[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000815

Length: 907

Sequence [FASTA format sequence]
CTCCTCTTCT CTGGTTCCCT CATCCATGAC CTCTCATCTC TCTGTCCCTT CCTCAGGCAT
CAGAACCTAG TTTACCAGGC GTGAGGCCGG AGGTGCTGCC ATGGCACCCC TGAGGCCCCT
TCTGATGCTG GCCCTGCTGG CATGGGTTGC TCTGGCTGAC CAAGGTGCGG GAGGATATGG
ATATTGGTGA CCATTTGGGT CAATGTAGGG TGGGTAAGTG TGGCCTGGCC TGGGCGGTGC
CAGCTGTCAT ACTCCCTCTC CACAGAGTCG TGCAAGGGCC GCTGCACAGA CGGCTTCATT
GCCGAAAGGA AGTGTCAGTG TGACGAGCTG TGCTCTTACT ACCAGAGCTG CTGCACTGAC
TACGTGGCCG AGTGCAAGCC CCAAGGTGCG TTCAGAGGGG CTGGGCGGGC CTGGGGTCCC
CTCTGCAGCT GGAGACTCAC CACCCCCCTC TTTGTCTGCA GTGACTCGCG GGGATGTATT
CCTTCAGCCA GATGATGAGT ACAGGGCCTA TGACTACCAC GAGGAGACCA GACACAACAC
CAGCGTCCAA GAAGAGCAGA GGATCCCTGT CCTGCTGGCC AAGACTGAAG AGACTCCGGT
TCTGAAACCT GAGGAAGAGG CCCCACCACC TGGGCCTCAG ACTGATGATC TAGGGGTCTC
TGAGGAAGAG CTGTGCAGTG GGAAACCCTT TGATGCCTTC ACCAACCTCA AGAACGGTTC
CGTCTTTGCC TTCCGAGGTG ACTGGAATGG CAGACCTTGG GACTAGGGTC TGCCGCAGGA
GCATCCTGCC TCACACGGCC TCCCTTCCTC TAGGGCTGTA CTGCTATGAG CTGGATGAAA
AGGCAGTGAG GCCTGGGTAC CCCAAGCTCA TCCAAGATGT CTGGGGGGCA TCAAGGGCCC
CATTGAT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVTNvitronectin precursor [Homo sapiens]. 98.65e-51O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVtnvitronectin precursor [Mus musculus]. 923e-48O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480621PREDICTED: similar to Vitronectin precursor (Serum spreading factor) (S-protein) (V75) isoform 3 [Canis familiaris]. 97.82e-51O
Contig/Assembly ProteinLOC480621PREDICTED: similar to Vitronectin precursor (Serum spreading factor) (S-protein) (V75) isoform 2 [Canis familiaris]. 97.82e-51O
Contig/Assembly ProteinLOC480621PREDICTED: similar to Vitronectin precursor (Serum spreading factor) (S-protein) (V75) isoform 1 [Canis familiaris]. 97.82e-51O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVTNvitronectin [Bos taurus]. 1015e-52O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVTNvitronectin precursor [Sus scrofa]. 1932e-83O


Assembly Members: 4      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010071D11LVR01_0071_D11.bBP444468 
LVR010088B10LVR01_0088_B10.bCJ000440 
LVR010092H09LVR01_0092_H09.bCJ000839 
LVRM10007C09LVRM1_0007_C09.bBP138737 AK232690

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
355A110.500WNACT/T
G200.500GCT/A
357C200.500WSACC/T
T110.500ACT/T
451C200.500W-
T110.500


Alignment:      TOP

20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0007_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_D11.b : gttgaacttttcagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_H09.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_B10.b : gccxxxxxxxxxxx
20110601C-000815 : .............CTCCTCTTCTCTGGTTCCCTCATCCATGACCTCTCATCTCTCTGTCC
---------+---------+---------+---------+---------+---------+ 47
