[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000819

Length: 1,086

Sequence [FASTA format sequence]
GATGCCGATA TAAGAGCCGG GCCAGCGCTA CCTGGGCCAC AGTCTTCGCG GAGAGTCGCT
GCGGTTTCCT GCTTCAACAG TGCTTGGACG GAACCCGGCG CTCGTCACCC GCCCCGGCCG
GCCGCTCAGA GCCAGCCCTC GCCACCTCTT CACAGCGCCC TCGGACCGCC CCAAGGCCAC
CGCCACCGCT CCCGCGCCGC TGCCGCCACC ACCGCTCCTC AGCCTCCCGC CATGACGACC
TCGTGCTCCT CGCAGGTGCG CCAGAACTAC CACCAGGACT CGGAGGCGGC CATCAACCGC
CAGATCAACC TGGAGCTCTA TGCCTCCTAC GTCTACCTGT CCATGTCATA CTATTTTGAC
CGCGATGATG TGGCTTTGAA GAACTTTGCC AAATACTTTC TTCACCAATC TCATGAGGAG
AGGGAACATG CTGAGAAACT GATGAAGCTG CAGAACCAAC GAGGTGGCCG AATCTTCCTT
CAGGATATCA AGAAACCGGA GCGCGATGAC TGGGAGAATG GGCTGACTGC CATGGAATGT
GCGCTGCACT TGGAAAAAAA CGTGAATCAG TCCCTGCTGG AACTGCACAA ACTGGCCACT
GACAAAAATG ACCCCCACTT GTGTGACTTC ATTGAGACGC ATTACCTGGA TGAGCAGGTG
AAAGCCATCA AAGAATTGGG TGACCACATT ACCAACTTGC ACAGGATGGG GGCCCCCGAG
TATGGCATGG CCGAGTATCT CTTTGACAAG CACACCCTGG GGAGCAGTGA GAGCTAAGCC
CTAAGCTGGC CTCCCGGAGA CACGGGGTGA CCCCCCCGGT CACCAAAGCA GTGCATGCAT
GTTTCGGGTT ACCGTCACCT TTTCTATAAG TCCTACCAGA ACATCTACTT CAGTTCTTTC
CTTAGTGTAC CATTCCTTCA AATAAAGTAA TTTGGTACCC AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
GCACAAAAAA AAACCAAGCT GCCAGGTCGC CGGCCCCTCT AAAAGTATCC CCTCAAGGGG
GCCCCA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFTH1ferritin heavy chain [Homo sapiens]. 3392e-93O
Contig/Assembly ProteinFTMTferritin, mitochondrial precursor [Homo sapiens]. 2931e-79O
Contig/Assembly ProteinFTHL17ferritin heavy polypeptide-like 17 [Homo sapiens]. 2293e-60O
Contig/Assembly ProteinFTLferritin light chain [Homo sapiens]. 2188e-57O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFth1ferritin heavy chain [Mus musculus]. 3309e-91O
Contig/Assembly ProteinFtmtferritin, mitochondrial precursor [Mus musculus]. 2915e-79O
Contig/Assembly ProteinGm14511hypothetical protein LOC434727 [Mus musculus]. 2056e-53O
Contig/Assembly ProteinGm5634hypothetical protein LOC434726 [Mus musculus]. 2047e-53O
Contig/Assembly ProteinFtl1ferritin light chain 1 [Mus musculus]. 2002e-51O
Contig/Assembly ProteinGm5635ferritin, heavy polypeptide-like [Mus musculus]. 1971e-50O
Contig/Assembly ProteinGm14499PREDICTED: ferritin heavy polypeptide-like 17-like [Mus musculus]. 1955e-50O
Contig/Assembly ProteinFthl17ferritin heavy polypeptide-like 17 [Mus musculus]. 1932e-49O
Contig/Assembly ProteinGm14458hypothetical protein LOC100042782 [Mus musculus]. 1932e-49O
Contig/Assembly ProteinLOC434624PREDICTED: ferritin light chain 1-like [Mus musculus]. 1819e-46O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFTH1ferritin heavy chain [Canis lupus familiaris]. 3423e-94O
Contig/Assembly ProteinLOC100499480ferritin, heavy polypeptide 1 [Canis lupus familiaris]. 3423e-94O
Contig/Assembly ProteinLOC478376PREDICTED: similar to Ferritin heavy chain (Ferritin H subunit) (Proliferation-inducing gene 15 protein) [Canis familiaris]. 2786e-75O
Contig/Assembly ProteinLOC487855PREDICTED: similar to ferritin, heavy polypeptide 1 [Canis familiaris]. 2508e-68O
Contig/Assembly ProteinLOC608550PREDICTED: similar to mitochondrial ferritin [Canis familiaris]. 2348e-62O
Contig/Assembly ProteinLOC481426PREDICTED: similar to mitochondrial ferritin [Canis familiaris]. 2348e-62O
Contig/Assembly ProteinFTLferritin light chain [Canis lupus familiaris]. 2132e-55O
Contig/Assembly ProteinLOC479746PREDICTED: similar to Ferritin light chain 2 (Ferritin L subunit 2) (Ferritin subunit LG) [Canis familiaris]. 1963e-50O
Contig/Assembly ProteinLOC612277PREDICTED: similar to Ferritin heavy chain (Ferritin H subunit) [Canis familiaris]. 1949e-50O
Contig/Assembly ProteinLOC612257PREDICTED: similar to Ferritin heavy chain (Ferritin H subunit) [Canis familiaris]. 1949e-50O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFTH1ferritin heavy chain [Bos taurus]. 3354e-92O
Contig/Assembly ProteinLOC782705PREDICTED: ferritin heavy chain-like [Bos taurus]. 3301e-90O
Contig/Assembly ProteinLOC782705PREDICTED: ferritin heavy chain-like [Bos taurus]. 3301e-90O
Contig/Assembly ProteinLOC513842PREDICTED: ferritin heavy chain-like isoform 1 [Bos taurus]. 3232e-88O
Contig/Assembly ProteinLOC513842PREDICTED: ferritin heavy chain-like [Bos taurus]. 3232e-88O
Contig/Assembly ProteinFTMTferritin, mitochondrial precursor [Bos taurus]. 2893e-78O
Contig/Assembly ProteinLOC513925PREDICTED: ferritin heavy chain-like [Bos taurus]. 2433e-64O
Contig/Assembly ProteinLOC513925PREDICTED: ferritin heavy chain-like [Bos taurus]. 2433e-64O
Contig/Assembly ProteinLOC788801PREDICTED: ferritin light chain-like [Bos taurus]. 2132e-55O
Contig/Assembly ProteinFTLferritin light chain [Bos taurus]. 2132e-55O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFTH1ferritin heavy chain [Sus scrofa]. 3401e-93O
Contig/Assembly ProteinLOC100524926PREDICTED: ferritin, mitochondrial-like [Sus scrofa]. 2901e-78O
Contig/Assembly ProteinLOC100154515PREDICTED: ferritin heavy chain-like [Sus scrofa]. 2331e-61
Contig/Assembly ProteinLOC100625618PREDICTED: ferritin heavy chain-like [Sus scrofa]. 2323e-61O
Contig/Assembly ProteinLOC100625302PREDICTED: hypothetical protein LOC100625302 [Sus scrofa]. 2162e-56
Contig/Assembly ProteinLOC100523709PREDICTED: ferritin-1, chloroplastic-like [Sus scrofa]. 2162e-56
Contig/Assembly ProteinLOC100524231PREDICTED: ferritin heavy chain-like [Sus scrofa]. 2123e-55O
Contig/Assembly ProteinLOC100624737PREDICTED: ferritin heavy chain-like [Sus scrofa]. 2123e-55O
Contig/Assembly ProteinFTLPREDICTED: ferritin light chain isoform 1 [Sus scrofa]. 2114e-55O
Contig/Assembly ProteinLOC100625511PREDICTED: ferritin heavy chain-like [Sus scrofa]. 1662e-41O


Assembly Members: 845      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010005E06ADR01_0005_E06.bDB781971 
ADR010011A02ADR01_0011_A02.bDB782456 
ADR010026C03ADR01_0026_C03.bDB783771 
ADR010032G05ADR01_0032_G05.bDB784362 
ADR010033A01ADR01_0033_A01.bDB784381 
ADR010041C08ADR01_0041_C08.bDB785128 
ADR010050A01ADR01_0050_A01.bDB785909 
ADR010068F08ADR01_0068_F08.bDB787566 
ADR010073G03ADR01_0073_G03.bDB788007 
ADR010074C06ADR01_0074_C06.bDB788053 
ADR010087H10ADR01_0087_H10.bDB789269 
ADR010092C02ADR01_0092_C02.bDB789651 
ADR010101A11ADR01_0101_A11.bDB790446 
AMP010015G02AMP01_0015_G02.bBW956113 
AMP010033H10AMP01_0033_H10.bBW957402 
BFLT10026G05BFLT1_0026_G05.bFS642142 
BFLT10034H03BFLT1_0034_H03.bFS642816 
BFLT10043G09BFLT1_0043_G09.bFS643456 
BFLT10051D08BFLT1_0051_D08.bFS644025 
BFLT10060E10BFLT1_0060_E10.bFS644766 
BFLT10087B09BFLT1_0087_B09.bFS646870 
BFLT10090D06BFLT1_0090_D06.bFS647138 
BFLT10096F09BFLT1_0096_F09.bFS647670 
BFLT10115A11BFLT1_0115_A11.bHX202953 
BFLT10121H11BFLT1_0121_H11.bHX203519 
BFLT10130B02BFLT1_0130_B02.bHX204161 
BFLT10148D07BFLT1_0148_D07.b  
BKFL10005B03BKFL1_0005_B03.bFS648125 
BKFL10016D10BKFL1_0016_D10.bFS648957 
BKFL10032F06BKFL1_0032_F06.bFS650113 
BKFL10043A02BKFL1_0043_A02.bFS651059 
BMWN10010H12BMWN1_0010_H12.bHX206260 
BMWN10016G11BMWN1_0016_G11.bHX206555 
BMWN10017A08BMWN1_0017_A08.bHX206569 
BMWN10023A07BMWN1_0023_A07.bHX206942 
BMWN10023H05BMWN1_0023_H05.bHX206993 
BMWN10024C08BMWN1_0024_C08.bHX207016 
BMWN10024H03BMWN1_0024_H03.bHX207051 
BMWN10025D12BMWN1_0025_D12.bHX207087 
BMWN10025G06BMWN1_0025_G06.bHX207108 
BMWN10026B08BMWN1_0026_B08.bHX207136 
BMWN10030H04BMWN1_0030_H04.b  
BMWN10032H05BMWN1_0032_H05.bHX207581 
BMWN10035B02BMWN1_0035_B02.bHX207728 
BMWN10035D07BMWN1_0035_D07.bHX207747 
BMWN10041H03BMWN1_0041_H03.b  
BMWN10042A10BMWN1_0042_A10.bHX208087 
BMWN10042C09BMWN1_0042_C09.bHX208099 
BMWN10043F11BMWN1_0043_F11.bHX208141 
BMWN10046F02BMWN1_0046_F02.bHX208302 
BMWN10047B01BMWN1_0047_B01.bHX208342 
BMWN10049A10BMWN1_0049_A10.bHX208494 
BMWN10052A12BMWN1_0052_A12.bHX208720 
BMWN10058E10BMWN1_0058_E10.b  
BMWN10060H10BMWN1_0060_H10.bHX209249 
BMWN10061F12BMWN1_0061_F12.bHX209290 
BMWN10061G11BMWN1_0061_G11.bHX209299 
BMWN10064F02BMWN1_0064_F02.bHX209473 
BMWN10071E11BMWN1_0071_E11.bHX209922 
BMWN10073D05BMWN1_0073_D05.b  
BMWN10073E04BMWN1_0073_E04.bHX210050 
BMWN10077C04BMWN1_0077_C04.b  
BMWN10077F02BMWN1_0077_F02.bHX210310 
BMWN10080B09BMWN1_0080_B09.b  
BMWN10081F01BMWN1_0081_F01.bHX210564 
BMWN10083D02BMWN1_0083_D02.bHX210682 
BMWN10094E07BMWN1_0094_E07.bHX211383 
BMWN10096G01BMWN1_0096_G01.bHX211524 
BMWN10100G05BMWN1_0100_G05.b  
CBLT10004E01CBLT1_0004_E01.bHX212023 
CBLT10007C05CBLT1_0007_C05.bHX212261 
CBLT10008F03CBLT1_0008_F03.bHX212365 
CBLT10008H08CBLT1_0008_H08.bHX212391 
CBLT10009B04CBLT1_0009_B04.bHX212404 
CBLT10012D05CBLT1_0012_D05.bHX212652 
CBLT10012E01CBLT1_0012_E01.bHX212659 
CBLT10013C07CBLT1_0013_C07.bHX212714 
CBLT10013H07CBLT1_0013_H07.bHX212757 
CBLT10014A04CBLT1_0014_A04.bHX212762 
CBLT10014B12CBLT1_0014_B12.bHX212777 
CBLT10015A10CBLT1_0015_A10.bHX212835 
CBLT10017C01CBLT1_0017_C01.bHX212988 
CBLT10018B10CBLT1_0018_B10.bHX213064 
CBLT10018H11CBLT1_0018_H11.bHX213122 
CBLT10021F11CBLT1_0021_F11.bHX213327 
CBLT10025D07CBLT1_0025_D07.bHX213597 
CBLT10025F07CBLT1_0025_F07.bHX213618 
CBLT10027B11CBLT1_0027_B11.bHX213732 
CBLT10029G02CBLT1_0029_G02.bHX213884 
CBLT10030B01CBLT1_0030_B01.bHX213901 
CBLT10030E08CBLT1_0030_E08.b  
CBLT10031G02CBLT1_0031_G02.bHX214011 
CBLT10033H10CBLT1_0033_H10.bHX214155 
CBLT10034D06CBLT1_0034_D06.bHX214186 
CBLT10034G02CBLT1_0034_G02.bHX214211 
CBLT10034H06CBLT1_0034_H06.bHX214225 
CBLT10035A07CBLT1_0035_A07.bHX214231 
CBLT10038B02CBLT1_0038_B02.bHX214427 
CBLT10039D02CBLT1_0039_D02.bHX214507 
CBLT10039H06CBLT1_0039_H06.bHX214542 
CBLT10040B08CBLT1_0040_B08.bHX214551 
CBLT10047F04CBLT1_0047_F04.bHX214985 
CBLT10049A05CBLT1_0049_A05.b  
CBLT10051H08CBLT1_0051_H08.bHX215268 
CBLT10052C11CBLT1_0052_C11.bHX215295 
CBLT10053B09CBLT1_0053_B09.bHX215355 
CBLT10054D07CBLT1_0054_D07.bHX215456 
CBLT10055E10CBLT1_0055_E10.bHX215548 
CBLT10057A02CBLT1_0057_A02.bHX215664 
CBLT10057H12CBLT1_0057_H12.b  
CBLT10060A08CBLT1_0060_A08.bHX215880 
CBLT10061H12CBLT1_0061_H12.b  
CBLT10063A06CBLT1_0063_A06.bHX216110 
CBLT10066H11CBLT1_0066_H11.bHX216434 
CBLT10067B08CBLT1_0067_B08.bHX216453 
CBLT10068E07CBLT1_0068_E07.bHX216575 
CBLT10069A05CBLT1_0069_A05.bHX216610 
CBLT10071F10CBLT1_0071_F10.bHX216836 
CBLT10073G07CBLT1_0073_G07.bHX217011 
CBLT10074A06CBLT1_0074_A06.bHX217033 
CBLT10074D10CBLT1_0074_D10.bHX217069 
CBLT10074H04CBLT1_0074_H04.bHX217108 
CBLT10075E11CBLT1_0075_E11.bHX217169 
CBLT10077E05CBLT1_0077_E05.bHX217329 
CBLT10077H02CBLT1_0077_H02.bHX217354 
CBLT10081D06CBLT1_0081_D06.bHX217601 
CBLT10083A01CBLT1_0083_A01.bHX217711 
CBLT10083A03CBLT1_0083_A03.bHX217713 
CBLT10083G09CBLT1_0083_G09.bHX217776 
CBLT10085B12CBLT1_0085_B12.bHX217876 
CBLT10086C04CBLT1_0086_C04.bHX217960 
CBLT10086D08CBLT1_0086_D08.bHX217973 
CBLT10086H08CBLT1_0086_H08.bHX218012 
CBLT10088A06CBLT1_0088_A06.bHX218108 
CBLT10088G05CBLT1_0088_G05.bHX218174 
CBLT10090F11CBLT1_0090_F11.bHX218333 
CBLT10093E09CBLT1_0093_E09.bHX218568 
CLNT10004E04CLNT1_0004_E04.bFS657362 
CLNT10023H03CLNT1_0023_H03.bFS658896 
CLNT10058D08CLNT1_0058_D08.bFS661633 
CLNT10080H05CLNT1_0080_H05.b  
CLNT10111D03CLNT1_0111_D03.bHX219995 
CLNT10136C04CLNT1_0136_C04.bHX221905 
CLNT10138D10CLNT1_0138_D10.bHX222061 
DCI010055B06DCI01_0055_B06.bDB794563 
HTMT10001D11HTMT1_0001_D11.b  
HTMT10004F05HTMT1_0004_F05.bFS664585 
HTMT10006G01HTMT1_0006_G01.bFS664708 
HTMT10008A11HTMT1_0008_A11.bFS664783 
HTMT10008B11HTMT1_0008_B11.bFS664791 
HTMT10009H03HTMT1_0009_H03.bFS664890 
HTMT10011A08HTMT1_0011_A08.bFS664978 
HTMT10011B09HTMT1_0011_B09.bFS664988 
HTMT10011D11HTMT1_0011_D11.bFS665007 
HTMT10014A11HTMT1_0014_A11.bFS665189 
HTMT10016B12HTMT1_0016_B12.bFS665346 
HTMT10017D09HTMT1_0017_D09.bFS665443 
HTMT10017H11HTMT1_0017_H11.bFS665483 
HTMT10018F03HTMT1_0018_F03.bFS665535 
HTMT10019F04HTMT1_0019_F04.bFS665616 
HTMT10021B01HTMT1_0021_B01.bFS665722 
HTMT10021B03HTMT1_0021_B03.bFS665724 
HTMT10021F03HTMT1_0021_F03.bFS665762 
HTMT10022C08HTMT1_0022_C08.bFS665819 
HTMT10023E02HTMT1_0023_E02.bFS665912 
HTMT10023F06HTMT1_0023_F06.bFS665924 
HTMT10023G12HTMT1_0023_G12.bFS665940 
HTMT10023H06HTMT1_0023_H06.bFS665945 
HTMT10024D01HTMT1_0024_D01.bFS665981 AK344744
HTMT10026B10HTMT1_0026_B10.bFS666107 
HTMT10026C03HTMT1_0026_C03.bFS666111 
HTMT10027E09HTMT1_0027_E09.bFS666211 
HTMT10027G06HTMT1_0027_G06.bFS666229 
HTMT10030E07HTMT1_0030_E07.bFS666431 
HTMT10032B06HTMT1_0032_B06.bFS666541 
HTMT10032E03HTMT1_0032_E03.bFS666556 
HTMT10033H05HTMT1_0033_H05.bFS666643 
HTMT10035A06HTMT1_0035_A06.bFS666706 
HTMT10035G07HTMT1_0035_G07.bFS666754 
HTMT10038A07HTMT1_0038_A07.bFS666870 
HTMT10039H04HTMT1_0039_H04.bFS666971 
HTMT10041G04HTMT1_0041_G04.bFS667085 
HTMT10041G12HTMT1_0041_G12.bFS667091 
HTMT10045E12HTMT1_0045_E12.bFS667358 
HTMT10046G12HTMT1_0046_G12.bFS667456 
HTMT10048A10HTMT1_0048_A10.bFS667555 
HTMT10048D05HTMT1_0048_D05.bFS667577 
HTMT10048H02HTMT1_0048_H02.bFS667613 
HTMT10049F06HTMT1_0049_F06.bFS667673 
HTMT10050E08HTMT1_0050_E08.bFS667745 
HTMT10050G08HTMT1_0050_G08.bFS667765 
HTMT10051C07HTMT1_0051_C07.bFS667803 
HTMT10052C10HTMT1_0052_C10.bFS667874 AK392136
HTMT10052D08HTMT1_0052_D08.b  
HTMT10053E12HTMT1_0053_E12.bFS667975 
HTMT10053H10HTMT1_0053_H10.bFS668003 
HTMT10054B08HTMT1_0054_B08.bFS668020 
HTMT10056E04HTMT1_0056_E04.bFS668184 
HTMT10056E08HTMT1_0056_E08.bFS668187 
HTMT10056H05HTMT1_0056_H05.bFS668213 
HTMT10056H08HTMT1_0056_H08.bFS668216 
HTMT10058E02HTMT1_0058_E02.bFS668330 
HTMT10059E11HTMT1_0059_E11.bFS668415 
HTMT10060E07HTMT1_0060_E07.bFS668484 
HTMT10061A05HTMT1_0061_A05.bFS668521 
HTMT10061C03HTMT1_0061_C03.bFS668537 
HTMT10062B05HTMT1_0062_B05.bFS668603 
HTMT10062C11HTMT1_0062_C11.b  
HTMT10065B07HTMT1_0065_B07.bFS668822 
HTMT10066C09HTMT1_0066_C09.bFS668908 
HTMT10066C11HTMT1_0066_C11.bFS668910 
HTMT10066G02HTMT1_0066_G02.bFS668939 
HTMT10068G10HTMT1_0068_G10.bFS669095 
HTMT10069C03HTMT1_0069_C03.bFS669125 
HTMT10072H06HTMT1_0072_H06.b  
HTMT10073G06HTMT1_0073_G06.bFS669426 
HTMT10077E11HTMT1_0077_E11.bFS669696 
HTMT10078D10HTMT1_0078_D10.bFS669750 
HTMT10079E08HTMT1_0079_E08.bFS669819 
HTMT10079H11HTMT1_0079_H11.bFS669847 
HTMT10080H07HTMT1_0080_H07.b  
HTMT10081F11HTMT1_0081_F11.b  
HTMT10082A09HTMT1_0082_A09.bFS669958 
HTMT10085D04HTMT1_0085_D04.bFS670180 
HTMT10086F03HTMT1_0086_F03.bFS670274 
HTMT10087F06HTMT1_0087_F06.bFS670351 
HTMT10087H12HTMT1_0087_H12.bFS670374 
HTMT10088G10HTMT1_0088_G10.bFS670438 
HTMT10089E07HTMT1_0089_E07.bFS670489 
HTMT10091A02HTMT1_0091_A02.bFS670589 
HTMT10091G09HTMT1_0091_G09.bFS670653 
HTMT10091H05HTMT1_0091_H05.bFS670661 
HTMT10092G12HTMT1_0092_G12.bFS670737 
HTMT10096H10HTMT1_0096_H10.bFS671036 
HTMT10098B02HTMT1_0098_B02.bFS671118 
HTMT10098E02HTMT1_0098_E02.bFS671149 
HTMT10100A06HTMT1_0100_A06.bFS671269 
HTMT10100E10HTMT1_0100_E10.bFS671311 
HTMT10101A11HTMT1_0101_A11.bHX223253 
HTMT10101D06HTMT1_0101_D06.bHX223271 
HTMT10101G05HTMT1_0101_G05.bHX223296 
HTMT10103H08HTMT1_0103_H08.bHX223449 
HTMT10105C08HTMT1_0105_C08.bHX223555 
HTMT10105G02HTMT1_0105_G02.bHX223585 
HTMT10106B12HTMT1_0106_B12.bHX223620 
HTMT10108C08HTMT1_0108_C08.bHX223775 
HTMT10108E05HTMT1_0108_E05.bHX223792 
HTMT10108H11HTMT1_0108_H11.b  
HTMT10111B08HTMT1_0111_B08.bHX223985 
HTMT10111G04HTMT1_0111_G04.bHX224029 
HTMT10112E11HTMT1_0112_E11.bHX224088 
HTMT10113E02HTMT1_0113_E02.b  
HTMT10116B05HTMT1_0116_B05.b  
HTMT10116E03HTMT1_0116_E03.b  
HTMT10116G03HTMT1_0116_G03.b  
HTMT10117D02HTMT1_0117_D02.b  
HTMT10118C02HTMT1_0118_C02.b  
HTMT10120C10HTMT1_0120_C10.b  
HTMT10121G02HTMT1_0121_G02.b  
HTMT10122C01HTMT1_0122_C01.bHX224681 
HTMT10122F03HTMT1_0122_F03.bHX224697 
HTMT10123F08HTMT1_0123_F08.b  
HTMT10125E09HTMT1_0125_E09.b  
HTMT10126D03HTMT1_0126_D03.bHX224907 
HTMT10127A07HTMT1_0127_A07.bHX224956 
HTMT10127H10HTMT1_0127_H10.b  
HTMT10129G12HTMT1_0129_G12.b  
HTMT10132H11HTMT1_0132_H11.b  
HTMT10132H12HTMT1_0132_H12.bHX225275 
HTMT10133E08HTMT1_0133_E08.bHX225323 
HTMT10137C08HTMT1_0137_C08.bHX225599 
HTMT10139H03HTMT1_0139_H03.bHX225806 
HTMT10142C04HTMT1_0142_C04.bHX225984 
HTMT10144B11HTMT1_0144_B11.bHX226132 
HTMT10145A01HTMT1_0145_A01.bHX226191 
HTMT10146B04HTMT1_0146_B04.bHX226279 
HTMT10147A12HTMT1_0147_A12.bHX226341 
HTMT10149C02HTMT1_0149_C02.b  
HTMT10150G07HTMT1_0150_G07.bHX226589 
HTMT10150H04HTMT1_0150_H04.bHX226595 
HTMT10151F12HTMT1_0151_F12.bHX226653 
ILNT10002F09ILNT1_0002_F09.bHX226881 
ILNT10002G11ILNT1_0002_G11.bHX226893 
ILNT10003H09ILNT1_0003_H09.bHX226986 
ILNT10006A09ILNT1_0006_A09.bHX227153 
ILNT10009E03ILNT1_0009_E03.bHX227415 
ILNT10013D04ILNT1_0013_D04.bHX227720 
ILNT10014D05ILNT1_0014_D05.bHX227807 
ILNT10027A11ILNT1_0027_A11.bHX228773 
ILNT10028G06ILNT1_0028_G06.bHX228909 
ILNT10033C10ILNT1_0033_C10.bHX229278 
ILNT10036D04ILNT1_0036_D04.bHX229536 
ILNT10039G09ILNT1_0039_G09.bHX229819 
ILNT10040D10ILNT1_0040_D10.bHX229873 
ILNT10041D07ILNT1_0041_D07.bHX229954 
ILNT10042B06ILNT1_0042_B06.bHX230011 
ILNT10044D04ILNT1_0044_D04.bHX230192 
ILNT10049B01ILNT1_0049_B01.bHX230563 
ILNT10050G06ILNT1_0050_G06.bHX230704 
ILNT10051G02ILNT1_0051_G02.bHX230781 
ILNT10054G02ILNT1_0054_G02.bHX231025 
ILNT10055A02ILNT1_0055_A02.bHX231047 
ILNT10056A07ILNT1_0056_A07.bHX231131 
ILNT10056B12ILNT1_0056_B12.bHX231148 
ILNT10056H01ILNT1_0056_H01.bHX231203 
ILNT10056H07ILNT1_0056_H07.bHX231208 
ILNT10060E06ILNT1_0060_E06.bHX231503 
ILNT10069C02ILNT1_0069_C02.bHX232234 
ILNT10071D05ILNT1_0071_D05.bHX232410 
ILNT10074B12ILNT1_0074_B12.bHX232634 
ILNT10079B04ILNT1_0079_B04.bHX233029 
ILNT10079B07ILNT1_0079_B07.b  
ILNT10080E11ILNT1_0080_E11.bHX233139 
ILNT10083C02ILNT1_0083_C02.b  
ILNT10084E03ILNT1_0084_E03.bHX233459 
ILNT10085A03ILNT1_0085_A03.bHX233500 
ILNT10086B09ILNT1_0086_B09.bHX233602 
ILNT10090C03ILNT1_0090_C03.bHX233931 
ILNT10090C10ILNT1_0090_C10.bHX233936 
ILNT10090H04ILNT1_0090_H04.bHX233980 
ILNT10091G09ILNT1_0091_G09.bHX234052 
ILNT10092D07ILNT1_0092_D07.bHX234098 
ILNT10094F04ILNT1_0094_F04.bHX234267 
ILNT10094G08ILNT1_0094_G08.bHX234280 
ILNT10096H08ILNT1_0096_H08.b  
ILNT10097E05ILNT1_0097_E05.bHX234482 
ILNT10099E04ILNT1_0099_E04.bHX234623 
ITT010001F07ITT01_0001_F07.bBW976099 
ITT010002D03ITT01_0002_D03.bBW976165 
ITT010003E07ITT01_0003_E07.bBW976271 
ITT010006E04ITT01_0006_E04.bBW976540 
ITT010008F06ITT01_0008_F06.bBW976739 
ITT010010D03ITT01_0010_D03.bBW976897 
ITT010012D04ITT01_0012_D04.bBW977086 
ITT010012G10ITT01_0012_G10.bBW977125 
ITT010013A11ITT01_0013_A11.bBW977149 
ITT010014A07ITT01_0014_A07.bBW977229 
ITT010014B09ITT01_0014_B09.bBW977243 
ITT010014H02ITT01_0014_H02.bBW977304 
ITT010018F03ITT01_0018_F03.bBW977635 
ITT010019F04ITT01_0019_F04.bBW977727 
ITT010020F10ITT01_0020_F10.bBW977825 
ITT010021A05ITT01_0021_A05.bBW977853 
ITT010026C03ITT01_0026_C03.bBW978334 
ITT010027A12ITT01_0027_A12.bBW978410 
ITT010028C04ITT01_0028_C04.bBW978514 
ITT010030B08ITT01_0030_B08.bBW978676 
ITT010030C04ITT01_0030_C04.bBW978683 
ITT010031F11ITT01_0031_F11.bBW978815 
ITT010033H10ITT01_0033_H10.bBW979016 
ITT010038H07ITT01_0038_H07.bBW979469 
ITT010039D12ITT01_0039_D12.bBW979519 
ITT010040C11ITT01_0040_C11.bBW979595 
ITT010040H11ITT01_0040_H11.bBW979648 
ITT010042A02ITT01_0042_A02.bBW979743 
ITT010042F11ITT01_0042_F11.bBW979809 
ITT010043A04ITT01_0043_A04.bBW979835 
ITT010045G05ITT01_0045_G05.bBW980088 
ITT010047D01ITT01_0047_D01.bBW980141 
ITT010047D12ITT01_0047_D12.bBW980152 
ITT010049A05ITT01_0049_A05.bBW980296 
ITT010049E10ITT01_0049_E10.bBW980346 
ITT010049G12ITT01_0049_G12.bFS671338 
ITT010049H05ITT01_0049_H05.bBW980375 
ITT010049H09ITT01_0049_H09.bBW980379 
ITT010052B11ITT01_0052_B11.bBW980589 
ITT010052E06ITT01_0052_E06.bBW980618 
ITT010053A10ITT01_0053_A10.bBW980668 
ITT010055C07ITT01_0055_C07.bBW980873 
ITT010055D01ITT01_0055_D01.bBW980879 
ITT010055H03ITT01_0055_H03.bBW980928 
ITT010059H01ITT01_0059_H01.bBW981284 
ITT010062C09ITT01_0062_C09.bBW981500 
ITT010062H08ITT01_0062_H08.bBW981556 
ITT010064E10ITT01_0064_E10.bBW981704 
ITT010065C04ITT01_0065_C04.bBW981765 
ITT010065E06ITT01_0065_E06.bBW981790 
ITT010065H08ITT01_0065_H08.bBW981826 
ITT010065H09ITT01_0065_H09.bBW981827 
ITT010066B08ITT01_0066_B08.bBW981850 
ITT010066G05ITT01_0066_G05.bBW981905 
ITT010070E11ITT01_0070_E11.bBW982250 
ITT010071H01ITT01_0071_H01.bBW982362 
ITT010072F03ITT01_0072_F03.bBW982428 
ITT010072G06ITT01_0072_G06.bBW982440 
ITT010074C12ITT01_0074_C12.bBW982582 
ITT010074D02ITT01_0074_D02.bBW982583 
ITT010074D11ITT01_0074_D11.bBW982592 
ITT010075G03ITT01_0075_G03.bBW982705 
ITT010076B02ITT01_0076_B02.bBW982733 
ITT010077H02ITT01_0077_H02.b  
ITT010078D10ITT01_0078_D10.bBW982932 
ITT010083C03ITT01_0083_C03.bBW983362 
ITT010088A05ITT01_0088_A05.bBW983777 
ITT010091C02ITT01_0091_C02.bBW984067 
ITT010092C02ITT01_0092_C02.bBW984155 
ITT010092G01ITT01_0092_G01.bBW984200 
ITT010093D02ITT01_0093_D02.bBW984253 
ITT010095C07ITT01_0095_C07.bBW984428 
ITT010095F07ITT01_0095_F07.bBW984463 
ITT010097A03ITT01_0097_A03.bBW984585 
ITT010097G09ITT01_0097_G09.bBW984657 
ITT010099C03ITT01_0099_C03.bBW984788 
ITT010100A02ITT01_0100_A02.bBW984858 
ITT010101E09ITT01_0101_E09.bBW985000 
ITT010102G07ITT01_0102_G07.bBW985113 
KDN010004A08KDN01_0004_A08.b  
KDN010004B02KDN01_0004_B02.bHX234734 
KDN010010H03KDN01_0010_H03.bFS671975 
KDN010020A06KDN01_0020_A06.bFS672661 
KDN010034F11KDN01_0034_F11.bFS673808 
KDN010036B10KDN01_0036_B10.bFS673933 
KDN010040A08KDN01_0040_A08.b  
KDN010041E05KDN01_0041_E05.bFS674058 
KDN010042G12KDN01_0042_G12.bFS674152 
KDN010043B04KDN01_0043_B04.bFS674172 
KDN010050F01KDN01_0050_F01.b  
KDN010053G11KDN01_0053_G11.bFS674693 
KDN010056E06KDN01_0056_E06.bFS674901 
KDN010065B09KDN01_0065_B09.bFS675600 
KDN010065D04KDN01_0065_D04.bFS675615 
KDN010066B09KDN01_0066_B09.bFS675679 
KDN010072F08KDN01_0072_F08.bFS676186 
KDN010074B10KDN01_0074_B10.bFS676313 
KDN010074D12KDN01_0074_D12.b  
KDN010074H11KDN01_0074_H11.bFS676376 
KDN010078E04KDN01_0078_E04.bFS676651 
KDN010079G06KDN01_0079_G06.bFS676748 
KDN010097F07KDN01_0097_F07.bFS678172 
KDN010099E07KDN01_0099_E07.bFS678317 
KDN010099E08KDN01_0099_E08.bFS678318 
LNG010011C09LNG01_0011_C09.bBP435624 
LNG010017G12LNG01_0017_G12.bBP439884 
LNG010034A08LNG01_0034_A08.bBP433609 
LNG010042D07LNG01_0042_D07.bBP436464 
LNG010058B01LNG01_0058_B01.bBP434015 
LNG010080G07LNG01_0080_G07.bBP439504 
LNG010103E02LNG01_0103_E02.bBP437082 
LNG010109C08LNG01_0109_C08.bBP435612 
LVR010009H11LVR01_0009_H11.bBP447993 
LVR010034G03LVR01_0034_G03.bBP446490 
LVR010038A02LVR01_0038_A02.bBP441046 
LVR010044H01LVR01_0044_H01.bBP447244 
LVR010057F09LVR01_0057_F09.bBP446053 
LVR010062C03LVR01_0062_C03.bBP442984 
LVR010073H07LVR01_0073_H07.bBP447739 
LVR010088H03LVR01_0088_H03.bCJ000498 
LVRM10003C06LVRM1_0003_C06.bCJ001016 
LVRM10004H09LVRM1_0004_H09.bCJ001135 
LVRM10006A11LVRM1_0006_A11.bBP137874 
LVRM10013B12LVRM1_0013_B12.bBP449668 
LVRM10019F11LVRM1_0019_F11.bBP140208 
LVRM10021G12LVRM1_0021_G12.bCJ001194 
LVRM10024C04LVRM1_0024_C04.bBP138538 
LVRM10024H02LVRM1_0024_H02.bBP140796 
LVRM10026G06LVRM1_0026_G06.bBP140473 AK394114
LVRM10026G11LVRM1_0026_G11.bBP140674 
LVRM10028E09LVRM1_0028_E09.bBP139670 
LVRM10029G07LVRM1_0029_G07.bBP140516 
LVRM10037E10LVRM1_0037_E10.bCJ001596 
LVRM10047E10LVRM1_0047_E10.bCJ002310 
LVRM10050B06LVRM1_0050_B06.bBP449265 
LVRM10053E11LVRM1_0053_E11.bBP139753 
LVRM10090E06LVRM1_0090_E06.bCJ003220 
LVRM10093A01LVRM1_0093_A01.bCJ003422 
LVRM10093G04LVRM1_0093_G04.bCJ003481 
LVRM10096G11LVRM1_0096_G11.bCJ003716 
LVRM10099G06LVRM1_0099_G06.bCJ003957 
LVRM10102C11LVRM1_0102_C11.bBP138858 
LVRM10109A08LVRM1_0109_A08.bBP448605 
LVRM10113G11LVRM1_0113_G11.bBP453698 
LVRM10124G11LVRM1_0124_G11.bBP453709 
LVRM10125B02LVRM1_0125_B02.bBP449027 
LVRM10130D12LVRM1_0130_D12.bBP451364 
LVRM10132B12LVRM1_0132_B12.bBP449693 
LVRM10141E09LVRM1_0141_E09.bBP451959 
LVRM10142F03LVRM1_0142_F03.bBP452355 
LVRM10148G03LVRM1_0148_G03.bBP453160 
LVRM10149G08LVRM1_0149_G08.bBP453514 
LVRM10153C05LVRM1_0153_C05.bBP450037 
LVRM10153G03LVRM1_0153_G03.bBP453165 
LVRM10155B08LVRM1_0155_B08.bBP449457 
LVRM10158H04LVRM1_0158_H04.bBP454074 
LVRM10169E04LVRM1_0169_E04.bCJ004575 
LVRM10176E02LVRM1_0176_E02.bCJ005121 
LVRM10179H12LVRM1_0179_H12.bCJ005412 
LVRM10187A12LVRM1_0187_A12.bCJ006009 
LVRM10197B11LVRM1_0197_B11.bCJ006741 
LVRM10198A01LVRM1_0198_A01.bCJ006813 
LVRM10201H04LVRM1_0201_H04.bCJ007137 
MLN010002C07MLN01_0002_C07.bCJ007828 
MLN010005A04MLN01_0005_A04.bCJ008031 
MLN010007G01MLN01_0007_G01.bCJ008250 
MLN010008A01MLN01_0008_A01.bCJ008271 
MLN010010B05MLN01_0010_B05.bCJ008453 
MLN010011H06MLN01_0011_H06.bCJ008591 
MLN010015H03MLN01_0015_H03.bCJ008900 
MLN010020A10MLN01_0020_A10.bCJ009122 
MLN010020G10MLN01_0020_G10.bCJ009182 
MLN010021D03MLN01_0021_D03.bCJ009230 
MLN010023F09MLN01_0023_F09.bCJ009419 
MLN010024D05MLN01_0024_D05.bCJ009481 
MLN010024G06MLN01_0024_G06.bCJ009516 
MLN010025E04MLN01_0025_E04.bCJ009574 
MLN010027F12MLN01_0027_F12.bCJ009750 
MLN010028B07MLN01_0028_B07.bCJ009787 
MLN010036G12MLN01_0036_G12.bCJ010487 
MLN010037G07MLN01_0037_G07.bCJ010561 
MLN010038E12MLN01_0038_E12.bCJ010627 
MLN010039G08MLN01_0039_G08.bCJ010731 
MLN010041C12MLN01_0041_C12.bCJ010865 
MLN010041F10MLN01_0041_F10.bCJ010896 
MLN010044B02MLN01_0044_B02.bCJ011094 
MLN010044E01MLN01_0044_E01.bCJ011122 
MLN010047B12MLN01_0047_B12.bCJ011264 
MLN010047C06MLN01_0047_C06.bCJ011268 
MLN010047C08MLN01_0047_C08.bCJ011270 
MLN010048E12MLN01_0048_E12.bCJ011373 
MLN010049G11MLN01_0049_G11.bCJ011481 
MLN010050B02MLN01_0050_B02.bCJ011501 
MLN010051B04MLN01_0051_B04.bCJ011585 
MLN010053E06MLN01_0053_E06.bCJ011801 
MLN010058G01MLN01_0058_G01.bBW963646 
MLN010060B06MLN01_0060_B06.bCJ012352 
MLN010062F07MLN01_0062_F07.bCJ012534 
MLN010063D03MLN01_0063_D03.bCJ012598 
MLN010064C10MLN01_0064_C10.bCJ012676 
MLN010065A02MLN01_0065_A02.bCJ012727 
MLN010066D02MLN01_0066_D02.bCJ012850 
MLN010067G05MLN01_0067_G05.bCJ012968 
MLN010069H10MLN01_0069_H10.bCJ013159 
MLN010073G01MLN01_0073_G01.bCJ013490 
MLN010075A12MLN01_0075_A12.bCJ013587 
MLN010076E09MLN01_0076_E09.bBW963768 AK394517
MLN010079D10MLN01_0079_D10.bCJ013922 
MLN010082C09MLN01_0082_C09.bCJ014166 
MLN010082H11MLN01_0082_H11.bCJ014226 
MLN010085B04MLN01_0085_B04.bCJ014408 
MLN010086A11MLN01_0086_A11.bCJ014488 
MLN010089A08MLN01_0089_A08.bCJ014735 
MLN010089D10MLN01_0089_D10.bCJ014770 
MLN010089H08MLN01_0089_H08.bCJ014812 
MLN010090E04MLN01_0090_E04.bCJ014852 
MLN010093B07MLN01_0093_B07.bCJ015088 
MLN010093E06MLN01_0093_E06.bCJ015120 
MLN010097C09MLN01_0097_C09.bCJ015432 
MLN010097H06MLN01_0097_H06.bCJ015480 
MLN010099D11MLN01_0099_D11.bCJ015622 
MLN010099F01MLN01_0099_F01.bCJ015636 
MLN010100C03MLN01_0100_C03.bCJ015694 
MLN010101D05MLN01_0101_D05.bCJ015794 
MLN010101E11MLN01_0101_E11.bCJ015812 
MLN010101F12MLN01_0101_F12.bCJ015825 
OVR010001G09OVR01_0001_G09.bBP144242 
OVR010012E12OVR01_0012_E12.bBP143444 
OVR010015B05OVR01_0015_B05.b  
OVR010032F12OVR01_0032_F12.bBP143921 
OVR010039C09OVR01_0039_C09.bBP142464 
OVR010055F04OVR01_0055_F04.bBW964536 
OVR010057F11OVR01_0057_F11.bBW964721 
OVR010061G06OVR01_0061_G06.bBW965089 
OVR010068E12OVR01_0068_E12.bBW965690 
OVR010094D03OVR01_0094_D03.b  
OVR010095H03OVR01_0095_H03.bBW967791 
OVRM10009E01OVRM1_0009_E01.bBP149928 
OVRM10010A03OVRM1_0010_A03.bBP145047 
OVRM10015B07OVRM1_0015_B07.bBP146769 
OVRM10027A09OVRM1_0027_A09.bBP145699 
OVRM10048F12OVRM1_0048_F12.bBP460335 
OVRM10049F12OVRM1_0049_F12.bBP152303 
OVRM10049H08OVRM1_0049_H08.bBP154472 
OVRM10052D06OVRM1_0052_D06.bBP149193 
OVRM10067C05OVRM1_0067_C05.bBP147829 
OVRM10069D09OVRM1_0069_D09.bBP149529 
OVRM10071D08OVRM1_0071_D08.bBP149424 
OVRM10074E06OVRM1_0074_E06.bBP150449 AK235373
OVRM10078E02OVRM1_0078_E02.bBP150054 
OVRM10080F10OVRM1_0080_F10.bBP152123 
OVRM10106D07OVRM1_0106_D07.bBP149351 
OVRM10112B08OVRM1_0112_B08.bBP146949 
OVRM10126D02OVRM1_0126_D02.bBP148843 
OVRM10128A08OVRM1_0128_A08.bBP145677 
OVRM10139A10OVRM1_0139_A10.bBP145909 
OVRM10165E01OVRM1_0165_E01.bBP458482 
OVRM10179B01OVRM1_0179_B01.bCJ016125 
OVRM10183F03OVRM1_0183_F03.bBP459603 
OVRM10187B04OVRM1_0187_B04.bBP455840 
OVRM10187B06OVRM1_0187_B06.bBP456012 
OVRM10188H07OVRM1_0188_H07.b  
OVRM10191G12OVRM1_0191_G12.bBP461330 
OVRM10210H09OVRM1_0210_H09.bBP462050 
OVRM10225H05OVRM1_0225_H05.bBP461743 
OVRT10007D04OVRT1_0007_D04.bFS686955 
OVRT10010F01OVRT1_0010_F01.bFS687217 
OVRT10014E02OVRT1_0014_E02.bFS687544 
OVRT10016D01OVRT1_0016_D01.bFS687704 
OVRT10019F04OVRT1_0019_F04.bFS687969 
OVRT10030D11OVRT1_0030_D11.bFS688835 
OVRT10031B12OVRT1_0031_B12.bFS688898 
OVRT10039F04OVRT1_0039_F04.bFS689601 
OVRT10040D04OVRT1_0040_D04.bFS689664 
OVRT10042G01OVRT1_0042_G01.bFS689855 
OVRT10044C07OVRT1_0044_C07.bFS689984 
OVRT10082F09OVRT1_0082_F09.bFS693107 
OVRT10094D08OVRT1_0094_D08.bFS694069 
OVRT10095A04OVRT1_0095_A04.bFS694117 
OVRT10098G12OVRT1_0098_G12.bFS694440 
OVRT10099F04OVRT1_0099_F04.bFS694505 
OVRT10101B12OVRT1_0101_B12.bHX234851 
OVRT10102C05OVRT1_0102_C05.bHX234934 
OVRT10102F08OVRT1_0102_F08.bHX234972 
OVRT10103H08OVRT1_0103_H08.bHX235072 
OVRT10110E09OVRT1_0110_E09.bHX235618 
OVRT10117C09OVRT1_0117_C09.bHX236186 
OVRT10127E12OVRT1_0127_E12.bHX236990 
OVRT10139F12OVRT1_0139_F12.bHX237966 
OVRT10141A04OVRT1_0141_A04.bHX238070 
OVRT10147H03OVRT1_0147_H03.bHX238641 
OVRT10150F01OVRT1_0150_F01.bHX238876 
OVRT10151G12OVRT1_0151_G12.bHX238973 
PBL010001A01PBL01_0001_A01.bBW968548 
PBL010021E02PBL01_0021_E02.bBW969787 
PBL010025B09PBL01_0025_B09.bBP155396 
PBL010029A06PBL01_0029_A06.bBP155110 
PBL010034G12PBL01_0034_G12.bBW970144 
PBL010042B12PBL01_0042_B12.bBW970530 
PBL010072F04PBL01_0072_F04.bBW972585 
PBL010086A05PBL01_0086_A05.bBW973773 
PCT010004G09PCT01_0004_G09.bFS694893 
PCT010019H09PCT01_0019_H09.bFS695934 
PCT010025D08PCT01_0025_D08.bFS696309 
PCT010034E03PCT01_0034_E03.bFS696885 
PST010020F01PST01_0020_F01.bFS698566 
