[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000796

Length: 1,107

Sequence [FASTA format sequence]
TTGTTGGCCT ACTGGAGCAT TGCGGGCAGG CAGCGGCTCT GGGTCCACTC AGCGCATCCC
GCTCTGCGAG GCAGACATGA GGGCGGAGGG AATGTCCCTC TTCCTGGCTC TGGGGCTCCT
GGTGGCTGGG CTCTGCTCCA GGGTCCACTG CGTCCCAGCG GATGACCTTG CCTCAAAGAC
TGTGACCCTG AAGGGCCAGA TCAAGAAGCT GCCAGCGCAC AACACCGCCG TCGTCTCCAG
CAACACCGAC TTCGCCTTCA GCCTCTACAA GCAGCTGGCT CTGGCCGAAC GCAGAGAAAA
TGTCATCTTC TCCCCGCTGA GCGTCTCCAT AGCCTTGGCC TTCCTGTCTC TGGGGGCCCG
AGGCCCCACC CTGATAGAGC TCCTGGAAGG CCTCAAGTTC AACCTCACAA AGACCCCCGA
GGCAGAAATC CACCAGGGCT TCCAGCACCT CCTGCAGGCC CTCAGCCAAC CCAGCAACCT
GCTGCAGCTG AACGTGGGCA ACGCCATGTT CGTGGATGAG CGGCTGAAGC TGCTGGACAA
GTTCGTCCAA GATGCCCGTG AGCTGTACTT CTCCGAGGTC TTCTCCATCA GCTTTAAGGA
CTCCGATGCT GCCATAGAGT TCATCAACAA CTATGTAAAG AATAAGACCA AGGGGAAAAT
TGTGGATTTG TTCAAACAAC TTTCCCCGGA TACCGTCCTG GTTCTGGTGA ACTGCATCTA
CTTTAAAGCC AAGTGGAAGA TGCCCTTCAA TCCCAACTTT ACCACGGGGG CAGATTTCCA
CGTGAGCAAG AACAGGACGG TGAGGGTGCC CATGATGGGC ATTACGGGCC GCACCGTGCC
TTACTTCCGG GACCAGGAGC TGGCCTGCAC GGTGGTGGAG CTCCCGTACA CCAGCAACGA
CAGCGCGCTC TTCATCCTCC CTGACGACGG CAGGATGGAG GACGTGGAAA GCCAAGCTGC
TCCCGGAGAC ACTGAGGAGG TGGAAGAGAC TCCCTGCAGC CCAAACGGAT AACTGCCCTC
CACCTGCCAC GGTTTTCCGT CTCCGGGGGA CTATAAGCTG CATGACATCC TTCCCCACCT
GGGCATTAAA AAAGTCTTCA CCCACCA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINA3alpha-1-antichymotrypsin precursor [Homo sapiens]. 3148e-86O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA5plasma serine protease inhibitor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2341e-61O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSerpina3cserine protease inhibitor A3C precursor [Mus musculus]. 2979e-81O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 2915e-79O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 2915e-79O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 2915e-79O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 1 [Mus musculus]. 2862e-77O
Contig/Assembly ProteinSerpina3iserine (or cysteine) peptidase inhibitor, clade A, member 3I [Mus musculus]. 2862e-77O
Contig/Assembly ProteinSerpina3mserine protease inhibitor A3M precursor [Mus musculus]. 2863e-77O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 2 [Mus musculus]. 2862e-77O
Contig/Assembly ProteinSerpina3nserine protease inhibitor A3N precursor [Mus musculus]. 2856e-77O
Contig/Assembly ProteinSerpina3gserine protease inhibitor A3G [Mus musculus]. 2856e-77O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480425PREDICTED: similar to Alpha-1-antichymotrypsin precursor (ACT) [Canis familiaris]. 3331e-91O
Contig/Assembly ProteinSERPINA1serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 [Canis lupus familiaris]. 2341e-61O
Contig/Assembly ProteinLOC480423PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 [Canis familiaris]. 2262e-59O
Contig/Assembly ProteinLOC490838PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 2217e-58O
Contig/Assembly ProteinLOC612381PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 [Canis familiaris]. 2194e-57O
Contig/Assembly ProteinLOC481007PREDICTED: similar to Thyroxine-binding globulin precursor (T4-binding globulin) [Canis familiaris]. 2186e-57O
Contig/Assembly ProteinLOC490840PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 [Canis familiaris]. 2149e-56O
Contig/Assembly ProteinLOC480424PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 [Canis familiaris]. 2071e-53O
Contig/Assembly ProteinLOC612386PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 [Canis familiaris]. 2062e-53O
Contig/Assembly ProteinLOC612383PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 1633e-40


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINA3-8SERPINA3-8 [Bos taurus]. 377e-105O
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2C-like [Bos taurus]. 369e-102O
Contig/Assembly ProteinSERPINA3-6serpin A3-6 [Bos taurus]. 366e-101O
Contig/Assembly ProteinSERPINA3serpin A3-5 [Bos taurus]. 362e-100O
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2B-like [Bos taurus]. 361e-100O
Contig/Assembly ProteinSERPINA3-2serpin A3-2 [Bos taurus]. 3571e-98O
Contig/Assembly ProteinSERPINA3-1serpin A3-1 precursor [Bos taurus]. 3554e-98O
Contig/Assembly ProteinSERPINA3-3serpin A3-3 [Bos taurus]. 3549e-98O
Contig/Assembly ProteinLOC100138846PREDICTED: endopin 2C-like [Bos taurus]. 3521e-97O
Contig/Assembly ProteinSERPINA3-7serpin A3-7 [Bos taurus]. 3516e-97O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153899PREDICTED: serpin A3-8 [Sus scrofa]. 539e-153O
Contig/Assembly ProteinSERPINA3-2alpha-1-antichymotrypsin 2 [Sus scrofa]. 460e-130O
Contig/Assembly ProteinLOC100156325PREDICTED: serpin A3-6 [Sus scrofa]. 459e-130O
Contig/Assembly ProteinSERPINA3-3PREDICTED: serpin A3-5 [Sus scrofa]. 440e-124
Contig/Assembly ProteinSERPINA3-1PREDICTED: serpin A3-6 [Sus scrofa]. 3161e-86O
Contig/Assembly ProteinLOC100622237PREDICTED: serpin A3-8-like, partial [Sus scrofa]. 2579e-69O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Sus scrofa]. 2432e-64O
Contig/Assembly ProteinLOC100155953PREDICTED: serpin A11 [Sus scrofa]. 2262e-59O
Contig/Assembly ProteinSERPINA11PREDICTED: serpin A11 [Sus scrofa]. 2247e-59O
Contig/Assembly ProteinLOC100153513PREDICTED: plasma serine protease inhibitor-like [Sus scrofa]. 2245e-59O


Assembly Members: 462      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010001G01LVR01_0001_G01.bBP446308 
LVR010001G10LVR01_0001_G10.bBP446976 
LVR010002B01LVR01_0002_B01.bBP441861 
LVR010002D04LVR01_0002_D04.bBP443908 
LVR010002F06LVR01_0002_F06.bBP445801 
LVR010002H03LVR01_0002_H03.bBP447368 
LVR010002H09LVR01_0002_H09.bBP447833 
LVR010003A03LVR01_0003_A03.bBP441096 
LVR010003B10LVR01_0003_B10.bBP442551 
LVR010003D07LVR01_0003_D07.bBP444123 
LVR010003E10LVR01_0003_E10.bBP445200 
LVR010004D05LVR01_0004_D05.bBP443982 
LVR010004D10LVR01_0004_D10.bBP444341 
LVR010004E02LVR01_0004_E02.bBP444648 
LVR010004F10LVR01_0004_F10.bBP446086 
LVR010004F11LVR01_0004_F11.bBP446161 
LVR010004H07LVR01_0004_H07.bBP447681 
LVR010004H12LVR01_0004_H12.bBP448069 
LVR010005A10LVR01_0005_A10.bBP441643 
LVR010005D01LVR01_0005_D01.bBP443677 
LVR010005F12LVR01_0005_F12.bBP446238 
LVR010005H12LVR01_0005_H12.bBP448070 
LVR010008D07LVR01_0008_D07.bBP444126 
LVR010008E09LVR01_0008_E09.bBP445131 
LVR010009A02LVR01_0009_A02.bBP441021 
LVR010009B03LVR01_0009_B03.bBP442018 
LVR010009D09LVR01_0009_D09.bBP444266 
LVR010009F04LVR01_0009_F04.bBP445659 
LVR010011B03LVR01_0011_B03.bBP442020 
LVR010011B06LVR01_0011_B06.bBP442255 
LVR010011C05LVR01_0011_C05.bBP443095 
LVR010011D10LVR01_0011_D10.bBP444345 
LVR010011G07LVR01_0011_G07.bBP446770 
LVR010011H09LVR01_0011_H09.bBP447840 
LVR010012F03LVR01_0012_F03.bBP445586 
LVR010012F06LVR01_0012_F06.bBP445808 
LVR010012F11LVR01_0012_F11.bBP446167 
LVR010013A05LVR01_0013_A05.bBP441262 
LVR010013A10LVR01_0013_A10.bBP441648 
LVR010013B01LVR01_0013_B01.bBP441868 
LVR010013B05LVR01_0013_B05.bBP442178 
LVR010013G07LVR01_0013_G07.bBP446771 
LVR010013G08LVR01_0013_G08.bBP446840 
LVR010013H03LVR01_0013_H03.bBP447376 
LVR010014A03LVR01_0014_A03.bBP441105 
LVR010014B03LVR01_0014_B03.bBP442023 
LVR010014C02LVR01_0014_C02.bBP442871 
LVR010014F01LVR01_0014_F01.bBP445434 
LVR010014G06LVR01_0014_G06.bBP446703 
LVR010014H04LVR01_0014_H04.bBP447458 
LVR010014H06LVR01_0014_H06.bBP447611 
LVR010014H11LVR01_0014_H11.bBP447998 
LVR010015A05LVR01_0015_A05.bBP441263 
LVR010015C03LVR01_0015_C03.bBP442946 
LVR010015C08LVR01_0015_C08.bBP443317 
LVR010015D06LVR01_0015_D06.bBP444062 
LVR010015E03LVR01_0015_E03.b  
LVR010015E12LVR01_0015_E12.bBP445356 
LVR010015F03LVR01_0015_F03.bBP445588 
LVR010015F11LVR01_0015_F11.bBP446169 
LVR010015G11LVR01_0015_G11.bBP447064 
LVR010015H06LVR01_0015_H06.bBP447612 
LVR010016B08LVR01_0016_B08.bBP442411 
LVR010016F10LVR01_0016_F10.bBP446095 
LVR010016F12LVR01_0016_F12.bBP446245 
LVR010016G08LVR01_0016_G08.bBP446842 
LVR010017B04LVR01_0017_B04.bBP442105 
LVR010017B12LVR01_0017_B12.bBP442718 
LVR010017D08LVR01_0017_D08.bBP444201 
LVR010017F06LVR01_0017_F06.bBP445812 
LVR010017G04LVR01_0017_G04.bBP446553 
LVR010017G11LVR01_0017_G11.bBP447066 
LVR010017H08LVR01_0017_H08.bBP447769 
LVR010017H12LVR01_0017_H12.bBP448080 
LVR010018H06LVR01_0018_H06.bBP447615 
LVR010019A02LVR01_0019_A02.bBP441031 
LVR010019C09LVR01_0019_C09.bBP443391 
LVR010020B05LVR01_0020_B05.bBP442185 
LVR010020D02LVR01_0020_D02.bBP443771 
LVR010020D06LVR01_0020_D06.bBP444066 
LVR010021A07LVR01_0021_A07.bBP441423 
LVR010021C01LVR01_0021_C01.bBP442798 
LVR010021F08LVR01_0021_F08.bBP445954 
LVR010022B12LVR01_0022_B12.bBP442722 
LVR010022C01LVR01_0022_C01.bBP442799 
LVR010022G06LVR01_0022_G06.bBP446708 
LVR010025C07LVR01_0025_C07.bBP443251 
LVR010025E07LVR01_0025_E07.bBP445014 
LVR010025G07LVR01_0025_G07.bBP446781 
LVR010026A08LVR01_0026_A08.bBP441504 
LVR010026B01LVR01_0026_B01.bBP441878 
LVR010026H06LVR01_0026_H06.bBP447621 
LVR010028A10LVR01_0028_A10.bBP441660 
LVR010028C11LVR01_0028_C11.bBP443544 
LVR010028C12LVR01_0028_C12.bBP443622 
LVR010028D12LVR01_0028_D12.bBP444510 
LVR010028F05LVR01_0028_F05.bBP445743 
LVR010028G02LVR01_0028_G02.bBP446404 
LVR010028H01LVR01_0028_H01.bBP447230 
LVR010028H03LVR01_0028_H03.bBP447388 
LVR010029C03LVR01_0029_C03.bBP442957 
LVR010029C04LVR01_0029_C04.bBP443034 
LVR010029C12LVR01_0029_C12.bBP443623 
LVR010029D10LVR01_0029_D10.bBP444358 
LVR010029E01LVR01_0029_E01.b  
LVR010029G04LVR01_0029_G04.bBP446561 
LVR010029G08LVR01_0029_G08.bBP446851 
LVR010030C02LVR01_0030_C02.bBP442883 
LVR010030E05LVR01_0030_E05.bBP444883 
LVR010031A02LVR01_0031_A02.bBP441040 
LVR010031A03LVR01_0031_A03.bBP441119 
LVR010031A04LVR01_0031_A04.bBP441198 
LVR010031E02LVR01_0031_E02.bBP444668 
LVR010031E08LVR01_0031_E08.bBP445082 
LVR010031F11LVR01_0031_F11.bBP446181 
LVR010031H04LVR01_0031_H04.bBP447469 
LVR010033A11LVR01_0033_A11.bBP441738 
LVR010033A12LVR01_0033_A12.bBP441811 
LVR010033C06LVR01_0033_C06.bBP443187 
LVR010033D08LVR01_0033_D08.bBP444211 
LVR010033E04LVR01_0033_E04.bBP444814 
LVR010033H08LVR01_0033_H08.bBP447780 
LVR010034B12LVR01_0034_B12.bBP442728 
LVR010034C06LVR01_0034_C06.bBP443188 
LVR010034D12LVR01_0034_D12.bBP444514 
LVR010034E01LVR01_0034_E01.bBP444592 
LVR010034E02LVR01_0034_E02.bBP444670 
LVR010034F03LVR01_0034_F03.bBP445601 
LVR010034G10LVR01_0034_G10.bBP447002 
LVR010034H07LVR01_0034_H07.bBP447704 
LVR010035A09LVR01_0035_A09.bBP441589 
LVR010035A12LVR01_0035_A12.bBP441813 
LVR010035D06LVR01_0035_D06.b  
LVR010035E04LVR01_0035_E04.b  
LVR010035H03LVR01_0035_H03.bBP447394 
LVR010036A02LVR01_0036_A02.bBP441044 
LVR010036A12LVR01_0036_A12.bBP441814 
LVR010036E01LVR01_0036_E01.bBP444594 
LVR010036G03LVR01_0036_G03.b  
LVR010036H03LVR01_0036_H03.bBP447395 
LVR010036H11LVR01_0036_H11.bBP448016 
LVR010037A01LVR01_0037_A01.bBP440964 
LVR010037C01LVR01_0037_C01.bBP442810 
LVR010037D12LVR01_0037_D12.bBP444516 
LVR010037H09LVR01_0037_H09.bBP447861 
LVR010038B08LVR01_0038_B08.bBP442427 
LVR010038C04LVR01_0038_C04.bBP443040 
LVR010038D06LVR01_0038_D06.bBP444077 
LVR010038F06LVR01_0038_F06.bBP445826 
LVR010038H11LVR01_0038_H11.bBP448018 
LVR010039B04LVR01_0039_B04.bBP442121 
LVR010039B11LVR01_0039_B11.bBP442655 
LVR010039G12LVR01_0039_G12.bBP447161 
LVR010040C09LVR01_0040_C09.bBP443406 
LVR010040C10LVR01_0040_C10.bBP443481 
LVR010040C11LVR01_0040_C11.bBP443553 
LVR010040D01LVR01_0040_D01.bBP443706 
LVR010040D02LVR01_0040_D02.bBP443783 
LVR010040E09LVR01_0040_E09.bBP445155 
LVR010040F12LVR01_0040_F12.bBP446263 
LVR010040G12LVR01_0040_G12.bBP447162 
LVR010040H03LVR01_0040_H03.bBP447399 
LVR010040H11LVR01_0040_H11.bBP448020 
LVR010041D06LVR01_0041_D06.bBP444079 
LVR010041F04LVR01_0041_F04.bBP445680 
LVR010041F06LVR01_0041_F06.bBP445828 
LVR010042C08LVR01_0042_C08.b  
LVR010042G12LVR01_0042_G12.bBP447164 
LVR010042H11LVR01_0042_H11.bBP448022 
LVR010043B08LVR01_0043_B08.bBP442431 
LVR010043B11LVR01_0043_B11.bBP442659 
LVR010043C03LVR01_0043_C03.bBP442968 
LVR010043D10LVR01_0043_D10.bBP444369 
LVR010043E05LVR01_0043_E05.bBP444891 
LVR010043F03LVR01_0043_F03.bBP445610 
LVR010043G11LVR01_0043_G11.bBP447087 
LVR010044D05LVR01_0044_D05.bBP444009 
LVR010044E01LVR01_0044_E01.bBP444602 
LVR010044G07LVR01_0044_G07.b  
LVR010044G09LVR01_0044_G09.bBP446934 
LVR010044G11LVR01_0044_G11.bBP447088 
LVR010044G12LVR01_0044_G12.bBP447166 
LVR010045A05LVR01_0045_A05.bBP441289 
LVR010045E03LVR01_0045_E03.bBP444751 
LVR010045F02LVR01_0045_F02.bBP445533 
LVR010045F04LVR01_0045_F04.bBP445684 
LVR010045G10LVR01_0045_G10.bBP447012 
LVR010045H01LVR01_0045_H01.bBP447245 
LVR010045H02LVR01_0045_H02.bBP447323 
LVR010046B05LVR01_0046_B05.bBP442205 
LVR010046F01LVR01_0046_F01.bBP445460 
LVR010046F07LVR01_0046_F07.bBP445901 
LVR010047A04LVR01_0047_A04.bBP441211 
LVR010047A05LVR01_0047_A05.bBP441291 
LVR010047B08LVR01_0047_B08.bBP442435 
LVR010047B09LVR01_0047_B09.bBP442512 
LVR010047D07LVR01_0047_D07.bBP444153 
LVR010047G03LVR01_0047_G03.bBP446499 
LVR010047G05LVR01_0047_G05.bBP446653 
LVR010047H12LVR01_0047_H12.bBP448104 
LVR010048A05LVR01_0048_A05.bBP441292 
LVR010048A06LVR01_0048_A06.bBP441364 
LVR010048B12LVR01_0048_B12.bBP442742 
LVR010048D07LVR01_0048_D07.bBP444154 
LVR010048E04LVR01_0048_E04.bBP444823 
LVR010048E05LVR01_0048_E05.bBP444895 
LVR010048G01LVR01_0048_G01.bBP446344 
LVR010049B07LVR01_0049_B07.bBP442359 
LVR010049D02LVR01_0049_D02.bBP443792 
LVR010049D11LVR01_0049_D11.bBP444451 
LVR010049G03LVR01_0049_G03.bBP446501 
LVR010049G07LVR01_0049_G07.bBP446797 
LVR010049G10LVR01_0049_G10.bBP447016 
LVR010050A07LVR01_0050_A07.bBP441447 
LVR010050A12LVR01_0050_A12.bBP441827 
LVR010050B09LVR01_0050_B09.bBP442514 
LVR010050D04LVR01_0050_D04.bBP443942 
LVR010050F07LVR01_0050_F07.bBP445905 
LVR010050F08LVR01_0050_F08.bBP445975 
LVR010050G12LVR01_0050_G12.bBP447171 
LVR010051C07LVR01_0051_C07.bBP443269 
LVR010052B06LVR01_0052_B06.bBP442285 
LVR010052C06LVR01_0052_C06.bBP443201 
LVR010052F09LVR01_0052_F09.bBP446048 
LVR010052H11LVR01_0052_H11.bBP448032 
LVR010053C12LVR01_0053_C12.bBP443642 
LVR010054B01LVR01_0054_B01.bBP441902 
LVR010054B07LVR01_0054_B07.bBP442364 
LVR010054C03LVR01_0054_C03.bBP442977 
LVR010054D02LVR01_0054_D02.bBP443796 
LVR010054D06LVR01_0054_D06.bBP444090 
LVR010054E10LVR01_0054_E10.bBP445238 
LVR010055A10LVR01_0055_A10.bBP441684 
LVR010055G02LVR01_0055_G02.bBP446430 
LVR010055G04LVR01_0055_G04.bBP446584 
LVR010056A09LVR01_0056_A09.bBP441608 
LVR010056B04LVR01_0056_B04.bBP442137 
LVR010056C04LVR01_0056_C04.bBP443057 
LVR010056E12LVR01_0056_E12.bBP445391 
LVR010056G04LVR01_0056_G04.bBP446585 
LVR010056H06LVR01_0056_H06.bBP447646 
LVR010057A09LVR01_0057_A09.bBP441609 
LVR010057D02LVR01_0057_D02.bBP443799 
LVR010057G03LVR01_0057_G03.bBP446508 
LVR010058A03LVR01_0058_A03.bBP441142 
LVR010058B11LVR01_0058_B11.bBP442674 
LVR010058E09LVR01_0058_E09.bBP445171 
LVR010058F08LVR01_0058_F08.bBP445982 
LVR010058F11LVR01_0058_F11.bBP446205 
LVR010058G10LVR01_0058_G10.bBP447024 
LVR010058H08LVR01_0058_H08.bBP447801 
LVR010059B03LVR01_0059_B03.bBP442062 
LVR010059E02LVR01_0059_E02.bBP444691 
LVR010060A03LVR01_0060_A03.bBP441144 
LVR010060B01LVR01_0060_B01.bBP441908 
LVR010060D08LVR01_0060_D08.bBP444232 
LVR010060F04LVR01_0060_F04.bBP445699 
LVR010060G03LVR01_0060_G03.bBP446511 
LVR010061A02LVR01_0061_A02.bBP441068 
LVR010061C07LVR01_0061_C07.bBP443278 
LVR010061E09LVR01_0061_E09.bBP445173 
LVR010061H05LVR01_0061_H05.bBP447573 
LVR010061H10LVR01_0061_H10.bBP447961 
LVR010062B05LVR01_0062_B05.bBP442220 
LVR010062B09LVR01_0062_B09.bBP442525 
LVR010062F10LVR01_0062_F10.bBP446134 
LVR010062G03LVR01_0062_G03.bBP446513 
LVR010062G12LVR01_0062_G12.bBP447183 
LVR010063C09LVR01_0063_C09.bBP443427 
LVR010063D09LVR01_0063_D09.bBP444314 
LVR010063F02LVR01_0063_F02.bBP445550 
LVR010063F10LVR01_0063_F10.bBP446135 
LVR010065A01LVR01_0065_A01.bBP440990 
LVR010065A12LVR01_0065_A12.bBP441837 
LVR010065B08LVR01_0065_B08.bBP442450 
LVR010065B09LVR01_0065_B09.bBP442527 
LVR010065D09LVR01_0065_D09.bBP444315 
LVR010065E05LVR01_0065_E05.bBP444908 
LVR010065E11LVR01_0065_E11.bBP445320 
LVR010065G01LVR01_0065_G01.bBP446359 
LVR010065G08LVR01_0065_G08.bBP446883 
LVR010066A11LVR01_0066_A11.bBP441764 
LVR010066F02LVR01_0066_F02.bBP445552 
LVR010066F05LVR01_0066_F05.bBP445777 
LVR010066G12LVR01_0066_G12.bBP447186 
LVR010066H08LVR01_0066_H08.bBP447808 
LVR010067A04LVR01_0067_A04.bBP441229 
LVR010067D01LVR01_0067_D01.bBP443731 
LVR010067E04LVR01_0067_E04.bBP444839 
LVR010067F01LVR01_0067_F01.bBP445479 
LVR010067F06LVR01_0067_F06.bBP445850 
LVR010067G02LVR01_0067_G02.bBP446439 
LVR010067G05LVR01_0067_G05.bBP446669 
LVR010067H02LVR01_0067_H02.bBP447343 
LVR010067H10LVR01_0067_H10.bBP447965 
LVR010068D01LVR01_0068_D01.bBP443732 
LVR010068E07LVR01_0068_E07.bBP445038 
LVR010071A03LVR01_0071_A03.bBP441152 
LVR010071A09LVR01_0071_A09.bBP441619 
LVR010071C09LVR01_0071_C09.bBP443432 
LVR010071E08LVR01_0071_E08.bBP445107 
LVR010072A10LVR01_0072_A10.bBP441697 
LVR010072A12LVR01_0072_A12.bBP441842 
LVR010072B06LVR01_0072_B06.bBP442302 
LVR010072D04LVR01_0072_D04.bBP443960 
LVR010072D05LVR01_0072_D05.bBP444033 
LVR010073B02LVR01_0073_B02.bBP441993 
LVR010073B03LVR01_0073_B03.bBP442073 
LVR010073B12LVR01_0073_B12.bBP442761 
LVR010073E07LVR01_0073_E07.bBP445041 
LVR010074C05LVR01_0074_C05.bBP443145 
LVR010074C10LVR01_0074_C10.bBP443508 
LVR010074D04LVR01_0074_D04.bBP443962 
LVR010074D11LVR01_0074_D11.bBP444471 
LVR010074G04LVR01_0074_G04.bBP446598 
LVR010074G10LVR01_0074_G10.bBP447037 
LVR010074H05LVR01_0074_H05.b  
LVR010076C03LVR01_0076_C03.bBP442994 
LVR010076E08LVR01_0076_E08.bBP445110 
LVR010076G02LVR01_0076_G02.bBP446445 
LVR010077A05LVR01_0077_A05.bBP441313 
LVR010077C01LVR01_0077_C01.bBP442846 
LVR010077C07LVR01_0077_C07.bBP443289 
LVR010077G04LVR01_0077_G04.bBP446599 
LVR010078A01LVR01_0078_A01.bBP440999 
LVR010078A04LVR01_0078_A04.bBP441237 
LVR010078D10LVR01_0078_D10.bBP444398 
LVR010079E08LVR01_0079_E08.bBP445113 
LVR010079F12LVR01_0079_F12.bBP446295 
LVR010081A01LVR01_0081_A01.bBP441001 
LVR010081A12LVR01_0081_A12.bBP441849 
LVR010081B03LVR01_0081_B03.bBP442079 
LVR010081B07LVR01_0081_B07.bBP442385 
LVR010081C08LVR01_0081_C08.bBP443364 
LVR010081D12LVR01_0081_D12.bBP444552 
LVR010081E09LVR01_0081_E09.bBP445186 AK394052
LVR010081F07LVR01_0081_F07.bBP445925 
LVR010082B11LVR01_0082_B11.bBP442693 
LVR010082C06LVR01_0082_C06.bBP443222 
LVR010082E12LVR01_0082_E12.bBP445410 
LVR010082H12LVR01_0082_H12.bBP448133 
LVR010083F08LVR01_0083_F08.bCJ000062 
LVR010084D08LVR01_0084_D08.bCJ000130 
LVR010084F10LVR01_0084_F10.bCJ000154 
LVR010084G07LVR01_0084_G07.bCJ000160 
LVR010084H02LVR01_0084_H02.bCJ000166 
LVR010085A10LVR01_0085_A10.bCJ000184 
LVR010085F02LVR01_0085_F02.bCJ000226 
LVR010085H03LVR01_0085_H03.bCJ000247 
LVR010086A03LVR01_0086_A03.bCJ000259 
LVR010086B07LVR01_0086_B07.bBW962725 
LVR010086G05LVR01_0086_G05.bCJ000322 
LVR010087A03LVR01_0087_A03.bCJ000342 
LVR010087B04LVR01_0087_B04.bCJ000353 
LVR010087C05LVR01_0087_C05.bCJ000364 
LVR010087D12LVR01_0087_D12.bCJ000378 
LVR010087F05LVR01_0087_F05.bCJ000392 
LVR010087H10LVR01_0087_H10.bCJ000416 
LVR010088E08LVR01_0088_E08.bCJ000469 
LVR010088F12LVR01_0088_F12.bCJ000485 
LVR010088G01LVR01_0088_G01.bCJ000486 
LVR010089C11LVR01_0089_C11.bCJ000540 
LVR010089D11LVR01_0089_D11.bCJ000551 
LVR010089F03LVR01_0089_F03.bCJ000563 
LVR010089F04LVR01_0089_F04.bCJ000564 
LVR010089G03LVR01_0089_G03.bCJ000575 
LVR010089G07LVR01_0089_G07.bCJ000579 
LVR010089G08LVR01_0089_G08.bCJ000580 
LVR010089G09LVR01_0089_G09.bCJ000581 
LVR010089H09LVR01_0089_H09.bCJ000593 
LVR010090B10LVR01_0090_B10.bCJ000617 
LVR010090D12LVR01_0090_D12.bCJ000640 
LVR010090H09LVR01_0090_H09.bCJ000677 
LVR010091A01LVR01_0091_A01.bCJ000680 
LVR010091A02LVR01_0091_A02.bCJ000681 
LVR010091B09LVR01_0091_B09.bCJ000696 
LVR010091F05LVR01_0091_F05.bCJ000734 
LVR010091F10LVR01_0091_F10.bCJ000739 
LVR010091F12LVR01_0091_F12.bCJ000741 
LVR010091H01LVR01_0091_H01.bCJ000750 
LVR010091H05LVR01_0091_H05.bCJ000754 
LVR010091H07LVR01_0091_H07.bCJ000756 
LVR010091H09LVR01_0091_H09.bCJ000757 
LVR010092C09LVR01_0092_C09.bCJ000784 
LVR010092H02LVR01_0092_H02.bCJ000833 
LVR010092H06LVR01_0092_H06.bCJ000837 
LVR010093E01LVR01_0093_E01.bCJ000877 
LVR010093E02LVR01_0093_E02.bCJ000878 
LVR010093F04LVR01_0093_F04.bBW962772 
LVR010093G01LVR01_0093_G01.bCJ000889 
LVR010093G04LVR01_0093_G04.bCJ000892 
LVR010094B03LVR01_0094_B03.bCJ000922 
LVR010094C07LVR01_0094_C07.bCJ000936 
LVR010094H11LVR01_0094_H11.bCJ000991 
LVR010095A01LVR01_0095_A01.bBP441003 
LVR010095A07LVR01_0095_A07.bBP441475 
LVR010095A12LVR01_0095_A12.bBP441851 
LVR010095B04LVR01_0095_B04.bBP442158 
LVR010095B05LVR01_0095_B05.bBP442236 
LVR010095B07LVR01_0095_B07.bBP442387 
LVR010095C02LVR01_0095_C02.bBP442925 
LVR010095E10LVR01_0095_E10.bBP445259 
LVR010095F04LVR01_0095_F04.bBP445716 
LVR010095F07LVR01_0095_F07.bBP445927 
LVR010095F12LVR01_0095_F12.bBP446297 
LVR010095H10LVR01_0095_H10.bBP447977 
LVR010096B02LVR01_0096_B02.bBP442002 
LVR010096B06LVR01_0096_B06.bBP442312 
LVR010096E01LVR01_0096_E01.bBP444636 
LVR010096F09LVR01_0096_F09.bBP446074 
LVR010096H11LVR01_0096_H11.bBP448055 
LVR010097A10LVR01_0097_A10.bBP441708 
LVR010097A12LVR01_0097_A12.bBP441853 
LVR010097D02LVR01_0097_D02.bBP443820 
LVR010097E01LVR01_0097_E01.bBP444637 
LVR010097E05LVR01_0097_E05.bBP444922 
LVR010097E06LVR01_0097_E06.bBP444988 
LVR010097F09LVR01_0097_F09.bBP446075 
LVR010097F12LVR01_0097_F12.bBP446299 
LVR010097H01LVR01_0097_H01.bBP447277 
LVR010098A07LVR01_0098_A07.bBP441477 
LVR010098B05LVR01_0098_B05.bBP442239 
LVR010098F01LVR01_0098_F01.bBP445493 
LVR010099A02LVR01_0099_A02.bBP441087 
LVR010099A07LVR01_0099_A07.bBP441478 
LVR010099A08LVR01_0099_A08.bBP441554 
LVR010099B07LVR01_0099_B07.bBP442391 
LVR010099C10LVR01_0099_C10.bBP443518 
LVR010099D04LVR01_0099_D04.bBP443973 
LVR010099D05LVR01_0099_D05.bBP444046 
LVR010099E02LVR01_0099_E02.bBP444713 
LVR010099F08LVR01_0099_F08.bBP446005 
LVR010099H04LVR01_0099_H04.bBP447516 
LVR010099H12LVR01_0099_H12.bBP448138 
LVR010100B01LVR01_0100_B01.bBP441929 
LVR010100B11LVR01_0100_B11.bBP442699 
LVR010100B12LVR01_0100_B12.bBP442774 
LVR010100C04LVR01_0100_C04.bBP443082 
LVR010100H08LVR01_0100_H08.bBP447825 
LVR010101B11LVR01_0101_B11.bBP442700 
LVR010101D03LVR01_0101_D03.bBP443901 
LVR010101D10LVR01_0101_D10.bBP444407 
LVR010101E11LVR01_0101_E11.bBP445340 
LVR010102D04LVR01_0102_D04.bBP443976 
LVR010102H10LVR01_0102_H10.bBP447984 
LVR010103C06LVR01_0103_C06.bBP443231 
LVR010103H07LVR01_0103_H07.bBP447753 
LVR010103H09LVR01_0103_H09.bBP447908 
LVR010104B12LVR01_0104_B12.bBP442777 
LVR010104G12LVR01_0104_G12.bBP447206 
LVR010104H10LVR01_0104_H10.bBP447986 
LVR010105D08LVR01_0105_D08.bBP444258 
LVR010105G06LVR01_0105_G06.bBP446761 
LVR010105H01LVR01_0105_H01.bBP447285 
LVR010106A12LVR01_0106_A12.bBP441859 
LVR010106B10LVR01_0106_B10.bBP442625 
LVR010106C05LVR01_0106_C05.bBP443160 
LVR010106G08LVR01_0106_G08.bBP446903 
LVR010106H05LVR01_0106_H05.bBP447599 
LVR010106H10LVR01_0106_H10.bBP447987 
TES010036F08TES01_0036_F08.bCJ032393 
TES010108F01TES01_0108_F01.bCJ037139 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
614A36000.843WNATA/I
G6700.157GTA/V
637A36800.838WSGTA/V
G7100.162GTG/V


Alignment:      TOP

20110601C-000796 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0081_E09.b : ggcatttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_E12.b : ggtccggcttttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_C01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_B03.b : gcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_E04.b : tagaagtcaatcacctaaaaatataaaagttggggtattaaca
LVR01_0035_D06.b : atatgatcagtctctaaacattcaaagggattggggtatgaagacg
LVR01_0042_C08.b : cttttggtggxxxxxxxxxxxxx
LVR01_0052_F09.b : gtgtttgttttttctgcatagtgxxxxxxxxx
LVR01_0089_G08.b : catttgggtgxxxxxxxxxxxxx
LVR01_0048_B12.b : gcggtttttttcttgcttggtgxxxxxxxxxxxxxx
LVR01_0047_B09.b : ggggtctttttttgcatagtgcxxxxxxxxxxxxx
LVR01_0068_D01.b : ctgtttgggcttcccggtttggtgxxxxxxxxxxxxxx
LVR01_0074_C05.b : gccxxxxxxxxxxxxxxxxxxx
LVR01_0100_C04.b : cxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_A05.b : ggttttttttttagcatagtgaaxxxxxxxxxxxxxx
LVR01_0015_F11.b : cxxxxxxxxxxxxxxxxxxxx
LVR01_0058_E09.b : cttttttggtgxxxxxxxxxxxxxx
LVR01_0016_G08.b : cattagagtgxxxxxxxxxxxxx
LVR01_0084_G07.b : gatxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F12.b : ggcattagggtgxxxxxxxxxxxx
LVR01_0099_F08.b : ccttagcgtgxxxxxxxxxxxxx
LVR01_0047_H12.b : ggtgtttttatttagcttagtgxxxxxxxxxxxx
LVR01_0016_F12.b : ggcattatgtgxxxxxxxxxxxxx
LVR01_0067_A04.b : cgcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_G01.b : ttcttcccgtcgtgactatanngacxx
LVR01_0081_A01.b : gtcatxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_B05.b : gccaxxxxxxxxxxxxxxxxxxxx
LVR01_0082_C06.b : gccxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_D12.b : ctttatggtgxxxxxxxxxxxxx
LVR01_0029_E01.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G07.b : ttttttggtgcacctattataaaxxxx
LVR01_0036_H03.b : tttttgggggaxxxxxxxxxxxxxx
LVR01_0095_A01.b : ggcttttagtgxxxxxxxxxxxxxx
LVR01_0031_E08.b : ttttgggggxxxxxxxxxxxxxx
LVR01_0036_H11.b : tttgggggxxxxxxxxxxxxxx
LVR01_0025_C07.b : ttgggggaacxxxxxxxxxxxx
LVR01_0040_E09.b : atttgggggxxxxxxxxxxxxx
LVR01_0095_E10.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_F04.b : ctttttgtgcacxxxxxxxxxxx
LVR01_0035_H03.b : tttttggggtgaactttaxxxxxxxxx
LVR01_0019_C09.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_C06.b : gccttttggtgxxxxxxxxxxxxx
LVR01_0052_B06.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_G07.b : gggggngggctttggtgcctatgagacxx
LVR01_0026_H06.b : atttagagtgcxxxxxxxxxxxxxxxxx
LVR01_0043_B08.b : gggtagggcttttgtgaxxxxxxxxxxxx
LVR01_0034_H07.b : cttttgggggcgggxxxxxxxxx
LVR01_0095_F12.b : gcttttggtgxxxxxxxxxxxxx
LVR01_0040_C11.b : gcttttggtgxxxxxxxxxxxxxx
LVR01_0095_F07.b : cttttggxxxxxxxxxxxxxxxxxx
LVR01_0025_G07.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_H09.b : ttggtttttagtgactataacxxxxxxx
LVR01_0030_E05.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_D10.b : tttggxxxxxxxxxxxxxxxxxxx
LVR01_0038_H11.b : cttttggtggxxxxxxxxxxxxxx
LVR01_0035_A12.b : cxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_E07.b : taggggaacxxxxxxxxxxxx
LVR01_0089_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_F09.b : txxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_C01.b : ggtctttangntgactatanngacxxx
LVR01_0033_H08.b : gctttatxxxxxxxxxxxxxxxxxxx
LVR01_0060_D08.b : gcxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D06.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C07.b : cttxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C06.b : ctttagggtgxxxxxxxxxxxxx
LVR01_0097_E06.b : catttxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D07.b : tttgggtgagtatatgaacxx
LVR01_0047_A04.b : gggggggttttcacgcatctgtgxxxxxxxxxxxx
LVR01_0038_F06.b : gcxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_A12.b : ttggggcttggtgcnxxxxxxxxxxx
LVR01_0016_F10.b : cxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F11.b : tctttggttgacxxxxxxxxxxx
LVR01_0087_C05.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_F01.b : ctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_C09.b : cttttagtgactxxxxxxxxxxx
LVR01_0054_C03.b : gctttatggtgxxxxxxxxxxxxx
LVR01_0040_C10.b : ctttttgttgxxxxxxxxxxxxxx
LVR01_0043_E05.b : cxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_A02.b : catttxxxxxxxxxxxxxxxxxx
LVR01_0034_D12.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_E01.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G08.b : ctttttggtgxxxxxxxxxxxxxx
LVR01_0014_G06.b : ctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_A11.b : tttggcttaggtgctxxxxxxxxxxxx
LVR01_0054_B01.b : tttttaattttatatcgcctcgtgxxxxxxxxxxx
LVR01_0095_F04.b : ccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B08.b : cttttggggcctxxxxxxxxxxxx
LVR01_0077_A05.b : ggtcattttgggtgxxxxxxxxxxxxx
LVR01_0102_H10.b : acxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E12.b : gttgcgctttggtgxxxxxxxxxxxxx
LVR01_0028_D12.b : cttatxxxxxxxxxxxxxxxxx
LVR01_0041_F06.b : cctttgggtgcctxxxxxxxxxxx
LVR01_0035_A09.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C02.b : ctttttttctcgcattagtgxxxxxxxxxxx
LVR01_0082_H12.b : gggcctttggtgxxxxxxxxxxxxxx
LVR01_0098_B05.b : gcttttatgctgacxxxxxxxxxxx
LVR01_0028_A10.b : gxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_C07.b : gggctnttttttggctttgtgxxxxxxxxxxxx
LVR01_0096_B02.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D09.b : ttttaggcattxxxxxxxxxxxxxxxxx
LVR01_0015_H06.b : cttttggtgxxxxxxxxxxxxxx
LVR01_0034_B12.b : ggcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_G12.b : ttttctagctttggtgxxxxxxxxxxxx
LVR01_0053_C12.b : gctttttgtgxxxxxxxxxxxxx
LVR01_0081_A12.b : gcccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_G12.b : tttttagcttagtgxxxxxxxxxxxx
LVR01_0015_C03.b : gctxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_H10.b : gggctttggtgxxxxxxxxxxxxx
LVR01_0105_D08.b : ctttttgttgcxxxxxxxxxxxx
LVR01_0047_D07.b : ggtgtgttttttagcatggtgxxxxxxxxxxxx
LVR01_0066_H08.b : gagcaxxxxxxxxxxxxxxxxxxxx
LVR01_0005_D01.b : ggcatttggtgxxxxxxxxxxxxx
LVR01_0028_C11.b : ttttcgtgxxxxxxxxxxxxxx
LVR01_0004_D05.b : tttgggtgxxxxxxxxxxxxx
LVR01_0086_G05.b : gcatttggtgxxxxxxxxxxxxx
LVR01_0012_F06.b : gggctgagcattagtgxxxxxxxxxxxx
LVR01_0045_G10.b : ctxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_E11.b : gcatttggctgxxxxxxxxxxxxxx
LVR01_0013_G08.b : ccxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_H10.b : gactxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_C02.b : gcattaagtgxxxxxxxxxxxxx
LVR01_0041_F04.b : ttttttggcttaxxxxxxxxxxxxxxx
LVR01_0033_C06.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_C12.b : tttggctcccnxxxxxxxxxx
LVR01_0061_E09.b : tttttttagcatttgtgxxxxxxxxxxxx
LVR01_0047_G05.b : gggggtcttcgaggctagtgxxxxxxxxxxxx
LVR01_0014_H06.b : ctttctcaagcttagtgxxxxxxxxxxxx
LVR01_0055_A10.b : tgtggttcaatttggtgxxxxxxxxxxxx
LVR01_0015_F03.b : ttgcgctttggtgxxxxxxxxxxxxx
LVR01_0082_E12.b : gcatxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E03.b : tgggcttttgtgxxxxxxxxxxxx
LVR01_0040_H11.b : gcattttagtccnxxxxxxxxxxx
LVR01_0074_C10.b : ttttttttttttagcttggtgxxxxxxxxxxxxx
LVR01_0081_D12.b : ggctttttggctgxxxxxxxxxxxxxx
LVR01_0002_H09.b : ttttcgtgacctanntagacxx
LVR01_0004_D10.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B05.b : ccctttggctgxxxxxxxxxxxxx
LVR01_0031_E02.b : cttatggtgxxxxxxxxxxxxxx
LVR01_0091_F10.b : ccatttggctgxxxxxxxxxxxxx
LVR01_0005_H12.b : ggcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_C04.b : tttxxxxxxxxxxxxxxxxxx
LVR01_0050_B09.b : ttgtgtttttttttggcattagtgxxxxxxxxxxx
LVR01_0039_B11.b : ttttggggcttggtgxxxxxxxxxxxx
LVR01_0089_C11.b : ggcattaggtgcxxxxxxxxxxxxx
LVR01_0095_B04.b : gcatxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_A02.b : cgcaxxxxxxxxxxxxxxxxxxxx
LVR01_0082_B11.b : gtcttttagggtgxxxxxxxxxxxxxx
LVR01_0003_E10.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G11.b : ttttttttagcttggtgxxxxxxxxxxxxx
LVR01_0074_H05.b : ggcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_D06.b : catttggtggxxxxxxxxxxxxx
LVR01_0013_H03.b : ttttagccgcatggtgxxxxxxxxxxxx
LVR01_0009_A02.b : gaagatctcngtgxxxxxxxxxxxx
LVR01_0088_E08.b : gctttaggctgxxxxxxxxxxxxx
LVR01_0014_B03.b : ccxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_E07.b : gcatttagggtgactactagxxxxxx
LVR01_0031_H04.b : ctxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_E07.b : ccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_G07.b : gggtgtttttgcagcttagtgactxxxxxxxxx
LVR01_0043_F03.b : ggggcaxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_H09.b : gttataggcttaxxxxxxxxxxxxxxx
LVR01_0049_G03.b : gggggggnnntcgggcttggtgxxxxxxxxxxxx
LVR01_0014_H11.b : tttttttttagcttxxxxxxxxxxxxxxxx
LVR01_0040_F12.b : cacccaagcattgtgacntatagacxxx
LVR01_0004_F10.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G01.b : ggttttctttcttgcttcgtgcxxxxxxxxxxx
LVR01_0104_G12.b : ggtttttcttgcattagtgxxxxxxxxxxx
LVR01_0003_B10.b : ttatcgtgacctanntagacxx
LVR01_0047_B08.b : ggggttttttgggctagtgxxxxxxxxxxxx
LVR01_0043_D10.b : gctttaggtgagxxxxxxxxxxx
LVR01_0050_A12.b : gcaggtttttgtttcgcattagtgxxxxxxxxxxx
LVR01_0090_D12.b : gggcatttggtgxxxxxxxxxxxxx
LVR01_0089_G07.b : gcaxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_B02.b : ggcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_C08.b : xxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_G08.b : atacaaagcttxxxxxxxxxxxxxxxx
LVR01_0056_H06.b : gagcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B11.b : cgctttttggtgactatanngacxxx
LVR01_0022_G06.b : cccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_F06.b : ttttggtggcxxxxxxxxxxxx
LVR01_0008_E09.b : catttcgtgxxxxxxxxxxxxx
LVR01_0020_B05.b : cttttggtgcaxxxxxxxxxxx
LVR01_0028_H03.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_D09.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_B04.b : gccxxxxxxxxxxxxxxxxxxxx
LVR01_0020_D02.b : ccttttggtgxxxxxxxxxxxxx
LVR01_0043_G11.b : gcatttggtgxxxxxxxxxxxxx
LVR01_0081_B07.b : gctttttcgtgccnxxxxxxxxxxxx
LVR01_0063_C09.b : tttttttttagcttxxxxxxxxxxxxxxxxx
LVR01_0065_E05.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B08.b : ctttaagcattggtgxxxxxxxxxxxx
LVR01_0015_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F10.b : cctxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_H09.b : ttaaaatttgcatagtgxxxxxxxxxxxx
LVR01_0074_D11.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_D04.b : ggggtttttttttggcttagtgxxxxxxxxxxxxx
LVR01_0057_D02.b : gctgttggtcgxxxxxxxxxxxxx
LVR01_0106_C05.b : ccttatgggtgxxxxxxxxxxxxx
LVR01_0040_H03.b : gcttttgcgccnxxxxxxxxxxx
LVR01_0001_G10.b : tttxxxxxxxxxxxxxxxxxx
LVR01_0040_D01.b : ggggctaggcttggtgactagtagacxxx
LVR01_0084_H02.b : ggggcaxxxxxxxxxxxxxxxxxxx
LVR01_0089_F03.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G09.b : ccttttggctgacxxxxxxxxxxxx
LVR01_0096_E01.b : gcctttatgtgaaxxxxxxxxxxxx
LVR01_0002_D04.b : tttggtggxxxxxxxxxxxxx
LVR01_0029_C03.b : xxxxxxxxxxxxxxxxxxxxx
LVR01_0049_G10.b : gggggttttttttggcattgtgxxxxxxxxxxxxx
LVR01_0084_F10.b : gcaxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D10.b : gtgtaggcattggtgxxxxxxxxxxxx
LVR01_0013_A10.b : ggcttttcxxxxxxxxxxxxxxxx
LVR01_0014_H04.b : gccxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_C04.b : cttttagggtgxxxxxxxxxxxxx
LVR01_0044_D05.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G09.b : cttttatgtgxxxxxxxxxxxxxx
LVR01_0045_E03.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B07.b : cttxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F11.b : ccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_G10.b : ctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_G11.b : catttxxxxxxxxxxxxxxxxxx
LVR01_0084_D08.b : ctttggatgxxxxxxxxxxxxxx
LVR01_0085_H03.b : gcataagcgccnxxxxxxxxxxx
LVR01_0012_F03.b : gggttaagctttxxxxxxxxxxxxxxx
LVR01_0037_C01.b : gcatttggtgxxxxxxxxxxxxxxx
LVR01_0058_H08.b : gctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_A05.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_F02.b : cctattggtgxxxxxxxxxxxxxx
LVR01_0089_G03.b : ccttagggtgxxxxxxxxxxxxxx
LVR01_0091_A01.b : ggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_H01.b : gcattaggtgcxxxxxxxxxxxxx
LVR01_0105_G06.b : cttttggcgccxxxxxxxxxxxxx
LVR01_0049_D11.b : gttttttttttatagcttggtgxxxxxxxxxxxxx
LVR01_0044_E01.b : ggcnaacctgcttggtgcactgtagacxx
LVR01_0011_G07.b : ggggggggctttgtgxxxxxxxxxxxxx
LVR01_0091_H07.b : ggcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_B12.b : gccttatggtccnxxxxxxxxxxxx
LVR01_0017_H08.b : gcttatgggtgxxxxxxxxxxxxxx
LVR01_0022_B12.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A12.b : agcttatcgtgxxxxxxxxxxxxxx
LVR01_0071_C09.b : ccatttgcgtgxxxxxxxxxxxxxx
LVR01_0074_G10.b : ctxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_F12.b : ggcattaggtgcxxxxxxxxxxxxx
LVR01_0101_D10.b : ccxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D03.b : gcatttggtgxxxxxxxxxxxxxx
LVR01_0017_D08.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_H09.b : gggcttttagtgcxxxxxxxxxxxxx
LVR01_0096_H11.b : ggccatttggtgxxxxxxxxxxxxxx
LVR01_0034_G10.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G12.b : gcatttcgtgccnxxxxxxxxxxxx
LVR01_0067_E04.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_D12.b : ggcctttggttctxxxxxxxxxxxx
LVR01_0093_E01.b : gcctttggctgxxxxxxxxxxxxxx
LVR01_0097_E01.b : ggcaxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_C10.b : ggagcattcgtgcnxxxxxxxxxxx
LVR01_0102_D04.b : actttttggtggxxxxxxxxxxxxx
LVR01_0098_F01.b : ggctattggtgxxxxxxxxxxxxx
LVR01_0099_D05.b : catttxxxxxxxxxxxxxxxxxxx
LVR01_0034_E02.b : cttttagtgcactcactagacxx
LVR01_0054_D02.b : ccaxxxxxxxxxxxxxxxxxxxx
LVR01_0086_B07.b : tttatxxxxxxxxxxxxxxxxx
LVR01_0097_E05.b : ccttttatggtccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_C05.b : gggtcggcattxxxxxxxxxxxxxxxx
LVR01_0077_G04.b : gcctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_F12.b : gccxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_A03.b : gcctctcgcgccnxxxxxxxxxxxx
LVR01_0046_F07.b : gccttttgctgxxxxxxxxxxxxx
LVR01_0050_G12.b : ggcaxxxxxxxxxxxxxxxxxxxx
LVR01_0091_F12.b : ggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_C09.b : gctttttggtccgtatagtatcxx
LVR01_0050_F08.b : ggggttttttttaagcatagtgxxxxxxxxxxxxx
LVR01_0063_F10.b : tgtttttcatagcttagtgxxxxxxxxxxxx
LVR01_0062_G03.b : gcctaggggcataggtgxxxxxxxxxxxx
