*CCCCTACTGGCTGGGCGGCActcctgaacaacgaatggggtgacatggctt
KDN01_0046_B05.b : ctatggttgggtcgaaactcctggaacagaaaggggtgacaagggcttctttagatcttc
LVR01_0091_D10.b : AATGGCCC*CCCCTtactggctgggtcgggaacctcccggaaaccaaaactgggggggga
KDN01_0011_B05.b : AATGGCAC*CCCTTACTGGCTGGTCGGCAACTCCGGGA*CACAGACTGGGGTGA*CNATG
ADR01_0012_C07.b : ATGGCACC*CCctattgcctggtcgcaactcctggaaccgactggggtgacatggcttct
PCT01_0007_H05.b : AATN*CAC*CCCCTACTGGCTGGNTCGCAACTCCTG*AACACAGACTGGGGTGG*ACATG
THY01_0064_D07.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
SPLT1_0083_B04.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
ILNT1_0064_G06.b : AATGGCAC*CCCCTACTGGCTGTTCGGGCACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0067_B05.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGNAACACAGACTGGGGTGA*CAATG
OVR01_0100_C06.b : AATGGCACCCCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTTGGGGTGACAATG
LVR01_0099_F12.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
MLN01_0032_B07.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGAAACACAGACTGGGGTGG*ACATG
KDN01_0028_F10.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0054_B01.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0012_H06.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
DCI01_0021_C12.b : AAAG*CAA*CCCCTACTGGCTGGTCCGGCACTCCTGGAAAAAAAACTGGGGTGA*AAATG
KDN01_0047_E11.b : AATGGCAC*CCCCTtattggtttgtcggcaactccctgtaacacagactggggttgaaca
KDN01_0015_E11.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
LVRM1_0037_A08.b : GATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGGACACAGACTG
OVRM1_0179_C01.b : GATGGCCC*CCACCACAGGCTGGTCGGCaatccttgtactcaaaaaggggtgacaacggc
DCI01_0118_A02.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
KDN01_0086_F02.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
DCI01_0028_F01.b : AATGG*AC*CCCCCACTGGCTGGTCGGGAACTCCTGGAACACAactggggtgacagtggc
OVRM1_0110_B01.b : AATGGCAC*CCCCTACTGGCTGGTCGGNCACTCCTGGAACACAGACTGGGGTGA*CAATG
DCI01_0045_D03.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
UTR01_0014_D02.b : AATGGCAC*CCCCTACTGGCTGGTCGGCAACTCCTGGAACACAGACTGGGGTGA*CAATG
20110601C-000779 : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
---------+---------+---------+---------+---------+---------+ 1126
LVR01_0036_C01.b : gggtctcctcgtttactactcctcccctcgacaaacacccacaaataaaccaggtgggcc
CBLT1_0047_H06.b : ccaccccgacgcagagtttatggtggatcctattcggattctccgcggcgcgcccacttt
HTMT1_0033_E10.b : aaaacccaaaaggacggaaccctggggctccagtcaaaaattggggggtgaacccggggc
ADR01_0019_B07.b : tggggggaatactcattcccccatataatagattttatttgcccccctgggtttttttct
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ccccctttaaaagaaatttttttgcccccccgggtattttttcccaaaaccccggggggg
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : gtggtggtgggcttgggtatatatctcttgtgttgatactattaacgttgtgctgtggat
PTG01_0109_G09.b : ggggcccacaccaaaatcgggcgggaacccgggtcccccctttcaaaggtttattttttg
SPL01_0018_E05.b :
OVR01_0060_H04.b : gtggggtgaacaagtggcttctn
OVR01_0096_A06.b :
SPL01_0084_C10.b : tgtggacaaggggcttctttttagaccctcctaagaaatg
THY01_0066_H07.b :
OVRT1_0015_F10.b : ctccaaagaaaggaatcctggggactcgatcaaaatcggggttgaaacccgtggcccccc
OVR01_0032_E06.b : gggggggaaaaaattgggcttttcttttaaaaatccctccaaaaaggaaaaagggaatcc
THY01_0205_F10.b : aaggggcttcttttaaaattcccccaaaaggaaagggttttcctggggggcctttcgaat
LVR01_0063_B05.b : ggacaatgggttttct
OVR01_0033_C02.b : aaaatgggcttttttttaaaaatcccctaaaaggaaaagggaatccctttggggggcttc
THY01_0062_H02.b :
OVRT1_0095_C10.b : gatcttcaagggacgggacccggggctccaatccaaaatggggctggatccctgtccccc
SMG01_0060_C01.b : tcttaaatccttaaagaaaggatcctgtggggcccagctcaaatcggggctggaacccag
TCH01_0063_A12.b : ggctcccttaagatccccagaggaaa
KDN01_0098_A08.b : tttaaatctacaaagaaggatcctgggcatcaatcagaaatctgctggaaccaggactcc
SKNB1_0070_D05.b : taaaatctccaaggacagatcctgtgcctccaatccaaaatctggctggaaccccattac
OVRM1_0039_F04.b :
KDN01_0021_F12.b : tttagatcttcaaagaacagatcactgtgcatcaagtcaaaatcgtgcctgaatccatgt
PST01_0081_A12.b : ccttctttaaaatcctccaaaagaagggtcacgggggccatcaaaccaaaaatctggcct
PST01_0098_C02.b : GCTTtctttagatccctcgaagaaaaggatcctgggggcatcaattccaaatccttggct
KDN01_0067_G01.b : tcttttagatctcaaagnaangatcactggtgcatcaagtcgaantcgtggctgaaatcc
SKNB1_0089_G01.b : tctctgcctcaccctctcccccccgctcctactctctctccccatccccccgctcccccg
BMWN1_0073_G08.b : gatccggggcctcatcaaaattggggggaaacaggtcccccctttaaaagtgttttgttg
ADR01_0031_B12.b : tcctttagatcctccaaggaaaggatcccgtgggctccaaacaaaaaatgggggggggaa
OVRT1_0073_D02.b : cttaaatcctcaagggacggaccctgtggcacaattcaaaacctggtggaatccagtctc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b : agggctttctttaagatccttcgaaaggcaggatcccc
LVRM1_0042_H08.b :
PTG01_0033_E06.b : aagaacctgtggctcaatcaaaatggggcggaacccaggacccccttttcaaaaagggaa
ADR01_0020_F05.b : gtctncttgtggttccagtcaaaattgggctggaatccctggtacccccatttcaaaaag
SPLT1_0014_H11.b : ttaaaattccaaaaagaaggaatccggggggccccaataaaaaataggggggggaaaccc
LVR01_0086_H02.b : catggggctttttttaaaaatccccccaaaggaacagggattcctgggggggaattccaa
ADR01_0048_D01.b : aaatctcaaagacggatctcgtggcatcattcaaattgtggcggaacccagtaccccctt
BFLT1_0035_F07.b : GCTTCTTTAAaaccctcaaaggaggaatcctggtggctctcactcaaaatggggctggaa
LVRM1_0150_A10.b :
PCT01_0008_F05.b : tgctcagtcgaaacgggctggatcatgactccaattcaaatgctattgttgcgccctggc
TCH01_0040_E08.b : gaaaaatggctttcctttaaaatcccccaaaggaaaggaattcccgggtggctctccaaa
SPL01_0057_F08.b : ggaacaagggcct
KDN01_0006_A03.b : tccttaagattctcgaagaaaggatcctggtgcatcattcaaaatcgggctggaatccat
CLNT1_0092_D01.b : aaatcctcaaggacaggtcccggggctcgagtccaaaactggctggaaccctggactccc
BFLT1_0030_G03.b : tcttaaaacccccaaagaaagaatccggggccttcgagtaaaaatcgggggggaacccag
LVR01_0067_C09.b :
SKNB1_0002_H12.b : agaaaaaaatgggggcccccccccccccatcatgggcgcctgtggggtcgggggcaaaac
KDN01_0026_D08.b : taaaatcctcagaaacaagatccctgggcatcgatcagaatcgtggctggatccctgact
KDN01_0049_H11.b : gctttctttaaaatccccnaaggacaggatcacgtgggcactgaattcaaaaattggggc
KDN01_0007_G05.b : nagatctcannagacagatcctgggcatcnagtaaaatcgggctggatccatggctccaa
KDN01_0071_E04.b : tttagatcctcaaggacagatcctnggcatcgagtcaaaaacgtggtggaatccagtact
KDN01_0099_D03.b : tcttaagatcctcaaagacaggatcatgtggcatccagtcaagatcgtggctggatccat
KDN01_0043_A07.b : cttctttagaatctcaaaagacggatcactgtgcatcaagtcgaaatcgtggctgaaatc
KDN01_0043_B03.b : cttctttagaatctcagaggacagaatcactgtgcatcgagtcaaagacgtgcctggaat
KDN01_0062_F04.b : GCTTCTTaagaatctcaaangacagatcctgtggcatnagtcgaaaacgtggctggaatc
KDN01_0082_F01.b : CCTTCTTTAnaatctcaaaggaaggatcactgggcctcaaatcaaaatcctggctgaaat
KDN01_0096_H10.b : GCTTCTTTAgaatctcaaagaaaggatcactgtggcatccagtcgaaatccgggctgaaa
KDN01_0040_E11.b : GCTTCCTTAAGATCCTC*AGAagaacgggatcctggtggcatcgaatcaaaaaatcggct
KDN01_0008_B06.b : GCTTCTTTAgatcctcagaggacagatcctgtgncatcnagtcaaaatcgtggctgggat
KDN01_0100_G05.b : GCTTTCTTTAGATCCTC*AGAGGACCAGATCACTGTGGCATCAAGTCgagatcgtggctg
SKNB1_0008_B08.b : GCTTCTTTTAGATCCTCAAAAGGACAGGATCCCTGTGGCATCCAATCAGAGATC*GGGGC
KDN01_0015_E02.b : GCTTCTTTNAGATCCTC*AAAGGACANGATCACTGGTGCATCAAGTCCGAAATC*GTGGC
KDN01_0094_D09.b : GCTTCTTTAAGATCCTC*AAAAGAACAGATCACTGTGGCATCGAGTCAAAAATC*GTGGC
KDN01_0086_A12.b : CCTTCTTTAAGATCCTC*AGAAGACAGGATCACTGTGGCATCAAGTCAAAGATC*GTGGC
PTG01_0074_F05.b : gcacaaaaaaaaaaaagggggggggaccccccccccccccccctctaaaaaaaaaatttt
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : taggggggggaccccgttcccccttttcaaaaggtaatttttgccccccggggattttcc
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : ggatcctggggactcagcaaaaactgggctgaaaccagtgccccatttcaaaaggttaat
UTR01_0015_G03.b :
SMG01_0062_G07.b : gaaggatcctggggcaccatcaaaatcggggcgggacccaggatccccattttaaaaggc
UTR01_0088_F03.b : ctttctttaaaaaccccaaagaaggaattcctggggcatctcattaaaaatcgggggctg
SPL01_0052_G07.b : ggggaacattgggcc
LVR01_0050_C03.b : a
MLN01_0054_H07.b : aaggaaggatccctggtgcttcaatccaaaatcggggggggaaaccctgttctcccattt
UTR01_0047_D02.b : gaaaaatggggcttcttttaaaaatccttcaaaa
SPL01_0068_F02.b :
CLNT1_0063_C01.b : atcccccaaggaaggatcccggggcaccaagccaaatcgggccgggaacccagtaccccc
LVR01_0098_F04.b : ggggaacaatggggctttcttttaaaaattccctcccaaaggaaacaggatttcccttgg
OVRT1_0038_F03.b : cttccttaaaatccctaaaggacaagaacctgtgggcatccattccaaaatctgggttgg
ADR01_0079_C03.b : ctttaaatctcaaaagacagatcctgtgcatcnatcaaaaatctgctgggatccatgact
ITT01_0076_A09.b : ctttagatcctcaaagacggatcctgtggcatcagtcaaaatcctgctggaatcctgtac
ITT01_0008_F03.b : ctttagatcctcgaggacaggatcctgttgcatcnagtcnaaatcggggctgaattccat
ITT01_0072_F01.b : ttctttaaatcctcaaaggacaggatcacgtggcatcaagccgaaattctggctggaatc
BFLT1_0019_G09.b : tttttttaaatccccaaagaaaaggatcccgtggcctccaatccaaaatcgggccgggaa
BFLT1_0036_G01.b : tctttaaaaccccaaagaaaggatcatggtggcatcagtcaaaaatctgcgtggaaaccc
LNG01_0007_A07.b : ttggccttcctttaaaatccctccaaaaggacagggattacttggtgggcatccaagatt
OVRT1_0068_C01.b : ctctttaggatctccaaaggaaggatccttgtgcatcgagtcaaaatgtgggcgggaacc
KDN01_0051_G04.b : tcctctaagcacaggatgcagggggttatgagatcaaaaaatcgggggggaaaaccccgt
KDN01_0004_B01.b : ctttaggatcccaaaaaaaggatacctggggatcaaatccaaaatccgggcgggaaccca
KDN01_0004_E01.b : ttaaaatccccaaagaaaggatccctgtggatccaaccaaaaataggggcggaacccctt
KDN01_0088_A09.b : ctttagatctcagaggacagatcactgtgcatcaatcaaagtcgtggctgaatccatgtc
KDN01_0009_G09.b : cttctttagaatctcnaagacaggatcctgtggctcgagtccaaaatctggctggatccc