PST010026F07PST01_0026_F07.bFS699053 
PST010053B01PST01_0053_B01.bFS700997 
PST010065C04PST01_0065_C04.bFS701963 
PST010066G12PST01_0066_G12.bFS702084 
PTG010018F08PTG01_0018_F08.bFS706019 
PTG010021A08PTG01_0021_A08.bFS706222 
PTG010086E01PTG01_0086_E01.bFS711711 
SKNB10028G12SKNB1_0028_G12.b  
SKNB10046B09SKNB1_0046_B09.bDB802599 
SMG010024C12SMG01_0024_C12.bFS715357 
SMG010025A01SMG01_0025_A01.bFS715418 
SMG010037C11SMG01_0037_C11.bFS716512 
SMG010060H09SMG01_0060_H09.bFS718495 
SMG010067H01SMG01_0067_H01.bFS719098 
SMG010080C11SMG01_0080_C11.bFS720181 
SPL010010B03SPL01_0010_B03.bBP157054 
SPL010015H05SPL01_0015_H05.bBP159162 
SPL010021F11SPL01_0021_F11.bBP158665 
SPL010029G06SPL01_0029_G06.bCJ016274 
SPL010033A05SPL01_0033_A05.bCJ016568 
SPL010053A04SPL01_0053_A04.bCJ017752 
SPL010064B03SPL01_0064_B03.bCJ018754 
SPL010066F07SPL01_0066_F07.bCJ018978 
SPL010071B05SPL01_0071_B05.bCJ019379 
SPL010071F12SPL01_0071_F12.bCJ019432 
SPL010073B11SPL01_0073_B11.bCJ019565 
SPL010075E03SPL01_0075_E03.bCJ019773 
SPL010084C09SPL01_0084_C09.bCJ020580 
SPL010098C07SPL01_0098_C07.bCJ021826 
SPLT10001D12SPLT1_0001_D12.bHX239310 
SPLT10005D02SPLT1_0005_D02.bHX239594 
SPLT10006F03SPLT1_0006_F03.b  
SPLT10008H11SPLT1_0008_H11.bHX239858 
SPLT10009E08SPLT1_0009_E08.bHX239905 
SPLT10014G03SPLT1_0014_G03.bHX240296 
SPLT10017A05SPLT1_0017_A05.bHX240477 
SPLT10017D10SPLT1_0017_D10.bHX240512 
SPLT10017E11SPLT1_0017_E11.bHX240520 
SPLT10019A04SPLT1_0019_A04.bHX240634 
SPLT10020A06SPLT1_0020_A06.bHX240710 
SPLT10023H08SPLT1_0023_H08.bHX241022 
SPLT10025C03SPLT1_0025_C03.bHX241124 
SPLT10026E01SPLT1_0026_E01.bHX241222 
SPLT10034C03SPLT1_0034_C03.bHX241811 
SPLT10034D03SPLT1_0034_D03.bHX241823 
SPLT10036B01SPLT1_0036_B01.bHX241963 
SPLT10037B08SPLT1_0037_B08.bHX242049 
SPLT10038C12SPLT1_0038_C12.bHX242141 
SPLT10040G10SPLT1_0040_G10.bHX242337 
SPLT10041B05SPLT1_0041_B05.bHX242363 
SPLT10042G02SPLT1_0042_G02.bHX242494 
SPLT10046D06SPLT1_0046_D06.bHX242778 
SPLT10046E09SPLT1_0046_E09.bHX242790 
SPLT10046E10SPLT1_0046_E10.bHX242791 
SPLT10051F05SPLT1_0051_F05.bHX243159 
SPLT10053H10SPLT1_0053_H10.bHX243329 
SPLT10055B12SPLT1_0055_B12.bHX243426 
SPLT10055E01SPLT1_0055_E01.bHX243450 
SPLT10055H04SPLT1_0055_H04.bHX243482 
SPLT10056B06SPLT1_0056_B06.bHX243501 
SPLT10058B02SPLT1_0058_B02.bHX243664 
SPLT10061F07SPLT1_0061_F07.bHX243943 
SPLT10070C10SPLT1_0070_C10.bHX244636 
SPLT10070H03SPLT1_0070_H03.bHX244681 
SPLT10072G09SPLT1_0072_G09.bHX244829 
SPLT10073B12SPLT1_0073_B12.bHX244860 
SPLT10076B06SPLT1_0076_B06.bHX245093 
SPLT10079C08SPLT1_0079_C08.bHX245341 
SPLT10081E09SPLT1_0081_E09.bHX245527 
SPLT10084B09SPLT1_0084_B09.bHX245723 
SPLT10085G10SPLT1_0085_G10.bHX245850 
SPLT10086G01SPLT1_0086_G01.bHX245922 
SPLT10086G02SPLT1_0086_G02.bHX245923 
SPLT10089F11SPLT1_0089_F11.b  
SPLT10090E04SPLT1_0090_E04.bHX246217 
SPLT10091A09SPLT1_0091_A09.bHX246258 
SPLT10095C05SPLT1_0095_C05.bHX246599 
TCH010080B06TCH01_0080_B06.bCJ028197 
TCH010087C07TCH01_0087_C07.bCJ028766 
TES010002H11TES01_0002_H11.bCJ030154 
TES010057H02TES01_0057_H02.bCJ033667 
TES010077A11TES01_0077_A11.bCJ034938 
TES010104C09TES01_0104_C09.bCJ036847 
UTR010004B11UTR01_0004_B11.bBP170332 
UTR010004G03UTR01_0004_G03.bBP172650 
UTR010005A08UTR01_0005_A08.bBP169666 
UTR010005H10UTR01_0005_H10.b  
UTR010006A08UTR01_0006_A08.bBP169667 
UTR010007B02UTR01_0007_B02.bBP169934 
UTR010008A05UTR01_0008_A05.bBP169536 
UTR010008C11UTR01_0008_C11.bBP170872 
UTR010009H03UTR01_0009_H03.bBP173193 
UTR010009H07UTR01_0009_H07.bBP173371 
UTR010012B12UTR01_0012_B12.bBP170386 
UTR010013E11UTR01_0013_E11.bBP171950 
UTR010014G09UTR01_0014_G09.bBP172928 
UTR010015B01UTR01_0015_B01.bBP169898 
UTR010016A11UTR01_0016_A11.bBP169813 
UTR010016B10UTR01_0016_B10.bBP170302 
UTR010016H01UTR01_0016_H01.bBP173110 
UTR010019A09UTR01_0019_A09.bBP169724 
UTR010019G04UTR01_0019_G04.bBP172707 
UTR010021A10UTR01_0021_A10.bBP169771 
UTR010021D06UTR01_0021_D06.bBP171207 
UTR010021E03UTR01_0021_E03.bBP171603 
UTR010021F08UTR01_0021_F08.bBP172354 
UTR010023A12UTR01_0023_A12.bBP169861 
UTR010024H02UTR01_0024_H02.bBP173164 
UTR010025C08UTR01_0025_C08.bBP170758 
UTR010026H05UTR01_0026_H05.bBP173299 
UTR010028B05UTR01_0028_B05.bBP170085 
UTR010028C10UTR01_0028_C10.bBP170847 
UTR010031A05UTR01_0031_A05.bBP169556 
UTR010032B06UTR01_0032_B06.bBP170137 
UTR010032G10UTR01_0032_G10.bBP172989 
UTR010033C09UTR01_0033_C09.bBP170808 
UTR010034E04UTR01_0034_E04.bBP171661 
UTR010035B01UTR01_0035_B01.bBP169916 
UTR010035F07UTR01_0035_F07.bBP172323 
UTR010036A08UTR01_0036_A08.bBP169694 
UTR010036A11UTR01_0036_A11.bBP169830 
UTR010038B11UTR01_0038_B11.bBP170364 
UTR010038E06UTR01_0038_E06.bBP171750 
UTR010039D02UTR01_0039_D02.bBP171042 
UTR010039F03UTR01_0039_F03.bBP172151 
UTR010040B01UTR01_0040_B01.bBP169920 
UTR010040F09UTR01_0040_F09.bBP172415 
UTR010042B06UTR01_0042_B06.bBP170145 
UTR010042G03UTR01_0042_G03.bBP172684 
UTR010044A06UTR01_0044_A06.bBP169611 
UTR010044B11UTR01_0044_B11.bBP170370 
UTR010044F11UTR01_0044_F11.bBP172505 
UTR010045G01UTR01_0045_G01.bBP172598 
UTR010045H10UTR01_0045_H10.bBP173531 
UTR010046E02UTR01_0046_E02.bBP171580 
UTR010047D03UTR01_0047_D03.bBP171097 
UTR010047E01UTR01_0047_E01.bBP171538 
UTR010047E04UTR01_0047_E04.bBP171673 
UTR010048G11UTR01_0048_G11.bBP173047 
UTR010049E12UTR01_0049_E12.bBP172023 
UTR010049G05UTR01_0049_G05.bBP172779 
UTR010051E09UTR01_0051_E09.bBP464014 
UTR010052A04UTR01_0052_A04.bBP462736 
UTR010052E03UTR01_0052_E03.bBP463878 
UTR010053A06UTR01_0053_A06.bBP462787 
UTR010053F01UTR01_0053_F01.bBP464116 
UTR010054B06UTR01_0054_B06.bBP463085 
UTR010056B03UTR01_0056_B03.bBP463010 
UTR010061A01UTR01_0061_A01.bBP462670 
UTR010061D01UTR01_0061_D01.bBP463547 
UTR010062B11UTR01_0062_B11.bBP463212 
UTR010063A04UTR01_0063_A04.bBP462747 
UTR010064A09UTR01_0064_A09.bBP462873 
UTR010064E12UTR01_0064_E12.bBP464101 
UTR010066H11UTR01_0066_H11.bBP464946 
UTR010070G10UTR01_0070_G10.bBP464633 
UTR010070H11UTR01_0070_H11.bBP464949 
UTR010072C03UTR01_0072_C03.bBP463315 
UTR010072H11UTR01_0072_H11.bBP464951 
UTR010074B11UTR01_0074_B11.bBP463221 
UTR010074C12UTR01_0074_C12.bBP463531 
UTR010074G02UTR01_0074_G02.bBP464441 
UTR010075D06UTR01_0075_D06.bBP463680 
UTR010075F10UTR01_0075_F10.bBP464344 
UTR010079A08UTR01_0079_A08.bBP462859 
UTR010079B03UTR01_0079_B03.bBP463028 
UTR010079E10UTR01_0079_E10.bBP464059 
UTR010079H03UTR01_0079_H03.bBP464762 
UTR010080G11UTR01_0080_G11.bBP464666 
UTR010082C06UTR01_0082_C06.bCJ037552 
UTR010082E05UTR01_0082_E05.bCJ037574 
UTR010082G04UTR01_0082_G04.bCJ037596 
UTR010084B06UTR01_0084_B06.bCJ037724 
UTR010084E11UTR01_0084_E11.bCJ037762 
UTR010085A04UTR01_0085_A04.bCJ037803 
UTR010086C07UTR01_0086_C07.bCJ037922 
UTR010086E10UTR01_0086_E10.bCJ037948 
UTR010087C03UTR01_0087_C03.bCJ038012 
UTR010087C12UTR01_0087_C12.bCJ038021 
UTR010087G07UTR01_0087_G07.bCJ038063 
UTR010088B06UTR01_0088_B06.bCJ038096 
UTR010088F01UTR01_0088_F01.bCJ038138 
UTR010089A12UTR01_0089_A12.bCJ038184 
UTR010090E07UTR01_0090_E07.bCJ038320 
UTR010090G03UTR01_0090_G03.bCJ038339 
UTR010090G07UTR01_0090_G07.bCJ038343 
UTR010092E02UTR01_0092_E02.bCJ038493 
UTR010094D03UTR01_0094_D03.bCJ038667 
UTR010094F05UTR01_0094_F05.bCJ038691 
UTR010095B05UTR01_0095_B05.bCJ038736 
UTR010095H06UTR01_0095_H06.bCJ038808 
UTR010096A10UTR01_0096_A10.bCJ038824 
UTR010096C04UTR01_0096_C04.bCJ038842 
UTR010096C10UTR01_0096_C10.bCJ038848 
UTR010096D06UTR01_0096_D06.bCJ038856 
UTR010096H02UTR01_0096_H02.bCJ038900 
UTR010098C04UTR01_0098_C04.bCJ038936 
UTR010099D02UTR01_0099_D02.bCJ039040 
UTR010099H12UTR01_0099_H12.bCJ039098 
UTR010100B07UTR01_0100_B07.bCJ039117 
UTR010100B12UTR01_0100_B12.bCJ039122 
UTR010100E05UTR01_0100_E05.bCJ039151 
UTR010100H01UTR01_0100_H01.bCJ039182 
UTR010101G05UTR01_0101_G05.bCJ039265 
UTR010103G12UTR01_0103_G12.bCJ039454 
UTR010103H05UTR01_0103_H05.bCJ039459 
UTR010104A01UTR01_0104_A01.bCJ039467 
UTR010104A06UTR01_0104_A06.bCJ039472 
UTR010104D05UTR01_0104_D05.bCJ039506 
UTR010105B02UTR01_0105_B02.bCJ039571 
UTR010106E06UTR01_0106_E06.bCJ039703 
UTR010107C08UTR01_0107_C08.bCJ039774 

  

SNPs: 6      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
138C640700.902O-
T7610.098
203A18100.230W-
C538690.770
229A9800.123W-
G626710.877
405C503690.715WSCAC/H
T22800.285CAT/H
817C23400.645W-
T12900.355
833A3100.082W-
G34500.918


Alignment:      TOP

20110601C-000819 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0026_G06.b : cg
MLN01_0076_E09.b : cttgtgacttaacxxxxxx
HTMT1_0073_G06.b : ntttccgacggtag
MLN01_0041_C12.b : nnngggttgga
HTMT1_0011_D11.b :
CBLT1_0034_H06.b :
HTMT1_0077_E11.b :
BMWN1_0081_F01.b :
ILNT1_0079_B04.b :
LVRM1_0125_B02.b :
CBLT1_0034_G02.b :
BMWN1_0041_H03.b :
BMWN1_0080_B09.b :
BMWN1_0032_H05.b :
BMWN1_0073_D05.b :
HTMT1_0078_D10.b :
BMWN1_0017_A08.b :
HTMT1_0072_H06.b :
BMWN1_0073_E04.b :
HTMT1_0079_E08.b :
HTMT1_0059_E11.b :
HTMT1_0150_H04.b :
CBLT1_0034_D06.b :
BMWN1_0030_H04.b :
UTR01_0040_B01.b :
HTMT1_0116_E03.b :
HTMT1_0151_F12.b :
SPLT1_0006_F03.b :
SPLT1_0026_E01.b :
BMWN1_0094_E07.b :
HTMT1_0146_B04.b :
CBLT1_0029_G02.b :
HTMT1_0035_G07.b :
HTMT1_0127_H10.b :
HTMT1_0116_B05.b :
ILNT1_0009_E03.b :
BMWN1_0026_B08.b :
HTMT1_0103_H08.b :
CBLT1_0086_D08.b :
HTMT1_0033_H05.b :
SPLT1_0073_B12.b :
ILNT1_0096_H08.b :
ILNT1_0094_F04.b :
CBLT1_0035_A07.b :
CBLT1_0057_H12.b :
HTMT1_0017_H11.b :
HTMT1_0026_B10.b :
CBLT1_0018_B10.b :
CBLT1_0071_F10.b :
HTMT1_0030_E07.b :
ILNT1_0055_A02.b :
HTMT1_0098_E02.b :
SPLT1_0079_C08.b :
CBLT1_0083_A03.b :
SPLT1_0034_C03.b :
HTMT1_0125_E09.b :
ILNT1_0085_A03.b :
HTMT1_0018_F03.b :
HTMT1_0086_F03.b :
HTMT1_0065_B07.b :
SPLT1_0041_B05.b :
HTMT1_0061_A05.b :
HTMT1_0091_A02.b :
HTMT1_0087_F06.b :
BMWN1_0061_F12.b :
CBLT1_0014_A04.b :
BMWN1_0025_G06.b :
HTMT1_0126_D03.b :
HTMT1_0023_G12.b :
HTMT1_0082_A09.b :
ILNT1_0092_D07.b :
SPLT1_0046_D06.b :
HTMT1_0132_H12.b :
ILNT1_0027_A11.b :
HTMT1_0023_E02.b :
CBLT1_0031_G02.b :
ILNT1_0090_C03.b :
HTMT1_0088_G10.b :
HTMT1_0089_E07.b :
ILNT1_0071_D05.b :
SPLT1_0017_E11.b :
SPLT1_0061_F07.b :
SPLT1_0014_G03.b :
HTMT1_0147_A12.b :
ILNT1_0033_C10.b :
CBLT1_0057_A02.b :
SPLT1_0058_B02.b :
SPLT1_0056_B06.b :
CBLT1_0027_B11.b :
BMWN1_0024_C08.b :
HTMT1_0091_H05.b :
HTMT1_0068_G10.b :
CBLT1_0088_A06.b :
CBLT1_0013_C07.b :
CBLT1_0033_H10.b :
ILNT1_0084_E03.b :
HTMT1_0100_A06.b :
CBLT1_0054_D07.b :
CBLT1_0015_A10.b :
CBLT1_0074_H04.b :
ILNT1_0002_G11.b :
HTMT1_0045_E12.b :
BMWN1_0047_B01.b :
SPLT1_0070_C10.b :
ILNT1_0097_E05.b :
HTMT1_0054_B08.b :
HTMT1_0056_H08.b :
BMWN1_0052_A12.b :
CBLT1_0039_D02.b :
ILNT1_0002_F09.b :
HTMT1_0058_E02.b :
HTMT1_0133_E08.b :
HTMT1_0019_F04.b :
CBLT1_0039_H06.b :
BMWN1_0061_G11.b :
CBLT1_0047_F04.b :
CBLT1_0093_E09.b :
MLN01_0082_H11.b :
CBLT1_0053_B09.b :
SPLT1_0037_B08.b :
BMWN1_0024_H03.b :
HTMT1_0052_C10.b :
HTMT1_0100_E10.b :
HTMT1_0108_E05.b :
MLN01_0048_E12.b :
SPLT1_0046_E09.b :
HTMT1_0032_E03.b :
BMWN1_0096_G01.b :
CBLT1_0014_B12.b :
HTMT1_0052_D08.b :
ITT01_0038_H07.b :
HTMT1_0098_B02.b :
BMWN1_0025_D12.b :
HTMT1_0056_E04.b :
CBLT1_0012_D05.b :
SPLT1_0020_A06.b :
SPLT1_0038_C12.b :
SPLT1_0055_E01.b :
BMWN1_0060_H10.b :
ILNT1_0056_A07.b :
HTMT1_0026_C03.b :
CBLT1_0038_B02.b :
MLN01_0085_B04.b :
ILNT1_0049_B01.b :
CBLT1_0086_H08.b :
HTMT1_0085_D04.b :
ILNT1_0013_D04.b :
ILNT1_0090_C10.b :
HTMT1_0101_G05.b :
SPLT1_0023_H08.b :
HTMT1_0035_A06.b :
UTR01_0064_A09.b : tttt
BMWN1_0100_G05.b :
SPL01_0021_F11.b :
SPLT1_0008_H11.b :
ILNT1_0069_C02.b :
BMWN1_0035_B02.b :
UTR01_0040_F09.b :
ITT01_0049_H05.b :
HTMT1_0056_E08.b :
BMWN1_0064_F02.b :
HTMT1_0144_B11.b :
SPLT1_0009_E08.b :
MLN01_0058_G01.b :
OVRT1_0127_E12.b :
HTMT1_0105_G02.b :
HTMT1_0050_E08.b :
SMG01_0060_H09.b :
ILNT1_0056_B12.b :
HTMT1_0051_C07.b :
LNG01_0103_E02.b :
UTR01_0104_A01.b :
ILNT1_0056_H07.b :
OVRT1_0094_D08.b :
CBLT1_0077_H02.b :
ITT01_0065_C04.b :
SMG01_0067_H01.b :
HTMT1_0027_E09.b :
SPL01_0098_C07.b :
UTR01_0063_A04.b : ttttt
ILNT1_0080_E11.b :
LVRM1_0029_G07.b :
SPL01_0015_H05.b :
UTR01_0023_A12.b :
BMWN1_0023_A07.b :
ITT01_0049_H09.b :
ADR01_0074_C06.b :
HTMT1_0069_C03.b :
ITT01_0074_D11.b :
ITT01_0097_A03.b :
ILNT1_0094_G08.b :
ITT01_0020_F10.b :
ITT01_0075_G03.b :
OVRT1_0098_G12.b :
UTR01_0104_D05.b :
ADR01_0041_C08.b :
SPLT1_0017_A05.b :
BMWN1_0043_F11.b :
HTMT1_0111_G04.b :
UTR01_0079_B03.b :
LNG01_0011_C09.b :
LNG01_0017_G12.b :
LVRM1_0148_G03.b :
LVRM1_0096_G11.b :
ILNT1_0079_B07.b :
OVR01_0057_F11.b :
LVRM1_0197_B11.b :
LVRM1_0153_C05.b :
LVRM1_0130_D12.b :
OVRM1_0187_B06.b :
LVRM1_0153_G03.b :
LVRM1_0004_H09.b :
OVRM1_0128_A08.b :
OVRM1_0210_H09.b :
HTMT1_0149_C02.b :
HTMT1_0120_C10.b :
PBL01_0029_A06.b :
HTMT1_0108_H11.b :
OVRM1_0027_A09.b :
PBL01_0034_G12.b :
SPLT1_0005_D02.b :
HTMT1_0113_E02.b :
CBLT1_0074_A06.b :
HTMT1_0123_F08.b :
UTR01_0028_C10.b :
HTMT1_0121_G02.b :
UTR01_0024_H02.b :
UTR01_0007_B02.b :
UTR01_0044_B11.b :
UTR01_0045_H10.b :
BMWN1_0042_A10.b :
CBLT1_0066_H11.b :
UTR01_0008_A05.b :
CBLT1_0088_G05.b :
UTR01_0006_A08.b :
UTR01_0042_G03.b :
UTR01_0005_A08.b :
CBLT1_0074_D10.b :
HTMT1_0008_B11.b :
UTR01_0015_B01.b :
UTR01_0038_B11.b :
HTMT1_0008_A11.b :
HTMT1_0150_G07.b :
CBLT1_0012_E01.b :
HTMT1_0101_D06.b :
SPLT1_0055_B12.b :
CBLT1_0069_A05.b :
HTMT1_0049_F06.b :
SPLT1_0040_G10.b :
HTMT1_0105_C08.b :
SPLT1_0017_D10.b :
SPLT1_0072_G09.b :
HTMT1_0053_E12.b :
CBLT1_0055_E10.b :
ILNT1_0099_E04.b :
HTMT1_0060_E07.b :
HTMT1_0081_F11.b :
SPLT1_0081_E09.b :
ILNT1_0014_D05.b :
HTMT1_0022_C08.b :
CBLT1_0021_F11.b :
CBLT1_0009_B04.b :
SPLT1_0001_D12.b :
ITT01_0049_E10.b :
ITT01_0008_F06.b :
HTMT1_0041_G04.b :
HTMT1_0066_C11.b :
CBLT1_0073_G07.b :
HTMT1_0112_E11.b :
ILNT1_0042_B06.b :
HTMT1_0023_F06.b :
CBLT1_0030_B01.b :
HTMT1_0096_H10.b :
BMWN1_0046_F02.b :
ILNT1_0040_D10.b :
HTMT1_0106_B12.b :
SPLT1_0091_A09.b :
HTMT1_0132_H11.b :
CBLT1_0081_D06.b :
HTMT1_0041_G12.b :
ILNT1_0039_G09.b :
ILNT1_0006_A09.b :
CBLT1_0049_A05.b :
UTR01_0034_E04.b :
BMWN1_0023_H05.b :
BMWN1_0049_A10.b :
CBLT1_0083_A01.b :
SPLT1_0036_B01.b :
UTR01_0021_E03.b :
CBLT1_0018_H11.b :
HTMT1_0062_B05.b :
CBLT1_0025_F07.b :
CBLT1_0085_B12.b :
UTR01_0032_G10.b :
HTMT1_0142_C04.b :
ITT01_0059_H01.b :
CLNT1_0004_E04.b :
HTMT1_0066_G02.b :
ILNT1_0003_H09.b :
CBLT1_0008_H08.b :
HTMT1_0122_F03.b :
SPLT1_0090_E04.b :
HTMT1_0108_C08.b :
ILNT1_0060_E06.b :
ILNT1_0074_B12.b :
SPLT1_0046_E10.b :
CBLT1_0063_A06.b :
SPLT1_0086_G02.b :
HTMT1_0137_C08.b :
CBLT1_0083_G09.b :
ILNT1_0051_G02.b :
ITT01_0074_C12.b :
HTMT1_0017_D09.b :
CBLT1_0004_E01.b :
HTMT1_0021_F03.b :
ITT01_0013_A11.b :
HTMT1_0016_B12.b :
ADR01_0032_G05.b :
ITT01_0039_D12.b :
ITT01_0052_E06.b :
HTMT1_0061_C03.b :
HTMT1_0139_H03.b :
CBLT1_0007_C05.b :
HTMT1_0023_H06.b :
HTMT1_0039_H04.b :
SPLT1_0053_H10.b :
SPL01_0064_B03.b :
ITT01_0072_G06.b :
ITT01_0014_A07.b :
ITT01_0095_C07.b :
HTMT1_0048_H02.b :
ITT01_0047_D01.b :
SPLT1_0034_D03.b :
UTR01_0105_B02.b :
MLN01_0008_A01.b :
CBLT1_0017_C01.b :
HTMT1_0014_A11.b :
UTR01_0085_A04.b :
HTMT1_0056_H05.b :
ILNT1_0091_G09.b :
HTMT1_0046_G12.b :
ILNT1_0036_D04.b :
SPLT1_0095_C05.b :
HTMT1_0038_A07.b :
HTMT1_0122_C01.b :
ITT01_0071_H01.b :
ITT01_0003_E07.b :
HTMT1_0048_A10.b :
SPLT1_0086_G01.b :
BMWN1_0077_C04.b :
ILNT1_0028_G06.b :
BMWN1_0010_H12.b :
OVR01_0095_H03.b :
OVRT1_0039_F04.b :
MLN01_0044_E01.b :
CBLT1_0040_B08.b :
UTR01_0079_E10.b :
SPLT1_0076_B06.b :
HTMT1_0048_D05.b :
HTMT1_0032_B06.b :
UTR01_0035_F07.b :
HTMT1_0111_B08.b :
SMG01_0037_C11.b :
OVRT1_0010_F01.b :
MLN01_0037_G07.b :
MLN01_0038_E12.b :
HTMT1_0053_H10.b :
CBLT1_0077_E05.b :
HTMT1_0101_A11.b :
ILNT1_0050_G06.b :
MLN01_0065_A02.b :
SPLT1_0085_G10.b :
BFLT1_0026_G05.b :
MLN01_0027_F12.b :
UTR01_0096_A10.b :
UTR01_0079_A08.b :
SPLT1_0042_G02.b :
ILNT1_0056_H01.b :
CBLT1_0090_F11.b :
UTR01_0047_E01.b :
UTR01_0075_F10.b :
OVRM1_0074_E06.b :
LVRM1_0132_B12.b :
OVRM1_0183_F03.b :
OVRM1_0049_F12.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_E09.b :
UTR01_0100_B12.b :
UTR01_0008_C11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0042_C09.b :
TES01_0104_C09.b :
UTR01_0042_B06.b :
ITT01_0040_H11.b :
MLN01_0063_D03.b :
ITT01_0100_A02.b :
CLNT1_0058_D08.b :
OVRT1_0102_F08.b :
OVRT1_0082_F09.b :
UTR01_0074_B11.b :
UTR01_0095_B05.b :
UTR01_0087_G07.b :
UTR01_0047_D03.b :
UTR01_0070_H11.b :
UTR01_0079_H03.b :
CBLT1_0075_E11.b : ttttgggcggtagaggccgtagtatttatxxxxxxxxxxxxxxxxxxx
MLN01_0041_F10.b : nnaact
LNG01_0058_B01.b : nngggctcnnnntgcgatggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_D01.b :
OVRT1_0040_D04.b :
HTMT1_0009_H03.b :
LVRM1_0169_E04.b :
OVRT1_0101_B12.b : ntt
SPL01_0029_G06.b :
OVRM1_0009_E01.b :
LVRM1_0021_G12.b :
LVRM1_0176_E02.b :
LVRM1_0024_C04.b :
UTR01_0072_C03.b :
LVRM1_0201_H04.b :
OVRM1_0165_E01.b :
LVRM1_0187_A12.b :
LVRM1_0179_H12.b :
LVRM1_0090_E06.b :
LVRM1_0026_G11.b :
LVRM1_0047_E10.b :
LVRM1_0028_E09.b :
OVRM1_0126_D02.b :
LVRM1_0142_F03.b :
OVRM1_0139_A10.b :
LVRM1_0037_E10.b :
LVRM1_0053_E11.b :
OVRM1_0225_H05.b :
OVRM1_0010_A03.b :
OVRM1_0191_G12.b :
LVRM1_0102_C11.b :
LVRM1_0155_B08.b :
LVRM1_0003_C06.b :
OVRM1_0078_E02.b :
OVRM1_0048_F12.b :
LVRM1_0149_G08.b :
LVRM1_0124_G11.b :
OVRM1_0067_C05.b :
LVRM1_0013_B12.b :
OVRM1_0112_B08.b :
LVRM1_0113_G11.b :
LVRM1_0158_H04.b :
ADR01_0011_A02.b :
LVRM1_0109_A08.b :
LVRM1_0019_F11.b :
OVRM1_0080_F10.b :
UTR01_0012_B12.b :
UTR01_0013_E11.b :
PBL01_0001_A01.b :
LVRM1_0050_B06.b :
OVRM1_0071_D08.b :
UTR01_0070_G10.b :
MLN01_0024_G06.b :
OVR01_0094_D03.b :
ADR01_0026_C03.b :
UTR01_0014_G09.b :
OVRM1_0069_D09.b :
UTR01_0051_E09.b :
UTR01_0045_G01.b :
CLNT1_0111_D03.b :
UTR01_0009_H07.b :
UTR01_0026_H05.b :
SPL01_0010_B03.b :
UTR01_0099_H12.b :
UTR01_0009_H03.b :
UTR01_0016_A11.b :
UTR01_0044_F11.b :
UTR01_0075_D06.b :
PBL01_0025_B09.b :
OVR01_0068_E12.b :
UTR01_0025_C08.b :
UTR01_0084_E11.b :
UTR01_0016_B10.b :
UTR01_0016_H01.b :
SPLT1_0025_C03.b :
UTR01_0044_A06.b :
KDN01_0072_F08.b :
UTR01_0021_A10.b :
UTR01_0019_A09.b :
PST01_0065_C04.b :
KDN01_0053_G11.b :
UTR01_0031_A05.b :
KDN01_0078_E04.b :
KDN01_0074_H11.b :
KDN01_0074_B10.b :
UTR01_0039_F03.b :
KDN01_0036_B10.b :
KDN01_0043_B04.b :
KDN01_0097_F07.b :
UTR01_0019_G04.b :
KDN01_0099_E08.b :
UTR01_0039_D02.b :
KDN01_0010_H03.b :
KDN01_0079_G06.b :
KDN01_0099_E07.b :
PST01_0053_B01.b :
KDN01_0066_B09.b :
KDN01_0034_F11.b :
PST01_0066_G12.b :
CBLT1_0025_D07.b :
UTR01_0021_F08.b :
ITT01_0002_D03.b :
ITT01_0027_A12.b :
ITT01_0028_C04.b :
ITT01_0055_C07.b :
ITT01_0083_C03.b :
ITT01_0040_C11.b :
ITT01_0047_D12.b :
ITT01_0092_C02.b :
ITT01_0097_G09.b :
ITT01_0078_D10.b :
ITT01_0018_F03.b :
ITT01_0012_D04.b :
ITT01_0026_C03.b :
UTR01_0021_D06.b :
ITT01_0064_E10.b :
ITT01_0077_H02.b :
SMG01_0080_C11.b :
ITT01_0062_H08.b :
ITT01_0019_F04.b :
ITT01_0043_A04.b :
KDN01_0056_E06.b :
HTMT1_0091_G09.b :
ITT01_0062_C09.b :
LVR01_0073_H07.b : gcctxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_G12.b :
ITT01_0055_D01.b :
ITT01_0042_F11.b :
ITT01_0012_G10.b :
ITT01_0014_B09.b :
ITT01_0021_A05.b :
ITT01_0102_G07.b :
CBLT1_0061_H12.b :
ITT01_0095_F07.b :
PBL01_0042_B12.b :
ITT01_0093_D02.b :
ADR01_0033_A01.b :
ITT01_0091_C02.b :
ADR01_0073_G03.b :
LNG01_0042_D07.b :
BFLT1_0096_F09.b :
CLNT1_0138_D10.b :
ITT01_0049_A05.b :
ITT01_0010_D03.b :
ITT01_0014_H02.b :
ITT01_0072_F03.b :
PBL01_0072_F04.b :
ITT01_0055_H03.b :
UTR01_0033_C09.b :
ADR01_0092_C02.b :
ITT01_0031_F11.b :
ITT01_0030_C04.b :
ITT01_0076_B02.b :
MLN01_0024_D05.b :
MLN01_0089_A08.b :
MLN01_0101_F12.b :
OVRT1_0031_B12.b :
ADR01_0005_E06.b :
ITT01_0070_E11.b :
ITT01_0074_D02.b :
UTR01_0032_B06.b :
ADR01_0101_A11.b :
SMG01_0025_A01.b :
UTR01_0036_A08.b :
SPL01_0075_E03.b :
MLN01_0086_A11.b :
MLN01_0060_B06.b :
CLNT1_0136_C04.b :
CBLT1_0086_C04.b :
ITT01_0006_E04.b :
ITT01_0052_B11.b :
ITT01_0088_A05.b :
LNG01_0080_G07.b :
MLN01_0053_E06.b :
UTR01_0090_G07.b :
UTR01_0096_C04.b :
MLN01_0089_H08.b :
MLN01_0093_E06.b :
UTR01_0096_D06.b :
ITT01_0053_A10.b :
ITT01_0066_B08.b :
LNG01_0109_C08.b :
MLN01_0066_D02.b :
SPL01_0033_A05.b :
UTR01_0082_C06.b :
UTR01_0084_B06.b :
UTR01_0104_A06.b :
SPL01_0066_F07.b :
UTR01_0087_C12.b :
UTR01_0101_G05.b :
ITT01_0045_G05.b :
MLN01_0051_B04.b :
MLN01_0064_C10.b :
UTR01_0086_E10.b :
UTR01_0087_C03.b :
UTR01_0088_B06.b :
UTR01_0100_H01.b :
MLN01_0099_F01.b :
UTR01_0082_E05.b :
TCH01_0080_B06.b :
UTR01_0094_D03.b :
BFLT1_0087_B09.b :
OVRT1_0099_F04.b :
PTG01_0021_A08.b :
ITT01_0065_H09.b :
UTR01_0086_C07.b :
UTR01_0098_C04.b :
MLN01_0010_B05.b :
UTR01_0066_H11.b :
OVRT1_0147_H03.b :
ITT01_0042_A02.b :
CLNT1_0023_H03.b :
ADR01_0050_A01.b :
UTR01_0049_E12.b :
MLN01_0028_B07.b :
OVRT1_0042_G01.b :
BFLT1_0043_G09.b :
PTG01_0018_F08.b :
ITT01_0092_G01.b :
OVRT1_0019_F04.b :
BFLT1_0060_E10.b :
OVRT1_0014_E02.b :
ITT01_0101_E09.b :
BFLT1_0115_A11.b :
OVRT1_0150_F01.b :
SMG01_0024_C12.b :
BFLT1_0090_D06.b :
ITT01_0066_G05.b :
MLN01_0025_E04.b :
OVRT1_0103_H08.b :
OVRT1_0007_D04.b :
ITT01_0065_E06.b :
MLN01_0090_E04.b :
UTR01_0094_F05.b :
MLN01_0047_C06.b :
MLN01_0082_C09.b :
BFLT1_0034_H03.b :
UTR01_0096_C10.b :
MLN01_0011_H06.b :
OVRT1_0102_C05.b :
MLN01_0020_G10.b :
OVRT1_0044_C07.b :
HTMT1_0087_H12.b :
MLN01_0101_D05.b :
MLN01_0044_B02.b :
MLN01_0047_C08.b :
OVRT1_0095_A04.b :
MLN01_0079_D10.b :
MLN01_0050_B02.b :
SPL01_0071_B05.b :
MLN01_0020_A10.b :
UTR01_0046_E02.b :
MLN01_0039_G08.b :
MLN01_0097_C09.b :
UTR01_0048_G11.b :
UTR01_0090_E07.b :
MLN01_0002_C07.b :
MLN01_0036_G12.b :
UTR01_0082_G04.b :
MLN01_0073_G01.b :
LVR01_0057_F09.b :
MLN01_0100_C03.b :
MLN01_0023_F09.b :
UTR01_0047_E04.b :
UTR01_0096_H02.b :
UTR01_0100_E05.b :
UTR01_0103_G12.b :
OVRT1_0151_G12.b :
MLN01_0007_G01.b :
UTR01_0062_B11.b :
LVR01_0009_H11.b :
MLN01_0099_D11.b :
OVR01_0061_G06.b :
OVR01_0039_C09.b :
UTR01_0064_E12.b :
UTR01_0089_A12.b :
OVRT1_0139_F12.b :
UTR01_0080_G11.b :
MLN01_0015_H03.b :
UTR01_0056_B03.b :
MLN01_0047_B12.b :
LVR01_0088_H03.b :
UTR01_0100_B07.b :
UTR01_0088_F01.b :
MLN01_0093_B07.b :
OVR01_0032_F12.b :
MLN01_0069_H10.b :
UTR01_0053_A06.b :
UTR01_0074_G02.b :
UTR01_0107_C08.b :
UTR01_0061_D01.b :
UTR01_0103_H05.b : caaaacataaacaaaccctccccccttttccnnn
UTR01_0052_A04.b :
UTR01_0053_F01.b :
UTR01_0052_E03.b :
UTR01_0090_G03.b :
LNG01_0034_A08.b :
UTR01_0049_G05.b :
OVR01_0012_E12.b : ggaaaaattggax
OVR01_0001_G09.b : aaaaccttxxxxx
LVR01_0034_G03.b :
BFLT1_0148_D07.b :
TES01_0077_A11.b :
HTMT1_0080_H07.b :
BMWN1_0035_D07.b :
SKNB1_0046_B09.b :
KDN01_0040_A08.b :
TES01_0002_H11.b :
BMWN1_0077_F02.b :
UTR01_0099_D02.b :
OVRT1_0030_D11.b :
BFLT1_0130_B02.b :
OVRT1_0117_C09.b :
BFLT1_0121_H11.b :
OVRT1_0141_A04.b :
UTR01_0074_C12.b :
LVR01_0038_A02.b :
LVRM1_0093_G04.b :
MLN01_0075_A12.b :
LVRM1_0093_A01.b :
LVRM1_0099_G06.b :
OVRM1_0179_B01.b :
OVRM1_0052_D06.b :
OVRM1_0049_H08.b :
OVRM1_0106_D07.b :
UTR01_0092_E02.b :
LVRM1_0006_A11.b :
KDN01_0074_D12.b :
HTMT1_0011_B09.b :
HTMT1_0004_F05.b :
HTMT1_0006_G01.b :
UTR01_0036_A11.b :
HTMT1_0011_A08.b :
ITT01_0099_C03.b :
ITT01_0030_B08.b :
UTR01_0004_G03.b :
UTR01_0035_B01.b :
ADR01_0087_H10.b :
MLN01_0097_H06.b :
ITT01_0001_F07.b :
MLN01_0067_G05.b :
UTR01_0106_E06.b :
SPL01_0073_B11.b :
OVRT1_0110_E09.b :
UTR01_0061_A01.b :
MLN01_0101_E11.b :
OVR01_0015_B05.b :
UTR01_0038_E06.b :
TCH01_0087_C07.b :
LVR01_0044_H01.b :
LVR01_0062_C03.b :
UTR01_0095_H06.b :
UTR01_0054_B06.b :
UTR01_0072_H11.b :
OVRM1_0187_B04.b :
KDN01_0004_B02.b :
KDN01_0004_A08.b :
SPL01_0084_C09.b :
PTG01_0086_E01.b :
UTR01_0028_B05.b :
PST01_0026_F07.b :
ITT01_0033_H10.b :
ITT01_0065_H08.b :
MLN01_0089_D10.b :
MLN01_0062_F07.b :
OVRM1_0188_H07.b : gxxxxxxxxxxxxx
OVRM1_0015_B07.b :
OVR01_0055_F04.b :
KDN01_0042_G12.b :
KDN01_0041_E05.b :
UTR01_0004_B11.b :
PCT01_0025_D08.b :
PCT01_0019_H09.b :
CLNT1_0080_H05.b :
BMWN1_0071_E11.b :
MLN01_0049_G11.b :
TES01_0057_H02.b :
PST01_0020_F01.b :
PCT01_0034_E03.b :
MLN01_0021_D03.b :
KDN01_0020_A06.b :
SPL01_0071_F12.b :
UTR01_0005_H10.b :
HTMT1_0118_C02.b :
HTMT1_0117_D02.b :
HTMT1_0116_G03.b :
HTMT1_0129_G12.b :
HTMT1_0092_G12.b :
KDN01_0050_F01.b :
LVRM1_0024_H02.b :
BFLT1_0051_D08.b :
PBL01_0086_A05.b :
KDN01_0065_B09.b :
KDN01_0065_D04.b :
LVRM1_0198_A01.b :
PBL01_0021_E02.b :
ADR01_0068_F08.b :
HTMT1_0062_C11.b :
CBLT1_0030_E08.b :
HTMT1_0001_D11.b :
CBLT1_0008_F03.b :
CBLT1_0013_H07.b :
HTMT1_0021_B01.b :
HTMT1_0021_B03.b :
AMP01_0015_G02.b :
SPLT1_0051_F05.b :
BKFL1_0005_B03.b :
SPLT1_0070_H03.b :
PCT01_0004_G09.b :
HTMT1_0027_G06.b :
ILNT1_0044_D04.b :
SPL01_0053_A04.b :
MLN01_0005_A04.b :
BMWN1_0083_D02.b :
HTMT1_0145_A01.b :
SKNB1_0028_G12.b :
AMP01_0033_H10.b :
BMWN1_0016_G11.b :
BKFL1_0032_F06.b :
BKFL1_0043_A02.b :
DCI01_0055_B06.b :
SPLT1_0084_B09.b :
HTMT1_0127_A07.b :
CBLT1_0060_A08.b :
ILNT1_0054_G02.b :
ILNT1_0041_D07.b :
HTMT1_0066_C09.b :
BKFL1_0016_D10.b :
CBLT1_0067_B08.b :
CBLT1_0068_E07.b :
CBLT1_0051_H08.b :
CBLT1_0052_C11.b :
ILNT1_0086_B09.b :
BMWN1_0058_E10.b :
HTMT1_0050_G08.b :
HTMT1_0079_H11.b :
HTMT1_0024_D01.b :
SPLT1_0055_H04.b :
SPLT1_0019_A04.b :
ILNT1_0090_H04.b :
ILNT1_0083_C02.b :
SPLT1_0089_F11.b :
20110601C-000819 : .........................................................GAT
---------+---------+---------+---------+---------+---------+ 3
LVRM1_0026_G06.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAT
MLN01_0076_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAT
HTMT1_0073_G06.b : aggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0041_C12.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_D11.b :
CBLT1_0034_H06.b : nttttggcaagtacacgcagtagtaxx
HTMT1_0077_E11.b : tttccgcaggaagaggxxxxxxxxxxxx
BMWN1_0081_F01.b : ttttccacggtacgacgxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0079_B04.b : nnggatagtacgaggxxxxxxxxxxxxxx
LVRM1_0125_B02.b : nagtttgtcatxxxxxxxxxxxxxxxxxxxx
CBLT1_0034_G02.b : ttttagcaggtacacgxxxxxxxxxxx
BMWN1_0041_H03.b : nggaaattacgacgxxxxxxxxxxx
BMWN1_0080_B09.b : ttgggcacggaagacgccataxxxxxx
BMWN1_0032_H05.b : tttttggcgagaagacxxxxxxxxxxxxxxx
BMWN1_0073_D05.b : nacagagtacgaxxxxxxxxxxxxxxx
HTMT1_0078_D10.b : ntttggacaggaacgacgxxxxxxxxxxxx
BMWN1_0017_A08.b : tttttagacggtagacgccgtaxxxxxxxxxxxxxxxxxxx
HTMT1_0072_H06.b : ntaagagagtaagacgxxxxxxxxxxx
BMWN1_0073_E04.b : ttggatagtacgacgccgtaxxxxxxxx
HTMT1_0079_E08.b : nnccgcaggtagaggccgtaxxxxxxx
HTMT1_0059_E11.b : tttttccgaggtacgaggccataxxxxxxx
HTMT1_0150_H04.b : nttgacagtagaxxxxxxxxxxxxxxxx
CBLT1_0034_D06.b : tttccgcagtacacxxxxxxxxxxxxx
BMWN1_0030_H04.b : ttttagcagagtagacgxxxxxxxxxxx
UTR01_0040_B01.b : tttttgggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0116_E03.b : nngggatagtaagaggccgtagtaxxxx
HTMT1_0151_F12.b : tttacgcagttagaxxxxxxxxxxxxxxx
SPLT1_0006_F03.b : nnnttcgcagtagaggccgtagtatta
SPLT1_0026_E01.b : nnnggtgcggtagaggxxxxxxxxxxx
BMWN1_0094_E07.b : tttttccgacggtagacgccgtaxxxxxxxxxxxxxxxxxx
HTMT1_0146_B04.b : ttttttggcaggtagacxxxxxxxxxxxxxx
CBLT1_0029_G02.b : nttgcaagaagacgxxxxxxxxxx
HTMT1_0035_G07.b : ngggaaggtacgaggccgtaxxxxxxx
HTMT1_0127_H10.b : ntttaagatagtacgaggcagtagtaxxx
HTMT1_0116_B05.b : nnnggacggtgagaggxxxxxxxxxxxx
ILNT1_0009_E03.b : nnnnnggcggtagaggcagtagtatta
BMWN1_0026_B08.b : nttttcgacggtagaggxxxxxxxxxxx
HTMT1_0103_H08.b : nttttggatagtxxxxxxxxxxxxxxxxxxx
CBLT1_0086_D08.b : ttttggacagtagaggxxxxxxxxxxx
HTMT1_0033_H05.b : tggacggtacgacgccgtaxxxxxxx
SPLT1_0073_B12.b : nnngggcgtgagaggxxxxxxxxxxx
ILNT1_0096_H08.b : nnnnggcaggtagacxxxxxxxxxxxxx
ILNT1_0094_F04.b : nnnnngcaagtacacgccgtaxxxxxxx
CBLT1_0035_A07.b : ttttccagtgagaxxxxxxxxxxxxxxx
CBLT1_0057_H12.b : tttttaacgaagtacacgxxxxxxxxxx
HTMT1_0017_H11.b : nttttggagagtagacgxxxxxxxxxxx
HTMT1_0026_B10.b : ttttccgcaagtagaggxxxxxxxxxxx
CBLT1_0018_B10.b : nnnnaagagagtagaggxxxxxxxxxx
CBLT1_0071_F10.b : nccgcaagtaagaggccgcxxxxxxxx
HTMT1_0030_E07.b : nttggacggtacgaggccgtaxxxxxx
ILNT1_0055_A02.b : nnccgagagtagaggxxxxxxxxxxxx
HTMT1_0098_E02.b : tttttggacagtacgaggccgtaxxxxxx
SPLT1_0079_C08.b : nnnnggcggtagaggxxxxxxxxxxxxxx
CBLT1_0083_A03.b : ttttggacggtagacgxxxxxxxxxxx
SPLT1_0034_C03.b : nnnncgcgagtagaggxxxxxxxxxxx
HTMT1_0125_E09.b : tttcgacggtagaggccgtaxxxxxx
ILNT1_0085_A03.b : nnnnactagtagacgxxxxxxxxxxx
HTMT1_0018_F03.b : nnttaggacggtagaggxxxxxxxxxxxx
HTMT1_0086_F03.b : ttttaggacggtacgaggxxxxxxxxxxx
HTMT1_0065_B07.b : ttttacgacagtagaggxxxxxxxxxxx
SPLT1_0041_B05.b : nnnnggcggtagaxxxxxxxxxxxxxxx
HTMT1_0061_A05.b : nntttcgacggtagaggccgtaxxxxxxxx
HTMT1_0091_A02.b : ttttaagagagtxxxxxxxxxxxxxxxxxx
HTMT1_0087_F06.b : ttttccgagagacgaggccgtaxxxxxxx
BMWN1_0061_F12.b : ntttggatagtacgaggxxxxxxxxxxx
CBLT1_0014_A04.b : ttttggacggtagaggxxxxxxxxxxx
BMWN1_0025_G06.b : ttttnggagagtagaggxxxxxxxxxxx
HTMT1_0126_D03.b : ttttggatagtacgaggxxxxxxxxxxx
HTMT1_0023_G12.b : tttttggacggtagacgxxxxxxxxxxxx
HTMT1_0082_A09.b : nnnccgcaggtagaggxxxxxxxxxxxxx
ILNT1_0092_D07.b : nnnaaagcaagtagaxxxxxxxxxxxxxx
SPLT1_0046_D06.b : nnnnggcgagtagaxxxxxxxxxxxxxx
HTMT1_0132_H12.b : tttggacggtacgaggxxxxxxxxxxx
ILNT1_0027_A11.b : nnnaagacaggagaggcagtagtatta
HTMT1_0023_E02.b : tttttggcaagtagaggxxxxxxxxxxx
CBLT1_0031_G02.b : ttttccgagatacgaxxxxxxxxxxxxxxx
ILNT1_0090_C03.b : nnnnnccaagtagaxxxxxxxxxxxxxxxx
HTMT1_0088_G10.b : tttttggatagtacgaggcagtagtatta
HTMT1_0089_E07.b : ttttaggcaggtagaggxxxxxxxxxxxx
ILNT1_0071_D05.b : nnnggacggtacgaggxxxxxxxxxxxx
SPLT1_0017_E11.b : nnnnccaggttagaggccgtaxxxxxxx
SPLT1_0061_F07.b : nnnccgcgagtagaggccgtaxxxxxxx
SPLT1_0014_G03.b : nnccgcgagtagacgxxxxxxxxxxxx
HTMT1_0147_A12.b : ttttttggcagagtagacxxxxxxxxxxxxxxx
ILNT1_0033_C10.b : nnnnccgcgagtagaggccgtagtatta
CBLT1_0057_A02.b : ttttgcgcaggagacgxxxxxxxxxxx
SPLT1_0058_B02.b : nnnccgcgataagaggxxxxxxxxxxx
SPLT1_0056_B06.b : nnncgcgagtagaggcagtagtatta
CBLT1_0027_B11.b : tttttccaggtagaxxxxxxxxxxxxxx
BMWN1_0024_C08.b : nnngacgacggtagacgcagtagtatt
HTMT1_0091_H05.b : ttttacgagagtagaggcagtagtatt