LVR01_0045_A05.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D05.b : gcttttgcgtgxxxxxxxxxxxxxx
LVR01_0078_D10.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F04.b : cctxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A07.b : gaggcaatcgtgxxxxxxxxxxxxx
LVR01_0097_F09.b : cctxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H07.b : gctttggtgxxxxxxxxxxxxxx
LVR01_0050_F07.b : gggggctcntttcgcttagtgxxxxxxxxxxxxx
LVR01_0079_E08.b : cctttttgggtggxxxxxxxxxxxxxx
LVR01_0040_D02.b : gggggagcattggtgctxxxxxxxxxx
LVR01_0074_D04.b : cctxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_D07.b : ggggttttttttagcttggtgxxxxxxxxxxxxx
LVR01_0049_B07.b : ggggttttgttttagcatagtgxxxxxxxxxxxx
LVR01_0063_F02.b : ctttttttcagcttagtgxxxxxxxxxxxx
LVR01_0061_H10.b : tggtctagcattxxxxxxxxxxxxxxxx
LVR01_0093_G01.b : ttttgaagcaxxxxxxxxxxxxxxxxxx
LVR01_0071_A03.b : tttcccttttatcgcttxxxxxxxxxxxxxxxx
LVR01_0042_G12.b : acaaaacttgcttagtgacntatagacxx
LVR01_0026_B01.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E04.b : gggtttttttttggcatagtgxxxxxxxxxxxxxxx
LVR01_0071_E08.b : tttttttttttcagcttggtgxxxxxxxxxxxx
LVR01_0095_A12.b : gcccctcctctgctttgtgacntatagacxxx
LVR01_0049_D02.b : cggtgttttatacggctttagtgxxxxxxxxxxxx
LVR01_0048_E05.b : gtgggttttttttagcattgtgxxxxxxxxxxxx
LVR01_0017_F06.b : ctttatggtgxxxxxxxxxxxxx
LVR01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A09.b : gttgtttttttttcgcttggtgxxxxxxxxxxxxx
LVR01_0051_C07.b : ggggtttttttttggcttagtgxxxxxxxxxxxx
LVR01_0014_A03.b : tttacgcggcttagtgxxxxxxxxxxxxx
LVR01_0005_A10.b : gagctttxxxxxxxxxxxxxxxxx
LVR01_0021_A07.b : ctxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A04.b : cttttggtgacctanntagacxx
LVR01_0004_H12.b : gcaaatcgtgxxxxxxxxxxxxxx
LVR01_0033_E04.b : gattttgtxxxxxxxxxxxxxxxx
LVR01_0091_F05.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H05.b : ggcattaggtccnxxxxxxxxxxx
LVR01_0092_H06.b : gactttggagccnxxxxxxxxxxx
LVR01_0099_E02.b : catttxxxxxxxxxxxxxxxxxxx
LVR01_0047_G03.b : gggcgccctaccagcttggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_G02.b : ggggggggtttttttagcatagtgxxxxxxxxxxxxx
LVR01_0003_A03.b : gatactxxxxxxxxxxxxxxxxxxx
LVR01_0009_B03.b : ggggcttttgtgantatanngacxx
LVR01_0097_A12.b : ggcaxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_D07.b : cttttcxxxxxxxxxxxxxxxx
LVR01_0073_B12.b : gttcttattttaaaagcttagtgxxxxxxxxxxxxx
LVR01_0039_B04.b : tctgaagcttaxxxxxxxxxxxxxxx
LVR01_0045_F04.b : ccxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F02.b : ttttgttagcttggtgxxxxxxxxxxx
LVR01_0028_F05.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_B03.b : tgttacatgccatgtgxxxxxxxxxxxx
LVR01_0090_B10.b : gccatttcgtgaaxxxxxxxxxxxx
LVR01_0087_B04.b : gcttttcgtgxxxxxxxxxxxxx
LVR01_0106_H05.b : ggtggcncccgcttagtgxxxxxxxxxxxx
LVR01_0103_H07.b : gtttcctttgctttagtgxxxxxxxxxxxx
LVR01_0034_E01.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_G12.b : ggcatttngtgxxxxxxxxxxxxxx
LVR01_0083_F08.b : ctxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C08.b : ccxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_E02.b : tttttcgtggcctatanngacxx
LVR01_0095_A07.b : cgtttttttaggcttagtgcxxxxxxxxxxxx
LVR01_0105_H01.b : ggtgactttagcatggtgxxxxxxxxxxxx
LVR01_0072_D04.b : gcctttgggtgxxxxxxxxxxxxx
LVR01_0103_C06.b : ggttttatttgggttxxxxxxxxxxxxxxxx
LVR01_0005_F12.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_F08.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B05.b : ccttttggtggxxxxxxxxxxxxx
LVR01_0101_E11.b : ccatttcgtgxxxxxxxxxxxxxx
LVR01_0017_G11.b : cccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A11.b : gcatttggtgcaaxxxxxxxxxxxx
LVR01_0056_G04.b : catttatggtgxxxxxxxxxxxxxx
LVR01_0057_A09.b : ggggctttggtgxxxxxxxxxxxxx
LVR01_0067_F06.b : gcctattggtgxxxxxxxxxxxxxx
LVR01_0073_B03.b : gctaxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_F02.b : gggcatagxxxxxxxxxxxxxxxxx
LVR01_0018_H06.b : ccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_H10.b : ggctttagggggcttagtgxxxxxxxxxxxxx
LVR01_0013_A05.b : gttaaaaagcattgtgxxxxxxxxxxxx
LVR01_0061_H05.b : tcggccagcattaxxxxxxxxxxxxxxx
LVR01_0099_A02.b : ttttgtgtttttttaagaacgggxxxxxxxxxxxxxxx
LVR01_0060_F04.b : caggccagctttcgtgxxxxxxxxxxxxx
LVR01_0104_H10.b : gtttaaactagcaatxxxxxxxxxxxxxxx
LVR01_0067_H02.b : gattttaaattaaatagcttagtgxxxxxxxxxxxx
LVR01_0002_H03.b : tttacgtgacctanntagacxx
LVR01_0052_H11.b : tgttttgtttttttcggttcxxxxxxxxxxxxxxxx
LVR01_0059_B03.b : gttaccagcttttxxxxxxxxxxxxxxx
LVR01_0059_E02.b : tttagggcatttxxxxxxxxxxxxxxx
LVR01_0060_B01.b : gcatgtacxxxxxxxxxxxxxxxx
LVR01_0021_C01.b : tttttaacagctttgtgxxxxxxxxxxxx
LVR01_0081_F07.b : gacxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F05.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_G04.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_H10.b : cttctgttttaaaccgcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_A02.b : gtaaacaagcttttgtgxxxxxxxxxxxx
LVR01_0100_B12.b : cgcatttcgtgxxxxxxxxxxxxx
LVR01_0085_A10.b : ggcxxxxxxxxxxxxxxxxxxxx
LVR01_0097_D02.b : cgctttnaaaggattagtgxxxxxxxxxxxx
LVR01_0067_G05.b : gccxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D04.b : gctttxxxxxxxxxxxxxxxxxx
LVR01_0092_H02.b : aaccaagctttxxxxxxxxxxxxxxxx
LVR01_0017_H12.b : gggggcattxxxxxxxxxxxxxxxxx
LVR01_0099_H04.b : gctcxxxxxxxxxxxxxxxxxxxx
LVR01_0060_G03.b : atagtaagcattxxxxxxxxxxxxxxxx
LVR01_0056_A09.b : ttttcagctttggtgxxxxxxxxxxxx
LVR01_0029_G04.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A03.b : cattatggtgcxxxxxxxxxxxx
LVR01_0078_A04.b : ttttttttttttaccgcctggtgxxxxxxxxxxxxx
LVR01_0017_G04.b : gcaxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A08.b : gagcacacxxxxxxxxxxxxxxxxx
LVR01_0076_C03.b : ccxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_B09.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_B06.b : gtttttcttgagcatagtgxxxxxxxxxxxxx
LVR01_0009_F04.b : ctttttcgtgcxxxxxxxxxxxx
LVR01_0045_H02.b : gcatttngtgxxxxxxxxxxxxxx
LVR01_0057_G03.b : gctxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_G01.b : gcggcattggtgxxxxxxxxxxxxx
LVR01_0099_H12.b : ttagctttggtgxxxxxxxxxxxxx
LVR01_0046_F01.b : gagggtttttgcttagtgactggtagacxx
LVR01_0101_B11.b : tgtgggcattcgtgxxxxxxxxxxxx
LVR01_0002_B01.b : tctacxxxxxxxxxxxxxxxxx
LVR01_0067_F01.b : ttttttggttttttcagcatagtgxxxxxxxxxxxxx
LVR01_0067_G02.b : gtattgggggttccccgcttagtgxxxxxxxxxxxxx
LVR01_0012_F11.b : ggtttgggcattggtgxxxxxxxxxxxx
LVR01_0065_A12.b : ttttttagctctggtgcnxxxxxxxxxx
LVR01_0091_H01.b : ttttaagcattxxxxxxxxxxxxxxxxx
LVR01_0058_B11.b : gcatttggctgxxxxxxxxxxxxx
LVR01_0094_B03.b : gcatttggcgccnxxxxxxxxxxx
LVR01_0100_B01.b : ggcttttagtgxxxxxxxxxxxxx
LVR01_0086_A03.b : gcatttggtgxxxxxxxxxxxxx
LVR01_0042_H11.b : tttttttggcttagtgcxxxxxxxxxxx
LVR01_0011_B06.b : gggttaagcttggtgxxxxxxxxxxxx
LVR01_0031_A02.b : ctaxxxxxxxxxxxxxxxxxxxx
LVR01_0060_A03.b : taaaacagctttxxxxxxxxxxxxxxxx
LVR01_0050_A07.b : gtgtggttttttcaggaaagtgxxxxxxxxxxxx
LVR01_0065_A01.b : taaatcagcttttgtgxxxxxxxxxxxx
LVR01_0019_A02.b : attattaggcttagtgcxxxxxxxxxxxxxx
LVR01_0058_A03.b : tggcggctttggtgxxxxxxxxxxxxx
LVR01_0062_B09.b : ttttaccagcttagtgxxxxxxxxxxxx
LVR01_0062_G12.b : tttttttagcattcgtgxxxxxxxxxxxxx
LVR01_0043_C03.b : gttactaaggcttxxxxxxxxxxxxxxxx
LVR01_0072_B06.b : gctttgttttttcctgcttggtgxxxxxxxxxxxxx
LVR01_0013_B01.b : ttaaaagaggctatxxxxxxxxxxxxxxx
LVR01_0056_C04.b : ccxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H01.b : gggggaaaggcattgtgactagtagacxxx
LVR01_0098_A07.b : ggtttttttcccgcattgtgcxxxxxxxxxxxx
LVR01_0056_B04.b : gcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_B05.b : ttttttaggcatttxxxxxxxxxxxxxxx
LVR01_0047_A05.b : ggggttttgtgtagcatggtgxxxxxxxxxxxxx
LVR01_0029_G08.b : ttagggggaactxxxxxxxxxx
LVR01_0036_A12.b : ctxxxxxxxxxxxxxxxxxxx
LVR01_0041_D06.b : gcxxxxxxxxxxxxxxxxxxxx
LVR01_0043_B11.b : tttttttagcatttgtgxxxxxxxxx
LVR01_0078_A01.b : ggtcxxxxxxxxxxxxxxxxxxx
LVR01_0020_D06.b : cttttggtgccxxxxxxxxxxxx
LVR01_0093_E02.b : ctttttxxxxxxxxxxxxxxx
LVR01_0076_E08.b : cttttatggtgxxxxxxxxxx
LVR01_0100_H08.b : gctcxxxxxxxxxxxxxxxxxx
LVR01_0087_F05.b : cttxxxxxxxxxxxxxxxxxxx
LVR01_0065_G01.b : tcctcgtgtagcttagtgxxxxxxxxxxx
LVR01_0026_A08.b : tttagggtgxxxxxxxxxxx
LVR01_0063_D09.b : cctttatxxxxxxxxxxxxxx
LVR01_0072_A12.b : gctaaaaaaaaaaaagcttagtgxxxxxxxxx
LVR01_0055_G04.b : cccttttggtgxxxxxxxxxxx
LVR01_0033_D08.b : txxxxxxxxxxxxxxxxxxx
LVR01_0004_F11.b : tttacggtgxxxxxxxxxx
LVR01_0028_G02.b : agcxxxxxxxxxxxxxxxxxx
LVR01_0034_F03.b : ccxxxxxxxxxxxxxxxxxxxx
LVR01_0089_H09.b : cgggctttxxxxxxxxxxxxxx
LVR01_0095_B07.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0055_G02.b : tttttaagcttagtgxxxxxxxxx
LVR01_0106_B10.b : gcgttaaactagcatagtgacntatagac
LVR01_0091_H09.b : gccxxxxxxxxxxxxxxxxxx
LVR01_0061_C07.b : tcttagagcttagtgxxxxxxxxx
LVR01_0067_D01.b : ggcxxxxxxxxxxxxxxxxxxx
LVR01_0072_A10.b : ttttttttttttattgcttggtgxxxxxxxxx
LVR01_0037_A01.b : caxxxxxxxxxxxxxxxxxx
LVR01_0099_B07.b : ggagcctccgtgcxxxxxxxxx
LVR01_0097_A10.b : tggttttattacagcttcgtgxxxxxxxxx
LVR01_0036_G03.b :
LVR01_0048_A06.b :
LVR01_0094_H11.b :
LVR01_0093_G04.b :
LVR01_0054_E10.b :
LVR01_0016_B08.b :
LVR01_0065_B09.b :
LVR01_0029_C12.b :
LVR01_0030_C02.b :
TES01_0108_F01.b :
TES01_0036_F08.b :
LVR01_0104_B12.b :
20110601C-000796 : .............................................TTGTTGGCCTACTGG
---------+---------+---------+---------+---------+---------+ 15
LVR01_0081_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTTGGCCTACTGG
LVR01_0056_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCCTACTGG
LVR01_0022_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttGGCCTACTGG
LVR01_0081_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCTACTGG
LVR01_0035_E04.b : aaatgtaaaaaaaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccttCTACTGG
LVR01_0035_D06.b : ctgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccttttTACTGG
LVR01_0042_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtaacgCTGG
LVR01_0052_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVR01_0089_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVR01_0048_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGG
LVR01_0047_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
LVR01_0068_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0074_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtG
LVR01_0100_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0048_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgC
LVR01_0015_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVR01_0016_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVR01_0071_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVR01_0058_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_G03.b : caaccttcgccccttgtcctactcgtgagca
LVR01_0048_A06.b : ggggttttttctaagcttggtgcxx
LVR01_0094_H11.b : cgcattttg
LVR01_0093_G04.b : ctxxxxxx
LVR01_0054_E10.b : cxxxxxxxx
LVR01_0016_B08.b : ctttatgg
LVR01_0065_B09.b : tataaggcattt
LVR01_0029_C12.b :
LVR01_0030_C02.b :
TES01_0108_F01.b :
TES01_0036_F08.b :
LVR01_0104_B12.b :
20110601C-000796 : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
---------+---------+---------+---------+---------+---------+ 75
LVR01_0081_E09.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_E12.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0022_C01.b : AGCACTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_B03.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0035_E04.b : AGCATTGCGGGCAAGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0035_D06.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0042_C08.b : AGCATTGCGGGCAGGTGGTGGCTCTGGC*CCTCTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0052_F09.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGCCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_G08.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_B12.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_B09.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0068_D01.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_C05.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0100_C04.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_A05.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_F11.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_E09.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0016_G08.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0084_G07.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0079_F12.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_F08.b : AGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_H12.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0016_F12.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_A04.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0001_G01.b : AGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_A01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_B05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0082_C06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0037_D12.b : xTCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCACA
LVR01_0029_E01.b : xGCATTGCCGGGAGGCTGCGGCTCTGGGTCCTCTCTTCGCGTCCCGCTCTGCGAGGCAGA
LVR01_0044_G07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCC*CTCTGCGCCTCCCGCTCTGCGAGGCAGA
LVR01_0036_H03.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_A01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_E08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0036_H11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0025_C07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_E09.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_E10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0093_F04.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0035_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0019_C09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0052_C06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0052_B06.b : xGCATTGCGGGCAGGCGGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_G07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0026_H06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_B08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCATA
LVR01_0034_H07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_F12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_C11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_F07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0025_G07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0037_H09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCATA
LVR01_0030_E05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0029_D10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0038_H11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0035_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCCCATCCCGCTCTGCGAGGCAGA
LVR01_0025_E07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_D11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0096_F09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0077_C01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_H08.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0060_D08.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0054_D06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0094_C07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_C06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_E06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0003_D07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_A04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0038_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0016_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_F11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_C05.b : xGCACTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_F01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_C09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0054_C03.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_C10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_E05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0036_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_D12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0036_E01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_G08.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_G06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0066_A11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0054_B01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_F04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0038_B08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0077_A05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0102_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_E12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_D12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0041_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0035_A09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_C02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0082_H12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0098_B05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCCGCGAGGCATA
LVR01_0028_A10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0077_C07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0096_B02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_D09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_H06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_B12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0039_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0053_C12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_C03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0105_D08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_D07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0066_H08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0005_D01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_C11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_D05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0086_G05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0012_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_G10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_E11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_G08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_C02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0041_F04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_C06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_C12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0061_E09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_G05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_H06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0055_A10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_F03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0082_E12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_E03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_H11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_C10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_D12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0002_H09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_D10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_B05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_E02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0005_H12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTACGAGGCAGA
LVR01_0029_C04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_B09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0039_B11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_C11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_B04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0082_B11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0003_E10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0044_G11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_H05.b : xGCATTGCGGGCTGGCAGCGGCTCTGGGTCTCCTCTCCGCATCCCGCTCTGCGAGGCAGA
LVR01_0038_D06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0009_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0088_E08.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0068_E07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_H04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0073_E07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0049_G07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_F03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_H09.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAG****A
LVR01_0049_G03.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_H11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_F12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_G01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0104_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0003_B10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_B08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_D10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0090_D12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_G07.b : xGCATTGCGGGCGGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0073_B02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCTAGGCAGA
LVR01_0015_C08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_G08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_H06.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGTATCCCGCTCTGCGAGGCAGA
LVR01_0100_B11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0022_G06.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0002_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0008_E09.b : xGCGTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0020_B05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0009_D09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_B04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0020_D02.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_G11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_B07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0063_C09.b : xGCATTTCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_E05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_B08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_D06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0062_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0103_H09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_D11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_D04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0057_D02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_C05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCGCTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0001_G10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_D01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0084_H02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_F03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_G09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0096_E01.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0002_D04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0029_C03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0049_G10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0084_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_D10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_A10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCGGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_H04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0038_C04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0044_D05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0044_G09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_E03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0054_B07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_F11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_G10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_G11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0084_D08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0085_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0012_F03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0037_C01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_H08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0015_A05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_F02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_G03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_A01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_H01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0105_G06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0049_D11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0044_E01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_G07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_H07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_B12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_H08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0022_B12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0071_C09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_G10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0088_F12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0101_D10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0101_D03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_D08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_F08.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0090_H09.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0096_H11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_G10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0044_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_E04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_D12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCCCTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0093_E01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_E01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_C10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0102_D04.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0098_F01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTTTGCGAGGCAGA
LVR01_0099_D05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_E02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0054_D02.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0086_B07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_E05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_C05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0077_G04.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_F12.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0046_F07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_F12.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0092_C09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_F08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0063_F10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0062_G03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_A05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0072_D05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0078_D10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_F04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_A07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_F09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_H07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_F07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0079_E08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0040_D02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_D04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_D07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0049_B07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0063_F02.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0061_H10.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0093_G01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0071_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0042_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACCCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0026_B01.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_E04.b : tGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0071_E08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0049_D02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCACATCCCGCTCTGCGAGGCAGA
LVR01_0048_E05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_H01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0071_A09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0051_C07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0014_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0005_A10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAG****A
LVR01_0021_A07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_A04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_H12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_E04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_F05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_H05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0092_H06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_E02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_G03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0076_G02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0003_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0009_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_A12.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0008_D07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0073_B12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0039_B04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_F04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0066_F02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_F05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0090_B10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_B04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_H05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0103_H07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0034_E01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAG****A
LVR01_0066_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0083_F08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_C08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_E02.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_A07.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0105_H01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0072_D04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0103_C06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0005_F12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0021_F08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0046_B05.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0101_E11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_G11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_A11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_G04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0057_A09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_F06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0073_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0085_F02.b : gGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0018_H06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_A05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0061_H05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0060_F04.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0104_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_H02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0002_H03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0052_H11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0059_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0059_E02.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0060_B01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0021_C01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0081_F07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0066_F05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0074_G04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_H10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0061_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0100_B12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0085_A10.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_D02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_G05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_D04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0092_H02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_H12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_H04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0060_G03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_A09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCCCTGCGAGGCAGA
LVR01_0029_G04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCA*CCCGCTCTGCGAGGCAGA
LVR01_0031_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0078_A04.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0017_G04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_A08.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCTCATCCCGCTCTGCGAGGCAGA
LVR01_0076_C03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_B09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0096_B06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0009_F04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_H02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0057_G03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0088_G01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_H12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0046_F01.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0101_B11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0002_B01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_F01.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_G02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0012_F11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_A12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCGCTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_H01.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_B11.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0094_B03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0100_B01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0086_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0042_H11.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0011_B06.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0031_A02.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0060_A03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0050_A07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_A01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0019_A02.b : tGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0058_A03.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0062_B09.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0062_G12.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_C03.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0072_B06.b : xGCATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0013_B01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_C04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0045_H01.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0098_A07.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0056_B04.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0062_B05.b : xGCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0047_A05.b : xxCATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0029_G08.b : xxGATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0036_A12.b : xxGATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0041_D06.b : xxGATTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0043_B11.b : xxxATTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0078_A01.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0020_D06.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0093_E02.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0076_E08.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0100_H08.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0087_F05.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0065_G01.b : xxxtTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0026_A08.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0063_D09.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0072_A12.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0055_G04.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0033_D08.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0004_F11.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0028_G02.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAG****A