KDN01_0025_E11.b : GCTTNCTTAAGATCCTC*AGAagacggatcactgtggctccaatcagaaatcgtggctga
KDN01_0039_G05.b : ttaaatcctcaaagacaggatcctgtggcacgattcgaaaacgtgcctgaaaccctgtac
KDN01_0025_D08.b : cttnagatctcaaagacagatactgtgcatcgatcagagtctggctggatccatgtatcc
SPL01_0081_F04.b : ttaaagaggttcgggggtgggccctgggggaaaaaaccttaaaactgggctggaccccca
SPLT1_0074_G11.b : ttccttaaaatactaaaagaacggaatcctggggcatcagttcaaaattggggcgggatc
OVR01_0096_F07.b : attcctttgaaaatacaaatactgggggtggtaccactgtgtctttccctttaacaaaac
SPLT1_0011_A04.b : cttctttaaaatctcaaagaaaaggatactggggcatccaatcaaaaatctgggcgggat
OVRT1_0005_A04.b : taaaatcctcaaaggacggatcacgttggcatcaatcaaaataggggcgggaacccagga
SPLT1_0092_C01.b : tttaaattctcaaaaaaagaatcctgtggcctcaatcaaattggggcggaaacccatgta
CBLT1_0027_C11.b : ttcccaaaaaaagggatccctgggcccaaagccaaaaatctgggtggaaacccattaact
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : ggggggggacaaagggcttctttttataacccccctagagaaaaggagcattcgtggtgc
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : ggtcaaataatgcttttttttattataccctccctaagagattggttatcttgtttgcac
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : gggaaaattggctttctttaaaaaacccccaaaaggaaggggaatcctctgtggggcttc
OVR01_0091_H12.b : ggtgaaaaatggctttcttttaaaatatcctccaa
SMG01_0023_C09.b : tcaaagaaaggatcctgggcctctcaaccaaaatcgggcggaaacccggtatcccctttt
UTR01_0022_E08.b :
SMG01_0001_G11.b : ccaagaaaggaatctctgggccccagtcaaaaatgtggctggaaccccgtaatccccttt
ITT01_0063_B06.b : cttnagatctcagnagacagatcactgtgctcnagtcaagatcgtgctggatccctgtac
THY01_0097_B07.b : gggctttttttaaaacccccaaaggaaaggaatccctgtgggcatcgaatcccaaaaaat
LVR01_0048_C03.b : gggttttctttaaaaatccccaaaagaaaaggaa
OVRT1_0036_B07.b : tctttaaatcctcaaaggaaggatcctggggcatcaatcaaatatctggctgggaaccct
ADR01_0059_D09.b : GCTTCTTTAgatcctcagaaggaaggatcactgtggcatcaagatcaaaatcgtggccgg
OVRT1_0070_B08.b : cttctttaaaatctccgaggaaggatcctgtggcatcnagtcaaaatcgggctgaatcca
BFLT1_0022_H11.b : GCTTCTTTAAatccttcaaggaaaggatcctgggccatcatccaaaaatgtggctggaac
ITT01_0048_B12.b : GCTTTCTTNANNATCTC*ANNNAGACAGATCACTGTGGCATCNAGTCNAAAATC*TTGGC
KDN01_0031_H05.b : tctttaaatctccaagaaaggatccctggggctcaattaaaaatcgtgcctgaatccctg
KDN01_0017_D01.b : GCTTCTTTNAGATTCTC*AAAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : ggggaaaaaatggcttttttttaaaaatacccccaaaaagaaacaagaatccccttgggg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : ctttaaatcctcaaagaaaggatcctggggcatcaagtcaaaaacgtggtggaaacccag
SKNB1_0062_C01.b : tanatctccnnnagaaggatcatgtggctccantccaaaatcgtggctggaatccagtac
KDN01_0094_G04.b : tcttaaagatctcagaggacagatcctgtggcatcgagtcgaaatcgtgctggaatccag
PCT01_0015_E10.b : ctttagatctcnaaagacagatcctgtggctccaatcaaatcgggctggaatccggactc
KDN01_0021_F06.b : tacttaatatctgcaaagacagatcactgtggcatctgatcgatatcggggctggaatcc
PCT01_0014_C05.b : GTTTCTTTAgaatctcaaaggaaggatcctggggcatcgagtcaaaatcgggctggatcc
KDN01_0099_B12.b : GCTTCTTTTAGATCCTC*AGAGGACAGGATCACTGTGCCATCGAGTCAGAGATC*GTGGC
KDN01_0040_F03.b : GCTTCTTTAGAATCC*C*AAAGGACAGGATCACTGTGGCATCCAATCAAAAATC*GTGGC
KDN01_0079_B12.b : GCTTCTTAAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGATTCAGAGATC*CTGGC
BFLT1_0103_F05.b : aggatccctgggctcaaataaaattggggcggaaccatgtcccccattttaaaagcgtat
BFLT1_0099_C05.b : ccttaaaatcctcaaggacggatcacgtggcatcaatcaaaaacgggctggaatccagga
KDN01_0046_B05.b : aaagacggaatcttgggtcttagtctaaaaccgggatggaacccatatccccatctcaaa
LVR01_0091_D10.b : aaatgaactttttttaaaattcctcaaaagaacaggaattccctgggggcaatccaaggt
KDN01_0011_B05.b : GCTcttttagatccccaaagaaaggatcactgtggntcgagtcaaagacgtggctgaatc
ADR01_0012_C07.b : ttaaatctccaaggaaggtcccggggcatcagtccaaatcgggctggaaccctgtctccc
PCT01_0007_H05.b : GCTTCTTTAgatcctcaaagacaggatcactgtgcatccagtcaaaatctggctggatcc
THY01_0064_D07.b : GCTTCTTTAAGATTCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAAAAATCCGTGCC
SPLT1_0083_B04.b : GCTTCTTTAAAATTCTC*AGAGGACAAGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
ILNT1_0064_G06.b : GCTTCTTTAgatcctcaaggacagaatcactgtgcatcgattcaaaatcttggcgggaat
KDN01_0067_B05.b : GCTTCTTTTAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
OVR01_0100_C06.b : GCTTCTTTAAGATCCTC*Acaaggaaaggatcactgtgggcatccagatcaaaaaatctg
LVR01_0099_F12.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
MLN01_0032_B07.b : CCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GGGGC
KDN01_0028_F10.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
KDN01_0054_B01.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
KDN01_0012_H06.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
DCI01_0021_C12.b : GCTTCTTTtaaatccccaaaagaacagatccctggggcatccagtcaaaaatctgggctg
KDN01_0047_E11.b : tggcttcttttaagatcttcataggacaggatcacttgtgcctcaaatctaaagattgtt
KDN01_0015_E11.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
LVRM1_0037_A08.b :
OVRM1_0179_C01.b : ttcgatag
DCI01_0118_A02.b : GCTTCTTTAAGAT*CTC*AGAAGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
KDN01_0086_F02.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
DCI01_0028_F01.b : tccttaaaatcctcaaagaaaggtatcctgggcctcaatctcaaaattcgggctggaacc
OVRM1_0110_B01.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
DCI01_0045_D03.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
UTR01_0014_D02.b : GCTTCTTTAAGATCCTC*AGAGGACAGGATCACTGTGGCATCGAGTCAGAGATC*GTGGC
20110601C-000779 : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
---------+---------+---------+---------+---------+---------+ 1184
LVR01_0036_C01.b : acctgtgaactaactcccacggtggggcccccctctcctcttccctctcttc
CBLT1_0047_H06.b : tattaccgctttcagaagaaatatatttatgtcgcgccaccggggtgatttactctacat
HTMT1_0033_E10.b : cccccttttctaaaagcttaactgtttggccgccccggggaattttccccccaatcaccc
ADR01_0019_B07.b : cctaaatctctttattgtggtgggtgggacatatatattcttttttttttataaacaaga
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : ggggggggggggaaaaaaaatattttttttttttttaaaaaaaaagtgttttttttccgc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b : cact
PTG01_0109_G09.b : gcccccggggggttttctcccaaaaaccctgaattgggggggagggggaaaaaaaaattc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : tttcaaaaggtttatttttgtggcccccggggcatttttccccaaaataccttgaattgg
OVR01_0032_E06.b : cctttgggggggacttcctaaaacctccaaaaaaaatatctggggggggggtggggaaaa
THY01_0205_F10.b : ttcaaaaaaattttggggcggggggaaacccccctt
LVR01_0063_B05.b :
OVR01_0033_C02.b : tcagagttcaaaaaaaatcttggggggctcttgggaaataccccccgggtatttttctcc
THY01_0062_H02.b :
OVRT1_0095_C10.b : attttaaaagggtgatcggttgcccccccgggcattttccccaataaccctggaatgggg
SMG01_0060_C01.b : gactccccttttaaaaagggttttgtttggccccccgggggattttttccgcataaccct
TCH01_0063_A12.b :
KDN01_0098_A08.b : catttctaagggtgattgttgccgcccggggcattttccgaaaaaaccctggaatggggg
SKNB1_0070_D05.b : cccctttcaaaatcctaatcgttttgcccccctgggcatttttcccaaaacctggattgn
OVRM1_0039_F04.b :
KDN01_0021_F12.b : actccccattctaaaatgctgattgtttgccgcccgtgggcattttttcccaataaaccc
PST01_0081_A12.b : gggaaccccgggaactccccttttctaggaatggcttatctgtttggccgcccctgtggg
PST01_0098_C02.b : ggatcccatggacccccattttctaaaaagcttgatcggttggcccccctggggcatttt
KDN01_0067_G01.b : atgtactcccaattctaaaatgctgatcgttggccgcccctggggcagttttccgncaaa
SKNB1_0089_G01.b : ttctatattactctccccgccccttcacgtccacttacaccccccccctcctccttcgca
BMWN1_0073_G08.b : gcccccggggaattccccaaaacccttggatggggtgggggggaaaaatttttttttttt
ADR01_0031_B12.b : ccccggaacccccctttttgggaaggggttatttttttgccccccccgggggaatttttc
OVRT1_0073_D02.b : cccttcttaaaggttaatggttggcccccctgggcatttttccccataaccctggaattg
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : tgtttgccccctggggctttttcccaaaaccctgaatgggggggggggagaaaaaaattt
ADR01_0020_F05.b : gtttatcgtttggcgcccctggggcattttccccaataaaccttggaatgtggggtttat
SPLT1_0014_H11.b : cggtgcccccctttttaaaaaatcaatttttttttgccccccccggggaattttttccca
LVR01_0086_H02.b : gtcccaaaaaaattgggggggcgtggggaatccccccctgggttaccctccccccccttt
ADR01_0048_D01.b : tctaaatgcgatttgttggccgccctggggcattttccccattaacccttgaatgggggg
BFLT1_0035_F07.b : ttccatgtactcccatttcaaaaatgctgattggtttggccccccctggggaatttttcc
LVRM1_0150_A10.b :
PCT01_0008_F05.b : attttcccaaaacctggatggggtgaggggaaaaaaattttttttttattaaaaaaagct
TCH01_0040_E08.b : tccaagaaactgggggctggagaacccccgtgttcttccccctttcttaaa
SPL01_0057_F08.b :
KDN01_0006_A03.b : gtactcccatttctaaaatgctgattttttgcccccctggggcattttcccgcaataacc
CLNT1_0092_D01.b : tttctaaagggaatcgttggcccccgggggaatttccccaaaacccttgaatgggtggaa
BFLT1_0030_G03.b : gtctcccacttttaaaaggctaattgttgtggcccccgggggcatttttccccattaacc
LVR01_0067_C09.b :
SKNB1_0002_H12.b : tttccttggtggagaaacacacaaaaaacccggggggggggtgtgaaacaaattggtgcg
KDN01_0026_D08.b : cacattccaaaaggctgactgtaggcccccgggccatttttcgaaaaaaccctgtgatgg
KDN01_0049_H11.b : tgggaaacccctgtactcccccattttccaaaattgctgaatttgtttggcccccccctg
KDN01_0007_G05.b : ttctaaangctgattgtttggcgccctgggcattttcgcaataacctggatggggggagg
KDN01_0071_E04.b : cccattctaaantgctaatcgttggcccccctggggaattttccccaataaccttgggat
KDN01_0099_D03.b : gtatccccattctaaagtgctgatcgttggcggccctgggcattttccccatataacctt
KDN01_0043_A07.b : catgtactcccatttcagaatgctgatctgttgccgcccctgggcagttttcccccataa
KDN01_0043_B03.b : ccatgtactcccctttctagaagtgctgatctgtttggcgccccgtgggcagtttttccg
KDN01_0062_F04.b : catgtactccaatttctagagtgctgatctgttgggcggccctgggcagttttcggcana