HTMT1_0068_G10.b : tttttacgacagtagaggccgtxxxxxxx
CBLT1_0088_A06.b : tttttcgaggaagaggccgtagtattt
CBLT1_0013_C07.b : tttccgacggtagaggxxxxxxxxxxx
CBLT1_0033_H10.b : ttttcgcaagacacgccgtaxxxxxxx
ILNT1_0084_E03.b : nnnccgcggtagaggccgtagtattt
HTMT1_0100_A06.b : ttttaacgatggtxxxxxxxxxxxxxxxxxxx
CBLT1_0054_D07.b : tttttggcaggagaxxxxxxxxxxxxxxxx
CBLT1_0015_A10.b : ttttggacggtagaxxxxxxxxxxxxxxx
CBLT1_0074_H04.b : nnttccgacggtagaggxxxxxxxxxxx
ILNT1_0002_G11.b : nnnccgcgttacgaggxxxxxxxxxxxx
HTMT1_0045_E12.b : tttttggacagtagacgccgtaxxxxxxxx
BMWN1_0047_B01.b : nnnggccagagacgaggxxxxxxxxxxx
SPLT1_0070_C10.b : nnnccgcgagtagacgxxxxxxxxxxxx
ILNT1_0097_E05.b : nnnaaagcagtagacgxxxxxxxxxxx
HTMT1_0054_B08.b : ttttaaagacagtacgaxxxxxxxxxxxxxxxxxx
HTMT1_0056_H08.b : naaatcgagagtacgaxxxxxxxxxxxxxxx
BMWN1_0052_A12.b : tttttcgacggtagaggxxxxxxxxxxxx
CBLT1_0039_D02.b : tttnncgacagtagaggxxxxxxxxxxx
ILNT1_0002_F09.b : ttttcgcgtgagaggxxxxxxxxxxx
HTMT1_0058_E02.b : ttttccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxx
HTMT1_0133_E08.b : nnccactttnttnnnggacggtagaggxxxxxxxxxxxx
HTMT1_0019_F04.b : ttttacgagagtagacxxxxxxxxxxxxxxxx
CBLT1_0039_H06.b : nttttagacagtagacgxxxxxxxxxxx
BMWN1_0061_G11.b : nnnnggatagtaagacgxxxxxxxxxx
CBLT1_0047_F04.b : ntttacagtgagaggcagtagtatta
CBLT1_0093_E09.b : nnccgagtgagaggccgtagtatt
MLN01_0082_H11.b : nnggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0053_B09.b : nnnttaattttnttnnnggcaggagacgxxxxxxxxxxxx
SPLT1_0037_B08.b : nnncccgttttnnnnnggcagtagacgccgtaxxxxxxx
BMWN1_0024_H03.b : ntttacgagagtagacgcagtagtattaaxxxxxxxxxxx
HTMT1_0052_C10.b : tttttggacagtacgaxxxxxxxxxxxxxxxx
HTMT1_0100_E10.b : nttttggacggtacgaxxxxxxxxxxxxxx
HTMT1_0108_E05.b : ttttggacggtaagacgcagtagtatt
MLN01_0048_E12.b : nnngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0046_E09.b : nnnnggcgagtagaggxxxxxxxxxxx
HTMT1_0032_E03.b : gccggtacgaggccgtxxxxxxxxx
BMWN1_0096_G01.b : ttttccgacggtagaggxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0014_B12.b : tttttggacggtagaggxxxxxxxxxxx
HTMT1_0052_D08.b : ttttccgaggtacgaggccgtaxxxxxxxx
ITT01_0038_H07.b : nnnggtgxxxxxxxxxxxxxxxxxxx
HTMT1_0098_B02.b : ttttaggacggtacgaxxxxxxxxxxxxx
BMWN1_0025_D12.b : ttttacgacgttagacxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0056_E04.b : nttaaccgatagtacgaggxxxxxxxxxxxxxx
CBLT1_0012_D05.b : ttttccgacagtagaxxxxxxxxxxxxxxx
SPLT1_0020_A06.b : nnnaaagagagtagaggxxxxxxxxxxx
SPLT1_0038_C12.b : nnaaaccatttttnnncagcatagtagacgcantaxxxxxx
SPLT1_0055_E01.b : nnnccgcgagtagaggxxxxxxxxxxxx
BMWN1_0060_H10.b : ntttggatggtacgaggxxxxxxxxxx
ILNT1_0056_A07.b : nnnggacatgagaggcagtagtatta
HTMT1_0026_C03.b : ttttccgacggtacacgxxxxxxxxxxx
CBLT1_0038_B02.b : ttttccgaggtagaggcagtagtatta
MLN01_0085_B04.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0049_B01.b : nnnggacatgagaggcagtagtatta
CBLT1_0086_H08.b : nntttggcaggaagaggccgtagtattt
HTMT1_0085_D04.b : ttttccgacagtagaggxxxxxxxxxxxx
ILNT1_0013_D04.b : ttttccgagagagaxxxxxxxxxxxxxxx
ILNT1_0090_C10.b : nnnnnggcaagtagaxxxxxxxxxxxxxxx
HTMT1_0101_G05.b : ntttggcaggtaagaggxxxxxxxxxxx
SPLT1_0023_H08.b : nnnttcgcaagtagaggccgtaxxxxx
HTMT1_0035_A06.b : ntgagagtacgaggccataxxxxxxx
UTR01_0064_A09.b : ataaagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0100_G05.b : nttggacggaagaggccgtagtatttatxxxxxxxx
SPL01_0021_F11.b : ggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0008_H11.b : ttgcgaagaagaggccgtaxxxxxx
ILNT1_0069_C02.b : nnncgagagtagaggcagtagtatt
BMWN1_0035_B02.b : ttttggcagagtagacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_F09.b : attttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_H05.b : nnttgatgaacaxxxxxxxxxxxxx
HTMT1_0056_E08.b : tttttggatagtacgaggccgtagtaxxx
BMWN1_0064_F02.b : tttttcgagagtacgacgxxxxxxxxxx
HTMT1_0144_B11.b : ttttttggcaggtagacxxxxxxxxxxxxx
SPLT1_0009_E08.b : nnnggcgagagaggccxxxxxxxxx
MLN01_0058_G01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0127_E12.b : nnnnccgttctgcgtaggxxxxxxxxxxxxxxxxxxx
HTMT1_0105_G02.b : tttggatagtacgaggxxxxxxxxxxx
HTMT1_0050_E08.b : tttttggacggtacgaxxxxxxxxxxxxxxxx
SMG01_0060_H09.b : tttttttgatgaaagaxxxxxxxx
ILNT1_0056_B12.b : nnngggcaggtagaggxxxxxxxxxx
HTMT1_0051_C07.b : ttttggacggtgagaggxxxxxxxxxxx
LNG01_0103_E02.b : nnnttagctggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0104_A01.b : nnnccgctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_H07.b : nnccgagagtagaggxxxxxxxxxx
OVRT1_0094_D08.b : nnttcttnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxx
CBLT1_0077_H02.b : tttttacgaggtagaggxxxxxxxxxxxx
ITT01_0065_C04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxx
SMG01_0067_H01.b : ngcgttatttttaggctaaagcagcxxxxxxxxxxx
HTMT1_0027_E09.b : tttggcagagaagaggccgtagtaxxx
SPL01_0098_C07.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0063_A04.b : ttgtttcctcgcttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0080_E11.b : nnnggacggtacgaxxxxxxxxxxxxx
LVRM1_0029_G07.b : agttgtcxxxxxxxxxxxxxxx
SPL01_0015_H05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_A12.b : attttgggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_A07.b : nttttggcagagtagacgcagtagtat
ITT01_0049_H09.b : nnagagtaacaxxxxx
ADR01_0074_C06.b : nnnaacaaaaaaanggctaagagctggaxx
HTMT1_0069_C03.b : tttttcgacggtagaggcagtagtax
ITT01_0074_D11.b : nngggagxxxxxxxxxxxxxxxxxx
ITT01_0097_A03.b : nnggatgaacaxxxxxxxxxxx
ILNT1_0094_G08.b : nnnnttcaggttagaxxxxxxxxxxxxx
ITT01_0020_F10.b : nnnaagtgaaacaxxxx
ITT01_0075_G03.b : nnnggatgaacaxxxxxxxxxxx
OVRT1_0098_G12.b : nnnnnnctctgcgnacggatgxxxxxxxxxxxxxx
UTR01_0104_D05.b : nnnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0041_C08.b : nttgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0017_A05.b : nnnaaagcagtagaxxxxxxxxxxxx
BMWN1_0043_F11.b : nnnggcaagtagaggxxxxxxxxx
HTMT1_0111_G04.b : nnnnggacggtacgaggxxxxxxxxx
UTR01_0079_B03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_C09.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0017_G12.b : gagcatatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G03.b : cagttgtacxxxxxxxxxxxxxxxx
LVRM1_0096_G11.b : ttgtccxxxxxxxxxxxxxxxxxx
ILNT1_0079_B07.b : nnncgacggtacgaggxxxxxxxxxx
OVR01_0057_F11.b : tgcttgtgacttgacagtttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0197_B11.b : gtcxxxxxxxxxxxxxxxxxx
LVRM1_0153_C05.b : agttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0130_D12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_B06.b : gagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0153_G03.b : cagtgtcatxxxxxxxxxxxxxxxxx
LVRM1_0004_H09.b : cgttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0128_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0210_H09.b : agttgacxxxxxxxxxxxxxxxxxxx
HTMT1_0149_C02.b : nnnggacaagagaggcagtagt
HTMT1_0120_C10.b : ntcgatggtacgaggccgtagta
PBL01_0029_A06.b : ngtgcaagaxxxxxxxxx
HTMT1_0108_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0027_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0034_G12.b : agatgaacaxxxxxxxxxx
SPLT1_0005_D02.b : nnccgcagtaagaggccxxxxxxx
HTMT1_0113_E02.b : nttagcgagtxxxxxxxxxxxxxxxx
CBLT1_0074_A06.b : tttccgacagaagaggxxxxxxxx
HTMT1_0123_F08.b : ttttggaacggttagacxxxxxxxxxxx
UTR01_0028_C10.b : tggggggacctataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0121_G02.b : nttttcgatcgaagacgxxxxxxx
UTR01_0024_H02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0007_B02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_B11.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_H10.b : ggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0042_A10.b : tttggcagagtagacxxxxxxxxxxx
CBLT1_0066_H11.b : nnttttcttttttnntggacggtagaggxxxxxxx
UTR01_0008_A05.b : ttatgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0088_G05.b : nnttcgtaggacgaggccgtxxxx
UTR01_0006_A08.b : gtgaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_G03.b : ggttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0005_A08.b : tggtgtacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0074_D10.b : ttttaagacggtagaggxxxxxxxxx
HTMT1_0008_B11.b :
UTR01_0015_B01.b : ggggacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_B11.b : ggtgcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0008_A11.b :
HTMT1_0150_G07.b : nnggacagaagaggccgtagta
CBLT1_0012_E01.b : ttttgcacagtagaggxxxxxxxxx
HTMT1_0101_D06.b : tttccgagagtagacgxxxxxxxxx
SPLT1_0055_B12.b : nnggcgcgagtagaggxxxxxxxx
CBLT1_0069_A05.b : nnnaaggcgagtagacgxxxxxxxxx
HTMT1_0049_F06.b : tttnnggacatacgaggxxxxxxxxx
SPLT1_0040_G10.b : nnnnnggagagtagaggxxxxxxxxx
HTMT1_0105_C08.b : nnnggactataagaggxxxxxxxxx
SPLT1_0017_D10.b : nnnnggcaggtagaxxxxxxxxxxx
SPLT1_0072_G09.b : nnnaacgcagttagaggccgtaxxx
HTMT1_0053_E12.b : tttttggatggtacgaggxxxxxxxxxx
CBLT1_0055_E10.b : tttttccaggtagacgxxxxxxxx
ILNT1_0099_E04.b : nnnggggcaggagaggccgtagta
HTMT1_0060_E07.b : ttttccgacggtagaggcagtxxxxx
HTMT1_0081_F11.b : ttttggcagagagaggxxxxxxxxx
SPLT1_0081_E09.b : nnnnccgcgagagaggccgtagtax
ILNT1_0014_D05.b : nnnccgagtgagaggcagtagta
HTMT1_0022_C08.b : ttttggacggtagaggccxxxxxxxxx
CBLT1_0021_F11.b : nnnnnggagagtagaxxxxxxxxxxx
CBLT1_0009_B04.b : nttttggcaggtagaggcagtagta
SPLT1_0001_D12.b : nttttccatagagacgxxxxxxxx
ITT01_0049_E10.b : nnnggatgaacaxxxxxxxxxxx
ITT01_0008_F06.b : nnnnggatgaacaxxxxxxxxx
HTMT1_0041_G04.b : nttttaggcaagtagaxxxxxxxxxxxxx
HTMT1_0066_C11.b : ttttttggacggtagaggxxxxxxxxx
CBLT1_0073_G07.b : ttttcgacggtagaggxxxxxxxxxx
HTMT1_0112_E11.b : nnnnggatagtacgaggxxxxxxxx
ILNT1_0042_B06.b : nnngggagacggtagaggccgtaxxxxxx
HTMT1_0023_F06.b : tttaagacagagtaagaggccgtaxxxx
CBLT1_0030_B01.b : tttttagagagtagaxxxxxxxxxxxx
HTMT1_0096_H10.b : ttttaggatgagaagacgccanxxxxx
BMWN1_0046_F02.b : tttggatagtacgaggxxxxxxxxxxxxxxxxxxxx
ILNT1_0040_D10.b : nnnnggcgacggtagaggxxxxxxxxx
HTMT1_0106_B12.b : nttttggacggtaagaggxxxxxxxx
SPLT1_0091_A09.b : nnnccgcgagtagaxxxxxxxxxxxx
HTMT1_0132_H11.b : ttttcgaggtacgaggxxxxxxxx
CBLT1_0081_D06.b : nnggcaggtagaggxxxxxxxxx
HTMT1_0041_G12.b : tttttcgacggtagaggccataxxxx
ILNT1_0039_G09.b : nnnggggacggtagaggxxxxxxxxx
ILNT1_0006_A09.b : nnnccgagagtagacgcagtagta
CBLT1_0049_A05.b : nnttgaaataagaggxxxxxxxx
UTR01_0034_E04.b : ggtggacctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_H05.b : nttggggcaggtagacgcagtagta
BMWN1_0049_A10.b : tttttggcaggtagaggxxxxxxxx
CBLT1_0083_A01.b : tttttggcaggtagaggxxxxxxxx
SPLT1_0036_B01.b : nnnccgcgagtagaggxxxxxxxx
UTR01_0021_E03.b : tttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0018_H11.b : tttttggacggtagaxxxxxxxxxxxxx
HTMT1_0062_B05.b : tttttcgacggtagaggccgtagtax
CBLT1_0025_F07.b : nntttgcaggtagaggccgtaxxxx
CBLT1_0085_B12.b : ttttcgagtgagaggxxxxxxxx
UTR01_0032_G10.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0142_C04.b : ttaaaggacaggtagaggxxxxxxxxxx
ITT01_0059_H01.b : nnggtgtaacaxxxx
CLNT1_0004_E04.b : ngaaacgttcgcgnacgxxxxxxxxxxxxxxxxxxxx
HTMT1_0066_G02.b : ttttttagacggtagaggxxxxxxxx
ILNT1_0003_H09.b : tttttcgacggtagaggcagtagta
CBLT1_0008_H08.b : nttttccaagtagaggxxxxxxxx
HTMT1_0122_F03.b : nnnnnggaaggtacgaggxxxxxxxxx
SPLT1_0090_E04.b : nnnccgaggtagaggccxxxxxxxx
HTMT1_0108_C08.b : nnnaagatggtacgacgxxxxxxxxx
ILNT1_0060_E06.b : nnnccgaggtacgaggxxxxxxxxx
ILNT1_0074_B12.b : nnnnggacggtacgaggcagtagta
SPLT1_0046_E10.b : nnnccgcggtagacxxxxxxxxxx
CBLT1_0063_A06.b : ncgtcatnnnnnngggacggtagaggxxxxxxx
SPLT1_0086_G02.b : nnnnnggcgagaagaxxxxxxxxxxxxx
HTMT1_0137_C08.b : ttttttagacggtagacgxxxxxxxx
CBLT1_0083_G09.b : ntttggagagtagaxxxxxxxxxxx
ILNT1_0051_G02.b : nnccgagatgagaggxxxxxxxx
ITT01_0074_C12.b : nttgatgaacaxxxxx
HTMT1_0017_D09.b : tttttcgacggtacgaxxxxxxxxxxxx
CBLT1_0004_E01.b : ttttaccagtgagaggxxxxxxxxxx
HTMT1_0021_F03.b : nttagaagagtagaggxxxxxxxx
ITT01_0013_A11.b : nnggatgaacaxxxxxxxxxxx
HTMT1_0016_B12.b : ttttccgacaggtagaggccgtagtax
ADR01_0032_G05.b : ttaaaaggataaacaxxxxxxxxxx
ITT01_0039_D12.b : nngggtgxxxxxxxxxxxxxxxx
ITT01_0052_E06.b : nnnggatgaacaxxxxxxxxx
HTMT1_0061_C03.b : tttttcgagagtagaxxxxxxxxxxxxx
HTMT1_0139_H03.b : nttttaaggatagtacgaggxxxxxxxx
CBLT1_0007_C05.b : ttttnccaggtagaggxxxxxxxx
HTMT1_0023_H06.b : nnttaagcagagtagaggxxxxxxxxx
HTMT1_0039_H04.b : ttttgcgagagtagaggccgtaxxxx
SPLT1_0053_H10.b : nnntgcgagtagaggxxxxxxxxxxx
SPL01_0064_B03.b : nnnnggcttggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0072_G06.b : nnttgatgaacaxxxxxxxxxxx
ITT01_0014_A07.b : nnnggatgaacaxxxxxxxxxx
ITT01_0095_C07.b : nnggatgaacaxxxxxxxxxx
HTMT1_0048_H02.b : ttttacgacggtagacgccgtagtax
ITT01_0047_D01.b : nnngatgaacaxxxxxxxxxxxxx
SPLT1_0034_D03.b : nnnaagacggtagaggcagtagta
UTR01_0105_B02.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0008_A01.b : nnntttccctggctatgacagtttgtcxxxxxxxxxxxxxxxxxxx
CBLT1_0017_C01.b : nnnnncgacggtagaggxxxxxxxxx
HTMT1_0014_A11.b : tttttggacggtagaggxxxxxxxxx
UTR01_0085_A04.b : nnnnttgcatggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0056_H05.b : nnngaagacggtxxxxxxxxxxxxxxxx
ILNT1_0091_G09.b : nnnnnggcaagagaxxxxxxxxxxxxx
HTMT1_0046_G12.b : tttttcgaggaacgaggxxxxxxxxx
ILNT1_0036_D04.b : nnnnnggacggtagaggccgtagta
SPLT1_0095_C05.b : nnnnnggcgagagaxxxxxxxxxxxx
HTMT1_0038_A07.b : ttttggacggtagacgcagtagta
HTMT1_0122_C01.b : nttttcacagtagacgxxxxxxxx
ITT01_0071_H01.b : tttgatgaacaxxxxxxxxxxx
ITT01_0003_E07.b : nnnaagtgaacaxxxxxxxxx
HTMT1_0048_A10.b : ttttacgacggtagaggccgtaxxxx
SPLT1_0086_G01.b : nnnggtgcgagtagaggccgtaxxxx
BMWN1_0077_C04.b : tttcccagagtagacgxxxxxxxx
ILNT1_0028_G06.b : nnnaacgagagagaggcagtagta
BMWN1_0010_H12.b : ntttgggatggtacgaggxxxxxxxxxxxxxxxxxxxx
OVR01_0095_H03.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_F04.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxx
MLN01_0044_E01.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0040_B08.b : ttttagagagtagaggxxxxxxxx
UTR01_0079_E10.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0076_B06.b : nnccgcgagtagacgcagtagtattaaxxxxxxxx
HTMT1_0048_D05.b : ttttccgaggtacgaxxxxxxxxxxxx
HTMT1_0032_B06.b : ttcaagagaagaggxxxxxxxx
UTR01_0035_F07.b : gggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0111_B08.b : nnnngggacggtacgacgxxxxxxxx
SMG01_0037_C11.b : nnncgcgtctntnnntgggtcaacagcggtccg
OVRT1_0010_F01.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxx
MLN01_0037_G07.b : nnnttgttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0038_E12.b : nnnnggctaggactataacagtttgtacxxxxxxxxxxxxxxxxxx
HTMT1_0053_H10.b : ttttacgacggtacgaxxxxxxxxxxxxx
CBLT1_0077_E05.b : tttttgcagtgagaxxxxxxxxxxx
HTMT1_0101_A11.b : ttgggcaggtacgaggcagtagta
ILNT1_0050_G06.b : nnnnggacggtagaggccgtaxxx
MLN01_0065_A02.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0085_G10.b : nnnggcgagtagaggxxxxxxxxx
BFLT1_0026_G05.b : ggactctatagcgnacgxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_F12.b : nnttgcttggcctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_A10.b : ntttgcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0079_A08.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0042_G02.b : nnnncctgagtagaxxxxxxxxxxx
ILNT1_0056_H01.b : nnnccgagagaagaggxxxxxxxxx
CBLT1_0090_F11.b : tttggagagtagaggxxxxxxxxx
UTR01_0047_E01.b : tggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_F10.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0132_B12.b : nagttgacxxxxxxxxxxxxxxx
OVRM1_0183_F03.b : gagttgtcxxxxxxxxxxxxxxxxx
OVRM1_0049_F12.b : xxxxxxxxxxxxxxxxxxxxxxxgtactggggataacccaaaaaagctggaattaccggc
LVRM1_0141_E09.b : nagttgtcxxxxxxxxxxxxx
UTR01_0100_B12.b : aattgctaggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggccctaatttattttttctaacaat
BMWN1_0042_C09.b : nnttccttttnnnnnnnccagggtacacgcagtagtatt
TES01_0104_C09.b :
UTR01_0042_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_H11.b : nnaatgxxxxxxxxxxxx
MLN01_0063_D03.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0100_A02.b : nggataaacaxxxxxxx
CLNT1_0058_D08.b : nnnnnccgtctgcgtacgagtgxxxxxxxxxxxxxxxx
OVRT1_0102_F08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
OVRT1_0082_F09.b : nggatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxx
UTR01_0074_B11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0095_B05.b : nntttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G07.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_D03.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0070_H11.b : ttttgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0079_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0075_E11.b : xxxxxxxxxxggcgcggcgggcaggcggcgtgattggccgcggcggggcggacggccgat
MLN01_0041_F10.b : tggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0058_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtgattggccgcggcggggcggacggccgat
OVRT1_0016_D01.b : nnnnccgttagctgacgxxxxxxxxxxxxxxxxxxx
OVRT1_0040_D04.b : nntttccgttagcgcacgxxxxxxxxxxxxxxxxxxx
HTMT1_0009_H03.b :
LVRM1_0169_E04.b : agttgtcxxxxxxxxxxxxxxxxx
OVRT1_0101_B12.b : tccggnnnnnnnggtntnttnnnnnnnnccgttcgcgnaggxxxxxxxxxxxxxxxxxxx
SPL01_0029_G06.b : nggggggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0009_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_G12.b : nagctgtacxxxxxxxxxxxxxxxxx
LVRM1_0176_E02.b : tagttgtacxxxxxxxxxxxxxxxxx
LVRM1_0024_C04.b : cgttgacxxxxxxxxxxxxxxxxx
UTR01_0072_C03.b : ttttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_H04.b :
OVRM1_0165_E01.b : tagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0187_A12.b : xxxxxxxxx
LVRM1_0179_H12.b : gtcxxxxxxxxxxxxxxxxx
LVRM1_0090_E06.b : ttgtcxxxxxxxxxxxxxxxxx
LVRM1_0026_G11.b : agttgxxxxxxxxxxxxxxxxxx
LVRM1_0047_E10.b : xxxxxxxxxxxx
LVRM1_0028_E09.b : agttgacagxxxxxxxxxxxxxxx
OVRM1_0126_D02.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0142_F03.b : agttgtcxxxxxxxxxxxxxxxxx
OVRM1_0139_A10.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0037_E10.b : gagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0053_E11.b : ncagtgtcxxxxxxxxxxxxxxxxx
OVRM1_0225_H05.b : ttgtcxxxxxxxxxxxxxxxxx
OVRM1_0010_A03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_G12.b : xxxxxxxxx
LVRM1_0102_C11.b : cagtgtcxxxxxxxxxxxxxxxxx
LVRM1_0155_B08.b : cagtgtcxxxxxxxxxxxxxxxxx
LVRM1_0003_C06.b : agtttgtxxxxxxxxxxxxxxxxx
OVRM1_0078_E02.b : agttgxxxxxxxxxxxxxxxxxx
OVRM1_0048_F12.b : gttgtcxxxxxxxxxxxxxxxxx
LVRM1_0149_G08.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0124_G11.b : nagttgtcxxxxxxxxxxxxxxxxx
OVRM1_0067_C05.b : agttgtcxxxxxxxxxxxxxxxxx
LVRM1_0013_B12.b : ttgtcxxxxxxxxxxxxxxxxx
OVRM1_0112_B08.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0113_G11.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0158_H04.b : nagttgtcxxxxxxxxxxxxxxxxxx
ADR01_0011_A02.b : nnaatgaacaxxxxxxxxx
LVRM1_0109_A08.b : nagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0019_F11.b : agttgaataaagxxxxxxxxxxx
OVRM1_0080_F10.b : agttgxxxxxxxxxxxxxxxxx
UTR01_0012_B12.b : ctttttgggtgactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_E11.b : ggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0001_A01.b : gcatccnttcagatatagcagctgg
LVRM1_0050_B06.b : tagttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0071_D08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0070_G10.b : tttggggcacttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0024_G06.b : nnnnnccttgtactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0094_D03.b : ttcggataggactattacxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0026_C03.b : nnggagaaacaxxxxxxxx
UTR01_0014_G09.b : ggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_D09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_E09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_G01.b : aattttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0111_D03.b : nnnccactatagctcacggaggxxxxxxxxxxxxxxxx
UTR01_0009_H07.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_H05.b : ggggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_B03.b : ctttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_H12.b : nttttggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0009_H03.b : catttggctgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_A11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_F11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_D06.b : tttggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_B09.b : nngggtgxxxxxxxxxxxx
OVR01_0068_E12.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_C08.b : ggggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0084_E11.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_B10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0016_H01.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0025_C03.b : nnnnngcaagtagaxxxxxxxxx
UTR01_0044_A06.b : gggggaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_F08.b :
UTR01_0021_A10.b : ggggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0019_A09.b : ttgggtgacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0065_C04.b :
KDN01_0053_G11.b :
UTR01_0031_A05.b : cattttgctgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0078_E04.b :
KDN01_0074_H11.b :
KDN01_0074_B10.b :
UTR01_0039_F03.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0036_B10.b :
KDN01_0043_B04.b :
KDN01_0097_F07.b :
UTR01_0019_G04.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0099_E08.b :
UTR01_0039_D02.b : ttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0010_H03.b :
KDN01_0079_G06.b :
KDN01_0099_E07.b :
PST01_0053_B01.b :
KDN01_0066_B09.b :
KDN01_0034_F11.b :
PST01_0066_G12.b :
CBLT1_0025_D07.b : ttttggcgagagaxxxxxxxxxx
UTR01_0021_F08.b : gggtgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_D03.b : nnggataaacaxxxxxxxx
ITT01_0027_A12.b : nnggagtaacaxxxxxxx
ITT01_0028_C04.b : nnnggatgaacaxxxxxxxx
ITT01_0055_C07.b : nnnggatgaacaxxxxxxxx
ITT01_0083_C03.b : nnnggatgaacaxxxxxxxx
ITT01_0040_C11.b : nnnggtgaagcxxxxxxxxx
ITT01_0047_D12.b : nnnggatgaacaxxxxxxxx
ITT01_0092_C02.b : nnnggagaaacaxxxxxxxx
ITT01_0097_G09.b : nnnnggatgaacaxxxxxxxxx
ITT01_0078_D10.b : nnnnggatgxxxxxxxxxxxx
ITT01_0018_F03.b : nnnggatgaacaxxxxxxxx
ITT01_0012_D04.b : nnggatgaacaxxxxxxxx
ITT01_0026_C03.b : nnngatgaacaxxxxxxxx
UTR01_0021_D06.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_E10.b : nnnnggataaacaxxxxxxxxx
ITT01_0077_H02.b : nnnngatgaacaxxxxxxxx
SMG01_0080_C11.b : nnccgctttnnnnnnggagtaagcagcxxxxxx
ITT01_0062_H08.b : nnngggataaacaxxxxxxxxx
ITT01_0019_F04.b : nnnggatgaacxxxxxxxxxx
ITT01_0043_A04.b : nnggatgaacaxxxxxxxx
KDN01_0056_E06.b :
HTMT1_0091_G09.b : ttttcgagagtagacxxxxxxxxxx
ITT01_0062_C09.b : nnnnggatgaacaxxxxxxxxx
LVR01_0073_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_G12.b : ntaagatgaacaxxxxxxxx
ITT01_0055_D01.b : nnggatgaacaxxxxxxxx
ITT01_0042_F11.b : nnnggatgaacaxxxxxxxxx
ITT01_0012_G10.b : nnaagagtaacaxxxxxxxx
ITT01_0014_B09.b : nnnggatgaacaxxxxxxxx
ITT01_0021_A05.b : nttgatgaacaxxxxxxxxx
ITT01_0102_G07.b : nnggatacacxxxxxxxxxx
CBLT1_0061_H12.b : nnccttctttnnnnccgcaggtagacgxxxxxx
ITT01_0095_F07.b : nnaatgacacxxxxxxxxx
PBL01_0042_B12.b : nnaagtgxxxxxxxxxxxx
ITT01_0093_D02.b : naactcaacagctggtgx
ADR01_0033_A01.b : aaaannaaatactacacaxxxxxxxx
ITT01_0091_C02.b : nnggatgaacaxxxxxxxx
ADR01_0073_G03.b : nnnnnnggacaacaxxxxxxx
LNG01_0042_D07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0096_F09.b : gggatccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
CLNT1_0138_D10.b : nnncccttagcgnacgxxxxxxxxxxxxxxxxxx
ITT01_0049_A05.b : nnttgatgaagaxxxxxxxxx
ITT01_0010_D03.b : nnnggatgaacaxxxxxxxx
ITT01_0014_H02.b : nnggatgaacaxxxxxxxx
ITT01_0072_F03.b : nnggtgaacaxxxxxxxx
PBL01_0072_F04.b : nnggatgxxxxxxxxxxxxx
ITT01_0055_H03.b : nnggatgaacagcxxxx
UTR01_0033_C09.b : atttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0092_C02.b : nnnnnnggagtaacagctggax
ITT01_0031_F11.b : nnnggataaacaxxxxxxxxx
ITT01_0030_C04.b : nngggtgaacaxxxxxxxxx
ITT01_0076_B02.b : nngggatgaacaxxxxxxxx
MLN01_0024_D05.b : nnnggtaggacttgacagtttgtacxxxxxxxxxxxxxxxx
MLN01_0089_A08.b : nngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxx
MLN01_0101_F12.b : cgcttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_B12.b : ggcttccgtcagcgnacggatgxxxxxxxxxxxxxxx
ADR01_0005_E06.b : nntttttatgaacaxxxxxxx
ITT01_0070_E11.b : nngggagtaaxxxxxxxxxxx
ITT01_0074_D02.b : nnnggtgatacaxxxxxxxx
UTR01_0032_B06.b : tttttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0101_A11.b : naaaanggagtaagaxxxxxxxx
SMG01_0025_A01.b : tttttttgactaagcagcggta
UTR01_0036_A08.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0075_E03.b : nnngggttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0086_A11.b : nnngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxx
MLN01_0060_B06.b : tgttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0136_C04.b : nnnnnccgttagctntacgagtgxxxxxxxxxxxxxxx
CBLT1_0086_C04.b : ttttccgagtgagaggcagtag
ITT01_0006_E04.b : nnnggatgaacaxxxxxxxxx
ITT01_0052_B11.b : nngggatgaacaxxxxxxxxx
ITT01_0088_A05.b : nnggatgaacaxxxxxxx
LNG01_0080_G07.b : nnnggtgctggtataagacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0053_E06.b : nnnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0090_G07.b : nnggcttggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_C04.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0089_H08.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_E06.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_D06.b : nnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_A10.b : nnnggagtaacaxxxxxxxx
ITT01_0066_B08.b : nnggatgaacaxxxxxxxx
LNG01_0109_C08.b : tttttacttggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0066_D02.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0033_A05.b : tttttggcttggactatnacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0082_C06.b : nnnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0084_B06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0104_A06.b : nnnnggctaggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0066_F07.b : nnnggcttgtgcttaaacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_C12.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0101_G05.b : nnnttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0045_G05.b : nnnggatgaacaxxxxxxxx
MLN01_0051_B04.b : nnnnggctatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0064_C10.b : nnnnnccattggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0086_E10.b : nnttggctatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_C03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_B06.b : nnnttgcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0100_H01.b : nnnnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0099_F01.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_E05.b : nnnttgctaggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_B06.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0094_D03.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0087_B09.b : gggacccgttagctgtcngxxxxxxxxxxxxxxxxxxx
OVRT1_0099_F04.b : ncccccgtcagcgnacggatgxxxxxxxxxxxxxxx
PTG01_0021_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0065_H09.b : nnttgtgaaacaxxxxxxxx
UTR01_0086_C07.b : nnnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0098_C04.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_B05.b : nnnttagtggacttgacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0066_H11.b : gcctttagcgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_H03.b : nnntttcgttagctgacgxxxxxxxxxxxxxxxxxxx
ITT01_0042_A02.b : nttagagtaacaxxxxxxx
CLNT1_0023_H03.b : tttggtttagctgacgxxxxxxxxxxxxxxxxxxx
ADR01_0050_A01.b : ttccaagatgaacaxxxxxxx
UTR01_0049_E12.b : actttggctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0028_B07.b : taggnnnggcatggaatatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_G01.b : nnntttcgttagctnacgxxxxxxxxxxxxxxxxxxxx
BFLT1_0043_G09.b : nggactcgttagctnacgxxxxxxxxxxxxxxxxxxx
PTG01_0018_F08.b : nnggcgacttnnnnggctaaagcagcggta
ITT01_0092_G01.b : ngggatatacaxxxxxxxxx
OVRT1_0019_F04.b : nnaaaccgctagcggacgxxxxxxxxxxxxxxxxxxx
BFLT1_0060_E10.b : gattacgtcagcgnacgnatgxxxxxxxxxxxxxxx
OVRT1_0014_E02.b : nnnncctttagcgnacgagtgxxxxxxxxxxxxxx
ITT01_0101_E09.b : nnnnggatatacaxxxxxxxxxxxxxx
BFLT1_0115_A11.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxx
OVRT1_0150_F01.b : nnttccctacagcgnacgxxxxxxxxxxxxxxxxxxx
SMG01_0024_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0090_D06.b : nggaaccgttcagcgtcggxxxxxxxxxxxxxxxxxxx
ITT01_0066_G05.b : nnggataaacaxxxxxxxxx
MLN01_0025_E04.b : ngggtaggacttgacagtttgtcxxxxxxxxxxxxxxxxx
OVRT1_0103_H08.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
OVRT1_0007_D04.b : nncctttctgcgtacgagtgxxxxxxxxxxxxxxx
ITT01_0065_E06.b : nnnnggatgaacaxxxxxxxx
MLN01_0090_E04.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0094_F05.b : nnnnggcttggacttanacagtttgtacxxxxxxxxxxxxxxxx
MLN01_0047_C06.b : nngggttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0082_C09.b : nnggctaggaatatgacagtttgtacxxxxxxxxxxxxxxxx
BFLT1_0034_H03.b : ngaatccgtcagcgnacgnatgxxxxxxxxxxxxxx
UTR01_0096_C10.b : nttgcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0011_H06.b : nnntttgtggacttgacagtttgtcxxxxxxxxxxxxxxxxx
OVRT1_0102_C05.b : nnnnggtcagcgnaggxxxxxxxxxxxxxxxxxxx
MLN01_0020_G10.b : nnttctgtaggacttgacagtttgtacxxxxxxxxxxxxxxxx
OVRT1_0044_C07.b : nggccccttcagcgtacgagtgxxxxxxxxxxxxxxx
HTMT1_0087_H12.b : ttttcgatggaacgaggxxxxxxx
MLN01_0101_D05.b : tttggttggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0044_B02.b : nnnnggctaggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0047_C08.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_A04.b : nnncctcnnnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxx
MLN01_0079_D10.b : nnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxxx
MLN01_0050_B02.b : nnnnggctagtactaanacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_B05.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_A10.b : nntttccgtggacttgacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0046_E02.b : ttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_G08.b : ttcggggctaggactatnacagtttgtcxxxxxxxxxxxxxxxxx