LVRM1_0007_C09.b : xxxxxxxxxxxxxCTCCTCTTCTCTGGTTCCCTCATCCATGACCTCTCATCTCTCTGTCC
LVR01_0071_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCATGACCTCTCATCTCTCTGTCC
LVR01_0092_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCATGACCTCTCATCTCTCTGTCC
LVR01_0088_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000815 : CTTCCTCAGGCATCAGAACCTAGTTTACCAGGCGTGAGGCCGGAGGTGCTGCCATGGCAC
---------+---------+---------+---------+---------+---------+ 107
LVRM1_0007_C09.b : CTTCCTCAGGCATCAGAACCTAGTTTACCAGACGTGAGGCCGGAGGTGCTGCCATGGCAC
LVR01_0071_D11.b : CTTCCTCAGGCATCAGAACCTAGTTTACCAGACGTGAGGCCGGAGGTGCTGCCATGGCAC
LVR01_0092_H09.b : CTTCCTCAGGCATCAGAACCTAGTTTACCAGGCGTGAGGCCGGAGGTGCTGCCATGGCAC
LVR01_0088_B10.b : xxxxxxxxxxxxTCAGAACCTAGTTTACCAGGCGTGAGGCCGGAGGTGCTGCCATGGCAC
20110601C-000815 : CCCTGAGGCCCCTTCTGATGCTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGGTG
---------+---------+---------+---------+---------+---------+ 167
LVRM1_0007_C09.b : CCCTGAGGCCCCTTCTGATGCTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGGTG
LVR01_0071_D11.b : CCCTGAGGCCCCTTCTGATGCTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGGTG
LVR01_0092_H09.b : CCCTGAGGCCCCTTCTGATGCTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGGTG
LVR01_0088_B10.b : CCCTGAGGCCCCTTCTGATGCTGGCCCTGCTGGCATGGGTTGCTCTGGCTGACCAAGGTG
20110601C-000815 : CGGGAGGATATGGATATTGGTGACCATTTGGGTCAATGTAGGGTGGGTAAGTGTGGCCTG
---------+---------+---------+---------+---------+---------+ 227
LVRM1_0007_C09.b : CGGGAGGATATGGATATTGGTGACCATTTGGGTCAATGTAGGGTGGGTAAGTGTGGCCTG
LVR01_0071_D11.b : CGGGAGGATATGGATATTGGTGACCATTTGGGTCAATGTAGGGTGGGTAAGTGTGGCCTG
LVR01_0092_H09.b : CGGGAGGATATGGATATTGGTGACCATTTGGGTCAATGTAGGGTGGGTAAGTGTGGCCTG
LVR01_0088_B10.b : CGGGGGGATATGGATATTGGTGACCATTTGGGTCAATGTAGGGTGGGTAAGTGTGGCCTG
20110601C-000815 : GCCTGGGCGGTGCCAGCTGTCATACTCCCTCTCCACAGAGTCGTGCAAGGGCCGCTGCAC
---------+---------+---------+---------+---------+---------+ 287
LVRM1_0007_C09.b : GCCTGGGCGGTGCCAGCTGTCATACTCCCTCTCCACAGAGTCGTGCAAGGGCCGCTGCAC
LVR01_0071_D11.b : GCCTGGGCGGTGCCAGCTGTCATACTCCCTCTCCACAGAGTCGTGCAAGGGCCGCTGCAC
LVR01_0092_H09.b : GCCTGGGCGGTGCCAGCTGTCATACTCCCTCTCCACAGAGTCGTGCAAGGGCCGCTGCAC
LVR01_0088_B10.b : GCCTGGGCGGTGCCAGCTGTCATACTCCCTCTCCACAGAGTCGTGCAAGGGCCGCTGCAC
20110601C-000815 : AGACGGCTTCATTGCCGAAAGGAAGTGTCAGTGTGACGAGCTGTGCTCTTACTACCAGAG
---------+---------+---------+---------+---------+---------+ 347
LVRM1_0007_C09.b : AGACGGCTTCATTGCCGAAAGGAAGTGTCAGTGTGACGAGCTGTGCTCTTACTACCAGAG
LVR01_0071_D11.b : AGACGGCTTCATTGCCGAAAGGAAGTGTCAGTGTGACGAGCTGTGCTCTTACTACCAGAG
LVR01_0092_H09.b : AGACGGCTTCATTGCCGAAAGGAAGTGTCAGTGTGACGAGCTGTGCTCTTACTACCAGAG
LVR01_0088_B10.b : AGACGGCTTCATTGCCGAAAGGAAGTGTCAGTGTGACGAGCTGTGCTCTTACTACCAGAG
20110601C-000815 : CTGCTGCACTGACTACGTGGCCGAGTGCAAGCCCCAAGGTGCGTTCAGAGGGGCTGGGCG
---------+---------+---------+---------+---------+---------+ 407