KDN01_0082_F01.b : ccatgtatcccccattctaaaatgcttaacttgttggcccccctggggaatttttcccga
KDN01_0096_H10.b : tccatgtactccccattctaaagtgctgatcggttgccgccccggggcatttttccgcat
KDN01_0040_E11.b : ggaaatccatggacccccaatcctaaaaatgctgatttgtttggcccccctgggcacatt
KDN01_0008_B06.b : ccagtactccccattctaaantgctgatcgttgggcgcccctggggcgttttcggcaata
KDN01_0100_G05.b : aaatccatggactccccattctaaaatgctgattgtttggcgcccctgggcagttttccg
SKNB1_0008_B08.b : TG
KDN01_0015_E02.b : TGGAATCCatgtactcccatttctaaagtgctgatctgtttgccgcccctggggagtttt
KDN01_0094_D09.b : TGGAATCC*ATGTACTCCCCATTTCAAGAAtgctgatctggtggcccgcccctggggcaa
KDN01_0086_A12.b : TGGAATCCCATGTACTCCCCATTTCTAAAA**TGCTAATTTGTTTGGCCGCCCC*TGGGG
PTG01_0074_F05.b : tttttcccccccccccgtttttttctctctacaaaaaccccggggggggggggggggggg
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : caaaaaccctggattggggtgaagggggaaaaaaattttttttttgatcaaaaaagggga
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : ttttggcccccggggcatttccccaaaaaacctgtgatggggggaaggggaaaaaaattc
UTR01_0015_G03.b :
SMG01_0062_G07.b : gtatgtttggccccccggggattttccccataaccttggaatgggggggagggggaaaaa
UTR01_0088_F03.b : gaatcccgtggcccccccatttctaaaaaggcgaatatgtttggccccccccg
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : tcaaagtgcttatctttttgcccccccggggcatttttcccgacataacccttggaatgg
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b : ctttcaaaagggttaatgtttggcgccctggggaattttcccaaataactggatgtgggn
LVR01_0098_F04.b : ggggcccttctaaagttccaaaaaaattttggtggggccgggggaaaatccccccttggt
OVRT1_0038_F03.b : aacccaagtacctcccatttcaaaaggtgtttcgtttggccgcccctggggaattttccc
ADR01_0079_C03.b : cccattcagaatgctgactgtttgccgccctgggcattttccccaaataccttgggatgg
ITT01_0076_A09.b : tcccatttcagagtgctgattgtttgccggccctgggcaatttttcccataaaacctgga
ITT01_0008_F03.b : gtatccccattctagaatgctgatctgttggccccccttgggcaattttccgcaaaaaac
ITT01_0072_F01.b : catgcactccccatttcaaaagggctgattggttggcccccctgggccattttttcccca
BFLT1_0019_G09.b : tccctggactccccatttccaaaagtcttactgtttggccccccccgggcaatttttccc
BFLT1_0036_G01.b : tgtatccccctttcaaaaatgctaatgtgtttgcccccctggggcatttttcccaattaa
LNG01_0007_A07.b : caaaaaattcggtgggcctgggaattcccccatttttatc
OVRT1_0068_C01.b : caatgtacccccttttaaaatgctgatttgttggccccccggggcatttttcccaataac
KDN01_0051_G04.b : gtatccccccattttaaaaaggtgaacattactgggcccgccccgggttatattcttccc
KDN01_0004_B01.b : tgacccccctttctaaaaggctatctttttggccccccgggggaattttccccaaatacc
KDN01_0004_E01.b : gtacccccctttcaaaaaggttaatttgtttgccccccctgggaaaattttccccaatta
KDN01_0088_A09.b : tccccctttcaaaatgctatcggttggcccccctgggcagttttccgcataaacccttga
KDN01_0009_G09.b : agtaccccaattctaaaaggcggattgtttgcccccttgggcatttttcgcatataactt
KDN01_0025_E11.b : atcccatgtactcccaattctaaagtgctgaactgtttggcgccccggggcagtttttcc
KDN01_0039_G05.b : ccccatttcaaaaggcgatctgttgggcgccctgggcaattttcccgaaaaacccttgga
KDN01_0025_D08.b : ccattcagaatgtgatcgttggcgccctgggcattttccccntaaaccttggatgggttg
SPL01_0081_F04.b : aa
SPLT1_0074_G11.b : cccagaccccccttttcaaaaggtgtaattgtttgcgccccctggggaattttcccccaa
OVR01_0096_F07.b : tcccccagagagcaagacgagttacccctgtgctgtttcc
SPLT1_0011_A04.b : cccagtatccccattttcaaaaagggtaatcttttgcccccctggggcattttttcccaa
OVRT1_0005_A04.b : ctccccttccaaagtgcgaatcgtttggcgccccggggagatttcccgccaaaaccttgg
SPLT1_0092_C01.b : tcccctttcaaaatgtaattttttggccccccgggaatttttccccataaaccctgaatt
CBLT1_0027_C11.b : cccctttcaaaaaagtttattttgttgccacccccgggaaatttttcccacaataaaccc
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b : gttccagtaccaaacaattagagtgtgggaagtccctcagatacctcct
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : tctctacataataaagctagttgggtgggagacctcacggtgattccctacctttatctt
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaactccaaaaaatccgggggttgggaaatccccatggtatcccccccccctttttttca
OVR01_0091_H12.b :
SMG01_0023_C09.b : taaaaggcgattgtttgcccccctggggaattttccccaaaaacccctggaatggggtaa
UTR01_0022_E08.b :
SMG01_0001_G11.b : ctaaaaattctattttttgccccccctggggaattttccccaatataccttgtaatttgg
ITT01_0063_B06.b : tcccattcaaagtgctgatctgttgccgccccggggcgttttccgcattaaccctggatg
THY01_0097_B07.b : cggggctggggaaatcccaatgttcctctcccatttttctaaaaaagtgggttaaatttt
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ggtatccccattcaaaaatgctaatcgttgggccccccggggcatttttcccaataaccc
ADR01_0059_D09.b : aaacccaggtactccccattctgaaaggctgatctgtttgccgccccggggggaattttc
OVRT1_0070_B08.b : tgtatccccattcaaaatgctaattgtttgcccccccggggcaattttccccaaaaccct
BFLT1_0022_H11.b : cccggactccccctttcaaaaaggtaattttttggccccccccgggggatttttccccca
ITT01_0048_B12.b : TGGAATCCCATGTACTCCCATTTNCAAAAA**TGCTGATCTGTTTGGCCGCCCCCTGGGC
KDN01_0031_H05.b : tacccccatttctagaatgctgatcgtttggccccctggggagttttccccagaaaaccc
KDN01_0017_D01.b : TGGAATCCatgtactccccattctaaagtgctgatctgtttgccgcccctggggcagttt
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : ggcattctcaagttccaaaaaaaatttggggggcttgggaaaatccccccgtgttaatcc
LVR01_0050_H12.b :
OVRT1_0034_D12.b : gtacccccatttctaaagtgcttattgttgggccccccctggggaatttttccccaaaaa
SKNB1_0062_C01.b : tcccccttcaaaatgctaatcgtttgcccccccgggcattttccgcgtacctggaggggg
KDN01_0094_G04.b : tactcccattctaaaagctgatttgttgccgccctgtggcatttttccgcatataccctt
PCT01_0015_E10.b : catttcaaaagctaatcgtttgccccctgggacttttccccaaaaccctggatgggtgta
KDN01_0021_F06.b : atgtactcccattcaaaantctgatctgttggcgcccatgagcattttcccgcatatgcc
PCT01_0014_C05.b : atgactcccattccaaaatgctgatctgttgccgcccttggcaatttttcccaattaacc
KDN01_0099_B12.b : TGGAATCCatgtactcccaatttcaaaagtgctgatctgtttgccgcccctggggcattt
KDN01_0040_F03.b : TGGAACCC*AGGTACTCCCCATTTCTAaaaggctgatttgtttggcggcccctgggcatt
KDN01_0079_B12.b : TGGGAATCCATTGACTCCCC*TTTCTAGAA*TTGCTGATCTGTTTGGCCGCCCtggggca
BFLT1_0103_F05.b : tttttgccccccgggcaattttcccaataacccgtgattgggggttagggggaaaaaaat
BFLT1_0099_C05.b : actcccctttcaaaaagctgaatcgtttgccccccctgggaaatttcccccaaaaaccct
KDN01_0046_B05.b : agggtattgcttggccctcccgggaattattcccgacaaacccttgcatgggggttaggg
LVR01_0091_D10.b : caaaaaaatcctggggctgggaaatccccaagggtacccccccccttttttcttaaaaaa
KDN01_0011_B05.b : ccatgtactcccatttctaaagtgctgatcgtttggccgccctgggcatttttccccaat
ADR01_0012_C07.b : attctaaaatgcgatcggttggcgccctgggcagttttccccataaacttgggattgggg
PCT01_0007_H05.b : atgtctccccatctaaagtgctgattcgtggcgccctggggcatttccccaattaaccct
THY01_0064_D07.b : TGGAATCCCATGTACTCCCCATTTCTAGAAAGTGCTGATCTGTTTGGCCCGCCCCTGGGG
SPLT1_0083_B04.b : CTGGATCCCATGTACTCCCCATTTCCAGAA*GTGCTAATCTGTTTGccgcccctggggca
ILNT1_0064_G06.b : ccatggtatccccttttcaaaattgctaatcgttttgcccccccctgggcattttttccc
KDN01_0067_B05.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC**TGGG
OVR01_0100_C06.b : ggctggaaacccctggtactcccccattttctagaatgtgctgaatttgtttgggccccc
LVR01_0099_F12.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTNGTTGGGCGCCCC*TGGGG
MLN01_0032_B07.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCCCTGGGG
KDN01_0028_F10.b : TGGAATCCCATGTACTCCCCATT*CTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
KDN01_0054_B01.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTNGTTGGCCGCCCCCT*GGG
KDN01_0012_H06.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGGCGCCCC**TGGG
DCI01_0021_C12.b : gaaacccaaggactcccccctttttaaaaaggctgatttgtttgggccccccccggggca
KDN01_0047_E11.b : ggtggaaaccccatgtctccccttttctaaaaaagctgatctgttttgccgccccccgtg
KDN01_0015_E11.b : TGGAATCCCATGTACTCCCCATTTNCTAGA*GTGCTGATCTGTTTGGCCCGCCC*TGGGG
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : TGGAAATCCCTGTACCCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCT*TGGGG
KDN01_0086_F02.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
DCI01_0028_F01.b : caggtcctccccatttaaaaaggtcttatgtttggcccccccgggggcatttttccccca
OVRM1_0110_B01.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
DCI01_0045_D03.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
UTR01_0014_D02.b : TGGAATCCCATGTACTCCCCATTTCTAGAA*GTGCTGATCTGTTTGGCCGCCCC*TGGGG
20110601C-000779 : CAGTTTTTCCCGCAGTATAGCCCTTGGGATTGGGGGTGTGATGGGGGG**ATAGGAAATG
---------+---------+---------+---------+---------+---------+ 1242
LVR01_0036_C01.b :
CBLT1_0047_H06.b : cctaagcctccgagaatgcggaggtgagtgggagatatgacngctcctcatcacttgtct
HTMT1_0033_E10.b : ctgtgaatgtggggtggaaggggggaataaaacttttttttttgtagttatataaaaggg
ADR01_0019_B07.b : tattaattactcgacgatatgggacacttctttccaatttttctcagataatatctattg
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : gggggggggggggccccctcttcttttcttttttttaaaaaaaaatctgtttgaggggcc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : ttttttttttttaaaaaaaggggttttttaagggccagagggggggggaaccctggtgtc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : ggggttagggggagaaaaaattttttttttttagatcaaaagagaggtttttnaggcgcc
OVR01_0032_E06.b : atctcccccccttgttggttccccctccccccccccctttttttttttcttt
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b : ccccccccttttttt
THY01_0062_H02.b :
OVRT1_0095_C10.b : gtgaaggggaaaaaaaatcttttttttgattaaaaaacgggtttttaaaagcctggaggg
SMG01_0060_C01.b : tggatgggggggggagggggaaaaaaatcttttctttttgttcaaaaaggggattttaag
TCH01_0063_A12.b :
KDN01_0098_A08.b : ttatggggaaaaaaatcttttttcttgattaaaaaggcggattttaaggccccggagggg
SKNB1_0070_D05.b : nnggggggggnngngaaaaaaatttcttttcttttttcaaaaaaanngtttttaagcccn
OVRM1_0039_F04.b :