MLN01_0097_C09.b : ngcttggactatgacagtttgtcatxxxxxxxxxxxxxxxx
UTR01_0048_G11.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_E07.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0002_C07.b : ntttaggctggtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0036_G12.b : ttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_G04.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0073_G01.b : nnnnggctaggacttgacagtttgtacxxxxxxxxxxxxxxx
LVR01_0057_F09.b : ctttttgggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0100_C03.b : nnnagttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0023_F09.b : nttcgggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_E04.b : ttttggggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_H02.b : nnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0100_E05.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_G12.b : ttttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_G12.b : nntttactatagcgnacgagtgxxxxxxxxxxxxxxx
MLN01_0007_G01.b : nnnntttctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0062_B11.b : gccattttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_H11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0099_D11.b : nnggttaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_G06.b : nnnggcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxx
OVR01_0039_C09.b : gggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0064_E12.b : ggctttttgcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_A12.b : nnttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0139_F12.b : nnnaaccgttatcnnnnnnnccgtctgcgttagxxxxxxxxxxxxxxxxxxx
UTR01_0080_G11.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0015_H03.b : nnttttggctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0056_B03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0047_B12.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H03.b : cgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0100_B07.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_F01.b : nnnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_B07.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_F12.b : tcaggcttatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_H10.b : nnnttgctaggactatgacagtttgtcxxxxxxxxxxxxxxxxx
UTR01_0053_A06.b : gcttttttgtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0074_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_C08.b : nnggcttggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_D01.b : ggcttttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H05.b : nnnnnnnnnnnnnnnnngtgcatggtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_A04.b : ccttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0053_F01.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_E03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0090_G03.b : nnnttgcttggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_A08.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0049_G05.b : cttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_G03.b : cttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0148_D07.b : nnnccttcagcgtacgaggxxxxxxxxxxxxxx
TES01_0077_A11.b :
HTMT1_0080_H07.b : tacgcgagaagacgccata
BMWN1_0035_D07.b : ttttggcagagagacxxxxxxxxxx
SKNB1_0046_B09.b :
KDN01_0040_A08.b :
TES01_0002_H11.b :
BMWN1_0077_F02.b : ttttggagagtacgaggxxxxx
UTR01_0099_D02.b : nnnttgcatggactatgacxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_D11.b : nnnnccctcagcgnacggaggxxxxxxxxx
BFLT1_0130_B02.b : nnncccacgtcgcgnacgxxxxxxxxxxxxxxxxxx
OVRT1_0117_C09.b : nnncctttagctgacgagtgxxxxxxxxxxxxxx
BFLT1_0121_H11.b : nnccccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
OVRT1_0141_A04.b : nnnggctcacnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxx
UTR01_0074_C12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_A02.b : ttgtgggggaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_G04.b : cagttgtcxxxxxxxxxxxxxxx
MLN01_0075_A12.b : xxxxxxxxxxx
LVRM1_0093_A01.b : ttgtcxxxxxxxxxxxxxxx
LVRM1_0099_G06.b : nagtttgtcxxxxxxxxxxxxxxx
OVRM1_0179_B01.b : agttgtcxxxxxxxxxxxxxxx
OVRM1_0052_D06.b : acgtgxxxxxxxxxxxxxxx
OVRM1_0049_H08.b : gttgxxxxxxxxxxxxxxx
OVRM1_0106_D07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_E02.b : nnnttgcttggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0074_D12.b :
HTMT1_0011_B09.b :
HTMT1_0004_F05.b :
HTMT1_0006_G01.b :
UTR01_0036_A11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0011_A08.b :
ITT01_0099_C03.b : ngatgaacxxxxxxx
ITT01_0030_B08.b : nnggatgaacaxxxxxx
UTR01_0004_G03.b : tttggggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0035_B01.b : ggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0087_H10.b : nnnaatgataacaxxxx
MLN01_0097_H06.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_F07.b : nnnttgatgaacaxxxxxx
MLN01_0067_G05.b : nnngggttggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0106_E06.b : nnnggctttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_B11.b : nccgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_E09.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxx
UTR01_0061_A01.b : atatcagctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_E11.b : nggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0015_B05.b : gggcctttaggaggacttatcgaacaggtttggacaaaatggtgggctcggaccgag
UTR01_0038_E06.b : gggaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0087_C07.b : nnnttgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H01.b : gggtgttagcttagtgactagtagacxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_C03.b : cttttaccggcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0095_H06.b : nnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0054_B06.b : gcattttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0072_H11.b : cttttggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_B04.b : nagtttgtcxxxxxxxxxxxxx
KDN01_0004_B02.b :
KDN01_0004_A08.b :
SPL01_0084_C09.b : nnggcttggacttagacxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0086_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0028_B05.b : ggggtgcactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0026_F07.b :
ITT01_0033_H10.b : nngggatgxxxxxxx
ITT01_0065_H08.b : nnttgatgaacax
MLN01_0089_D10.b : nnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_F07.b : nnggctaggacttgacagtttgtacxxxxxxxxxxx
OVRM1_0188_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0015_B07.b : agaxxxxxxxxxxxxxxxxxx
OVR01_0055_F04.b : tttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxx
KDN01_0042_G12.b :
KDN01_0041_E05.b :
UTR01_0004_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0025_D08.b :
PCT01_0019_H09.b :
CLNT1_0080_H05.b : nnaaacgtcagctgacgaggxxxxxxxxxxxxxx
BMWN1_0071_E11.b : ttttggatagtacgaggcagtattat
MLN01_0049_G11.b : nnnttgctaggactatnacxxxxxxxxxxxxxxxxxxxxx
TES01_0057_H02.b :
PST01_0020_F01.b :
PCT01_0034_E03.b :
MLN01_0021_D03.b : nnnnggtaggacatgacagtttgtacxxxxxxxx
KDN01_0020_A06.b :
SPL01_0071_F12.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxx
UTR01_0005_H10.b : ttgggagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_C02.b : ngcaggtaagacgccanxxxxxxxx
HTMT1_0117_D02.b : ngactagtacgaxxxxxxxxxxxxxxxx
HTMT1_0116_G03.b : nnnttgatgaggagaggxxxxxxxx
HTMT1_0129_G12.b : tttacgagagtacgangxxxxxxxxxx
HTMT1_0092_G12.b :
KDN01_0050_F01.b :
LVRM1_0024_H02.b :
BFLT1_0051_D08.b :
PBL01_0086_A05.b :
KDN01_0065_B09.b :
KDN01_0065_D04.b :
LVRM1_0198_A01.b :
PBL01_0021_E02.b :
ADR01_0068_F08.b :
HTMT1_0062_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0030_E08.b : ntttggtaattxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0001_D11.b :
CBLT1_0008_F03.b :
CBLT1_0013_H07.b :
HTMT1_0021_B01.b :
HTMT1_0021_B03.b :
AMP01_0015_G02.b :
SPLT1_0051_F05.b :
BKFL1_0005_B03.b :
SPLT1_0070_H03.b :
PCT01_0004_G09.b :
HTMT1_0027_G06.b :
ILNT1_0044_D04.b :
SPL01_0053_A04.b :
MLN01_0005_A04.b :
BMWN1_0083_D02.b :
HTMT1_0145_A01.b :
SKNB1_0028_G12.b :
AMP01_0033_H10.b :
BMWN1_0016_G11.b :
BKFL1_0032_F06.b :
BKFL1_0043_A02.b :
DCI01_0055_B06.b :
SPLT1_0084_B09.b :
HTMT1_0127_A07.b :
CBLT1_0060_A08.b :
ILNT1_0054_G02.b :
ILNT1_0041_D07.b :
HTMT1_0066_C09.b :
BKFL1_0016_D10.b :
CBLT1_0067_B08.b :
CBLT1_0068_E07.b :
CBLT1_0051_H08.b :
CBLT1_0052_C11.b :
ILNT1_0086_B09.b :
BMWN1_0058_E10.b :
HTMT1_0050_G08.b :
HTMT1_0079_H11.b :
HTMT1_0024_D01.b :
SPLT1_0055_H04.b :
SPLT1_0019_A04.b :
ILNT1_0090_H04.b :
ILNT1_0083_C02.b :
SPLT1_0089_F11.b :
20110601C-000819 : GCCGATATAAGAGCCGGGCCAGCGCTACCTGGGCCACAGTCTTCGC*GGAG*AGTCGCTG
---------+---------+---------+---------+---------+---------+ 61
LVRM1_0026_G06.b : GCCGATATAAGAGCCGGGCCAGCGCTACCTGCGCCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0076_E09.b : GCCGATATAAGAGCCGGGCCAGCGCTACCTGCGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0073_G06.b : GCCGATATAAGAGCCGGGCCAGCGCTACCTGCGCCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0041_C12.b : xxxxxxxxxxGAGCCGGGCCAGCGCTACCTGCGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0011_D11.b : nnnggataacaaggatttaatgATTGGCCAC*GTCTTCGC*GGAG*AGTCGCTG
CBLT1_0034_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0081_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxtatGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0079_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
LVRM1_0125_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0034_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0041_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCCTTTA*GGAG*AGTCGCTG
BMWN1_0080_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACCCTTCGA*GGAG*AGTCGCTG
BMWN1_0032_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0073_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCCTTTTCGC*GGAG*AGTCGCTG
HTMT1_0078_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGCCTTCGC*GGAG*AGTCGCTG
BMWN1_0017_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0072_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCGTTTTTAA*GGAG*AGTCGCTG
BMWN1_0073_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCCTCTTCGC*GGAG*AGTCGCTG
HTMT1_0079_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACCCTTCGC*GGAG*AGTCGCTG
HTMT1_0059_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0150_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCCTCTC*GGAG*AGTCGCTG
CBLT1_0034_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GCAT*AGTCGCTG
BMWN1_0030_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGCCTTTGC*GGAG*AGTCGCTG
UTR01_0040_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaCTGGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0116_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCCTCTTAAC*GGAG*AGTCGCTG
HTMT1_0151_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCCTCGC*GGAG*AGTCGCTG
SPLT1_0006_F03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*CGAT*AGTCGCTG
SPLT1_0026_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0094_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0146_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0029_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTCCCC*TTAG*AGTCGCTG
HTMT1_0035_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
HTMT1_0127_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGCCTTCTC*GGAG*AGTCGCTG
HTMT1_0116_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACGCTCTTCAA*GGAG*AGTCGCTG
ILNT1_0009_E03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0026_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCTC*GGAG*AGTCGCTG
HTMT1_0103_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0086_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0033_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0073_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0096_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTCTCT*GGAG*AGTCGCTG
ILNT1_0094_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCTC*GGAG*AGTCGCTG
CBLT1_0035_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGTG*AGTCGCTG
CBLT1_0057_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCCT*TGAG*AGTCGCTG
HTMT1_0017_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0026_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0018_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0071_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0030_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0055_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0098_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0079_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxttaGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0083_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0034_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0125_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCCTTAA*GGAG*AGTCGCTG
ILNT1_0085_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0018_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0086_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0065_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0041_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0061_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0091_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0087_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0061_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
CBLT1_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGCTTGAG*AGTCGCTG
BMWN1_0025_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCTC*GGAG*AGTCGCTG
HTMT1_0126_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCTC*GGAG*AGTCGCTG
HTMT1_0023_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0082_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
ILNT1_0092_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0046_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0132_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACCCTTTTA*GGAG*AGTCGCTG
ILNT1_0027_A11.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0023_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0031_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0090_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0088_G10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0089_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0017_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0061_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0014_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0147_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0033_C10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0057_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GTAG*AGTCGCTG
SPLT1_0058_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0056_B06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0027_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0024_C08.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCCTCTT*GGAG*AGTCGCTG
HTMT1_0091_H05.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0068_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0088_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0013_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GTGAGAGTCGCTG
CBLT1_0033_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0084_E03.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0100_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACCGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0054_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0015_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0002_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0045_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0047_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0070_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0097_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0054_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxagcGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0056_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACGTTCTTCGC*GGAG*AGTCGCTG
BMWN1_0052_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0039_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0002_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0133_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0019_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
CBLT1_0039_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*TGAG*AGTCGCTG
BMWN1_0061_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
CBLT1_0047_F04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*CGAG*AGTCGCTG
CBLT1_0093_E09.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0082_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxctaCTGGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0053_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0037_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0024_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0052_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0100_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACATTCTTCGC*GGAG*AGTCGCTG
HTMT1_0108_E05.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0048_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxcctactGGACACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0046_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0032_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0096_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0014_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0052_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxttGGCCACGGTCGTCGC*GGAG*AGTCGCTG
ITT01_0038_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtGGACACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0098_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0025_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0056_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0012_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*TGAG*AGTCGCTG
SPLT1_0020_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0038_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0055_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0060_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0056_A07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0026_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0038_B02.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCCC*TTAG*AGTCGCTG
MLN01_0085_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGACACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0049_B01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0086_H08.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0085_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0013_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0090_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0101_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0023_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0035_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACACTCTTCGC*GGAG*AGTCGCTG
UTR01_0064_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTGGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0100_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0021_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxtggaTGGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0008_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAT*AGTCGCTG
ILNT1_0069_C02.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0035_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0040_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0049_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0056_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0064_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0144_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0009_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0058_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAGTCTTCAC*GGAG*AGTCGCTG
OVRT1_0127_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0105_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0050_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACACAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0060_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0056_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCTC*GGAG*AGTCGCTG
HTMT1_0051_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0103_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0104_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0056_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0094_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxactGACACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0077_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0065_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCACAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0067_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGACACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0027_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGACACAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0098_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0063_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0080_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAGTCTTCTC*GGAG*AGTCGCTG
LVRM1_0029_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0015_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0023_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0023_A07.b : taaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0049_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0074_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0069_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0074_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0097_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacACACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0094_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0020_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0075_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0098_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGTACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0104_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0041_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0017_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0043_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAGTCTTCCC*TGAG*AGTCGCTG
HTMT1_0111_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0079_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0011_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGACAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0017_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacTGACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0148_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0096_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0079_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCTCGC*GGAG*AGTCGCTG
OVR01_0057_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0197_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0153_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0130_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0187_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0153_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0004_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0128_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0210_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0149_C02.b : atttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCCC*GTTG*AGTCGCTG
HTMT1_0120_C10.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCCCTT*AGAG*AGTCGCTG
PBL01_0029_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0108_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGACAGTCCCCTA*AGAG*AGTCGCTG
OVRM1_0027_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
PBL01_0034_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0005_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0113_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCCCTT*GAAG*AGTCGCTG
CBLT1_0074_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0123_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCTCGC*GGAG*AGTCGCTG
UTR01_0028_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0121_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTCCGT*GGAG*AGTCGCTG
UTR01_0024_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0007_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0044_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0045_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0042_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCCCTT*GGAG*AGTCGCTG
CBLT1_0066_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0008_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0088_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GCAG*AGTCGCTG
UTR01_0006_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxggccttgTACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0042_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0005_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxggccttgTACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0074_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0008_B11.b : nnnggatatctaaggatttatgaattGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0015_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0038_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0008_A11.b : nnnggatatctaaggatttaatgaattggcCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0150_G07.b : tttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCCC*TTAG*AGTCGCTG
CBLT1_0012_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0101_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0055_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0069_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCCC*GGTAGAGTCGCTG
HTMT1_0049_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0040_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0105_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTCCGC*GGAG*AGTCGCTG
SPLT1_0017_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0072_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0053_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0055_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0099_E04.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0060_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0081_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCTCTC*GGAG*AGTCGCTG
SPLT1_0081_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0014_D05.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0022_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0021_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0009_B04.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0001_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0049_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0008_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0041_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGT*GGAG*AGTCGCTG
HTMT1_0066_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0073_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0112_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCTC*GGAG*AGTCGCTG
ILNT1_0042_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0023_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAT*AGTCGCTG
HTMT1_0096_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0046_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcattTACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0040_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0106_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0091_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0132_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTCCCC*TAAG*AGTCGCTG
CBLT1_0081_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0041_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0039_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0006_A09.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GCAT*AGTCGCTG
CBLT1_0049_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*CCCA*TANTGCTG
UTR01_0034_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0023_H05.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0049_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0036_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0021_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0018_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAT*AGTCGCTG
HTMT1_0062_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0025_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0085_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0032_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0142_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0059_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0004_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0066_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0003_H09.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0008_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0122_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0108_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0060_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0074_B12.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0046_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0063_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0086_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0137_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0083_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GTAG*AGTCGCTG