LVRM1_0007_C09.b : CTGCTGCACTGACTACGTGGCCGAGTGCAAGCCCCAAGGTGCGTTCAGAGGGGCTGGGCG
LVR01_0071_D11.b : CTGCTGCACTGACTACGTGGCCGAGTGCAAGCCCCAAGGTGCGTTCAGAGGGGCTGGGCG
LVR01_0092_H09.b : CTGCTGCGCCGACTACGTGGCCGAGTGCAAGCCCCAAGGTGCGTTCAGAGGGGCTGGGCG
LVR01_0088_B10.b : CTGCTGCGCCGACTACGTGGCCGAGTGCAAGCCCCAAGGTGCGTTCAGAGGGGCTGGGCG
20110601C-000815 : GGCCTGGGGTCCCCTCTGCAGCTGGAGACTCACCACCCCCCTCTTTGTCTGCAGTGACTC
---------+---------+---------+---------+---------+---------+ 467
LVRM1_0007_C09.b : GGCCTGGGGTCCCCTCTGCAGCTGGAGACTCACCACCCCCCTCTTTGTCTGCAGTGACTC
LVR01_0071_D11.b : GGCCTGGGGTCCCCTCTGCAGCTGGAGACTCACCACCCCCCTCTTTGTCTGCAGTGACTC
LVR01_0092_H09.b : GGCCTGGGGTCCCCTCTGCAGCTGGAGACTCACCACCCCCCTCCTTGTCTGCAGTGACTC
LVR01_0088_B10.b : GGCCTGGGGTCCCCTCTGCAGCTGGAGACTCACCACCCCCCTCCTTGTCTGCAGTGACTC
20110601C-000815 : GCGGGGATGTATTCCTTCAGCCAGATGATGAGTACAGGGCCTATGACTACCACGAGGAGA
---------+---------+---------+---------+---------+---------+ 527
LVRM1_0007_C09.b : GCGGGGATGTATTCCTTCAGCCAGATGATGAGTACAGGGCCTATGACTACCACGAGGAGA
LVR01_0071_D11.b : GCGGGGATGTATTCCTTCAGCCAGATGATGAGTACAGGGCCTATGACTACCACGAGGAGA
LVR01_0092_H09.b : GCGGGGATGTATTCCTTCAGCCAGATGATGAGTACAGGGCCTATGACTACCACGAGGAGA
LVR01_0088_B10.b : GCGGGGATGTATTCCTTCAGCCAGATGATGAGTACAGGGCCTATGACTACCACGAGGAGA
20110601C-000815 : CCAGACACAACACCAGCGTCCAAGAAGAGCAGAGGATCCCTGTCCTGCTGGCCAAGACTG
---------+---------+---------+---------+---------+---------+ 587
LVRM1_0007_C09.b : CCAGACACAACACCAGCGTCCAAGAAGAGCAGAGGATCCCTGTCCTGCTGGCCAAGACTG
LVR01_0071_D11.b : CCAGACACAACACCAGCGTCCAAGAAGAGCAGAGGATCCCTGTCCTGCTGGCCAAGACTG
LVR01_0092_H09.b : CCAGACACAACACCAGCGTCCAAGAAGAGCAGAGGATCCCTGTCCTGCTGGCCAAGACTG
LVR01_0088_B10.b : CCAGACACAACACCAGCGTCCAAGAAGAGCAGAGGATCCCTGTCCTGCTGGCCAAGACTG
20110601C-000815 : AAGAGACTCCGGTTCTGAAACCTGAGGAAGAGGCCCCACCACCTGGGCCTCAGACTGATG
---------+---------+---------+---------+---------+---------+ 647
LVRM1_0007_C09.b : AAGAGACTCCGGTTCTGAAACCTGAGGAAGAGGCCCCACCACCTGGGCCTCAGACTGATG
LVR01_0071_D11.b : AAGAGACTCCGGTTCTGAAACCTGAGGAAGAGGCCCCACCACCTGGGCCTCAGACTGATG
LVR01_0092_H09.b : AAGAGACTCCGGTTCTGAAACCTGAGGAAGAGGCCCCACCACCTGGGCCTCAGACTGATG
LVR01_0088_B10.b : AAGAGACTCCGGTTCTGAAACCTGAGGAAGAGGCCCCACCACCTGGGCCTCAGACTGATG
20110601C-000815 : ATCTAGGGGTCTCTGAGGAAGAGCTGTGCAGTGGGAAACCCTTTGATGCCTTCACCAACC
---------+---------+---------+---------+---------+---------+ 707
LVRM1_0007_C09.b : ATCTAGTGGTCCCTGAGGAAGAGCTGGGCAGTGGGAAACCCTTGGATGCCTT*ACCAACC
LVR01_0071_D11.b : ATCTAGGGGTCCCTGAGGAAGAGCTGTGCAGTGGGAAACCCTTTGATGCCTTCACCAACC
LVR01_0092_H09.b : ATCTAGGGGTCTCTGAGGAAGAGCTGTGCAGTGGGAAACCCTTTGATGCCTTCACCAACC
LVR01_0088_B10.b : ATCTAGGGGTCTCTGAGGAAGAGCTGTGCAGTGGGAAACCCTTTGATGCCTTCACCAACC
20110601C-000815 : TCAAGAACGGTTCCGTCTTTGCCTTCCGAGGTGACTGGAATGGCAGACCTTGGGACTAGG
---------+---------+---------+---------+---------+---------+ 767
LVRM1_0007_C09.b : TTAAGAACGGTTC*GTCTTTGCCTTCCGAGGTGACTGGAATGGCt