KDN01_0021_F12.b : tggaatgggggggagggggggaaaaaaaatctttattccttagtcaaaaaaaacggagtt
PST01_0081_A12.b : acattttctcccccaaaaaaaccctttggaaatgggggttgggataggggggaatagaaa
PST01_0098_C02.b : ttccccaaatacccttgggaatggggtttaagggggaaagaaagtcttttttcttgtatt
KDN01_0067_G01.b : aaaccttgggatggggggtagnagggggaaataaaaaatttttttttctttgattcaaaa
SKNB1_0089_G01.b : cccatacaacgatgtccccctccctccactcttctacacgctcccccccctccctcccat
BMWN1_0073_G08.b : tataaaaagcgttttaaccgcgagaggggggccctttttctccatttttaaaaaaaggtg
ADR01_0031_B12.b : ccccaaaaccccttggagggg
OVRT1_0073_D02.b : ggggtgaaggggaaaaaaaagctttatctttagataaaagggggggttttaaagcccaga
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : tttttttttacaaaaaagagcgtttaaaagccccaggagggggcactctgtcctcacatt
ADR01_0020_F05.b : ggggaaagaaaattctttatttttagttcaaaaaagccgattttaaaggcctcaggaggg
SPLT1_0014_H11.b : caaaataacccctgaaaaggggggtgtaaagggcgaaaaaaaaattttttttttttttat
LVR01_0086_H02.b : tttcttcataaaaaaaaagggggcgtcttttatat
ADR01_0048_D01.b : tatgggggaaaaaaattctttttctttgnttaaaaaagagagattttaaagccctcagag
BFLT1_0035_F07.b : caaaaatcccccttgaattgggggtgaaaggggatataaaaattctttttttttaattca
LVRM1_0150_A10.b :
PCT01_0008_F05.b : tttaaagctaaaggtgggaaccgtttcatatttttagaaacatagttggaagggttttaa
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ctggaatggggtttaagggggaaaaaaaaagctttttccttgattcaaaaaagcgagaat
CLNT1_0092_D01.b : gagggaaaaaaattttttatctggttaaaaaaagggggttttaaaggctagaatgggggg
BFLT1_0030_G03.b : cctggaaattggggttgaggggggaaaaaaattccttttttttgatccaaaaaacggggg
LVR01_0067_C09.b :
SKNB1_0002_H12.b : ccttc
KDN01_0026_D08.b : gcgggatggggatagaatccttttatcttattcaaaatcagatttttgagacctgggggg
KDN01_0049_H11.b : tgggcaattttttcccccataataacccttgtgaattgggggggtgatagggggaaatga
KDN01_0007_G05.b : gggggaaaaaaaagttttttcttgatttaaaaagggggttttaaggcttgaatggtgggg
KDN01_0071_E04.b : ggggtggatggggaaaagaaatgtttttatcttgattcaaaaaagcggattttaaaggcc
KDN01_0099_D03.b : gggatggggggtgatgggggaaaggaaatccttattcttaattcaaaaaatgggggattt
KDN01_0043_A07.b : accttgggatggggtggatgggggaataaaatgtctttttcttgagttcaaaaaagccga
KDN01_0043_B03.b : caaaaaacccttgggatgggggtggatgggggggataagaagtgcctttatctttgattc
KDN01_0062_F04.b : taccntgggatgggatggaaggggggggaaaaaaatttctttattttttagtgaaaagaa
KDN01_0082_F01.b : attaaccctgtgaattgggggtggaaggggggaaaaaaatgtccttattccttgaattca
KDN01_0096_H10.b : ataacccttggaatggggtgggatgggggaaagaaatgcttttaatcttgattcaaaaaa
KDN01_0040_E11.b : ttttccgccatataacccttggaaatgggggtggatggggggaaaaaaatagtcttttat
KDN01_0008_B06.b : acccttggatggtggtggggggggaaaaaaaagttttttttttttgtttaaaaaaaagga
KDN01_0100_G05.b : cataaacccttggaatgggggttgatgggggaaagaaagcctttatctttaattcaaaaa
SKNB1_0008_B08.b :
KDN01_0015_E02.b : ttcccagataaccctggaatgggtggaanggggaaaaaaaaaaaaatttttttctttggt
KDN01_0094_D09.b : tttttccgcataatacccttgggatggggggggtgatggggaaagaaaagtctttattct
KDN01_0086_A12.b : GAATTTTCCCCCCA*TAAACCCCTGGGGATTGGGGGTGGAAAGGGGGGAAATA**AAATG
PTG01_0074_F05.b : agagagaagaataatatttttttttttctttataaaaaaaaaaaaatttgttttttngnc
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : tttaaaggcccagaggggggcaccctgtgttcctaatttttttgaaaacatagggttgga
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : tttttctttattcaaagaagagattttatacgcccaggaggggggcaaaactgttcccca
UTR01_0015_G03.b :
SMG01_0062_G07.b : aattttttttttgtttcaaaaaagaggtttttaaaccccagaggggggcaatcccgtcca
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : gggggaatgggggaaaaaaaatcttttttccttgattccaaaaaagcgagatttttcagg
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b : nnnnnnnnaggaggagaaaaa
LVR01_0098_F04.b : tttccctccccccccctttttttcttttaaaaaaaaagggtgggccttgtgaaatatttc
OVRT1_0038_F03.b : ccaaaaacccttgggatagggggttagagaggggaaaaaaaattttttttctttgattaa
ADR01_0079_C03.b : ggggaagggggaagaaatctttttctttaatcaaaaaaaaggctttttaagcccaggatg
ITT01_0076_A09.b : atggggggtgatgggggaaagaaatgcttttttcttggttcaaaaaaacaggatttttaa
ITT01_0008_F03.b : cttgggattggggtggaaggggggaaagaattgtctttatccttagatcaaaaaagccgg
ITT01_0072_F01.b : aaaaaccctgggtatggggggtatagggggaaaaaaatgtctttattctttgttcaaaaa
BFLT1_0019_G09.b : caatataacctgggaattgggggggtaaggggggaataaaaatctttttttttgagtcca
BFLT1_0036_G01.b : cccttggaattggggttaagggggaaaaaaaatcccttttctttgattaaaaaaaaaggg
LNG01_0007_A07.b :
OVRT1_0068_C01.b : ccttggaatggggggggatagggggaaaaaaaattcttttttttaatccaaaaaaggcgg
KDN01_0051_G04.b : gcgactaaccctcttaaacagagggtgttgagaggcgaaataaaaactccttatattttt
KDN01_0004_B01.b : cttggaattggggtaaagggggaaaaaaaaaatcttttttctttggttcaaaaaaaccgg
KDN01_0004_E01.b : aacccttggaatggggtgttaaggggggaaaaaaaaattttttttttcttgtattcaaaa
KDN01_0088_A09.b : atgggggggatggggaaaaaaagtttttatctgattcaaaaaaaccggattttaacggcc
KDN01_0009_G09.b : ggatggggtggaggggggaaaaaaaaatctttttctttgttttaaaaaaacgaggtttta
KDN01_0025_E11.b : caatataccttggaatgtggggtgaaggggggaatagaaatgcttttttcttggatttaa
KDN01_0039_G05.b : tggggtggaagggggatagaaatgttttttctttaattaaaaaagccgaatttaaacggc
KDN01_0025_D08.b : aaggggggaagaattgctttatcttagtcaaaaaagccgagtttaaagcctcagaagggt
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aaaccctggaatgggggttaaggggggaaaaaaatttctttttcttttattcaaaaaagg
OVR01_0096_F07.b :
SPLT1_0011_A04.b : taaccccttgaatgggggtttaaaggggaaaaaaaattctttttcttttatttaaaaaaa
OVRT1_0005_A04.b : gatggggggggggggggaaggaaaaattttttttttgtttcaaaaaaaaggcgtttttaa
SPLT1_0092_C01.b : gggggtagagggggaaaaaaattttttttctaaattaaaaaaaacgcttgtttaagcccc
CBLT1_0027_C11.b : cttaaattgggtgttaagggggaaaaaaaactcttttcttctgtaattcaaagaagacga
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b : aacataacctttaattctgacttactccccg
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaaaaagtggcttttgaattttgtgttttgtgggccccgccccccctcggggggggagga
OVR01_0091_H12.b :
SMG01_0023_C09.b : gggggaaaaaaaaatttttttttttatttcaaaaaaaccgattttaaagcgctaaagtgg
UTR01_0022_E08.b :
SMG01_0001_G11.b : gttttaaggggaaaaaaaattttttttcttttgtttaaaaaaagggagattttaaagccc
ITT01_0063_B06.b : gggnttaaaggggggaaggaatttctttttctttgattcaaaaaggcggatttaaaagcc
THY01_0097_B07.b : gtttttggccccccccccccgggggggcc
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ctggaattggggtggaagggggaaaaaaaattttttttcttaactaaaaaagagagggtt
ADR01_0059_D09.b : ccgcatataaccctgggaattggggggttaatgggggaataaaaattcttttattcttga
OVRT1_0070_B08.b : tgaattggggttaagggggaaaaaaagcttttttcttaattaaaaaaaacggcttttaaa
BFLT1_0022_H11.b : aaaacccttttgaatgggggggaaagggggataaaaaaattctttttttttgtattcaaa
ITT01_0048_B12.b : ATTTTTcccgccaaaaaacccctgggaattgggggttgatagggggaaaaaaaaagcttt
KDN01_0031_H05.b : ttggattgggtggaggggggaataaaaagtctttttctttattccaaaaaaggagaattt
KDN01_0017_D01.b : tcccgacatataccctttggattgggggtggatgggggaaaggaatgtcttttatctttg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : cccccccccttttttttctaaaaaaaaagggggcttgaaaaattttgtgtttttttttgg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : accccttgatatggggggtgaaggggggaaaaaaaaaatcttttttcttttgattccaaa
SKNB1_0062_C01.b : ggggnnnnnnnnaaaaaaaaaaaaatttttttttttttttaaaaaaaaagggttttttta
KDN01_0094_G04.b : ggaatgggggttgaggggggaggaatgtctttattttgagttcaaaaaagcaggatttta
PCT01_0015_E10.b : ggggggaaaaaaatctttttctttattaaaaaaagcggttttaaagcctaagaatggtgg
KDN01_0021_F06.b : ctagaatggagcgtaggggggaattgaatgtctttctccttagtcttaagaatcagaatt
PCT01_0014_C05.b : ttggatggggggatgnnggggaaaaaaaatttttttttctttatttcaaaaaacggggtt
KDN01_0099_B12.b : ttcccgcatttaacccttgggaattggggtgggaatgggggaaaagaaaagtcttttatt
KDN01_0040_F03.b : tttcccccatataacccttggaattggggtgaagggggggatggaaatttcttttttctt
KDN01_0079_B12.b : atttttccgcatataacccttgggatgggggtgttaagggggaaaaggaaatgcttttaa
BFLT1_0103_F05.b : ttttttttatttaaaaaaagggtttttaaagcaaaggaggggggcacctttttgccctct
BFLT1_0099_C05.b : tggattggggtggaagggggaaaaaaatgcttttttcttaaatcaaaaaaaaagggtttt
KDN01_0046_B05.b : gataagaaagatcttttttgtagtctaaaaatacgaatttgtacgcctatggaggtgtgt
LVR01_0091_D10.b : aggggttgaattctctgttttttggggccccccccccccggggggggggggaaaattttt
KDN01_0011_B05.b : taaccttggaatggggtggagggggggaataaaaattttttttttttgattcaaaaaagc
ADR01_0012_C07.b : ttgatggggaaagaaatgctttattcttattcaaaaaagcagcgttttaaaagcccagaa
PCT01_0007_H05.b : ggattggggttgatgggggaaagaaatggctttatctttattcaaaaaagcagggtttaa
THY01_0064_D07.b : CAGTTTTTCCCc
SPLT1_0083_B04.b : ttttttccccaatataaccttgggattggggtgtgatggggggaaaagaaattcttttat
ILNT1_0064_G06.b : caaaaaaccccttgaattgggggtgtaggggggaaagaaaattctttatccttaattaaa
KDN01_0067_B05.b : GCAGTTTTCCCGCAGTATAGCCCTTGGGATGGGGtgtgatggggggataagaatgtcttt
OVR01_0100_C06.b : ccctgggggcagttttttccccgccacatataacccctttggaatttgggggttctgaat
LVR01_0099_F12.b : CAGTTTTTCCCGCAGTATACCCCTTGGGATTGGGGGGTGTGATGGGGGGGATAGGAAATG
MLN01_0032_B07.b : CATTTTTTCCCGCATTATACCCTTGGGGAATGGGGGTGTAATGGGGGGATAGAAAATGct
KDN01_0028_F10.b : CAGTTTTTCCCGCAGTATAGCCTTTGGGAATGGGG*GTGTGATGGGGGGGAATAGAAATG
KDN01_0054_B01.b : CAGTTTTTCCCGCAGTATAGCCCTTGGGGATGGGGGTGTGATGGGGGG**ATAGGAAATG
KDN01_0012_H06.b : GCAGTTTTTCCGCAGTATAGCCCTTGGGATTGGGGTGTGAT***GGGGGGATAAGAAATG
DCI01_0021_C12.b : aattttccccccataaaaccctttggattgggggggtgatgggggggaaaaaaaaatttt
KDN01_0047_E11.b : cattattttccctcatataacccttggtatttggggctttatggggggaaaggaaattgt
KDN01_0015_E11.b : CAGTTTTTCCCGCAGTATAGCCCTTGGGATGGGGGTGTGAT***GGGGGGATAGGAAATG
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : CATTTTTTCCCGCAGAAAGCCCTTGGGAATGGGGGTGTGATGGGGGGATAGGAAtgtctt