ILNT1_0051_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0074_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0017_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0004_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0021_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0013_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtTACAGTCTTCCC*TTAG*AGTCGCTG
HTMT1_0016_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0032_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0039_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0052_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0061_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0139_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0007_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0023_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0039_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0053_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0064_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0072_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0014_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGTG*AGTCGCTG
ITT01_0095_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0048_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0047_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0034_D03.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0105_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0008_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0017_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0014_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0085_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0056_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0091_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0036_D04.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0038_A07.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0122_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0071_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0003_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0048_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0086_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0077_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTCCTC*GGAG*AGTCGCTG
ILNT1_0028_G06.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0010_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0095_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0039_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0044_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0040_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*CGAT*AGTCGCTG
UTR01_0079_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0076_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0048_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0032_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCCTCTC*GGAG*AGTCGCTG
UTR01_0035_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0111_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0037_C11.b : gntccggaxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0010_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0037_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0038_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0053_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACTCTTCGC*GGAG*AGTCGCTG
CBLT1_0077_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0101_A11.b : ttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*TGAG*AGTCGCTG
ILNT1_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0065_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0085_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0026_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0027_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0096_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0079_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0042_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
ILNT1_0056_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0090_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0047_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0075_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0074_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0132_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0183_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0049_F12.b : agatggtacagtggtgaacctatggttttctgaagACAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0141_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0100_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0008_C11.b : actgttcagtaagagtcactctaccaataaggaatACAGTCTTCGC*GGAG*AGTCGCTG
BMWN1_0042_C09.b : aaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
TES01_0104_C09.b : nnttttagcgtggctatggaACAGCCTTCGC*GGAG*A*TCGCTG
UTR01_0042_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0040_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0063_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0100_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0058_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0102_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0082_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0074_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0095_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0087_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0047_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0070_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0079_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0075_E11.b : gccgatataagagccgggccagcgctacctgcgccACAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0041_F10.b : xxxxxxxxxxxxcgagtcggcctttggcctactggACAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0058_B01.b : gccgatataagagccgggccagcgctacctgcgccACAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0016_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAA*AGTCGCTG
OVRT1_0040_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0009_H03.b : ccccngcatccaaaggatttaatgattgACGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0169_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0101_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0029_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0009_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0021_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0176_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0024_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0072_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0201_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0165_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0187_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0179_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0090_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0026_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0047_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0028_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0126_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0142_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0139_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0037_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0053_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0225_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0010_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0191_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0102_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0155_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0003_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0078_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0048_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0149_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0124_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0067_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0013_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0112_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0113_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0158_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0011_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0109_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0019_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0080_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0012_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0013_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PBL01_0001_A01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0050_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0071_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0070_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0024_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0094_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0026_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0014_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0069_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0051_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0045_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0111_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0009_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0026_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0010_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0099_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0009_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0016_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0044_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0075_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PBL01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0068_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0025_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0084_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0016_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0016_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPLT1_0025_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0044_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0072_F08.b : nnncctgacgtggcactggACGTCTTCGC*GGAG*A*TCGCTG
UTR01_0021_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0019_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PST01_0065_C04.b : tttggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0053_G11.b : ntcgcggtggctatggACGTCTTCGC*GGAG*AGTCGCTG
UTR01_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0078_E04.b : nnnncctagcgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0074_H11.b : ncctgcggtggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0074_B10.b : nnttgacgtggcacggACGTCTTCGC*GGAG*A*TCGCTG
UTR01_0039_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0036_B10.b : tttttactgcggtggcacggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0043_B04.b : nnnncctgcggtggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0097_F07.b : nnnncctgacgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
UTR01_0019_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0099_E08.b : nnnnngctgctgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
UTR01_0039_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0010_H03.b : ncccttttnnnnccctgcgttggcacggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0079_G06.b : nnnncctagcgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0099_E07.b : nnnncctgctgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
PST01_0053_B01.b : ntccactgtggctatggaACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0066_B09.b : ttttttgctacggtggctatggACGTCTTCGC*GGAG*A*TCGCTG
KDN01_0034_F11.b : nnnnnnncctgaggtggctatggACGTCTTCGC*GGAG*A*TCGCTG
PST01_0066_G12.b : ntttactgcggtggctatggACGTCTTCGC*GGAG*A*TCGCTG
CBLT1_0025_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0021_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0002_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0027_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0028_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0055_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0083_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0040_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0047_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0092_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0097_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0078_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0018_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0012_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0026_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0021_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0064_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0077_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0080_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0062_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0019_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0043_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
KDN01_0056_E06.b : nnnttcgctgtggctatggACGTCTTCGC*GGAG*A*TCGCTG
HTMT1_0091_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0062_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0073_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0049_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGCAGATTCGCTG
ITT01_0055_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0042_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0014_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GCAG*TGTCGCTG
ITT01_0021_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0102_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0061_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GCAG*TGTCGCTG
ITT01_0095_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PBL01_0042_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0093_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0033_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0091_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0073_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0042_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0096_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0138_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTCTTCGC*GGAG*AGTCGCTG
ITT01_0049_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0010_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0014_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0072_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PBL01_0072_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0055_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0033_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0092_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0031_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0030_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0076_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0024_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0101_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0031_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0005_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0070_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0074_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0032_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0101_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0025_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0036_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0075_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0086_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0060_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0136_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CBLT1_0086_C04.b : tattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0006_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0052_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0088_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0080_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0053_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0090_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0096_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0089_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0093_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0096_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0053_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0066_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0109_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0066_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0033_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0082_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0084_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0104_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0066_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0087_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0101_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0045_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0051_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0064_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0086_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0087_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0088_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0100_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0099_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0082_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
TCH01_0080_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0094_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0087_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0099_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PTG01_0021_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0065_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0098_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0010_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0066_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0147_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0042_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
CLNT1_0023_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ADR01_0050_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0049_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*AGAG*AGTCGCTG
MLN01_0028_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0042_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0043_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
PTG01_0018_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0092_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0019_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0060_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0014_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0101_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0115_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0150_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCAGTCTTCGC*GGAG*AGTCGCTG
SMG01_0024_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0090_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0066_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGCG*ATTCGCTG
MLN01_0025_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0103_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0007_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
ITT01_0065_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0094_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0047_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0082_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0034_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0096_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0011_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0102_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0020_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0044_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0087_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0101_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0044_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0047_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0095_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0079_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0050_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
SPL01_0071_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0020_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0046_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0039_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0097_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0048_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0002_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0036_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0082_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0073_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0057_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0100_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0023_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0047_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0096_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0100_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0103_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0151_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0007_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0062_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0009_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0099_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0061_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0039_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0064_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0089_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0139_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0080_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0015_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0056_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0047_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0088_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0100_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0088_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0093_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0032_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
MLN01_0069_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0053_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0074_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0107_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0061_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0103_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0052_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0053_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0052_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0090_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LNG01_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0049_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0012_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
OVR01_0001_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0034_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0148_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttaagAGTCTTCGC*GGAG*AGTCGCTG
TES01_0077_A11.b : cgacgttggctatggaAGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0080_H07.b : ctttttaaccxxxxxxxxxxxxxxxxxxxxxxxxxxgAGTCCCCCC*TAAG*AGTCGCTG
BMWN1_0035_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGTCTTCGC*GGAG*AGTCGCTG
SKNB1_0046_B09.b : nnnntttgacggtggctatggaAGTCTTCGC*GGAG*A*TCGCTG
KDN01_0040_A08.b : tttnntccagcggtggctatggaAGTCTTCGC*GGAG*A*TCGCTG
TES01_0002_H11.b : tttttcgctgtggctacggatAGTCTTCGC*GGAG*A*TCGCTG
BMWN1_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0099_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0030_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0130_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggttAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0117_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtgaAGTCTTCGC*GGAG*AGTCGCTG
BFLT1_0121_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtaAGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0141_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCTTCGC*GGAG*AGTCGCTG
UTR01_0074_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCTTCGC*GGAG*AGTCGCTG
LVR01_0038_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0093_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
MLN01_0075_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0093_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0099_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0179_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0052_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0049_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0106_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagCTCTTCGCGGAAG*AGTCGCTG
UTR01_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVRM1_0006_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
KDN01_0074_D12.b : nncctgcgtggctaggaccGTCTTCGC*GGAT*A*TCGCTG
HTMT1_0011_B09.b : nnnggataacaaggatttatgattggccacGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0004_F05.b : nggatatctaaggattaatgaattggccacGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0006_G01.b : nnccggtacccataggatttaatgaattacGTCTTCGC*GGAG*AGTCGCTG
UTR01_0036_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
HTMT1_0011_A08.b : nnnncataacaaggatttaatgattggccacGTCTTCGC*GGAG*AGTCGCTG
ITT01_0099_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
ITT01_0030_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0004_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0035_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
ADR01_0087_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
MLN01_0097_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
ITT01_0001_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
MLN01_0067_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0106_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
SPL01_0073_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRT1_0110_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0061_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
MLN01_0101_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVR01_0015_B05.b : tccgaaattcctccgtggcaccgtagggcctcccggctGTCTTCGC*GGTG*AGTCGCCG
UTR01_0038_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
TCH01_0087_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVR01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
LVR01_0062_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0095_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0054_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
UTR01_0072_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCGC*GGAG*AGTCGCTG
OVRM1_0187_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTCGC*GGAG*AGTCGCTG
KDN01_0004_B02.b : ncccgactnnnnnnnnncctgcgttgtgcacgtgacgnTCTTCGC*GGAG*AGTCGCTG
KDN01_0004_A08.b : naaaactattnnnnnnnncctgagttggccacgtgagnTCTTCGC*GGAG*AGTCGCTG
SPL01_0084_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaTCTTCGC*GGAG*AGTCGCTG
PTG01_0086_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCTTCGC*GGAGAAGTCGCTG
UTR01_0028_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCGC*GGAG*AGTCGCTG
PST01_0026_F07.b : nnnncctgcgttggcactggaTCTCGC*GGAG*A*TCGCTG
ITT01_0033_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCGC*GGAG*AGTCGCTG
ITT01_0065_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgCTTCGC*GGAG*AGTCGCTG
MLN01_0089_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTTCGC*GGAG*AGTCGCTG
MLN01_0062_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCGC*GGAG*AGTCGCTG
OVRM1_0188_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccccagtttTTCGC*GGAAAAGTCGCTG
OVRM1_0015_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGC*GGAG*AGTCGCTG
OVR01_0055_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGC*GGAG*AGTCGCTG
KDN01_0042_G12.b : nccttnnnnnnnccctacgtgtgcacggaacaGTCTC*GCGGAGATCGCTG
KDN01_0041_E05.b : tttttttnaacgcgttgtgcacggacaGTCTC*GCGGAGATCGCTG
UTR01_0004_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGC*GGAG*AGTCGCTG
PCT01_0025_D08.b : nngcctgatnnnnnnncctgaggtggcacgtgacgntCTCGC*GGAG*AGTCGCTG
PCT01_0019_H09.b : nnnttccttaatnnnnnnactgacgggtgcacgtgagntCTCGC*GGAG*AGTCGCTG
CLNT1_0080_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxctccaaacagagTTCGC*GGAG*AGTCGCTG
BMWN1_0071_E11.b : ttatagactcacatagggaatttaatgaattggccacacttTTCGC*GGAG*AGTCGCTG
MLN01_0049_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGC*GGAG*AGTCGCTG
TES01_0057_H02.b : nnnncctgacgtggctacggaagTCTC*GCGGAGATCGCTG
PST01_0020_F01.b : nccccactttnnncctacgttggcacggaacgTCTC*GCGGAGATCGCTG
PCT01_0034_E03.b : nnnngggcttatannnnnggaacggtggctcgtagTCTC*GCGGAGATCGCTG
MLN01_0021_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGC*GGAG*AGTCGCTG
KDN01_0020_A06.b : naagcaatttttnnnnncctgacggtgtgcacgtgaagtcttGC*GGAG*AGTCGCTG
SPL01_0071_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaGC*GGAG*AGTCCCTG