LVR01_0034_F03.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0089_H09.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0095_B07.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0055_G02.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0106_B10.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0091_H09.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0061_C07.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0067_D01.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0072_A10.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0037_A01.b : xxxxTTGCGGGCAGGTGGTGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0099_B07.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0097_A10.b : xxxxTTGCGGGCAGGCAGCGGCTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0036_G03.b : tttgctgggcaggttggtggctTCTGGGTCCACTCAGCGCATCCCGCTCTGCGAGGCAGA
LVR01_0048_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_H11.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_B08.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_C12.b : txxxxxxxxxxxxxxxxxxxxx
LVR01_0030_C02.b :
TES01_0108_F01.b :
TES01_0036_F08.b :
LVR01_0104_B12.b :
20110601C-000796 : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
---------+---------+---------+---------+---------+---------+ 134
LVR01_0081_E09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_E12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0022_C01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0035_E04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0035_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0042_C08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0052_F09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_B09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0068_D01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_C05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0100_C04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_A05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_F11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_E09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0016_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0084_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0079_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_F08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0016_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_A04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0001_G01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0082_C06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0037_D12.b : CATGAGGGTGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_E01.b : CATGAGGGCTGATGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_H03.b : CATGAGGGCGGGGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_E08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0025_C07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_E09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_E10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0093_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0035_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0019_C09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0052_C06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0052_B06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0026_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_B08.b : CATGAAGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_H07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_C11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_F07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0025_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0037_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTG**CTCT
LVR01_0030_E05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0038_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0035_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0025_E07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_D11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0096_F09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0077_C01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_H08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0060_D08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0054_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0094_C07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_C06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_E06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0003_D07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_A04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0038_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0016_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_F11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_C05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_F01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_C09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0054_C03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_C10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_E05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_D12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_G06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0066_A11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0054_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0038_B08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0077_A05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0102_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_E12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_D12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0041_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0035_A09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_C02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0082_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0098_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0077_C07.b : CATGGGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0096_B02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_D09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0039_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0053_C12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_C03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0105_D08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_D07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0066_H08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0005_D01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_C11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_D05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0086_G05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0012_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_G10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_E11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_C02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0041_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_C06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_C12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0061_E09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_G05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0055_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_F03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0082_E12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_E03.b : CATGAGGGCGGAAGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_C10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_D12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0002_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0005_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_C04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_B09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0039_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_C11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_B04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_A02.b : CATGAAGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0082_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCCCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0003_E10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_G11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_H05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0038_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0009_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0088_E08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0068_E07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_H04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0073_E07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_F03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_G01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0104_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0003_B10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_B08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0090_D12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0073_B02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_C08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0100_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0022_G06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0002_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0008_E09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0020_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTAGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0009_D09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_B04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0020_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_G11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0063_C09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_E05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_B08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0062_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0103_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_D11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0057_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_C05.b : CACGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0001_G10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_D01.b : CATGAGGGCGGAGGGAATGTCCCTTTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0084_H02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_F03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_G09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0096_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0002_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_C03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_G10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0084_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_H04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0038_C04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_D05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_G09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_E03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0054_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_F11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_G10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_G11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCCCCTG*GTGGCTGGGCTCT
LVR01_0084_D08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0085_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0012_F03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0037_C01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_H08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0015_A05.b : CATGAGGGCGGAGGGGATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_F02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_H01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0105_G06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_D11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_G07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_H07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_H08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0022_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0071_C09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_G10.b : CACGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0088_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0101_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0101_D03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_D08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_F08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0090_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0096_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_G10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0044_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_E04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_D12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0093_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_C10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0102_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0098_F01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_D05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0054_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0086_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_E05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_C05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0077_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0046_F07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0092_C09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTGT
LVR01_0050_F08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0063_F10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0062_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_A05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0072_D05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0078_D10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_A07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_F09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_H07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_F07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0079_E08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0040_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_D07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0063_F02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0061_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0093_G01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0071_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0042_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0026_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_E04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0071_E08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0049_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_E05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_H01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0071_A09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0051_C07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0014_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0005_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0021_A07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_A04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_E04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_F05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_H05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0092_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0076_G02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0003_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0009_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0008_D07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0073_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0039_B04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0066_F02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_F05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0090_B10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_B04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_H05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0103_H07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_E01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0066_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0083_F08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_C08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_A07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0105_H01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0072_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0103_C06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0005_F12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0021_F08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0046_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0101_E11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_G11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_A11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0057_A09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_F06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0073_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0085_F02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0018_H06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_A05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0061_H05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0060_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0104_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_H02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCC
LVR01_0002_H03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0052_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0059_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0059_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0060_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0021_C01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0081_F07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0066_F05.b : CATGAGGGCGGAGGGAATGACCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0074_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_H10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0061_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0100_B12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0085_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_D02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_G05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_D04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0092_H02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_H04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0060_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_A09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0078_A04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0017_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_A08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0076_C03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_B09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0096_B06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0009_F04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_H02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0057_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0088_G01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_H12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0046_F01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0101_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0002_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_F01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_G02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0012_F11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_H01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0094_B03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0100_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0086_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0042_H11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0011_B06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0031_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0060_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0050_A07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0019_A02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0058_A03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0062_B09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0062_G12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_C03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0072_B06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0013_B01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_C04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0045_H01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0098_A07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0056_B04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGG*CTCT
LVR01_0062_B05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0047_A05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_G08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0041_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0043_B11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0078_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0020_D06.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0093_E02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0076_E08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0100_H08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0087_F05.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_G01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0026_A08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0063_D09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0072_A12.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0055_G04.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0033_D08.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0004_F11.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0028_G02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0034_F03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0089_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0095_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0055_G02.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0106_B10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0091_H09.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0061_C07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0067_D01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0072_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0037_A01.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0099_B07.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0097_A10.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0036_G03.b : CATGAGGGCGGAGGGAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0048_A06.b : xxxxxxxxxxgtatcAATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0094_H11.b : xxxxxxxxxxxxxxxxATGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0093_G04.b : xxxxxxxxxxxxxxxxxTGTCCCTCTTCCTGGCTCTGGGGCTCCCGCGTGGCTGGGCTCT
LVR01_0054_E10.b : xxxxxxxxxxxxxxxxxTGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0016_B08.b : xxxxxxxxxxxxxxxxxTGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0065_B09.b : xxxxxxxxxxxxxxxxxTGTCCCTCTTCCTGGCTCTGGGGCTCCTG*GTGGCTGGGCTCT
LVR01_0029_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_C02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0108_F01.b :
TES01_0036_F08.b :
LVR01_0104_B12.b :
20110601C-000796 : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
---------+---------+---------+---------+---------+---------+ 193
LVR01_0081_E09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_E12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0022_C01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0035_E04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0035_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0042_C08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0052_F09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_B09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0068_D01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_C05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGG*AG
LVR01_0100_C04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_F11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_E09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0016_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0084_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0079_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_F08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0016_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_A04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0001_G01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0082_C06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0037_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_E01.b : GCTCCACGGTCCACTGCTTCCCAGCGGATGACCTTGCCTCAGAGACTGTGACCCTGA*AG
LVR01_0044_G07.b : GCTCCAGGGTCCACTGCGTCCCCGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_E08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0025_C07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_E09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_E10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0093_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0035_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0019_C09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0052_C06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0052_B06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0026_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_B08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_H07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_C11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_F07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0025_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0037_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0030_E05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0038_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0035_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0025_E07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_D11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0096_F09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0077_C01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_H08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0060_D08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0094_C07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_C06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_E06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0003_D07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_A04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0038_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0016_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_F11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_C05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_F01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_C09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_C03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_C10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_E05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_G06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0066_A11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_B01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0038_B08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0077_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0102_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_E12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0041_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0035_A09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_C02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0082_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0098_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTTAAAGACTGTGACCCTGA*AG
LVR01_0028_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0077_C07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0096_B02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_D09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0039_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0053_C12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_C03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0105_D08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_D07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0066_H08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0005_D01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_C11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_D05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0086_G05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0012_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_E11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_C02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0041_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_C06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_C12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0061_E09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_G05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0055_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_F03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0082_E12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_E03.b : GCTCCAGGGTCCACTGCGTCCCACCAGATGACCTTGCCTCAAAAACTGTGACCCTGA*AG
LVR01_0040_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_C10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0002_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0005_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_C04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_B09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0039_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_C11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_B04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0082_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0003_E10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0044_G11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_H05.b : GCTCCTGGGTCCACTGCGTCCCATCGGATGACCTTGCCTCATATACTGTGACCCTGAGAG
LVR01_0038_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0009_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0088_E08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGG*AG
LVR01_0014_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0068_E07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_H04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0073_E07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_F03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_G01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0104_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0003_B10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_B08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0090_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0073_B02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGTCCCTGA*AG
LVR01_0015_C08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0100_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCTTGA*AG
LVR01_0022_G06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0002_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0008_E09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0020_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0009_D09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_B04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0020_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_G11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0063_C09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_E05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_B08.b : GCTCCAGGCTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0062_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0103_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_D11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0057_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_C05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0001_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_D01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0084_H02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_F03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_G09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0096_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0002_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_C03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0084_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCCTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_H04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0038_C04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0044_D05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0044_G09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_E03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_F11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_G11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0084_D08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0085_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0012_F03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0037_C01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_H08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0015_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_F02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_H01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0105_G06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_D11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0044_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_G07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_H07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_H08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0022_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0071_C09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0088_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0101_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0101_D03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_D08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCCGA*AG
LVR01_0058_F08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0090_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0096_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_G10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0044_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_E04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_D12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0093_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_C10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0102_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0098_F01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_D05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACTCTGA*AG
LVR01_0034_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0086_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_E05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_C05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0077_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0046_F07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0092_C09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_F08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0063_F10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0062_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0072_D05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0078_D10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_A07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_F09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_H07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_F07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0079_E08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0040_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_D07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0063_F02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0061_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0093_G01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0071_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0042_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAGAGACTGTGACCCTGA*AG
LVR01_0026_B01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_E04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0071_E08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0049_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCCGA*AG