KDN01_0086_F02.b : CAGTTTTTCCCGCAGTATAGCCCTTGGGATTGGGGGTGTGATGGGGGG**ATAGGAAATG
DCI01_0028_F01.b : ataaacccttggatttgggtttgaaagggggaaaaaaatcctttttttcttagtttaaaa
OVRM1_0110_B01.b : CAGTTTTTCC*GCAGTATAGCCCTTGGGATTGGGGGTGTGATGGG
DCI01_0045_D03.b : CAGTTTTTCCCGCAGTATAGCCCTTGGGATTGGGGGTGTGATGGGGGG**ATAGGAAATG
UTR01_0014_D02.b : CAGTTTTTCCCGCAGTATAGCCCTTGGGATTGGGGGTGTGATGGGGGG**ATAGGAAATG
20110601C-000779 : TCTTTTATTCTTTGAGTTCAGATAAGATGCAGGCGTTTTTAGACAGGCCTCAAGGACTGG
---------+---------+---------+---------+---------+---------+ 1302
LVR01_0036_C01.b :
CBLT1_0047_H06.b : gtcagctgatgtactgacatttatcctatctcgtgttcgcggagtcttatcatgttccca
HTMT1_0033_E10.b : gggttttaaacgcgcccggg
ADR01_0019_B07.b : ggtgctctttatcacaaaaattctttctactaaatcctcttatttttcattctcttttc
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b : cc
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : tcaaaggtttctcggaaaacatagcgtctgggggggggttttactaaacacgaaaacctt
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : agagtggggggaccccttgtgtctacctgtttttaagaaacaaaggggttggggagggtt
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b : gggggcacttcgttgtctcctttttttgggaaacaaggggttgggggggggttaaaaacc
SMG01_0060_C01.b : gggccagggggtgggcacccttggtgctctatttttctaagacacttgggttgaggaagg
TCH01_0063_A12.b :
KDN01_0098_A08.b : ggcaacccggtccctacatgttctagaaactaaggcgagggaggaggttaaaaaaccaaa
SKNB1_0070_D05.b : naanngnncnccccccctctcc
OVRM1_0039_F04.b :
KDN01_0021_F12.b : ttaaaggccccagaatggggggcaaacctgtttgcaacaaatcttcaaaaaa
PST01_0081_A12.b : aagtctctttttttcttttgagttccaaaaaaaggcggggaatttt
PST01_0098_C02.b : caaaaaaagcgagatttataaaggctcaggagggttgggccaaccctgttgcctatacat
KDN01_0067_G01.b : aaagcaagatttttaagggctttagaaggggggggacaaccccgtgttgccataattgtt
SKNB1_0089_G01.b : ccca
BMWN1_0073_G08.b : tgtggaaggtgttataaaaacccttcccaaaaacctctatttgggcccttcccccccccc
ADR01_0031_B12.b :
OVRT1_0073_D02.b : aggggtgggaaccttgttccataattgttttagaaaaaaaggcttggggaggaggttttc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : ttctaaaaacaggggtgaagggaggcgttataaaaaaaaaccctcccccccgaaaccccc
ADR01_0020_F05.b : gtggccacccttgttgttcatacgtttttctggaaaattatgctgttttgaagtgtcttt
SPLT1_0014_H11.b : gtcgagaaaagggcggttatttataggcggccgagagagggg
LVR01_0086_H02.b :
ADR01_0048_D01.b : ggggggaaccccggtgtcctccctttttttggaaaaaatagggtttggaggggctt
BFLT1_0035_F07.b : aaaaaaacaggggtttaaaaagccccagagaggggtgggcaaccttgttttccacacatg
LVRM1_0150_A10.b :
PCT01_0008_F05.b : aaaaaaaccttcccgaaaacctcaaagtggcgccttccccccccccccaaaaaaacttct
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ttaaaaggcctagagagggtgggcaaccttgttgtgcttacctttttcgggaaaacttag
CLNT1_0092_D01.b : aaccctgtgccatacgtttctcggaacttgagggtagg
BFLT1_0030_G03.b : tttttaaggcccagagaggggggggaaaccctgttctctcaaattttcttagagaaacct
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : ccgtttcccgggtgcctgccctttaatgaaacctcccataaggagactctcctaacagaa
KDN01_0049_H11.b : aaaagtttctttattctttaggtctcaaataaaagcgggagttttttagaaagccctaag
KDN01_0007_G05.b : aaccctttgccacccggtccagaaaatagggttggaagaagttattaaacaaaaccttcc
KDN01_0071_E04.b : tagaaggtgcgccaacctgtttcctaaatgttttaggaacacttaggcgaaggaggaccg
KDN01_0099_D03.b : taaaggcccagaatgggggggcaaccctggttgcttacactgtttcagagacactaagct
KDN01_0043_A07.b : gtttcgaaggcctaaggacgggtgggcaacccttgtttgcaataaatgtttccaagaaca
KDN01_0043_B03.b : caaaaaaggcgggaatttaaaanggctcagaatgggtggggcacccctgggtcactaaca
KDN01_0062_F04.b : gnggaatttatagggcctaagatggttgaggaaatctgtgtgtttaaaatgttttgtgga
KDN01_0082_F01.b : aaaaaatcagaattttttaacaggcctcaggatggtttggggcaacccctgggttgcact
KDN01_0096_H10.b : agcggaattttaaaagcctcaggaagggtcgggcaaacctggttgcctaaactttttcca
KDN01_0040_E11.b : tcttggattccaaaagatgccggattttttaaagagccctcagagtgtggggggccaaac
KDN01_0008_B06.b : gtttaaaggcctgggatggggggggaaccttgttgcccaattggtttcggagaaatagcg
KDN01_0100_G05.b : agcagaattttaaaaggctcaagaatggtgggccacctgggttgcccaacttgtttccag
SKNB1_0008_B08.b :
KDN01_0015_E02.b : tcaaaaaaaagaggagttttaaaaagcctcgggatgggtggggaaacccttgttggccta
KDN01_0094_D09.b : ttgagtcaaaaaaagccggaatttaaacaggcctaagatgggttgggcaaacccggtttg
KDN01_0086_A12.b : TCTTTTATTCTTTTGGTTCAaaaaaaagccggagtttttaa
PTG01_0074_F05.b : gggacgggggggggggggcggcgnnncccctccctcactcaactaaaaat
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b : gagagggattaaaacaaaaacctctcccccaaacacctaaattttggtcc
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : acattttcgagaaaaaaaagctaaggaggggaggtttaaaaaaaaacccttctgccccga
UTR01_0015_G03.b :
SMG01_0062_G07.b : taagtgtttaagaaacagggtttagggagtggtgtttaaaaaaaacccttcccccgaaaa
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b : c
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b : ttgtgggg
OVRT1_0038_F03.b : aaaaaggcgggtttttacaggcccacggaggggtggggcaactcgttgtccactacgttt
ADR01_0079_C03.b : gtgggccacccgtttccctaatgtttcggaaaaaaagggataggaagccgtaaccaaaca
ITT01_0076_A09.b : ggcctagatggttggggcaaccttgtgtctctacatttttaggaaacacaagggcgtttg
ITT01_0008_F03.b : aattttaaagggcccagagagggtgggccaaaccctgttgccccacattttttcgggaac
ITT01_0072_F01.b : aagcagatttttaaaggccccagggatgggttgggcagaccctgttggccctaaaattct
BFLT1_0019_G09.b : aaaaaagcggcggtttttaaagccctcaggatgggtggggcaacctctgttgcttaaact
BFLT1_0036_G01.b : gctttttaaaggccaaggatggtggggaaacctttgttccataaca
LNG01_0007_A07.b :
OVRT1_0068_C01.b : tttttaaaggcccagagggtggggcaaccttgtgtcctaaattgtttcaggaaccaaaag
KDN01_0051_G04.b : attagtatgaacacattatagcagtctttngaaatagacctagtacgagtatgggtcact
KDN01_0004_B01.b : ggttttttaaagggccaggagggggggggccaacctggggttcacaaacgtttttccaga
KDN01_0004_E01.b : aaaggccagttttttaagggccccaagaatgggggggggaaacctctggttgcccaaaaa
KDN01_0088_A09.b : taagatgggtgggcaaccctgtccccataatttttttagaaacacatagggtaaggaaga
KDN01_0009_G09.b : aagctcaggagggtggggagacctttggctaccttttttgggaaacaaaggggttggaga
KDN01_0025_E11.b : aaaagcccggaattttaaaggcctcaggaagggtcgggccaaccgtggttgcttaaactg
KDN01_0039_G05.b : ccaggaagggtggccaccccgtttgcttacttttctcggaaaactaaggcgtagggaagg
KDN01_0025_D08.b : cgcaacccggttgccacaatgctcaaggaacctaagcgatagaagggctttcataaacac
SPL01_0081_F04.b :
SPLT1_0074_G11.b : gcgttttataaggcccagaaggggggggaactctgtttctctccatttttccgagaacaa
OVR01_0096_F07.b :
SPLT1_0011_A04.b : ggcgcgttttttaacaccctaaaaatgtggtgcaaacccttttgtccaaccagttttctg
OVRT1_0005_A04.b : gcccaggagggtggggaacccggttgcttcaaatttttaagaaaaaaaagcgttggggag
SPLT1_0092_C01.b : gagaaggggtggcacctctgtgacacagcgcttctagaaaacgnnngcgggngaaggcgc
CBLT1_0027_C11.b : gcgtttttttagtcactatgtaatgttgtaggagcactatttatgacactgaataagctt
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b : aaattattttttttcttccccccccgccacaataaataaaaataaac
OVR01_0091_H12.b :
SMG01_0023_C09.b : tggggacaccctgttccctaaaatttcttggaaaaccttgggttgtgggaaggcgttcct
UTR01_0022_E08.b :
SMG01_0001_G11.b : ctaaggattgtggggcaaactttttgtgcccacaatatttggagaaaacccttagggtgt
ITT01_0063_B06.b : aaggagggtgggcaacctgtgtgctaaacgttttcggaacacaaagcggttggaagacgt
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ttaaagcccaaggagggggggcaccttttgtccttacagtttcggaaaaacaagcggagg
ADR01_0059_D09.b : ttcaaaaaaagcggcttttttaaggcctcaagaaggggggggcaacctttgtgtctttac
OVRT1_0070_B08.b : gcccaggaaggttgggaaccctggttctaaatttttagggaaacaaaggggtaggaaggg
BFLT1_0022_H11.b : aaaagaggggtttttcaacgcctcaagacg
ITT01_0048_B12.b : tattctttggttcaaaaaaaggcggagttttataaaggcctaaagaggtggtgggcaaac
KDN01_0031_H05.b : ttaagggccaagaagggtggggcaacccgggtctcactaatgtttccagaaacactaagg
KDN01_0017_D01.b : agtcaaaaagagcnggattttaaacggcctcggaatggtcggcccaactctgttgcctta
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b : gggccccccccccccccccccccggcggggggg
LVR01_0050_H12.b :
OVRT1_0034_D12.b : aaaagacgggttttttttaaagccccaagagggggtgggcccaacctggggttgcctaca
SKNB1_0062_C01.b : aaanacaaaagagtggggggcc
KDN01_0094_G04.b : aaggctctagactggtcgggcaaccctgtttgcataacttttttcaggaaaaactaggct
PCT01_0015_E10.b : caacctgtttcccaacttttttggaaaaataggggtggggaggggtttttcaaaaaaaaa
KDN01_0021_F06.b : ttaacagcccaggatggatgggcaagaccggttcctaaaatgtttatttgcaacctaggc
PCT01_0014_C05.b : ttaaaagctctaggaggggtgggaaccttggttcctaactttttttggaaaaaaaaaggg
KDN01_0099_B12.b : ctttgagttcaaaaaaaggcgggaatttttaaaaggccctaggaatggggtgggccaacc
KDN01_0040_F03.b : tggattccaaaagagcggaatttttaaaaggctctaagaggggtcggccaacctcggttg
KDN01_0079_B12.b : tccttgattccaaaaaaagtgcgaatttttaaacggccctcagaatggtgtggggcaaac
BFLT1_0103_F05.b : ttttgagaaaactggcttagaggattttttaaaaaaaaaaccctcctcccagaaccctca
BFLT1_0099_C05.b : taaagcctcaggagggttgggcaaaccggttgtcatacaggttttctagaaaacataagc
KDN01_0046_B05.b : cagaactgtcctgatacattgatacaagaagaatattgccgattggagtagctttaacaa
LVR01_0091_D10.b : ttttttttctccccgccccccaaattatattaaaaaac
KDN01_0011_B05.b : agaattttaaaaccttagagatgggtggccaaccctgtctccccaacttgtctcgggaaa
ADR01_0012_C07.b : tggtcgggcaactctgttgcatacctgttttcagaaaaataggcggtggaaggggcttta
PCT01_0007_H05.b : aagccctaagatggttgggcaaccctgtttcctaactttttcaggaaaactaggcgtagg
THY01_0064_D07.b :
SPLT1_0083_B04.b : cttttgatttaaaaaaatacgggtttttaaacggcctaaggaaggggtgggccaaccctt
ILNT1_0064_G06.b : aaaaatcaggttttgtaaagggccagggaaggttgggcgagcctcgttttgcaaagactt
KDN01_0067_B05.b : tatctttgagtcagataaaatgcagagtttttaacgggctcaggactgggtcggccaagc
OVR01_0100_C06.b : tgcgcgggaatagaaaacggtccctttattatcctctagattcccaaataaaatagccgg