UTR01_0005_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtagccttcaaC*GGAC*AGTCGCTG
HTMT1_0118_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggccacagcctttaaaaGAG*AGTCGCTG
HTMT1_0117_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggccacagccccttaagaGAG*AGTCGCTG
HTMT1_0116_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacagtcctcttaaGAG*AGTCGCTG
HTMT1_0129_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgacagtctccgattAAG*AGTCGCTG
HTMT1_0092_G12.b : tacgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0050_F01.b :
LVRM1_0024_H02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0051_D08.b : nnnnccgtcagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0086_A05.b : nnnggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0065_B09.b :
KDN01_0065_D04.b :
LVRM1_0198_A01.b : xxxxxxxxxxx
PBL01_0021_E02.b :
ADR01_0068_F08.b :
HTMT1_0062_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngacgagtcctctcgagagactcgctgc
CBLT1_0030_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxggcacttctcttcactctcatagtcgcgttcag
HTMT1_0001_D11.b :
CBLT1_0008_F03.b :
CBLT1_0013_H07.b :
HTMT1_0021_B01.b :
HTMT1_0021_B03.b :
AMP01_0015_G02.b : nnnntttgaatcaxxxx
SPLT1_0051_F05.b :
BKFL1_0005_B03.b :
SPLT1_0070_H03.b :
PCT01_0004_G09.b :
HTMT1_0027_G06.b :
ILNT1_0044_D04.b :
SPL01_0053_A04.b :
MLN01_0005_A04.b :
BMWN1_0083_D02.b :
HTMT1_0145_A01.b :
SKNB1_0028_G12.b :
AMP01_0033_H10.b :
BMWN1_0016_G11.b :
BKFL1_0032_F06.b :
BKFL1_0043_A02.b :
DCI01_0055_B06.b :
SPLT1_0084_B09.b :
HTMT1_0127_A07.b :
CBLT1_0060_A08.b :
ILNT1_0054_G02.b :
ILNT1_0041_D07.b :
HTMT1_0066_C09.b :
BKFL1_0016_D10.b :
CBLT1_0067_B08.b :
CBLT1_0068_E07.b :
CBLT1_0051_H08.b :
CBLT1_0052_C11.b :
ILNT1_0086_B09.b :
BMWN1_0058_E10.b :
HTMT1_0050_G08.b :
HTMT1_0079_H11.b :
HTMT1_0024_D01.b :
SPLT1_0055_H04.b :
SPLT1_0019_A04.b :
ILNT1_0090_H04.b :
ILNT1_0083_C02.b :
SPLT1_0089_F11.b :
20110601C-000819 : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
---------+---------+---------+---------+---------+---------+ 116
LVRM1_0026_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGGACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0076_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0073_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0041_C12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0011_D11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0034_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0077_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0081_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0079_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0125_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0034_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0041_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0080_B09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0032_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0073_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0078_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0017_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0072_H06.b : CGG*TTTCCTGCTTCAACAG*TGCCTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0073_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0079_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0059_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0150_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0034_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0030_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0040_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0116_E03.b : CGG*TTTCCTGCTTCAACAG*TGCCTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0151_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0006_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0026_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0094_E07.b : CGG*TTTCCTGCTT*AACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0146_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0029_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0035_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0127_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0116_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0009_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0026_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0103_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0086_D08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0033_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0073_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0096_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0094_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0035_A07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0057_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0017_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0026_B10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0018_B10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0071_F10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0030_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0055_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0098_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0079_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0083_A03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0034_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0125_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CTGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0085_A03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0018_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0086_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0065_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0041_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0061_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0091_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0087_F06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0061_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0014_A04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0025_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0126_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0023_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0082_A09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0092_D07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0046_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0132_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0027_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0023_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0031_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0090_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0088_G10.b : CGG*TTTCCTGCTTCAACAG*CCCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0089_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0071_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0017_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0061_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0014_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0147_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0033_C10.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0057_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0058_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0056_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0027_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0024_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0091_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0068_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0088_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0013_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0033_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0084_E03.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0100_A06.b : CGG*TTTCCTGCTTCAACAG*CGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0054_D07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0015_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0074_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0002_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0045_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0047_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0070_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0097_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0054_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0056_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0052_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0039_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0002_F09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0058_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0133_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0019_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0039_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0061_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0047_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0093_E09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0082_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0053_B09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0037_B08.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0024_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0052_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0100_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0108_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0048_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0046_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0032_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0096_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0014_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0052_D08.b : CGG*TTTCCTGCTTCAGCAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0038_H07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0098_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0025_D12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0056_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0012_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0020_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0038_C12.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0055_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0060_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0056_A07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0026_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0038_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0085_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0049_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0086_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0085_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0013_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0090_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0101_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0023_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0035_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0064_A09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0100_G05.b : CGG*TTTCCTGCCTCTACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0021_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0008_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0069_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0035_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0040_F09.b : CGG*CTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0049_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0056_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0064_F02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0144_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0009_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0058_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0127_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0105_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0050_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SMG01_0060_H09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0056_B12.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0051_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0103_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0104_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0056_H07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0094_D08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0077_H02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0065_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*TTCGTCACCCGCCCCG
SMG01_0067_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0027_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0098_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0063_A04.b : CGG*TTTCCTGTTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0080_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0029_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0015_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0023_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0023_A07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0049_H09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0074_C06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0069_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0074_D11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0097_A03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0094_G08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0020_F10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0075_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0098_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0104_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0041_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0017_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0043_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0111_G04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0079_B03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0011_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0017_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0148_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0096_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0079_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0057_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0197_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0153_C05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0130_D12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0187_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0153_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0004_H09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0128_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0210_H09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0149_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0120_C10.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0029_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0108_H11.b : CAG*TTTCCTGCTTCAACAG*TGCTTGGA*CTGAACC*CCGCG*CTCGTCACCCGCCCCG
OVRM1_0027_A09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0034_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0005_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0113_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0074_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0123_F08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0028_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0121_G02.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0024_H02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0007_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0044_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0045_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0042_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0066_H11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0008_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0088_G05.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0006_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0042_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0005_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0074_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0008_B11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0015_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0038_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0008_A11.b : CGG*TTTCCTGCCTCTA*AG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0150_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0012_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0101_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0055_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0069_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGCAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0049_F06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0040_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0105_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0017_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0072_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0053_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0055_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0099_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0060_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0081_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0081_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0014_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0022_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0021_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0009_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0001_D12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0049_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0008_F06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0041_G04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0066_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0073_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0112_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0042_B06.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0023_F06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0030_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0096_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0046_F02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0040_D10.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0106_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0091_A09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0132_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0081_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0041_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0039_G09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0006_A09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0049_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0034_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGACG*CTCGTCACCCGCCCCG
BMWN1_0023_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0049_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0083_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0036_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0021_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0018_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0062_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0025_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0085_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0032_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGG*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0142_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0059_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0004_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0066_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0003_H09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0008_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0122_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0090_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0108_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0060_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0074_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0046_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0063_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0086_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0137_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0083_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0051_G02.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0074_C12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0017_D09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0004_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0021_F03.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0013_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0016_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0032_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0039_D12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0052_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0061_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0139_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0007_C05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0023_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0039_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGTGACGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0053_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0064_B03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0072_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0014_A07.b : CGG*TTTCCTGCTTCAATAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0095_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0048_H02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0047_D01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0034_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0105_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0008_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0017_C01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0014_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0085_A04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0056_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0091_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0046_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0036_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0095_C05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0038_A07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0122_C01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0071_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0003_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0048_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0086_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0077_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0028_G06.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0010_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0095_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0039_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0044_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0040_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0079_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0076_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0048_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0032_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0035_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0111_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SMG01_0037_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0010_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0037_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0038_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0053_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0077_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0101_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0050_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0065_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0085_G10.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0026_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0027_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0096_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0079_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0042_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ILNT1_0056_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0090_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0047_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0075_F10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0074_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0132_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0183_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0049_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0141_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0100_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0008_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0042_C09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
TES01_0104_C09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0042_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0040_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0063_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0100_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0058_D08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0102_F08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0082_F09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0074_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0095_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0087_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0047_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0070_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0079_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0075_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0041_F10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0058_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0016_D01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0040_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0009_H03.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0169_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0101_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0029_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0009_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0021_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0176_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0024_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0072_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0201_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0165_E01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0187_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0179_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0090_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0026_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0047_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0028_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0126_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0142_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0139_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0037_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0053_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0225_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0010_A03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0191_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0102_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0155_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0003_C06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0078_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0048_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0149_G08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0124_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0067_C05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0013_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0112_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0113_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0158_H04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0011_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0109_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0019_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0080_F10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0012_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0013_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0001_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0050_B06.b : CGG*TTTCCTGCTTCAACAG*TGTTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0071_D08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0070_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0024_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0094_D03.b : CGC*CTTCATGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0026_C03.b : CGGATTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0014_G09.b : CGG*CTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0069_D09.b : TGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0051_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0045_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0111_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0009_H07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0026_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0010_B03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0099_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0009_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCA
UTR01_0016_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0044_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0075_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0025_B09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0068_E12.b : CGG*TTTCCCGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0025_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0084_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0016_B10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0016_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPLT1_0025_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0044_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0072_F08.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0021_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0019_A09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PST01_0065_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0053_G11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0031_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0078_E04.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0074_H11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGG*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0074_B10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0039_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0036_B10.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0043_B04.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0097_F07.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0019_G04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0099_E08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0039_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0010_H03.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCTCCG
KDN01_0079_G06.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0099_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PST01_0053_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0066_B09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0034_F11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PST01_0066_G12.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0025_D07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0021_F08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0002_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0027_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0028_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0055_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0083_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0040_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0047_D12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0092_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0097_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0078_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0018_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0012_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0026_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0021_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0064_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0077_H02.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SMG01_0080_C11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0062_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0019_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0043_A04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0056_E06.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0091_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0062_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0073_H07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0049_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0055_D01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCGCCCGCCCCG
ITT01_0042_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0012_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0014_B09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0021_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0102_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0061_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0095_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0042_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0093_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGGG*CTCGTCACCCGCCCCG
ADR01_0033_A01.b : CGG*TT*CCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0091_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0073_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0042_D07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0096_F09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0138_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0049_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0010_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0014_H02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0072_F03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0072_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0055_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0033_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0092_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0031_F11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0030_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0076_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0024_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0089_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0101_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CAGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0031_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0005_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0070_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0074_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0032_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0101_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SMG01_0025_A01.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0036_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0075_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0086_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0060_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0136_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CBLT1_0086_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0006_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0052_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0088_A05.b : CGG*TTTCCTGCTTCAACGG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0080_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0053_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0090_G07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0096_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0089_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0093_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0096_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0053_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0066_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0109_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0066_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0033_A05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0082_C06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACT*CGGCG*CTCGTCACCCGCCCCG
UTR01_0084_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0104_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0066_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0087_C12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0101_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0045_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCTG
MLN01_0051_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0064_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0086_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0087_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0088_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0100_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0099_F01.b : CCC*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0082_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
TCH01_0080_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0094_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0087_B09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0099_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PTG01_0021_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0065_H09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0086_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0098_C04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0010_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0066_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0147_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0042_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0023_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0050_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0049_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0028_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0042_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0043_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PTG01_0018_F08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0092_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0019_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0060_E10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0014_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0101_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0115_A11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0150_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SMG01_0024_C12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0090_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0066_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0025_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0103_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0007_D04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0065_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0090_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0094_F05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0047_C06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0082_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0034_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0096_C10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCCCCCCG
MLN01_0011_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0102_C05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0020_G10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0044_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0087_H12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0101_D05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0044_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0047_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0095_A04.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0079_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0050_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0071_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0020_A10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0046_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0039_G08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0097_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0048_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0090_E07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0002_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0036_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0082_G04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0073_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0057_F09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0100_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0023_F09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0047_E04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0096_H02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0100_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0103_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0151_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0007_G01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0062_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0009_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0099_D11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0061_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0039_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGT*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0064_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0089_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0139_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0080_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0015_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0056_B03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0047_B12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0088_H03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0100_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0088_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0093_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0032_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0069_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0053_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0074_G02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0107_C08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0061_D01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0103_H05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0052_A04.b : CGG*TTTC*TGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0053_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0052_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0090_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LNG01_0034_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0049_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0012_E12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0001_G09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0034_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0148_D07.b : CGG*TTTCCTGCTCCTTCAG*AGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
TES01_0077_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0080_H07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CTGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0035_D07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SKNB1_0046_B09.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0040_A08.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGACCCTTAAA*CGGCG*CTCGTCACCCGCCCCG
TES01_0002_H11.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0077_F02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0099_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0030_D11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0130_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0117_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0121_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0141_A04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0074_C12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0038_A02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0093_G04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0075_A12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0093_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0099_G06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0179_B01.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0052_D06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0049_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0106_D07.b : CGNGTTTCCTGCTTCAACAGTGGCTTGGA*CGGAACCNCGGCG*CTCGTCACCCGCCCCG
UTR01_0092_E02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0006_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0074_D12.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0011_B09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0004_F05.b : CGG*TTTCCTGCTCCA*TTG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0006_G01.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0036_A11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0011_A08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0099_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0030_B08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0004_G03.b : CGA*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0035_B01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ADR01_0087_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0097_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0001_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0067_G05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0106_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0073_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRT1_0110_E09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0061_A01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0101_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0015_B05.b : CGG*TTTCCCGCTTCAACAG*TGCTAGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0038_E06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
TCH01_0087_C07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0044_H01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
LVR01_0062_C03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0095_H06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0054_B06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0072_H11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0187_B04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0004_B02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0004_A08.b : CGG*TTTCCTGGCTTCACAGNTGCTTGGA*CGGAACC*CGGCGNCTCGTCACCCGCTCCG
SPL01_0084_C09.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PTG01_0086_E01.b : CGG*TTTCCTGGCTTCACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0028_B05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PST01_0026_F07.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0033_H10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
ITT01_0065_H08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0089_D10.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0062_F07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0188_H07.b : CGGTTTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVRM1_0015_B07.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
OVR01_0055_F04.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGTG*CTCGTCACCCGCCCCG
KDN01_0042_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0041_E05.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0004_B11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PCT01_0025_D08.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PCT01_0019_H09.b : CGG*TTTCCTGCTTCAACAG*TGCCTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
CLNT1_0080_H05.b : CGG*TTTCCTGCTTCC*CTT*TGAATGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BMWN1_0071_E11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0049_G11.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
TES01_0057_H02.b : CGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PST01_0020_F01.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PCT01_0034_E03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
MLN01_0021_D03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0020_A06.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
SPL01_0071_F12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
UTR01_0005_H10.b : CGA*ATGCCTGCTTCAACGC*TGCTTGGA*CGGAACC*CGGCA*CTCGACACCCGCCCCG
HTMT1_0118_C02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGCA*TGGAAGC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0117_D02.b : CGG*TTTCCTGCTTCAACAG*TGCTTGCC*CTGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0116_G03.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0129_G12.b : CGG*TTTCCTGCTTCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
HTMT1_0092_G12.b : gGG*TTTCCTGCTTCA*CAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0050_F01.b : tTGCTTCAACAG*TGCTTCCT*TTGAACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0024_H02.b : xxxxxxxxxxxxtgCAACAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
BFLT1_0051_D08.b : xxxxxxxxxxxxxxxxxCAG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
PBL01_0086_A05.b : xxxxxxxxxxxxxxxxxxxG*TGCTTGGA*CGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0065_B09.b : ttttttcctgcggtggctatggaggcttggaGGAACC*CGGCG*CTCGTCACCCGCCCCG
KDN01_0065_D04.b : nnnncctgctgtggctatggaggcttggacgACC*CGGCG*CTCGTCACCCGCCCCG
LVRM1_0198_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgggaaaaaaaACCCGCCCCG
PBL01_0021_E02.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0068_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
HTMT1_0062_C11.b : ggtgttgctgctgtcgctctcgcttggtatggaacccggttgctgctcgcgcgccccggg
CBLT1_0030_E08.b : gttcctgcgtttcccactgcttgtgactgcatcgttgctgctcgtcacccgcccgttgcc
HTMT1_0001_D11.b :
CBLT1_0008_F03.b :
CBLT1_0013_H07.b :
HTMT1_0021_B01.b :
HTMT1_0021_B03.b :
AMP01_0015_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0051_F05.b :
BKFL1_0005_B03.b : nntcctaatannnnnnggatatctatgggctxxxxxxxxxxxxxxxxxx
SPLT1_0070_H03.b :
PCT01_0004_G09.b :
HTMT1_0027_G06.b :
ILNT1_0044_D04.b :
SPL01_0053_A04.b :
MLN01_0005_A04.b :
BMWN1_0083_D02.b :
HTMT1_0145_A01.b :
SKNB1_0028_G12.b :
AMP01_0033_H10.b :
BMWN1_0016_G11.b :
BKFL1_0032_F06.b :
BKFL1_0043_A02.b :
DCI01_0055_B06.b :
SPLT1_0084_B09.b :
HTMT1_0127_A07.b :
CBLT1_0060_A08.b :
ILNT1_0054_G02.b :
ILNT1_0041_D07.b :
HTMT1_0066_C09.b :
BKFL1_0016_D10.b :
CBLT1_0067_B08.b :
CBLT1_0068_E07.b :
CBLT1_0051_H08.b :
CBLT1_0052_C11.b :
ILNT1_0086_B09.b :
BMWN1_0058_E10.b :
HTMT1_0050_G08.b :
HTMT1_0079_H11.b :
HTMT1_0024_D01.b :
SPLT1_0055_H04.b :
SPLT1_0019_A04.b :
ILNT1_0090_H04.b :
ILNT1_0083_C02.b :
SPLT1_0089_F11.b :
20110601C-000819 : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
---------+---------+---------+---------+---------+---------+ 176
LVRM1_0026_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0076_E09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0073_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0041_C12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0011_D11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0034_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0077_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0081_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0079_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0125_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0034_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0041_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0080_B09.b : GCCGGCCGCTCAAAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0032_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0073_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0078_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0017_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0072_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0073_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0079_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0059_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0150_H04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0034_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0030_H04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0040_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0116_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0151_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0006_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0026_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0094_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0146_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0029_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0035_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0127_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0116_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0009_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0026_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0103_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0086_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0033_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0073_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0096_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0094_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0035_A07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0057_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0017_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0026_B10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0018_B10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0071_F10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0030_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0055_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0098_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0079_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0083_A03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0034_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0125_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0085_A03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0018_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0086_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0065_B07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0041_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0061_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0091_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0087_F06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0061_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0014_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0025_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0126_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0023_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0082_A09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0092_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0046_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0132_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0027_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0023_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0031_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0090_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0088_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0089_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0071_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0017_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0061_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0014_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0147_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0033_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0057_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0058_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0056_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0027_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0024_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0091_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0068_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0088_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0013_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0033_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0084_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0100_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0054_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0015_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0074_H04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0002_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0045_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0047_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0070_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0097_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0054_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0056_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0052_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0039_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0002_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0058_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0133_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0019_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0039_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0061_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0047_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0093_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0082_H11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0053_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0037_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0024_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0052_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0100_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0108_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0048_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0046_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0032_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0096_G01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0014_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0052_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGAGCCCTCGGACCGCCCCAAGG