LVR01_0048_E05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_H01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0071_A09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0051_C07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0014_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0005_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0021_A07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_A04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_E04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_F05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_H05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0092_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0076_G02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0003_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0009_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0008_D07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0073_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0039_B04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0066_F02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_F05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0090_B10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_B04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_H05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0103_H07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_E01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0066_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0083_F08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_C08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_A07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0105_H01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0072_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0103_C06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0005_F12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0021_F08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0046_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0101_E11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_G11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_A11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0057_A09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_F06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0073_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0085_F02.b : GCTCCAGGGTCCACTGCGTCCCAGCGAATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0018_H06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_H10.b : GCTCCAGGGTCCACTGCGTCCTAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0061_H05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_A02.b : GCTCCAGGGTCCACTGCGTCCCAACGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0060_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0104_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_H02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0002_H03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0052_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACCGTGACCCTGA*AG
LVR01_0059_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0059_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0060_B01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0021_C01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0081_F07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0066_F05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0074_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_H10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0061_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0100_B12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0085_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_D02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_G05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_D04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0092_H02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_H04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0060_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_A09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0078_A04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0017_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_A08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0076_C03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_B09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0096_B06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0009_F04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_H02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0057_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0088_G01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_H12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0046_F01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0101_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0002_B01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_F01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_G02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0012_F11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_H01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0094_B03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0100_B01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0086_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0042_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0011_B06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0031_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0060_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0050_A07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0019_A02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0058_A03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0062_B09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0062_G12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_C03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0072_B06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0013_B01.b : GCTCCAGGGTCCACTGCATCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_C04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0045_H01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0098_A07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0056_B04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0062_B05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0047_A05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_G08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0041_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0043_B11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0078_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0020_D06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0093_E02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0076_E08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0100_H08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0087_F05.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_G01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0026_A08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0063_D09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0072_A12.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0055_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0033_D08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0004_F11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0028_G02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0034_F03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0089_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0095_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0055_G02.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0106_B10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0091_H09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0061_C07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0067_D01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0072_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0037_A01.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0099_B07.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0097_A10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0036_G03.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0048_A06.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0094_H11.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0093_G04.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0054_E10.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0016_B08.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0065_B09.b : GCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0029_C12.b : xCTCCAGGGTCCACTGCGTCCCAGCGGATGACCTTGCCTCAAAGACTGTGACCCTGA*AG
LVR01_0030_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA*AG
TES01_0108_F01.b :
TES01_0036_F08.b :
LVR01_0104_B12.b : ggttttggttgctttgtgacntata
20110601C-000796 : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
---------+---------+---------+---------+---------+---------+ 253
LVR01_0081_E09.b : GGCCGGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_E12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0022_C01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0035_E04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCTTCTCCAGCAACACCGACTTC
LVR01_0035_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0042_C08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0052_F09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_G08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_B09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0068_D01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_C05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0100_C04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_F11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_E09.b : GGTCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0016_G08.b : GGCCAGACCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0084_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0079_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_F08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0016_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_A04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0001_G01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0082_C06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0037_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_E01.b : GGCCAGATCAAGAAACTGCCTGCGCACAACACCGCCCTCGTCTCCAGCAACACCGACTTC
LVR01_0044_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_E08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0025_C07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_E09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_E10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0093_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0035_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0019_C09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0052_C06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0052_B06.b : GGCCAGATCACGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0026_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_B08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGTCGTCGTCTCCTGCAACACCGACTTC
LVR01_0034_H07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_C11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_F07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0025_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0037_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0030_E05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_D10.b : GGCCAGATCAGGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0038_H11.b : GGCCAGGTCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0035_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0025_E07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_D11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0096_F09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0077_C01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0033_H08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0060_D08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0094_C07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_C06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_E06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0003_D07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_A04.b : GGCCAGATCAAGAAGCTGCCAGCGCGCAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0038_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0016_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_F11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_C05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_F01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_C09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_C03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_C10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_E05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_G08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_G06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0066_A11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0038_B08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0077_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0102_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_E12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0041_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0035_A09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_C02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0082_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0098_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACATCGACTTC
LVR01_0077_C07.b : GGCCAGATCAAGAAGCTGCCAGCGCATAACACCGCCGTTGTCTCCAGCAACACCGACTTC
LVR01_0096_B02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_D09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0039_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0053_C12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_C03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0105_D08.b : GGCCAGATTAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_D07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0066_H08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0005_D01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_C11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_D05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0086_G05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0012_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCGCAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_E11.b : GGCCAGATCAAGAAGCTGCCAGTGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_G08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_C02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0041_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0033_C06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_C12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0061_E09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_G05.b : GGCCAGATCAAGAAGCTGCCAGCGCGCAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTAC
LVR01_0055_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_F03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0082_E12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_E03.b : GGACAGATCAAGAAGCTGCCACCGCAAAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_C10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0002_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_D10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0005_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_C04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_B09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0039_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_C11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_B04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0082_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0003_E10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0044_G11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_H05.b : GGCCATATCTTTAAGCTGCCCGCGCGCAACACCGCCGTCTTCTCCAGCAACACCGACTTC
LVR01_0038_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0009_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0088_E08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0068_E07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_H04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0073_E07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_F03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_G01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0104_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0003_B10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_B08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_D10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0090_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0073_B02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_C08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_G08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0100_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0022_G06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0002_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0008_E09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0020_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0009_D09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_B04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0020_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_G11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_B07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0063_C09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_E05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACTCCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_B08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0062_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0103_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_D11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0057_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_C05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0001_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_D01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0084_H02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_F03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_G09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0096_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0002_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_C03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0084_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_D10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_H04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0038_C04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0044_D05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0044_G09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_E03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_B07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_F11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_G11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGGCTTC
LVR01_0084_D08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0085_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0012_F03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0037_C01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_H08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0015_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_F02.b : GGCTAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_H01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0105_G06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_D11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0044_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_G07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_H07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_H08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0022_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0033_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0071_C09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0088_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0101_D10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0101_D03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_D08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCCCCAGCAACACCGACTTC
LVR01_0058_F08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0090_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACGCCGACTTC
LVR01_0096_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_G10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0044_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_E04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_D12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0093_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_C10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0102_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0098_F01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_D05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0086_B07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_E05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_C05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0077_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0046_F07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0092_C09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_F08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0063_F10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0062_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0072_D05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0078_D10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_A07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_F09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_H07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_F07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0079_E08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0040_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_D07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_B07.b : GGCCAGATCAGGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0063_F02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0061_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0093_G01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0071_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0042_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0026_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_E04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0071_E08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0049_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_E05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_H01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0071_A09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0051_C07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0014_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0005_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0021_A07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_A04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0033_E04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_F05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_H05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0092_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0076_G02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0003_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0009_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0008_D07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0073_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0039_B04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0066_F02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_F05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0090_B10.b : GGCCAGATCAAGAAGCTGCCAACGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_B04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_H05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0103_H07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_E01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0066_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0083_F08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_C08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_A07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0105_H01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0072_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0103_C06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0005_F12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0021_F08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0046_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0101_E11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_G11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGCCTCCAGCAACACCGACTTC
LVR01_0033_A11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0057_A09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_F06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0073_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0085_F02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0018_H06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0061_H05.b : GGCCAGATCAAGAGGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCCCCCTCCTCTCCAGCAACACCCACTTC
LVR01_0060_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0104_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_H02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0002_H03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0052_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0059_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0059_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0060_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0021_C01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0081_F07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0066_F05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0074_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_H10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0061_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0100_B12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0085_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_D02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_G05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_D04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0092_H02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_H04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0060_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_A09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0078_A04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0017_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_A08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0076_C03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_B09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0096_B06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0009_F04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_H02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0057_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0088_G01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_H12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0046_F01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0101_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0002_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_F01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_G02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACGCCGACTTC
LVR01_0012_F11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_H01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0094_B03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0100_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0086_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0042_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0011_B06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0031_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0060_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0050_A07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0019_A02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0058_A03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0062_B09.b : GGTCAGATCAAGAAGCTGCCAGCGCACATCACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0062_G12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_C03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0072_B06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0013_B01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_C04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0045_H01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0098_A07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0056_B04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0062_B05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0047_A05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_G08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0041_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0043_B11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0078_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0020_D06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0093_E02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0076_E08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0100_H08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0087_F05.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_G01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0026_A08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0063_D09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0072_A12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0055_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0033_D08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0004_F11.b : GGCCAGATCAAGAAGC*GCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0028_G02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0034_F03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0089_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0095_B07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0055_G02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0106_B10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0091_H09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0061_C07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0067_D01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0072_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0037_A01.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0099_B07.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0097_A10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0036_G03.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0048_A06.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACCCCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0094_H11.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0093_G04.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0054_E10.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0016_B08.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0065_B09.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0029_C12.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
LVR01_0030_C02.b : GGCCAGATCAAGAAGCTGCCAGCGCACAACACCGCCGTCGTCTCCAGCAACACCGACTTC
TES01_0108_F01.b : tttactacagttgctactggacacCCGCCGTCGTCTCC*GCAACACCGACTTC
TES01_0036_F08.b : nnncctacgttgctctgggtctctccGCACACCGACTTC
LVR01_0104_B12.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000796 : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
---------+---------+---------+---------+---------+---------+ 313
LVR01_0081_E09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_E12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0022_C01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0035_E04.b : GGCATCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCCGAGAAAATGTCATCTTCTCC
LVR01_0035_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0042_C08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0052_F09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_G08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_B09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0068_D01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_C05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0100_C04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_F11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_E09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0016_G08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0084_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0079_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_F08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0016_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_A04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0001_G01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_B05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0082_C06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0037_D12.b : GCCTTCATCCTCTACAATCATCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0029_E01.b : CCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCATACAAAATGTCGTCTTCTCC
LVR01_0044_G07.b : ACCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAAACAAAATGTCATCTTCTCC
LVR01_0036_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_E08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0036_H11.b : GCCTTCAGCCTCTACAGGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0025_C07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_E09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_E10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCGTCTTCTCC
LVR01_0093_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAGAATGTCATCTTCTCC
LVR01_0035_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0019_C09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0052_C06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0052_B06.b : GCCTTCAGCCTCTACAAGCAGCTGGTTCCGGTCGACCCCAAAAAAAATGTCATCTTCTCC
LVR01_0013_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0026_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_B08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAAAGAAAATGTCATCTTCTCC
LVR01_0034_H07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_C11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_F07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0025_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0037_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0030_E05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0029_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0038_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0035_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0025_E07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_D11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0096_F09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAGAATGTCATCTTCTCC
LVR01_0077_C01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_H08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0060_D08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0094_C07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_C06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_E06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0003_D07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_A04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0038_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0016_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_F11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_C05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_F01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_C09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_C03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_C10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_E05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0036_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_D12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0036_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_G08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_G06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0066_A11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0038_B08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0077_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0102_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_E12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_D12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0041_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0035_A09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_C02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0082_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0098_B05.b : TCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0077_C07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0096_B02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_D09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0039_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0053_C12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_C03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0105_D08.b : GCCCTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCCTCTCC
LVR01_0047_D07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0066_H08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0005_D01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_C11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_D05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0086_G05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0012_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_E11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_G08.b : GCCTTCAGCCTCTACAAGCAGCTGACTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_C02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0041_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_C06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_C12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0061_E09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_G05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0055_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_F03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0082_E12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_E03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTCCTCC
LVR01_0040_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_C10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_D12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0002_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_B05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0005_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0029_C04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_B09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0039_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_C11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_B04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0082_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0003_E10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0044_G11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_H05.b : TCCTTCCTCCTCTACCAGCAGCTGGCTCTGGCCGAACGCATAGAAAATGTCATCTTCTCC
LVR01_0038_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0009_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0088_E08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0068_E07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_H04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0073_E07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_F03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0011_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_G03.b : GCCTTCAGCCTCTACGAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_G01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0104_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0003_B10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_B08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0090_D12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0073_B02.b : GCCCTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_C08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_G08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0100_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0022_G06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0002_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0008_E09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0020_B05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0009_D09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_B04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0020_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_G11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0063_C09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_E05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_B08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0062_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0103_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_D11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0057_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_C05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0001_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_D01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0084_H02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_F03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_G09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0096_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0002_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTCCTCC
LVR01_0029_C03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0084_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCACCTTCTCC
LVR01_0011_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_H04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0038_C04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0044_D05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0044_G09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_E03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_F11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_G11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0084_D08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0085_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0012_F03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0037_C01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_H08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0015_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_F02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_H01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0105_G06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_D11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0044_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0011_G07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_H07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_H08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0022_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0071_C09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0088_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0101_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0101_D03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_D08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_F08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0090_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0096_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_G10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0044_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_E04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_D12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0093_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_C10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0102_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0098_F01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_D05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0086_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_E05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAACGTCATCTTCTCC
LVR01_0011_C05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0077_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0046_F07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0092_C09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_F08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0063_F10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0062_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0072_D05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0078_D10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_A07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_F09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_H07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_F07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0079_E08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0040_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_D07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0063_F02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0061_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0093_G01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0071_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0042_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0026_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_E04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0071_E08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0049_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_E05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_H01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0071_A09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0051_C07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0014_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0005_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0021_A07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_A04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_E04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_F05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_H05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0092_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0076_G02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0003_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0009_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0008_D07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0073_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0039_B04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0066_F02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_F05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0011_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0090_B10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_B04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_H05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0103_H07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_E01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0066_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0083_F08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_C08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_A07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTCCTCC
LVR01_0105_H01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0072_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0103_C06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0005_F12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0021_F08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0046_B05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0101_E11.b : GCCTTCAGCCTCTACAAGCTGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_G11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_A11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0057_A09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_F06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0073_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0085_F02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0018_H06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0061_H05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCTGAACTCAGAGAAAATGTCATCTTCTCC
LVR01_0099_A02.b : CCCTTCCGCCTCTACCAGCAACTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0060_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0104_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_H02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0002_H03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0052_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0059_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0059_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0060_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0021_C01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0081_F07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0066_F05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0074_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCCCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_H10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0061_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0100_B12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0085_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_D02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_G05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_D04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0092_H02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_H04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0060_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_A09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0029_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0078_A04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0017_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_A08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0076_C03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_B09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0096_B06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0009_F04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_H02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0057_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0088_G01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_H12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0046_F01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0101_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0002_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_F01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_G02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0012_F11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_H01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0094_B03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0100_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0086_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0042_H11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0011_B06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0031_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0060_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0050_A07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0019_A02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0058_A03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0062_B09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0062_G12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_C03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0072_B06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0013_B01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_C04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0045_H01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0098_A07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0056_B04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0062_B05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0047_A05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0029_G08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCAAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0036_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0041_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0043_B11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0078_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0020_D06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0093_E02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0076_E08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0100_H08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0087_F05.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_G01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0026_A08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0063_D09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0072_A12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0055_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0033_D08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0004_F11.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0028_G02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0034_F03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0089_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0095_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0055_G02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0106_B10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0091_H09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0061_C07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0067_D01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0072_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0037_A01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0099_B07.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0097_A10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0036_G03.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0048_A06.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0094_H11.b : GCCTTCAGCTTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0093_G04.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0054_E10.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0016_B08.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0065_B09.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCT
LVR01_0029_C12.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0030_C02.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
TES01_0108_F01.b : GCCTTCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
TES01_0036_F08.b : GCCTTC*GCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAATGTCATCTTCTCC
LVR01_0104_B12.b : xxxxxCAGCCTCTACAAGCAGCTGGCTCTGGCCGAACGCAGAGAAAGTGTCATCTTCTCC
20110601C-000796 : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
---------+---------+---------+---------+---------+---------+ 372
LVR01_0081_E09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_E12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0022_C01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTACCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0035_E04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0035_D06.b : CCGCTGAGCGTCTCTATAACCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0042_C08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0052_F09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_G08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_B09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0068_D01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_C05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0100_C04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_F11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_E09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0016_G08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0084_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0079_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_H12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0016_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_A04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0001_G01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0082_C06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0037_D12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_E08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0025_C07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_E09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_E10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0093_F04.b : CCGCTGGGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0035_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0019_C09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0052_C06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0052_B06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCTCCACCCT
LVR01_0013_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0026_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_B08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_H07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_C11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_F07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0025_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0037_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0030_E05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0038_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0035_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0025_E07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_D11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0096_F09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0077_C01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_H08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0060_D08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_D06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0094_C07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_C06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_E06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0003_D07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_A04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0038_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0016_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_F11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_C05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_F01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_C09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_C03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_C10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_E05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_D12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_G08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_G06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0066_A11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0038_B08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0077_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0102_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_E12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_D12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0041_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0035_A09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_C02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0082_H12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0098_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0077_C07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0096_B02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_D09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0039_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0053_C12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_C03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0105_D08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_D07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0066_H08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0005_D01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_C11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_D05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0086_G05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0012_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_E11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_G08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_C02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0041_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_C06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_C12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0061_E09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_G05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0055_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_F03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0082_E12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_E03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_C10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_D12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0002_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0005_H12.b : CCGCTGAGCGTCTCCATAGCTTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_C04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_B09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0039_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_C11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_B04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0082_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0003_E10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_G11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_H05.b : CCGCTGATCGTCTCCATACCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0038_D06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0009_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0088_E08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0068_E07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_H04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0073_E07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_F03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_G01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0104_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0003_B10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_B08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCCGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0090_D12.b : CCGCCGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0073_B02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_C08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_G08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0100_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0022_G06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0002_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0008_E09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0020_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0009_D09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_B04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0020_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_G11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0063_C09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_E05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_B08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_D06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CTCGAGGCCCCACCCT
LVR01_0062_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0103_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_D11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0057_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_C05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0001_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_D01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0084_H02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_F03.b : CCGCTGAGCGTCTCCGTAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_G09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0096_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0002_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_C03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0084_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_H04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0038_C04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_D05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_G09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_E03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_F11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_G11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0084_D08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0085_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0012_F03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0037_C01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_H08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0015_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_F02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_H01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0105_G06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_D11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_G07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_H07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_H08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0022_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0071_C09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0088_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0101_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0101_D03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_D08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0090_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0096_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_G10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0044_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_E04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_D12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0093_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_C10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0102_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0098_F01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_D05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0086_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_E05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_C05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0077_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0046_F07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0092_C09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0063_F10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0062_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0072_D05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0078_D10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_A07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_F09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_H07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_F07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0079_E08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0040_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_D07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0063_F02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0061_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0093_G01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0071_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0042_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0026_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_E04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0071_E08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0049_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_E05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCTT
LVR01_0017_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACTCT
LVR01_0028_H01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0071_A09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0051_C07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0014_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0005_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0021_A07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_A04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTTCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_H12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_E04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_F05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_H05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0092_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0076_G02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0003_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0009_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0008_D07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0073_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0039_B04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0066_F02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_F05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0090_B10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_B04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_H05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0103_H07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_E01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0066_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0083_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_C08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_A07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCGCCCT
LVR01_0105_H01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGACCCCACCCT
LVR01_0072_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0103_C06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0005_F12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0021_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0046_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0101_E11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_G11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_A11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0057_A09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_F06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGGGCCCGAGGCCCCACCCT
LVR01_0073_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0085_F02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0018_H06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0061_H05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0060_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0104_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_H02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0002_H03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0052_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0059_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0059_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0060_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0021_C01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0081_F07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0066_F05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0074_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_H10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0061_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0100_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0085_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_D02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_G05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_D04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0092_H02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_H12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_H04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0060_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_A09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTTCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0078_A04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0017_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_A08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0076_C03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_B09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0096_B06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0009_F04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_H02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0057_G03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0088_G01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_H12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0046_F01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0101_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0002_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_F01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_G02.b : CCGCTGAGCGTCCCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0012_F11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_H01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0094_B03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0100_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0086_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0042_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0011_B06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0031_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0060_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0050_A07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0019_A02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0058_A03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0062_B09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0062_G12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_C03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0072_B06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0013_B01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_C04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0045_H01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0098_A07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0056_B04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0062_B05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0047_A05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_G08.b : CCGCTGGGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0041_D06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0043_B11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0078_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0020_D06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0093_E02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0076_E08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0100_H08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0087_F05.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_G01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0026_A08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0063_D09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0072_A12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0055_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0033_D08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0004_F11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0028_G02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0034_F03.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0089_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0095_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0055_G02.b : CCGCTGAGCGCCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0106_B10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0091_H09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0061_C07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0067_D01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0072_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0037_A01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0099_B07.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0097_A10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0036_G03.b : CCGCTGAGCGTCTCCCTAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0048_A06.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0094_H11.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0093_G04.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0054_E10.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0016_B08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0065_B09.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0029_C12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0030_C02.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
TES01_0108_F01.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
TES01_0036_F08.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
LVR01_0104_B12.b : CCGCTGAGCGTCTCCATAGCCTTGGCCTTCCTGTCTCTGGGGG*CCCGAGGCCCCACCCT
20110601C-000796 : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
---------+---------+---------+---------+---------+---------+ 430
LVR01_0081_E09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_E12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0022_C01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0035_E04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*ATAGACCCCCGAGGCAGAAATC
LVR01_0035_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CTACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0042_C08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0052_F09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_B09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0068_D01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_C05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0100_C04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_F11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_E09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0016_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0084_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0079_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0016_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_A04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0001_G01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_A01.b : GATAGAGCTCCTGAAAGGGCTCAGGTTTCACCCTCAC*AAAGACCCCCGAGGCGAAATTC
LVR01_0013_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CTACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0082_C06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0037_D12.b : GATAGAGCTCCTGGAAGGCCTCTAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGACATC
LVR01_0029_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*ACAAACCCCCGAGGCACAAATC
LVR01_0044_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CCACCTCAC*AAAGACCCCCTAGGCAGAAATC
LVR01_0036_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_A01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_E08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0036_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0025_C07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_E09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_E10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0093_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AGAGACCCCCGAGGCAGAAATC
LVR01_0035_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0019_C09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGGCCCCCGAGGCAGAAATC
LVR01_0052_C06.b : GATAGAGCTCCTGGAAGGCCTCGAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0052_B06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0026_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_B08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAAAAATC
LVR01_0034_H07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_C11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_F07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0025_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0037_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCACAAATC
LVR01_0030_E05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0038_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CGACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0035_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0025_E07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_D11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0096_F09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0077_C01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_H08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0060_D08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0094_C07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_C06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_E06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0003_D07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_A04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0038_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0016_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_F11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_C05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_F01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_C09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_C03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_C10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_E05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0036_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_D12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0036_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_G06.b : GATAGAGCTCCTGGAAGGCCTCAAGTC*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0066_A11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_B01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0038_B08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0077_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0102_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_E12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_D12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0041_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0035_A09.b : GATAGAGCCCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_C02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0082_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0098_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAAAAATC
LVR01_0028_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0077_C07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0096_B02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_D09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0039_G12.b : GATAGGGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0053_C12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_C03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0105_D08.b : GATAGAGCGCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_D07.b : GATAGAGCCCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0066_H08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0005_D01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_C11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_D05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0086_G05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0012_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_E11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_C02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0041_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_C06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_C12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0061_E09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_G05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0055_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_F03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0082_E12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_E03.b : GATAGAACTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_C10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_D12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0002_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0005_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_C04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_B09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0039_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_C11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_B04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0082_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0003_E10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0044_G11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_H05.b : GATATAGCTCCTGCAACGCCTCGAGTT*CTGCCTCAC*AAAGACCCCCCAGGCACACATC
LVR01_0038_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0009_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0088_E08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0068_E07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_H04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0073_E07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_F03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_G01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0104_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0003_B10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_B08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0090_D12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0073_B02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_C08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0100_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0022_G06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0002_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0008_E09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0020_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0009_D09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_B04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0020_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_G11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0063_C09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_E05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_B08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0062_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0103_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_D11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0057_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_C05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0001_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_D01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0084_H02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_F03.b : GATAGGGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_G09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0096_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0002_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_C03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0084_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_H04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0038_C04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0044_D05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0044_G09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_E03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_F11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_G11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0084_D08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0085_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0012_F03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0037_C01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_H08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0015_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_F02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_A01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_H01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0105_G06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_D11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0044_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_G07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_H07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_H08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0022_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0071_C09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0088_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0101_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0101_D03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_D08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0090_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0096_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_G10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0044_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_E04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_D12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0093_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_C10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0102_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0098_F01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_D05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0086_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_E05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_C05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0077_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0046_F07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0092_C09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0063_F10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0062_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0072_D05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0078_D10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_A07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_F09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_H07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_F07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0079_E08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0040_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0074_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_D07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0063_F02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0061_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0093_G01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0071_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0042_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0026_B01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_E04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0071_E08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0049_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_E05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_H01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0071_A09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0051_C07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0014_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0005_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0021_A07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_A04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_E04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_F05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_H05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0092_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0076_G02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0003_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0009_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0008_D07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CGACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0073_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0039_B04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0066_F02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_F05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0090_B10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_B04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_H05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0103_H07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_E01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0066_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0083_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCACGAAAGACCCCCGAGGCAGAAATC
LVR01_0081_C08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_A07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0105_H01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0072_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0103_C06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0005_F12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0021_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0046_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0101_E11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_G11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_A11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0057_A09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_F06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACTCCCGAGGCAGAAATC
LVR01_0073_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0085_F02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0018_H06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0061_H05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0060_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0104_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_H02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0002_H03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0052_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0059_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0059_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0060_B01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0021_C01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0081_F07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0066_F05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAACC
LVR01_0074_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_H10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0061_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0100_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0085_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_D02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_G05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_D04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0092_H02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_H04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0060_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_A09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0078_A04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0017_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_A08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0076_C03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_B09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0096_B06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0009_F04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_H02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0057_G03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0088_G01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_H12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0046_F01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0101_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0002_B01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_F01.b : GATAAAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_G02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0012_F11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_H01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0094_B03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0100_B01.b : GATAGAGCTCCTGGAAGGCCTCAATTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0086_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0042_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0011_B06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0031_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0060_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0050_A07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_A01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CGACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0019_A02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0058_A03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0062_B09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0062_G12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_C03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0072_B06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0013_B01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_C04.b : GATAGAGCTCCTGGAAGGCCCCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0045_H01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0098_A07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0056_B04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0062_B05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0047_A05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_G08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0036_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0041_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0043_B11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0078_A01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0020_D06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0093_E02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0076_E08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0100_H08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0087_F05.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_G01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0026_A08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0063_D09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0072_A12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0055_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0033_D08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0004_F11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0028_G02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0034_F03.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0089_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0095_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0055_G02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0106_B10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0091_H09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0061_C07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0067_D01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0072_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0037_A01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0099_B07.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0097_A10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0036_G03.b : GATAGAGCTCCTGGAAGGCCTCATGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0048_A06.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0094_H11.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0093_G04.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0054_E10.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0016_B08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0065_B09.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0029_C12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0030_C02.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
TES01_0108_F01.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
TES01_0036_F08.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
LVR01_0104_B12.b : GATAGAGCTCCTGGAAGGCCTCAAGTT*CAACCTCAC*AAAGACCCCCGAGGCAGAAATC
20110601C-000796 : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
---------+---------+---------+---------+---------+---------+ 488
LVR01_0081_E09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_E12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0022_C01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0035_E04.b : CACCAGGGCTTCTAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCCGC
LVR01_0035_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAACAACCT*GCTGCAGC
LVR01_0042_C08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0052_F09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_B09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0068_D01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_C05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0100_C04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_F11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_E09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCG*ACCCAGCAACCT*GCTGCAGC
LVR01_0016_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0084_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0079_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0016_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_A04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0001_G01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_A01.b : ACCCAGGGCTTCaggcacctntgcaagccctcacccaccaaaccaccttgctgcaactga
LVR01_0013_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCACCCA*ACCCAGCAACCT*GCTGCATC
LVR01_0082_C06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCACCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0037_D12.b : CACCAGGGCTTCCAGCATCTCCTGCATGCCCTCAGCCC*ACCCAGCAACCT*GCTGCAAC
LVR01_0029_E01.b : CACCATTGCTTCCAGCACCTCCTGCAGGCCCTCAACCATACCCAGCAACCT*GCTGCAGC
LVR01_0044_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_A01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_E08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0025_C07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_E09.b : CACCANGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_E10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0093_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0035_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0019_C09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0052_C06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0052_B06.b : CACCAAGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0026_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_B08.b : CACCATGGCTTCCAGCACCTCCTGCAGGCCCTCGGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_H07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_C11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_F07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0025_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0037_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCACCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0030_E05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0038_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0035_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0025_E07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_D11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0096_F09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0077_C01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_H08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0060_D08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0094_C07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_C06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_E06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0003_D07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_A04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0038_F06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0016_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_F11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_C05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_F01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_C09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_C03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_C10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_E05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_D12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_G06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0066_A11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0038_B08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0077_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0102_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_E12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_D12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0041_F06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0035_A09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_C02.b : CACCAGGGCTTCCAGCACCTCCTGCAAGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0082_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0098_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCATCAACCT*GCTGCAGC
LVR01_0028_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0077_C07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0096_B02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_D09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0039_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0053_C12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_C03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0105_D08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_D07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0066_H08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0005_D01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_C11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_D05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0086_G05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0012_F06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_E11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_C02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0041_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_C06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_C12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0061_E09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_G05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0055_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_F03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0082_E12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_E03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_C10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_D12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0002_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0005_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_C04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_B09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0039_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_C11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GTTGCAGC
LVR01_0095_B04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0082_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0003_E10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0044_G11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_H05.b : CACCACGGCTTCCAACACCTCCTGCAGGCCCTCATCCA*ACCCACCAACCT*GCTGCATC
LVR01_0038_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0009_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0088_E08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0068_E07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_H04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0073_E07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0049_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_F03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTACAGC
LVR01_0011_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCGGC
LVR01_0049_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_G01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0104_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0003_B10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_B08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCGACCT*GCTGCAGC