LVR01_0099_F12.b : TCTTTTtattcttttgagttcagaaaaaaatgccaggccgttttttagacaggccctcaa
MLN01_0032_B07.b : tttatctttgattcaaaaagaggcagagttttaacggcctcaggacggggcgggccagct
KDN01_0028_F10.b : TCTTTTATTCTTTGATTTCAAATAAAATGCAGagtttttagaccgcctcaagactgggtc
KDN01_0054_B01.b : TCNTTTTATCNTTGAGTTCAGATAAGATGCAGGAAGTTTTAGACGGGCCTCAAGactggg
KDN01_0012_H06.b : TCCTTTATctttgatttcgaaaagagcaggatttttagaggcctcaggactggtcgggca
DCI01_0021_C12.b : ttttttcttttaatttcaaaaaaaaagccggcggttttttataaggcccccaagaacgag
KDN01_0047_E11.b : ttttctccttgtagttctaattattcatgaatttttacactttcccttttgctggtcttg
KDN01_0015_E11.b : TCTTTTATTCTTTGAGTTCAGATAAGATGCANGAAGTTTTAGACAGGNNCTCAGGACTGG
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : tattccttgagttcgaaaaaaagcagccaacctcctgtctgcatcgcattgcttcaagga
KDN01_0086_F02.b : TCTTTTATTCTTTGAGTTCAGATAAGATGCAGGAGTTTTTAGACAGGCCTNCAGGACTGG
DCI01_0028_F01.b : aaaagcaggttttttaaaaggccccaaggagggggggggcaacccttgtttccccaacaa
OVRM1_0110_B01.b :
DCI01_0045_D03.b : TCTTTTATTCTTTGAGTTCAGATAAGATGCAGGCGTTTTTAGACAGGCCTCAAGGACTGG
UTR01_0014_D02.b : ccctttcatcttcaagaccctactacgtggtcaggttggaggacttgccttgaacactgg
20110601C-000779 : GTCGGGCCAAGCCTCGTGTCTGCCATCAGCACTGTCTTCCAAGGAGACACAGCTAAGGCC
---------+---------+---------+---------+---------+---------+ 1362
LVR01_0036_C01.b :
CBLT1_0047_H06.b : tggcatctcacgcatataatttactgaattgcctcacctgatgggtccca
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b : ctccccccgagaaccccccacaatagtgtgccgccccctcccccc
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b : tctataaaccaaagacctcttgccccgaggatccttcatagtgttcgcgcctctt
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b : aaaacccttcgccccaaaacccttcat
SMG01_0060_C01.b : gtttcataaaaaanaaaactctcccccagagaccccacaattgttgggccctctgtcccc
TCH01_0063_A12.b :
KDN01_0098_A08.b : accttccccccgaaacccccaaaagttccggccctttggcccctccgcggga
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b : tttccagggaaacccaagcccgtaggaaggaacggttactaaaacacaaaaccgcctttc
KDN01_0067_G01.b : tctaggaacccttaggcggtatggaaggccgtttcccca
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : ttaaaaacnntttggacaccccccccccgaggggggccgccccttgtctttaaagaaata
ADR01_0031_B12.b :
OVRT1_0073_D02.b : aaaacagaagcccttcccccagaaaaccctcaaaatgtggcgcgccttcccccccccccc
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b : aaatgtggggccttttgcccccccccccggaaaaaaaaatttttggggagctcgagtagt
ADR01_0020_F05.b : tattaatacaagaaaccctctccctcgcgaaacccctcaaatatggtggtggcctntttg
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b : tttcttggaagaacaaagagcgttaggaggagagcggtatatcaaacaaagagccgctct
LVRM1_0150_A10.b :
PCT01_0008_F05.b : ggcccccccccccaagggnnncccttaaannnnttttaagaaaaaaccttaaataaaata
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ggctttaggaggacctgtaattaaaaccaaaacccctctcccccggaaaaacctctcaaa
CLNT1_0092_D01.b :
BFLT1_0030_G03.b : aggggcttaggagagaccgcctc
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : gcccttctcccgaaacccttaaatgtgggcccctggccccctcccctcgaaaaacctttt
KDN01_0049_H11.b : gagtggtggtggcacaacacctggttcgccaacaccggttcttctcggaaaa
KDN01_0007_G05.b : ccgaaaccccaaaggtgggcccctttcccccccccccccaaacaaattcaaaaaccaccc
KDN01_0071_E04.b : gtataaaaccaaaaaccgttccgccccgaaaccctcaaaagatgtgcgggcccttttggc
KDN01_0099_D03.b : gaagggaaggagttgcataaaaacaaaaaccctctccgcccggaaaccctccaaaatgtt
KDN01_0043_A07.b : actaagcctatgggatggaccgtccctcaaaaaccaaaaccccctttccccccggaaacc
KDN01_0043_B03.b : ggttttcaggaacaattaggctattaggaggaaccgttcttcaaaacaaaaacgcccttt
KDN01_0062_F04.b : acaattaggggttggaaggaaggtttttaaaacaaaagggcgtccccaaccaaacccccc
KDN01_0082_F01.b : acactgttttccaggaaaccccttaggctttatggaaagaacactttcaataaaaac
KDN01_0096_H10.b : ggaaaaacatagctctatggaagggacggttcattaaacacaaaaaaccacttctcgccc
KDN01_0040_E11.b : ctcttttctccaccagaatgttcttcaaggaaccacnttaggtcttattgggaagggccc
KDN01_0008_B06.b : gtagggaggggtgtctttaaacaaaaacctttcccccgaaaacacccaaaagttggggct
KDN01_0100_G05.b : gaacactaggccttaagggaagacctttataaaaaacaaaaccccttcgccccgaaaacc
SKNB1_0008_B08.b :
KDN01_0015_E02.b : aaggtttctaaagaaaaaaaggcgggagggaaaggagtgtttattaaaacaaaaaacccc
KDN01_0094_D09.b : cattacacttcttcaggaaaacattaagctgttagggaaggacgtgtcataaaaccaaaa
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b : aagcccctaaatagtgtgggtatttgtgcccccccacctcaaaaaat
UTR01_0015_G03.b :
SMG01_0062_G07.b : cccccaaaaggtgcggctctttccccccccccctcaaaaaacctttttcggacctcccac
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b : ttcaggaaacaatgagggtgggggagaggggttttaaaaacacaaagagcttttcccccc
ADR01_0079_C03.b : aaaccccctctcccggaaccctctaaatgttggcccccttt
ITT01_0076_A09.b : gaggaaggtttcttaaacacaaaaaacctttc
ITT01_0008_F03.b : actaggcctataggaagggggttttatataaaacaaaaccactttcccccgggaaacccc
ITT01_0072_F01.b : ccaggaaacacctaggctgttagaaagaacggttatataaaaccaaaaacacccttcgcc
BFLT1_0019_G09.b : tgttcttgggaacacacatgggctttaaggagaggggtgttatataaaacaaagaacgct
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b : gggatggagaggcggttataaaacagaagccttctccccacaaaaccctcaaaatggtgc
KDN01_0051_G04.b : ttgtgcgtggttctattaagctttatcagagcgtatatgttccagtaatgatcatggttt
KDN01_0004_B01.b : aaaaccttaaggcctattagaggaagcttttttaaaaaaacaaaaaaaccttttcccccc
KDN01_0004_E01.b : ttttttcagaaaaaaacaaaaggggtgattggaagaacccgtgtatataaaaccaaaaaa
KDN01_0088_A09.b : ctttcaaaaaacaaaaacccctttcccccggaaacccccaaaaatgtgtccggccctttg
KDN01_0009_G09.b : acgtttataaaacaaaagccttccccccaaagaccccaaaagttcggggctctgtccccc
KDN01_0025_E11.b : tttttagaaacacctaagctgtataggaaggacctttaatcaacaacaaaaacccctttc
KDN01_0039_G05.b : cggtttctaaaaccaaaacgcttttccaccggaaaaccctccaaaaggttgggggccctt
KDN01_0025_D08.b : aaacccctccccccgaaaaccctaaaatgtgtgggccctttccccccccccgctaaaaaa
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aagggcgtaaggagaggctttttaaaaaaaaaaaactcttttccccccaaacacccccaa
OVR01_0096_F07.b :
SPLT1_0011_A04.b : gaaaaacaagagcgttgtggaaaggctgttataaaaaaacaaaacccgctcccccccagg
OVRT1_0005_A04.b : gaagggtttaataaaaaagggctgtcccccgaaaaccccaaaaggtggggcccctctccc
SPLT1_0092_C01.b : gaatagaaacaaagcgccgccccccccgaaaccccgcaaattggtggcattctntgtgcg
CBLT1_0027_C11.b : t
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b : caaaacaaaacaccctctcccccaagaaacccccaaaagtgtggcgggcttttttggccc
UTR01_0022_E08.b :
SMG01_0001_G11.b : ttgagatagcccttattcaaaacacaagaaaccttttttcccccccaaaaaaacct
ITT01_0063_B06.b : taactaaccaaaaacctttcccccgaaacccccaaaagtggcgggctttcgccccccccc
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ggaggcgtgttataaaacaaaaaccccttgcccagaaaccctcaaaaggtggggggcctt
ADR01_0059_D09.b : atttttta
OVRT1_0070_B08.b : cgtctaaaaaaaaaaacccttccccccgaaacaccccaaagggggcggcctcttcgcccc
BFLT1_0022_H11.b :
ITT01_0048_B12.b : ctttgttgccataaacttgttcccagagaaaattaag
KDN01_0031_H05.b : tttaggagggactgttattataaccaaaaacctttttccccccgaaaaaccccccaaaat
KDN01_0017_D01.b : cattctttcagagaacactaagcgttaggaaggacctgtcttcaaaacaaaacgcccttc
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b : caagtttctccgaaagaat
SKNB1_0062_C01.b :
KDN01_0094_G04.b : ataggaaggacttgtattaaaaccaaaaccccttccgccccgaaaacctcccaaagggtg
PCT01_0015_E10.b : cctctccccccgaaacccccaaaaggtgggggccttttggccccccccccccgaagaaaa
KDN01_0021_F06.b : catgggggttacattgcaaaaaatccggaccgtttctccccactaaaccctcaaaaggtg
PCT01_0014_C05.b : tttggagggggctttcttaaaacaaaaaaccctctcccccccaaaaaccccaaaaagtgt
KDN01_0099_B12.b : cctggtttccattaat
KDN01_0040_F03.b : ccaaactgtttcttcagaacaccctaggcttgttggaaggccgttttcttctaaccagga
KDN01_0079_B12.b : ctcggttggccataaacggtttttcaagaaa
BFLT1_0103_F05.b : aatgttttcgcttttcccccccccctctaagaaacatttctctgagcccccccccccccc
BFLT1_0099_C05.b : gcttaggagagagcgttttaaaaacaaaaaacccccttccccccaaaaaaccctcaa
KDN01_0046_B05.b : atcaaattacctctccacgagtaagcctctatatggtggggggctctttgaacactcctc
LVR01_0091_D10.b :
KDN01_0011_B05.b : acctagcgttttagggagaacctttcttaaaacaaaaaaccctctcccccgaaaaacctc
ADR01_0012_C07.b : ttacaaccaaaacccccttccccccgaaaacccctcaaaatgttgtcgggccctttgccc
PCT01_0007_H05.b : gaagacctttctaaaaaaccaaacccctttccccccgaaaaccctccaaaaaggtgtggg
THY01_0064_D07.b :
SPLT1_0083_B04.b : ggtctgcctcaacatgtcttcaaggaaacactaaaggcttataggggaggaccccttcca
ILNT1_0064_G06.b : ttggcaagaaagcacgtggtgttggggatggcaggttgctgttaaccaaaagcccccttc
KDN01_0067_B05.b : tcgtgtcgcatcagactgtctccaggaaaccactaagcctgatcaggatggacgtttcca
OVR01_0100_C06.b : ggcgttcttttaaaccagggcccttaagggtat
LVR01_0099_F12.b : gggactgggggtccgggcccaagccctccgggttcctgcccaatccagcccccttttcct
MLN01_0032_B07.b : cttgctgccattacatggcttcagggaaaaactaagcctgatagggaagaaccctttcat
KDN01_0028_F10.b : gggcaagcctcgtgtctgcatcagcatgtcttcaagaaaaacactaagcctgatcaggaa
KDN01_0054_B01.b : tcgggccaagctcgtgtctgcatcacaatgtcttccaagagaccaactaggcctgatcag
KDN01_0012_H06.b : acctcgtgttgccatcacatggcttccaggaaaccactaaggctgataaggaaggaccct
DCI01_0021_C12.b : ggttgggccaaaccctctgttttgccctacacacacttcttttcaaga
KDN01_0047_E11.b : tgaaacttcagtctggttctttcgtttttcttttagacttattaaatggcttacgtatga
KDN01_0015_E11.b : GTCGGGGCCAGCCTCGTGTCTGCCATCAGCACTGTCTTCCA*AGAGACACAGCTAAGGCC
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : acacnctaagcctattcggaatgaacgctttccatccaaccccacaaaacgccctttccc
KDN01_0086_F02.b : GTCGGGCCAAGCCTCGTGTCTGCCATCAGCACTGTCTTCAA*GGAGACACAGCTAAGGCC