LVR01_0071_D11.b : TCAAGAACGGTTCCGTCTTTGCCTTCCGAGGTGACTGGAATGGCAGACCTTGGGACTAGG
LVR01_0092_H09.b : TCAAGAACGGTTCCGTCTTTGCCTTCCGAGGTGACTGGAATGGCAGACCTTGGGACTAGG
LVR01_0088_B10.b : TCAAGAACGGTTCCGTCTTTGCCTTCCGAGGTGACTGGAATGGCAGACCTTGGGACTAGG
20110601C-000815 : GTCTGCCGCAGGAGCATCCTGCCTCACACGGCCTCCCTTCCTCTAGGGCTGTACTGCTAT
---------+---------+---------+---------+---------+---------+ 827
LVRM1_0007_C09.b :
LVR01_0071_D11.b : GTCTGCCGCAGGAGCATCCTGCCTCACACGGCCTCCCTTCCTCTTAGACTGTACTGCTAT
LVR01_0092_H09.b : GTCTGCCGCAGGAGCATCCTGCCTCACACGGCCTCCCTTCCTCTAGGGCTGTACTGCTAT
LVR01_0088_B10.b : GTCTGCCGCAGGAGCATCCTGCCTCACACGGCCTCCCTTCCTCTAGGGCTGTACTGCTAT
20110601C-000815 : GAGCTGGATGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTC*ATCCAAGATGTCTGGGG
---------+---------+---------+---------+---------+---------+ 886
LVRM1_0007_C09.b :
LVR01_0071_D11.b : GAGCTGGATGAAAAGGCAATGAGGCCCTGGTACCCCAAGCTC*ATCCAAGATGTCTGGGG
LVR01_0092_H09.b : GAGCTGGATGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTC*ATCCAAGATGTCTGGGG
LVR01_0088_B10.b : GAGCTGGGTGAAAAGGCAGTGAGGCCTGGGTACCCCAAGCTCCATCCAAAATGTCTGGGG
20110601C-000815 : GGCATCAAGGGCCCCATTGAT.......................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b : catcaagggccccattgattccgccttcccccgcctcaactgttaggggaaaacctacct
LVR01_0092_H09.b : **CATCAGGGGCCCCATTGATgccgccttcacccgcatcaactgtcaagggagaacctac
LVR01_0088_B10.b : GGCATCAAGGGCCCCATTGATtgccgcctttcaccccgcaccaactgtcagggggaagac
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b : cttcaagggacccagcccaggggctgtggggtcagggttcaagcttttcctcacccggg
LVR01_0092_H09.b : ctcttcaaggtaccagcccaagggctgtgggtcaggggtcaaggcctttctccaccaggg
LVR01_0088_B10.b : ctacctttttccaggtaccagccccaagggcttgtgggtcaagggtcaaaggctatcctc
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b :
LVR01_0092_H09.b : ctttgagggctactatgccccagaacctgaatgggcccaaaagggtgggatccccgccct
LVR01_0088_B10.b : acccaggggctttgagggcttactatgccccaggaacctgaattggggccagaaagggct
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b :
LVR01_0092_H09.b : gggggtccccggcctggggaacttttttggggaaaattaaaaacccccaaaggggctccc
LVR01_0088_B10.b : gggattcccacccctgggggtcccccctgggttgggaaactctttttggggaaaataaaa
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b :
LVR01_0092_H09.b : ggggtcctttgggggcaaaaaaaccccccggggggaaaaatagggggcctggccctgccc
LVR01_0088_B10.b : aaaaccccccaaggggctccccgcggttctttggggggcaaaacacaaaccccctggggg
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b :
LVR01_0092_H09.b : cccctttgtgtggggggggtggaagagggaaaaccct
LVR01_0088_B10.b : aaaaaaaaaggggggctttgtccctttcccccttttttgggggggggggggagagaagag
20110601C-000815 : ............................................................
---------+---------+---------+---------+---------+---------+ 907
LVRM1_0007_C09.b :
LVR01_0071_D11.b :
LVR01_0092_H09.b :
LVR01_0088_B10.b : aaaaccttcttttcgcccccccccccccccccccccccccca