LVR01_0050_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0090_D12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0073_B02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_C08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0100_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0022_G06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCCCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0002_F06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0008_E09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0020_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_H03.b : CACCAGGGCTTCCAGCACCTCCTGTAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0009_D09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_B04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0020_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_G11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_B07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0063_C09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_E05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_B08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0062_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0103_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_D11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0057_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_C05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0001_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_D01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0084_H02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_F03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_G09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0096_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0002_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_C03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0049_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0084_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0011_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_H04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0038_C04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0044_D05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0044_G09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_E03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_B07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_F11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_G11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0084_D08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0085_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0012_F03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0037_C01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_H08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0015_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_F02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_A01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_H01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0105_G06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0049_D11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0044_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0011_G07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_H07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_H08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0022_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0071_C09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0088_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0101_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0101_D03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_D08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0090_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0096_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_G10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0044_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_E04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_D12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0093_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_C10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0102_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0098_F01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_D05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0086_B07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_E05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAGCCT*GCTGCAGC
LVR01_0011_C05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0077_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0046_F07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0092_C09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0063_F10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0062_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0072_D05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0078_D10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_A07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_F09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_H07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_F07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0079_E08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0040_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_D07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAGCCT*GCTGCAGC
LVR01_0049_B07.b : CACCGGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0063_F02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0061_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0093_G01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0071_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0042_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0026_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_E04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0071_E08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0049_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0048_E05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_F06.b : CACCAGGGCTTCCAGCACCCCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_H01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0071_A09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0051_C07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0014_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0005_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0021_A07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_A04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_E04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_F05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_H05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0092_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0076_G02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0003_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0009_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0008_D07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0073_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0039_B04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0066_F02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_F05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0011_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0090_B10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_B04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_H05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0103_H07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_E01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0066_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0083_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_C08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_A07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0105_H01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0072_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0103_C06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0005_F12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0021_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0046_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0101_E11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_G11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_A11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0057_A09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_F06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0073_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0085_F02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0018_H06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0061_H05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0060_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0104_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_H02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0002_H03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0052_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0059_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0059_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0060_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0021_C01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0081_F07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0066_F05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0074_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_H10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0061_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0100_B12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCGGC
LVR01_0085_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_D02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_G05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_D04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0092_H02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_H04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0060_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_A09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0078_A04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0017_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_A08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0076_C03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_B09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0096_B06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0009_F04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_H02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0057_G03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0088_G01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_H12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0046_F01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0101_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0002_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_F01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_G02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0012_F11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_H01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0094_B03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0100_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0086_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0042_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0011_B06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0031_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0060_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0050_A07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_A01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0019_A02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0058_A03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0062_B09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0062_G12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_C03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0072_B06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0013_B01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_C04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0045_H01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0098_A07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0056_B04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0062_B05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0047_A05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_G08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0041_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0043_B11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0078_A01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*CCCCAGCAACCT*GCTGCAGC
LVR01_0020_D06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0093_E02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0076_E08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0100_H08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0087_F05.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCGGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_G01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0026_A08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0063_D09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0072_A12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0055_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0033_D08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0004_F11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0028_G02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0034_F03.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0089_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0095_B07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0055_G02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0106_B10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0091_H09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0061_C07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0067_D01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0072_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0037_A01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0099_B07.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0097_A10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0036_G03.b : CATCAGGGCTTCCAGCACCTCCTGCAGGCCCTCTGCCT*ACCCATCAACCTTGCTGCAGC
LVR01_0048_A06.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0094_H11.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0093_G04.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0054_E10.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0016_B08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0065_B09.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0029_C12.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0030_C02.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
TES01_0108_F01.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
TES01_0036_F08.b : CACCAGGGCTTCCAGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
LVR01_0104_B12.b : CACCAGGGCTTCCGGCACCTCCTGCAGGCCCTCAGCCA*ACCCAGCAACCT*GCTGCAGC
20110601C-000796 : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
---------+---------+---------+---------+---------+---------+ 547
LVR01_0081_E09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_E12.b : TGAACGTAGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0022_C01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGGAGCTGCTGGACAAGTTCGTC
LVR01_0035_E04.b : TGAACGTGGGCACCGCCCTTGTCCGAGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0035_D06.b : TGAACAAGAGCAACGCCAT*GTTCGTGGATGAACGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0042_C08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0052_F09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_B09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0068_D01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_C05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0100_C04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_F11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_E09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0016_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0084_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0079_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0016_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_A04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0001_G01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_A01.b : acgtgggccaccccctgtttcttggataaacggcttaacccgcctgaacaatttcttcca
LVR01_0013_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAACGACTGACTCAGCTGGACTAGTTCGTC
LVR01_0082_C06.b : TGAACGTGGGCAACGCCTT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGAC
LVR01_0037_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCATC
LVR01_0029_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAATTCGTC
LVR01_0044_G07.b : TGACCGTGGGCAACACCCT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0036_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_A01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_E08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0036_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGGTGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0025_C07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_E09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_E10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0093_F04.b : TAAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0035_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0019_C09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0052_C06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0052_B06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0026_H06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_B08.b : TGAACGTGGACAACGACAT*GTTCGTGGATGAGCGGCTGAATCTGCTGGACAAGTTCGTC
LVR01_0034_H07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_C11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_F07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0025_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0037_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0030_E05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0038_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0035_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAATCTGCTGGACAAGTTCGTC
LVR01_0025_E07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_D11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0096_F09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0077_C01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_H08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0060_D08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_D06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0094_C07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_C06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_E06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0003_D07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_A04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGACGCTGCTGGACAAGTTCGTC
LVR01_0038_F06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0016_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_F11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_C05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_F01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_C09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_C03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_C10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_E05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTCCGTC
LVR01_0036_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0036_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_G06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0066_A11.b : TGAACGCGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0038_B08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0077_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0102_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_E12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0041_F06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0035_A09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_C02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0082_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0098_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0077_C07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0096_B02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCCGGACAAGTTCGTC
LVR01_0065_D09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_H06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0039_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0053_C12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_C03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0105_D08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_D07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0066_H08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0005_D01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_C11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_D05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0086_G05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0012_F06.b : TGAACGTGGGCAACGCCGT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_E11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_C02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0041_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_C06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_C12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0061_E09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_G05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_H06.b : TGAACGTGGGCAACGCCAT*GCTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0055_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_F03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0082_E12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_E03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAACGGCTGAAGCTGCTGGACAAATTCGTC
LVR01_0040_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_C10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0002_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCATC
LVR01_0095_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0005_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_C04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_B09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0039_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_C11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_B04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0082_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0003_E10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0044_G11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACGAGTTCGTC
LVR01_0074_H05.b : TGATCGTGAGCAACACCAT*GTTCGTGCATGAGCCGCTGAAACTGCTGGACAATTTCATC
LVR01_0038_D06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0009_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0088_E08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0068_E07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_H04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0073_E07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_F03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_G01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0104_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0003_B10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_B08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0090_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGCC
LVR01_0073_B02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_C08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_H06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0100_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0022_G06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0002_F06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0008_E09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0020_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0009_D09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGTTGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_B04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0020_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_G11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0063_C09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_E05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_B08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_D06.b : TGAACGTGGGCAACGCCAC*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0062_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0103_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_D11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0057_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_C05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0001_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_D01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0084_H02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_F03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_G09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0096_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0002_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_C03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0084_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_H04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0038_C04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0044_D05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0044_G09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_E03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_F11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_G11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0084_D08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0085_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACGAGTTCGTC
LVR01_0012_F03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0037_C01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_H08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0015_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_F02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_A01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_H01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0105_G06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_D11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0044_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_G07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_H07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_H08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0022_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0071_C09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0088_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0101_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0101_D03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_D08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0090_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0096_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_G10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0044_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_E04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_D12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0093_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_C10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0102_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0098_F01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_D05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0086_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_E05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_C05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0077_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0046_F07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0092_C09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0063_F10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0062_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0072_D05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0078_D10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_A07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_F09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_H07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_F07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0079_E08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0040_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_D07.b : TGAACGTGGGCAACGCCAT*GTTCGTAGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0063_F02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0061_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0093_G01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0071_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0042_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0026_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_E04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0071_E08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0049_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0048_E05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_F06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_H01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0071_A09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0051_C07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0014_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0005_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0021_A07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_A04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_E04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_F05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_H05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0092_H06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0076_G02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0003_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0009_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0008_D07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0073_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0039_B04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0066_F02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_F05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTCCGTC
LVR01_0090_B10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_B04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_H05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0103_H07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_E01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0066_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0083_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_C08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_A07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0105_H01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0072_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0103_C06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0005_F12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0021_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0046_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0101_E11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_G11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_A11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0057_A09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_F06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0073_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0085_F02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0018_H06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0061_H05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTT
LVR01_0099_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0060_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0104_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_H02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0002_H03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0052_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0059_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0059_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0060_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0021_C01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0081_F07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0066_F05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0074_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_H10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0061_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0100_B12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0085_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_D02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_G05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_D04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0092_H02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_H04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0060_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_A09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0078_A04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0017_G04.b : TGAACGTGGGCAACGCCAC*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_A08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0076_C03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_B09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0096_B06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0009_F04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_H02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0057_G03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0088_G01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_H12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAGGCTGCTGGACAAGTTCGTC
LVR01_0046_F01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0101_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0002_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_F01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_G02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0012_F11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_H01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0094_B03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0100_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0086_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0042_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0011_B06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0031_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0060_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0050_A07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_A01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0019_A02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0058_A03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0062_B09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0062_G12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_C03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0072_B06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0013_B01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_C04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0045_H01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0098_A07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0056_B04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0062_B05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0047_A05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_G08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0036_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0041_D06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGGTGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0043_B11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0078_A01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCTTC
LVR01_0020_D06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0093_E02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0076_E08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0100_H08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0087_F05.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_G01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0026_A08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0063_D09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0072_A12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0055_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0033_D08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0004_F11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0028_G02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0034_F03.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0089_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0095_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0055_G02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0106_B10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0091_H09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0061_C07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0067_D01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0072_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0037_A01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0099_B07.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0097_A10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0036_G03.b : TGACCGTGGGCAACGCCAT*GTTCGTGCCTGAGCGGCTGAACCTGCTGGAACAGTTCGTC
LVR01_0048_A06.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0094_H11.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0093_G04.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0054_E10.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0016_B08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0065_B09.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0029_C12.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0030_C02.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
TES01_0108_F01.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
TES01_0036_F08.b : TGAACGTGGGCAACGCCAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
LVR01_0104_B12.b : TGAACGTGGGCAACGCTAT*GTTCGTGGATGAGCGGCTGAAGCTGCTGGACAAGTTCGTC