DCI01_0028_F01.b : tttttttaaaggaaaaaattcaagcctttttggaaaagcccttttctcttaaaacaccaa
OVRM1_0110_B01.b :
DCI01_0045_D03.b : GTCGGGCCAAGCCTCGTGTCTGCCATCAGCACTGTCTTCCAAGGAGACACAGCTAAGGCC
UTR01_0014_D02.b : tgtcctgcgagaatcaagacacacctacccttagagaaaaactccccgccccgtcaggag
20110601C-000779 : TGATCAGGGAATGGACCGCTGTCACATCACAAACACCACAGAAGCCGCCGCTTCCGCCGC
---------+---------+---------+---------+---------+---------+ 1422
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b : ccccccccccagaaaaacactttttctggagactctcctcttcgtga
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b : gccccggaaagacccctcaaaaagtggtgccgc
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b : tacnnnnncgnnnngt
ADR01_0031_B12.b :
OVRT1_0073_D02.b : gcggaggaaaaacactttt
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b : gtctcctatctgctctaagaagaacccctctttcttagagactcccactcca
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b : cc
LVRM1_0150_A10.b :
PCT01_0008_F05.b : aannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : atgtgtggcggcccattcgcccccccccctcccgtcttaaaaaaaaccacttttctccga
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : tcaagagaccaaccttgnaaaaaannnnnnnaaaanncctttccaaaaataaagatttaa
KDN01_0049_H11.b :
KDN01_0007_G05.b : ncccaaaaaagggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0071_E04.b : ccctccccccctccggaaaaaccctttttcccgggaaacctctgacctttgacccacaaa
KDN01_0099_D03.b : gggggcccttttgcccccccctccgcctgaaaaaaacccttttttccgggggactcccga
KDN01_0043_A07.b : cccccaaaatgggggccgcgcccctcttcc
KDN01_0043_B03.b : ccccccgaaacaccctcaaaaaggttccggcctcttttgtcgccccttctcccctccaga
KDN01_0062_F04.b : aaaatagtgtgggggcgccttggccccccaccgctccttaaaaaaaacaatttttatagg
KDN01_0082_F01.b :
KDN01_0096_H10.b : cggaaaaccctctccaatatttt
KDN01_0040_E11.b : ttctatcctaaacaacaaaaaacccgttctccccacccgaaaaacaccccct
KDN01_0008_B06.b : ctgcgcccccccccccccnaaaaaccaattctgagaaccacctaccccaaaaaaaanaaa
KDN01_0100_G05.b : ccccccaaaagtgcgggggcctttgggcgccccctccccctcgggaaaagacacttggtt
SKNB1_0008_B08.b :
KDN01_0015_E02.b : tttccgccccggaaa
KDN01_0094_D09.b : cccgtttccccccccgaaaacacctccaaaagtgttgtcggcgccttttccgaacccacc
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b : tccccaaaaggggggnnnncctccnnggccgtgtttatgtttttttatatttt
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b : cagaaacccctaaaatgtggggggctttttttgcccccccccccgcccaagaaaac
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b : tcaaaatggttccggcgccctttgccccccccacccgcctcaa
ITT01_0072_F01.b : cccgaaa
BFLT1_0019_G09.b : c
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b : ggccctcttgcccccccccccccagaaaaaaac
KDN01_0051_G04.b : gactttgttgatttacgtattgctacacatcatactctgcgcatactgattaagtactcg
KDN01_0004_B01.b : cagaaaaacctcccaaaaagtgggggccccc
KDN01_0004_E01.b : acccttttccccccccgaaaaaccccccccaaaaagttttgccggccccccctct
KDN01_0088_A09.b : gcccccccccccctcaaaaaaaacccttgtttttgggt
KDN01_0009_G09.b : cccctcttaaaaaacattttagggccctactccccctaaaagagggggaaacccnggaac
KDN01_0025_E11.b : tccccaccaaaaca
KDN01_0039_G05.b : ttggcgccccctccccttttagaaaaaacccttgttctcgggggacccgaagatcttggt
KDN01_0025_D08.b : caccttttccagggctcccaacttaaccacaaagaggggggaaatcccgggtgctttgtt
SPL01_0081_F04.b :
SPLT1_0074_G11.b : aaagtggttggggccttttttgcccccccctccccccccaaaaaaaccccccttttttct
OVR01_0096_F07.b :
SPLT1_0011_A04.b : agaaccctcctataaagttttgccg
OVRT1_0005_A04.b : cccccccccaaaaaatttttcgggctccgactcccccctggaggggggggaaccgact
SPLT1_0092_C01.b : ncgcttnatncgnagaaaaacnntatctnggnggaccgacgcccagnccaggaaagggga
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b : tcctccccgtccgaagaaaacacctttttctcggagaa
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : gcccgaaaaacctctttcagagaccccaccccccccccaaatagtggggaaancgcccgg
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b : ttgcccccccccggctgagaaaacctctt
ADR01_0059_D09.b :
OVRT1_0070_B08.b : cccccccccgaaaaaaccttttttcggagacctaaccttcggccccagg
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b : ggtgggcgccctctttggcgccccacctcccgctcggagaaaa
KDN01_0017_D01.b : gcccccgaacaccccccaaatgtgttgggggctctttggccccctccccccgccaggaaa
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b : cgggccccctttccgcccccacccgctctagaaaaacaccctttttcagggaaactctga
PCT01_0015_E10.b : ccctttttcggaggcccccacccccccccaaaaaaggcgggaacccccctctcctttttc
KDN01_0021_F06.b : tgaggccacttttctccctattctcggaggaaaacctctttgtttagggatctctaatct
PCT01_0014_C05.b : gggggccttttttcccccccccccccccccggaaaaaaccctttttttcggggcacctcc
KDN01_0099_B12.b :
KDN01_0040_F03.b : aacccgttcccccccgaaaaaccctctcaaaagtgttgcgggcccttttgccccccctca
KDN01_0079_B12.b :
BFLT1_0103_F05.b : caaaggcgcccccccngnactcggaacgaggcgggngnnntngagccaggnggctagagt
BFLT1_0099_C05.b :
KDN01_0046_B05.b : gtaccagataaaaaacattgttaagagaatcaccgaactatactataatagggctgctaa
LVR01_0091_D10.b :
KDN01_0011_B05.b : taaatgtttccggccctcttttcccctcctcccccgcaaaaaaaaacccttttctcggag
ADR01_0012_C07.b : ccccctccgcctccgaaaaaacacccttgtttctggggactctctaagctcttaacttct
PCT01_0007_H05.b : gccctttggccccccactcccccttaaaaaaaaaccttttttccaggggccctccacccc
THY01_0064_D07.b :
SPLT1_0083_B04.b : ataaaaaccaaaaaaccccctttcccccccgcggaaaccccctctcaaaaaaatgttcgc
ILNT1_0064_G06.b : ccgcccaggaaagagccctccaaaagtttttgggggggcgcgtttggacggacctcagct
KDN01_0067_B05.b : tcaaaacacaagagccgccctccgcgccaccgaaaccaccctccgaatattgggtgggcc
OVR01_0100_C06.b :
LVR01_0099_F12.b : tcccaaagggaaaaaaacccaaaaccttaaaggggcccctgggaattttcagggggaaaa
MLN01_0032_B07.b : tcaaaattcaaaaaccacgtttccccccccgggaaagaccccttccaaaaattgtgtgcc
KDN01_0028_F10.b : tggaacctgtcattccaaacccaaaaaccgccgtttcgcccaccggaaaagaaccctcta
KDN01_0054_B01.b : ggatggacgctgtcaatcccaacccccggaaacgccgtttcgcgccacggaagacgcccc
KDN01_0012_H06.b : ttcaatcaaaacccaaaaaccgcccttccccgcacggaaaaccacccctctaaataagtg
DCI01_0021_C12.b :
KDN01_0047_E11.b : atcctttcttttgtattcttgattacccctttgttgcttatcttgaaagggcctcttctt
KDN01_0015_E11.b : TGATCAAGGAATGGACgctgtcacatcccaacaccacggagccgccgctttcgcgccacc
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : gccacggaaaaccaccttctcaaatattggtccgccggtccataattttggaaaacctcc
KDN01_0086_F02.b : TGATCAGGGAATGGACCGCTGTCCCATCACAAACACCACAGAAGCCACCGCTTCCGCCGC
DCI01_0028_F01.b : aaaacccccttccccccccccaaaaaacccccccccaaaaaaatttgtttgcgggccccc
OVRM1_0110_B01.b :
DCI01_0045_D03.b : TGATCAGGGAATGGACCGCTGTCACATCACAAACACCACAGAAGCCGCCGCTTCCGCCGC
UTR01_0014_D02.b : ccttcactgacagatgcgcctcgtcagccggcctcctacataacagagatcccatcatct
20110601C-000779 : CACCCGGAGAACGCACCCCTCCTCAGACTAGCTGTGTCCTGGCCGGTCCCACTCACTTCT
---------+---------+---------+---------+---------+---------+ 1482
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : gaaacctccgagccttacccccccaagaaaaggggggaaaactgccccttgtgacctgtg
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b : gnnnntngggcggaannnnn
KDN01_0049_H11.b :
KDN01_0007_G05.b : nnnnnnnnnnn
KDN01_0071_E04.b : gg
KDN01_0099_D03.b : gct
KDN01_0043_A07.b :
KDN01_0043_B03.b : aaaaaccccttgttctcggggatcctccacc
KDN01_0062_F04.b : aaacacaagctttnccccccaaaaaangggaaaaaatctcacttctcttttta
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b : annnnnaagtganntnnngagaggagactattataataataataannnnnnnnnnnnnng
KDN01_0100_G05.b : tcgggga
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b : cc
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b : tagatacacctccgaatatt
KDN01_0025_E11.b :
KDN01_0039_G05.b : tataggg
KDN01_0025_D08.b : ttacnggaatattaattatatttcacctaacttnnnnnnnnnnnnnnngaaatat
SPL01_0081_F04.b :
SPLT1_0074_G11.b : gaggaaactccagaacttttagggt
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b : agaacccgcctgagttagtttgatctat
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : ggccnntgttctccgggggtttatattgcgatgtacaannnnnnnnnnnnnnnnnnnnnn
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b : aaacctttgtttcagagggactctaaaccttaaggtgtgggg
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b : acctttagtttcaggaagaggggcgaaacctcccttttttct
PCT01_0015_E10.b : tt
KDN01_0021_F06.b : cttcaccaacaagagttgcnnnnnnggtttgtgnggagctcttctttaaanggcccaaaa
PCT01_0014_C05.b : acctcccccccccaaagagggggggaaaccccccngagaannngnttatcatagaaagca
KDN01_0099_B12.b :
KDN01_0040_F03.b : ctcaggtccctagaagacacccttgtttcctaggaagactctatagctctcaagcctaca
KDN01_0079_B12.b :
BFLT1_0103_F05.b : aaaataatcttatnnt
BFLT1_0099_C05.b :
KDN01_0046_B05.b : agctctctctctcatc
LVR01_0091_D10.b :
KDN01_0011_B05.b : accccacctcaccnccaaaagaaggccgaaannnnnnnnnnntttttttannnngggtgc
ADR01_0012_C07.b : aaaaagggggggggaaaaccggccccttggtacatcgggtgttatt
PCT01_0007_H05.b : caccccaagagaaggggggggaaaaccccccggggcggggggnnnnnnggttangnnnng
THY01_0064_D07.b :
SPLT1_0083_B04.b : cgggccccattttggcgccccctcacatccgcgctttctgaaaaaaaaaaaccccctttt
ILNT1_0064_G06.b : ggtgggctcgagaaaaaagccacggttgtttttggataaggcggtccggggaaaactttg
KDN01_0067_B05.b : ggccattattgccagacttcaattccacgattttaaaaaaaaaaaccccttttagttccg
OVR01_0100_C06.b :
LVR01_0099_F12.b : aaggggggaaaaccccccc
MLN01_0032_B07.b : gggccttttttgtcgccccccaaaccaacggtgccaagaaaaaaaaacccctttggtcct
KDN01_0028_F10.b : aaataatggtcggccggccactttttgtgccgaccccaaatccggcgattctaaaaaaaa
KDN01_0054_B01.b : tcctcaatagttggtcttgccggtcccttattttgcggaacttccaaatccgccaatgca
KDN01_0012_H06.b : gtctgccggcccataatttgtcaggcctcccaattcgccnattggaaaaaaaaaaaaccc