20110601C-000796 : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
---------+---------+---------+---------+---------+---------+ 603
LVR01_0081_E09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_E12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0022_C01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0035_E04.b : CAAGATGCCT*GTGAG*CTGAACTatccccgaggacattctcctcagcttttaacgactc
LVR01_0035_D06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TATTAGGACTC
LVR01_0042_C08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0052_F09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_B09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0068_D01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_C05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0100_C04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_F11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_E09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0016_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0084_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0079_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0016_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_A04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0001_G01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_A01.b : aaatccccttgaacctttcttttcccaagggttttcccccctaccctttaagggaccccc
LVR01_0013_B05.b : CAATATGCAC*GTGAG*CTGACCTTCTCCGATGTCatgtccttccactttactgacacgc
LVR01_0082_C06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCAAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0037_D12.b : CAAGATGCTC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAACGACTC
LVR01_0029_E01.b : CAAGATGCCC*GTGAGACTATACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_G07.b : CAATATGCCC*GTGAT*CTGTACTTCTCCGAGGTCTT*CTCTCTCAGC*TTTAATGACTC
LVR01_0036_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_A01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_E08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0036_H11.b : CAAGATGCCCCGTGAGCTTGTACTTCTCCGAGGTCTT*CTCCATCAGCTTTTAAGGACTC
LVR01_0025_C07.b : CAAGATGCCC*GTGAG*CTGTATTTCTCCGAGGTCTTTCTCCATCAGC*TTTAAGGACTC
LVR01_0040_E09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_E10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0093_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0035_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0019_C09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0052_C06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0052_B06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0026_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_B08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAAC*TTTAAAGACTC
LVR01_0034_H07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_C11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_F07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0025_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0037_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCTTCAGC*TTTAAGGACTC
LVR01_0030_E05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0038_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0035_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0025_E07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_D11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCACCAGC*TTTAAGGACTC
LVR01_0096_F09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0077_C01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0033_H08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0060_D08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_D06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0094_C07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_C06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_E06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0003_D07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_A04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGGGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0038_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0016_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_F11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_C05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_F01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_C09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_C03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_C10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_E05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0036_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_D12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0036_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_G06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0066_A11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0038_B08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0077_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0102_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_E12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_D12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0041_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0035_A09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_C02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0082_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0098_B05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0077_C07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0096_B02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_D09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0039_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0053_C12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_C03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0105_D08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_D07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0066_H08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0005_D01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_C11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_D05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0086_G05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0012_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_E11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTTCATCAGC*TTTAAGGACTC
LVR01_0095_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_C02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0041_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0033_C06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_C12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0061_E09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_G05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0055_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_F03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0082_E12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_E03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAAGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_C10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_D12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0002_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_B05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0005_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_C04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_B09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0039_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_C11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_B04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACCC
LVR01_0091_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0082_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0003_E10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_G11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_H05.b : CTGTATGCCC*CTGAG*CTGTACTTCTCCCATGTCTT*CTCCATCAGC*TTTCATGACTC
LVR01_0038_D06.b : CAAGATGCCC*GGGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0009_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0088_E08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0068_E07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_H04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0073_E07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_F03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_G01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0104_G12.b : CAAGATGCCC*GTGAG*CTGTACCTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0003_B10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_B08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0090_D12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0073_B02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_C08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0100_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0022_G06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0002_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0008_E09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0020_B05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0009_D09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_B04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0020_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_G11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0063_C09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_E05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_B08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_D06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0062_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0103_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_D11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTC*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0057_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_C05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0001_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_D01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0084_H02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_F03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_G09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0096_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0002_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_C03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0084_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_H04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0038_C04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_D05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_G09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_E03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_F11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_G11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0084_D08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0085_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0012_F03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0037_C01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_H08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0015_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_F02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_A01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_H01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0105_G06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_D11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_G07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_H07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTGAGGACTC
LVR01_0017_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_H08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0022_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCACCAGC*TTTAAGGACTC
LVR01_0033_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0071_C09.b : CAAGATACCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0088_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0101_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0101_D03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_D08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0090_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0096_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_G10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0044_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_E04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_D12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0093_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_C10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0102_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0098_F01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_D05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0086_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_E05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_C05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0077_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0046_F07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0092_C09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0063_F10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0062_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0072_D05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0078_D10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_A07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_F09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_H07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_F07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0079_E08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0040_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACCC
LVR01_0074_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_D07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0063_F02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0061_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0093_G01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0071_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0042_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0026_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_E04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0071_E08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0049_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0048_E05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_H01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0071_A09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0051_C07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0014_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0005_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0021_A07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_A04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0033_E04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_F05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_H05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0092_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0076_G02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0003_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0009_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0008_D07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0073_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0039_B04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0066_F02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_F05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0090_B10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_B04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_H05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0103_H07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_E01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0066_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0083_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_C08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_A07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0105_H01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0072_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0103_C06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0005_F12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0021_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0046_B05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0101_E11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_G11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0033_A11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0057_A09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_F06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0073_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0085_F02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCCT*CTCCATCAGC*TTTAAGGACTC
LVR01_0018_H06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0061_H05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0060_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0104_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_H02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0002_H03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAG*TCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0052_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0059_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0059_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0060_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0021_C01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0081_F07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0066_F05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0074_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_H10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0061_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0100_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0085_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_D02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_G05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_D04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0092_H02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_H04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0060_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_A09.b : CAAGATACCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0078_A04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0017_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_A08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0076_C03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_B09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0096_B06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0009_F04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_H02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0057_G03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0088_G01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_H12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0046_F01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0101_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0002_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_F01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_G02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0012_F11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_H01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0094_B03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0100_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0086_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0042_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0011_B06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0031_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0060_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0050_A07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_A01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0019_A02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0058_A03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0062_B09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0062_G12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_C03.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0072_B06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0013_B01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_C04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0045_H01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0098_A07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0056_B04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0062_B05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0047_A05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_G08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0036_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0041_D06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0043_B11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0078_A01.b : AAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTA*GGACTC
LVR01_0020_D06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0093_E02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0076_E08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0100_H08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0087_F05.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_G01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0026_A08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0063_D09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0072_A12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0055_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0033_D08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0004_F11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0028_G02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0034_F03.b : CAAGATGCC**GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0089_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0095_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0055_G02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0106_B10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0091_H09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0061_C07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0067_D01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0072_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTC*CTCCATCAGC*TTTAAGGACTC
LVR01_0037_A01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0099_B07.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0097_A10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0036_G03.b : CAAGATGCCC*GTGAT*CTGTACTTCTCCAAGGTCTT*CCCCCTCATC*TTTAAGGACTC
LVR01_0048_A06.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0094_H11.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0093_G04.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0054_E10.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0016_B08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0065_B09.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0029_C12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0030_C02.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
TES01_0108_F01.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
TES01_0036_F08.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
LVR01_0104_B12.b : CAAGATGCCC*GTGAG*CTGTACTTCTCCGAGGTCTT*CTCCATCAGC*TTTAAGGACTC
20110601C-000796 : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
---------+---------+---------+---------+---------+---------+ 655
LVR01_0081_E09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0056_E12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0022_C01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0081_B03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0035_E04.b : ccatgctgcctcaccgttcctcccccactatggaaacgactagaccacaggggaaaatat
LVR01_0035_D06.b : C*GATGCTGCCA*TAGAG*TTCTTCAA*CACAT*ATG*TAAAGAAATAAGA*CCACGGGG
LVR01_0042_C08.b : C*GATGCTGCCG*TACAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCCAAGGG
LVR01_0052_F09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_G08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0048_B12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0047_B09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0068_D01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0074_C05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0100_C04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0048_A05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_F11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0058_E09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0016_G08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0084_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0079_F12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0099_F08.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0047_H12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0016_F12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0067_A04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0001_G01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0081_A01.b : aagcctgccctaaaatttttcccccccccccttttttaaaaaaaaaaaaaccccggggga
LVR01_0013_B05.b : atgccatcctaccttacatcttatactaagtgatgtataaaactaaaagcgataattatg
LVR01_0082_C06.b : C*GATGCTGGCC*TAAAG*TTCATCCA*CAACT*ATG*TAAAGAA*TAAAA*CCCAGGGG
LVR01_0037_D12.b : C*GATGCTGCCG*TACAG*TTCATCAA*CTACT*ACT*TGAAGAA*TAATATCCAAGGGG
LVR01_0029_E01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0044_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAAA*CCCACGGG
LVR01_0036_H03.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0095_A01.b : C*GATGCTGCCA*TAGAG*TTCATCAAACAACT*ATG*TAAAGAAATAAGA*CCAAGGGG
LVR01_0031_E08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0036_H11.b : C*GATGCTGCCG*TAAAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0025_C07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_E09.b : C*GATGCTGCCG*TAAAG*TTCTTCAA*CAACT*ATG*TGAAGAATAAAGA*CCAAGGGG
LVR01_0095_E10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0093_F04.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGGAGAA*TAAGA*CCAAGGGG
LVR01_0035_H03.b : C*GATGCTGCCA*TAGAGTTTCATCAA*CAACT*ATGTTAAAGAATAAAGA*CCAAGGGG
LVR01_0019_C09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0052_C06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0052_B06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAGAGAA*TAAGA*CCAAAGGG
LVR01_0013_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0026_H06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0043_B08.b : C*GATGCAGCCT*TAGAG*TTCATCCA*CAACT*ATG*TAAAGAA*TAAGA*CCTAGGGG
LVR01_0034_H07.b : C*GATGCTGCCG*TAGAG*TTCGTCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0095_F12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_C11.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0095_F07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0025_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0037_H09.b : C*GATGCTGCCA*TAAAC*TTCATCAC*CTACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0030_E05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0029_D10.b : C*GATGCTGCCG*TAAAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0038_H11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0035_A12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGG*CCAAGGGG
LVR01_0025_E07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CTACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_D11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0096_F09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0077_C01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0033_H08.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0060_D08.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0054_D06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0094_C07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0034_C06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0097_E06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0003_D07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0047_A04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0038_F06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0106_A12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0016_F10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0031_F11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0087_C05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0014_F01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_C09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0054_C03.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0040_C10.b : C*GATGCTGCCA*TAGAG*TTCAACAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0043_E05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0036_A02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*GTG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0034_D12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0036_E01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0106_G08.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0014_G06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0066_A11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0054_B01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0095_F04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0038_B08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0077_A05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0102_H10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_E12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0028_D12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0041_F06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0035_A09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0095_C02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0082_H12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0098_B05.b : C*GATGCTGCCA*TACAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0028_A10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0077_C07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0096_B02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0065_D09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_H06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0034_B12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0039_G12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0053_C12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0081_A12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_G12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_C03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0087_H10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0105_D08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0047_D07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0066_H08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0005_D01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0028_C11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0004_D05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0086_G05.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0012_F06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0045_G10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0065_E11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAAGGG
LVR01_0013_G08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0095_H10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0014_C02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0041_F04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0033_C06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0028_C12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0061_E09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0047_G05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0014_H06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0055_A10.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0015_F03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0082_E12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_E03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_H11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0074_C10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0081_D12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0002_H09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0004_D10.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0095_B05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0031_E02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0091_F10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0005_H12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0029_C04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0050_B09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0039_B11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_C11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0095_B04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0091_A02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0082_B11.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0003_E10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0044_G11.b : C*GATGCTGCCA*TAGTG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0074_H05.b : C*TATGCTGCCA*TATAG*TTCATCAA*CAACT*ATA*TAAAGAA*TACTA*CCAAGGGG
LVR01_0038_D06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATGTAAAAGAA*TAAGA*CCAAAGGG
LVR01_0013_H03.b : C*GATGCTGCCA*TAGAG*TTCACCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0009_A02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0088_E08.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0014_B03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0068_E07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0031_H04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0073_E07.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0049_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0043_F03.b : C*GATGCTGCCA*TAGTG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0011_H09.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0049_G03.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0014_H11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_F12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0004_F10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGAGG
LVR01_0048_G01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0104_G12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0003_B10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0047_B08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0043_D10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0050_A12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0090_D12.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_G07.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0073_B02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_C08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0065_G08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0056_H06.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0100_B11.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0022_G06.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0002_F06.b : C*GATGCTGCCA*TAGGG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0008_E09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0020_B05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0028_H03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0009_D09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0017_B04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0020_D02.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0043_G11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0081_B07.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0063_C09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0065_E05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0065_B08.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0015_D06.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0062_F10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0103_H09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0074_D11.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0050_D04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0057_D02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0106_C05.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0040_H03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0001_G10.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0040_D01.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0084_H02.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_F03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0089_G09.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0096_E01.b : C*GATGCTGCCG*TAGAG*TTCATCAA*CAACT*ATG*TGAAGAA*TAAGA*CCAAGGGG
LVR01_0002_D04.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0029_C03.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0049_G10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*TAAAGAA*TAAGA*CCAAGGGG
LVR01_0084_F10.b : C*GATGCTGCCA*TAGAG*TTCATCAA*CAACT*ATG*T<