DCI01_0021_C12.b :
KDN01_0047_E11.b : atatagttttatacgattataccttatgtaacttatcctgctgcgtgactacttataaac
KDN01_0015_E11.b : ggagaagcacccttcttaaataagttggtctggcgggcccattcatttgggcaggacctt
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : caatccagcgtttgctaagaaaaaaaaccaccttcttggttcccgaggaggcgaccctct
KDN01_0086_F02.b : CACCCGGAGAACcacccctcctcaactaactgtgttctgcccggtcccactcatttttgc
DCI01_0028_F01.b : tttttgtgaaaacccctcaattttgggattcccgaaaaaaaaaaaaaccccttttggttt
OVRM1_0110_B01.b :
DCI01_0045_D03.b : CACCCGGAGAACGCACCCCTCCTCAGACTAGCTGTGTCCTGGCCGGTCCCACTCACTTCT
UTR01_0014_D02.b : tcgcggcgtagaacctctccgctgaaagtatccgtccgcatctctttgtgtccacggtcc
20110601C-000779 : GCCACGCACCCCCTCCACACTCCAGGCGCATCGCCTAGGAGCAGAACAGAGACCCCAGCA
---------+---------+---------+---------+---------+---------+ 1542
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b : ttctaacatcaa
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b : ggnnnnnnnnnt
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b : aattattattatatattaannnnnnnnnnnnnnnnnncccacagagtatgaaaant
PCT01_0014_C05.b : tgatct
KDN01_0099_B12.b :
KDN01_0040_F03.b : aggaagtgcgcgcg
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b : tacatcaaactctttt
ADR01_0012_C07.b :
PCT01_0007_H05.b : ttttcgtctctcaaaacaaatgcttttggggnnnnnnt
THY01_0064_D07.b :
SPLT1_0083_B04.b : gtttcggaggaggcacctccttaaaagtccttgagggcgttcacgagagagtggatgggt
ILNT1_0064_G06.b : agacggtatgnaaggtgaaagaggtgtcccagaaacaccgggccgcggagggaggtgtng
KDN01_0067_B05.b : agtggagcaacccccggaaacctttaagggttaaatgaaataaagatggggcgggaaaac
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b : gaggggggagctctggagggccttttt
KDN01_0028_F10.b : aaacccccttttaggttccgaaggaggcaacccccctgaaagcccttaaaggccgttacg
KDN01_0054_B01.b : aaggaaaaaaaacccaacttctgtttccggaaggaggcaaccttctgaaaaagctttgaa
KDN01_0012_H06.b : cattttagttccgaaggaaggcgatctcttggaaagccttaagacttttaaatggaatta
DCI01_0021_C12.b :
KDN01_0047_E11.b : tattaagctcatcttaatttacgaatgacaaatccatcctttagatcgtattctcacgtt
KDN01_0015_E11.b : cccaatcaagcggattgctagaaaaaaaaaaacccccctttttagtttcccgaaaggaag
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : tgaaagcctttaaagccttctaaagagggatagaatggggccctggaaaacccccggccc
KDN01_0086_F02.b : aaggaccctccaaaatccagncgaattgcttagaaaaaacaaaaaccccaccttctagtt
DCI01_0028_F01.b : tcccgggaagggaccccccctcgaagaactcttttaaggacttttcaccaaaggaagaag
OVRM1_0110_B01.b :
DCI01_0045_D03.b : GCCACGCACCCCCTCCACACTCCAGGCGCATCGCCTAGGAGCAGAACAGAGACCCCAGCA
UTR01_0014_D02.b : cgccgtcgccctcaacttgcgcccgctg
20110601C-000779 : TTCGTAGGTTTTCCCAGACTGGAAGGCCGAGCTCCTACCCTGGACAGAGCCCTTCTGAAG
---------+---------+---------+---------+---------+---------+ 1602
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b : gccgggaaaa
ILNT1_0064_G06.b : gcgtcagtagatggatacgtatggaggg
KDN01_0067_B05.b : ccccggcccccgcctggggtcccgggtttgtggttaaaaatttaaccggggg
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b : gaaattagaatggggccctggaaaacacatctcccccattt
KDN01_0054_B01.b : ggggtaaactgaaaattaaatttggggtccggaaaaccactcggggcccctggaatggag
KDN01_0012_H06.b : gatcggtgtccggaaaaccacccgccccccaaaagaagaatccccgtttgggtttcttat
DCI01_0021_C12.b :
KDN01_0047_E11.b : gtttaattcgtagactgtacgtgcggttactg
KDN01_0015_E11.b : gggactcccccgggaaagggcttctgaaaggggtgtaaactgggaaatttaaaaactggg
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b : cccggattagagataccccgtgttgggttctcaatattataaccccgggggaggctcttc
KDN01_0086_F02.b : ttccagaatggagggaaactctactggaagaggccttctacagggctgcaaacctgagag
DCI01_0028_F01.b : aggggggccggcaaaaaaccccccgccccccccccccctcgagaggcacccccgggcggt
OVRM1_0110_B01.b :
DCI01_0045_D03.b : TTCGTAGGTTTTCCCAGACTGGAAGGCCGAGCTCCTACCCTGGACAGAGCCCTTCTGAAG
UTR01_0014_D02.b :
20110601C-000779 : CAGCAGCTGCTAAACCTGGAGGAAGTTGAAGAANGTCTGGGTGGCCCCTGGGAAAAAAGC
---------+---------+---------+---------+---------+---------+ 1662
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b : gtcccaggggggtgggatctccaaaattataaacgcgggaaggggtccg
KDN01_0012_H06.b : ttaaacgggggggggggcgcccaataaaattatatcntagagaannnnnnnttccatatc
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b : gggcccgggaaaacc
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : gtaaggattcgggtggcctggaaaaaacacaatttccggcccccatttcagatttggggg
DCI01_0028_F01.b : gggggtctaaaaaaacaaaccagggggggaggggg
OVRM1_0110_B01.b :
DCI01_0045_D03.b : CAGCAGCTGCTAAACCTGGAGGAAGTTGAAGAANGTCTGGGTGGCCCCTGGGAAAAAAGC
UTR01_0014_D02.b :
20110601C-000779 : ACAGTCTGCCTGGGCCCCGCATCTGTCGAGCTTTGCGGA.....................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b : cacgatgctct
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : gtttcccaccggccggcctggggagtcttccattaaactttacaggacccccggggggaa
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : ACAGTCTGCCTGGGCCCCGCATCTGTCGAGCTTTGCGGAatgttnaccccatctggnctg
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b : ggttgtggttaagttcctctaaaaaaattttgaaaactttttttaaccgcttccgtgat
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : tccttggtgtggatcctctccaattcaaatcttgatccatgaaccctccgggtgtgggaa
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : ggcctggctggttcacggtcttcccttaagcatgaaatatttgcaaaaaccgtttttcgt
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_F10.b :
KDN01_0054_B01.b :
KDN01_0012_H06.b :
DCI01_0021_C12.b :
KDN01_0047_E11.b :
KDN01_0015_E11.b :
LVRM1_0037_A08.b :
OVRM1_0179_C01.b :
DCI01_0118_A02.b :
KDN01_0086_F02.b :
DCI01_0028_F01.b :
OVRM1_0110_B01.b :
DCI01_0045_D03.b : tataactcgttcccctgcaggaacaggaaagccaaaacgcctccccatgaacacggttgg
UTR01_0014_D02.b :
20110601C-000779 : ............................................................
---------+---------+---------+---------+---------+---------+ 1701
LVR01_0036_C01.b :
CBLT1_0047_H06.b :
HTMT1_0033_E10.b :
ADR01_0019_B07.b :
LVRM1_0058_B04.b :
LVRM1_0064_F05.b :
LVRM1_0047_C04.b :
LVRM1_0189_D03.b :
SMG01_0006_H10.b :
OVRM1_0199_B02.b :
LVRM1_0072_H12.b :
OVRM1_0057_G08.b :
LVRM1_0019_H03.b :
OVR01_0059_B10.b :
PTG01_0109_G09.b :
SPL01_0018_E05.b :
OVR01_0060_H04.b :
OVR01_0096_A06.b :
SPL01_0084_C10.b :
THY01_0066_H07.b :
OVRT1_0015_F10.b :
OVR01_0032_E06.b :
THY01_0205_F10.b :
LVR01_0063_B05.b :
OVR01_0033_C02.b :
THY01_0062_H02.b :
OVRT1_0095_C10.b :
SMG01_0060_C01.b :
TCH01_0063_A12.b :
KDN01_0098_A08.b :
SKNB1_0070_D05.b :
OVRM1_0039_F04.b :
KDN01_0021_F12.b :
PST01_0081_A12.b :
PST01_0098_C02.b :
KDN01_0067_G01.b :
SKNB1_0089_G01.b :
BMWN1_0073_G08.b :
ADR01_0031_B12.b :
OVRT1_0073_D02.b :
LVRM1_0122_E10.b :
SKNB1_0008_A06.b :
LVRM1_0042_H08.b :
PTG01_0033_E06.b :
ADR01_0020_F05.b :
SPLT1_0014_H11.b :
LVR01_0086_H02.b :
ADR01_0048_D01.b :
BFLT1_0035_F07.b :
LVRM1_0150_A10.b :
PCT01_0008_F05.b :
TCH01_0040_E08.b :
SPL01_0057_F08.b :
KDN01_0006_A03.b :
CLNT1_0092_D01.b :
BFLT1_0030_G03.b :
LVR01_0067_C09.b :
SKNB1_0002_H12.b :
KDN01_0026_D08.b :
KDN01_0049_H11.b :
KDN01_0007_G05.b :
KDN01_0071_E04.b :
KDN01_0099_D03.b :
KDN01_0043_A07.b :
KDN01_0043_B03.b :
KDN01_0062_F04.b :
KDN01_0082_F01.b :
KDN01_0096_H10.b :
KDN01_0040_E11.b :
KDN01_0008_B06.b :
KDN01_0100_G05.b :
SKNB1_0008_B08.b :
KDN01_0015_E02.b :
KDN01_0094_D09.b :
KDN01_0086_A12.b :
PTG01_0074_F05.b :
LVRM1_0174_C11.b :
LVRM1_0043_G10.b :
LVRM1_0077_F08.b :
LVRM1_0056_E02.b :
ADR01_0008_H03.b :
SPL01_0051_E12.b :
SPL01_0092_H12.b :
SPL01_0026_D06.b :
PTG01_0031_G03.b :
UTR01_0015_G03.b :
SMG01_0062_G07.b :
UTR01_0088_F03.b :
SPL01_0052_G07.b :
LVR01_0050_C03.b :
MLN01_0054_H07.b :
UTR01_0047_D02.b :
SPL01_0068_F02.b :
CLNT1_0063_C01.b :
LVR01_0098_F04.b :
OVRT1_0038_F03.b :
ADR01_0079_C03.b :
ITT01_0076_A09.b :
ITT01_0008_F03.b :
ITT01_0072_F01.b :
BFLT1_0019_G09.b :
BFLT1_0036_G01.b :
LNG01_0007_A07.b :
OVRT1_0068_C01.b :
KDN01_0051_G04.b :
KDN01_0004_B01.b :
KDN01_0004_E01.b :
KDN01_0088_A09.b :
KDN01_0009_G09.b :
KDN01_0025_E11.b :
KDN01_0039_G05.b :
KDN01_0025_D08.b :
SPL01_0081_F04.b :
SPLT1_0074_G11.b :
OVR01_0096_F07.b :
SPLT1_0011_A04.b :
OVRT1_0005_A04.b :
SPLT1_0092_C01.b :
CBLT1_0027_C11.b :
OVRM1_0003_E12.b :
LVRM1_0127_D10.b :
OVRM1_0113_H12.b :
OVR01_0080_B06.b :
OVRM1_0148_A01.b :
OVRM1_0194_H08.b :
LVRM1_0058_C10.b :
LVRM1_0056_E05.b :
OVRM1_0118_C01.b :
OVRM1_0084_C06.b :
OVR01_0084_B06.b :
OVRM1_0115_G12.b :
OVRM1_0107_A11.b :
OVR01_0046_C09.b :
OVR01_0091_H12.b :
SMG01_0023_C09.b :
UTR01_0022_E08.b :
SMG01_0001_G11.b :
ITT01_0063_B06.b :
THY01_0097_B07.b :
LVR01_0048_C03.b :
OVRT1_0036_B07.b :
ADR01_0059_D09.b :
OVRT1_0070_B08.b :
BFLT1_0022_H11.b :
ITT01_0048_B12.b :
KDN01_0031_H05.b :
KDN01_0017_D01.b :
LVRM1_0125_B07.b :
LVRM1_0013_C07.b :
OVRM1_0057_F06.b :
LVR01_0083_E08.b :
LVR01_0050_H12.b :
OVRT1_0034_D12.b :
SKNB1_0062_C01.b :
KDN01_0094_G04.b :
PCT01_0015_E10.b :
KDN01_0021_F06.b :
PCT01_0014_C05.b :
KDN01_0099_B12.b :
KDN01_0040_F03.b :
KDN01_0079_B12.b :
BFLT1_0103_F05.b :
BFLT1_0099_C05.b :
KDN01_0046_B05.b :
LVR01_0091_D10.b :
KDN01_0011_B05.b :
ADR01_0012_C07.b :
PCT01_0007_H05.b :
THY01_0064_D07.b :
SPLT1_0083_B04.b :
ILNT1_0064_G06.b :
KDN01_0067_B05.b :
OVR01_0100_C06.b :
LVR01_0099_F12.b :
MLN01_0032_B07.b :
KDN01_0028_