ITT01_0038_H07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0098_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0025_D12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0056_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0012_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0020_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0038_C12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0055_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0060_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0056_A07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0026_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0038_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0085_B04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0049_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0086_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0085_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0013_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0090_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0101_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0023_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0035_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0064_A09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0100_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0021_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0008_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0069_C02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0035_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0040_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0049_H05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0056_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0064_F02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0144_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0009_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0058_G01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0127_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0105_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0050_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SMG01_0060_H09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCGAGG
ILNT1_0056_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0051_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0103_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0104_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0056_H07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0094_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0077_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0065_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCTCCAAGG
SMG01_0067_H01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0027_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0098_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0063_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0080_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0029_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACTGCCCCAAGG
SPL01_0015_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0023_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0023_A07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0049_H09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0074_C06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0069_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0074_D11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0097_A03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0094_G08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0020_F10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0075_G03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0098_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0104_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0041_C08.b : GCCGGCCGCTCAGGGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0017_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0043_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0111_G04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0079_B03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0011_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0017_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0148_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0096_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0079_B07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0057_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0197_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0153_C05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0130_D12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCTAAGG
OVRM1_0187_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0153_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0004_H09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0128_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0210_H09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0149_C02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0120_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0029_A06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0108_H11.b : GCCGGCCGCTCATAGCCAGCCCTCGCCACCTCTTCTCAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0027_A09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0034_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0005_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0113_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0074_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0123_F08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACTTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0028_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0121_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0024_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0007_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0044_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0045_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0042_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0066_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0008_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0088_G05.b : GCCGGCCGCTCATAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0006_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0042_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0005_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0074_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0008_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0015_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0038_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0008_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0150_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0012_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0101_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0055_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0069_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0049_F06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0040_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0105_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0017_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0072_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0053_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0055_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0099_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0060_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0081_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0081_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0014_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0022_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0021_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0009_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0001_D12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0049_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0008_F06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0041_G04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0066_C11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0073_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0112_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0042_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0023_F06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0030_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0096_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0046_F02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0040_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0106_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0091_A09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0132_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0081_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0041_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0039_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0006_A09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0049_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0034_E04.b : GCCGGCCGCTCACAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0023_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0049_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0083_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0036_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0021_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0018_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0062_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0025_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0085_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0032_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0142_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0059_H01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0004_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0066_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0003_H09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0008_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0122_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0090_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0108_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0060_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0074_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0046_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0063_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0086_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0137_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0083_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0051_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0074_C12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0017_D09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0004_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0021_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0013_A11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0016_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0032_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0039_D12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0052_E06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0061_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0139_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0007_C05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0023_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0039_H04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0053_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0064_B03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0072_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0014_A07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0095_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0048_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0047_D01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0034_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0105_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0008_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0017_C01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0014_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0085_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0056_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0091_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0046_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0036_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0095_C05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0038_A07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0122_C01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0071_H01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0003_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0048_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0086_G01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0077_C04.b : GCCGGCCGCTCACAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0028_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0010_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0095_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0039_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0044_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0040_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0079_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0076_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0048_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0032_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0035_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0111_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SMG01_0037_C11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0010_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0037_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0038_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0053_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0077_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0101_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0050_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0065_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0085_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0026_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0027_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0096_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0079_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0042_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ILNT1_0056_H01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0090_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0047_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0075_F10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0074_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0132_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0183_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0049_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0141_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0100_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0008_C11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0042_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TES01_0104_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0042_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0040_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0063_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0100_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0058_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0102_F08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0082_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0074_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0095_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0087_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0047_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0070_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0079_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGGCCGCCCCAAGG
CBLT1_0075_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0041_F10.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0058_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0016_D01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0040_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0009_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0169_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGGCCGCCCCAAGG
OVRT1_0101_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0029_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0009_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0021_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0176_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0024_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0072_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0201_H04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0165_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0187_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0179_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0090_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0026_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0047_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0028_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0126_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0142_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0139_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0037_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0053_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0225_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0010_A03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0191_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0102_C11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0155_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0003_C06.b : GTCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0078_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0048_F12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0149_G08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0124_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0067_C05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0013_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0112_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0113_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0158_H04.b : GCCGGCCGCTCATAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0011_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0109_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0019_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0080_F10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0012_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0013_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0001_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0050_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0071_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0070_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0024_G06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAGGG
OVR01_0094_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0026_C03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0014_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0069_D09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0051_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0045_G01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0111_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0009_H07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0026_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0010_B03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0099_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0009_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0016_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0044_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0075_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0025_B09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0068_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0025_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0084_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0016_B10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0016_H01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPLT1_0025_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0044_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0072_F08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0021_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0019_A09.b : GCCGGCCGCTCAGGGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PST01_0065_C04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0053_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0031_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0078_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0074_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0074_B10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0039_F03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0036_B10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0043_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0097_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0019_G04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0099_E08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0039_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0010_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0079_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0099_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PST01_0053_B01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0066_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0034_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PST01_0066_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0025_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0021_F08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0002_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0027_A12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0028_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0055_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0083_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0040_C11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0047_D12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0092_C02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0097_G09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0078_D10.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0018_F03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0012_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0026_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0021_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0064_E10.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0077_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SMG01_0080_C11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACGGCGCCCTCGGACCGCCCCAAGG
ITT01_0062_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0019_F04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0043_A04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0056_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0091_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0062_C09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0073_H07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0049_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0055_D01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0042_F11.b : GCTGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0012_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0014_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0021_A05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0102_G07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0061_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0095_F07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0042_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0093_D02.b : GGCGGGCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0033_A01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0091_C02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0073_G03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0042_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0096_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0138_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0049_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0010_D03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0014_H02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0072_F03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0072_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0055_H03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0033_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0092_C02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0031_F11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0030_C04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0076_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0024_D05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0089_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0101_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0031_B12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0005_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0070_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0074_D02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0032_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0101_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGTCCTCGGACCGCCCCAAGG
SMG01_0025_A01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0036_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0075_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0086_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0060_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0136_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CBLT1_0086_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0006_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCCTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0052_B11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0088_A05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0080_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0053_E06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0090_G07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCTCTCGGACCGCCCCAAGG
UTR01_0096_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0089_H08.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0093_E06.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0096_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0053_A10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0066_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0109_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0066_D02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0033_A05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0082_C06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0084_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0104_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0066_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0087_C12.b : GCTGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0101_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0045_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0051_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0064_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0086_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0087_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0088_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0100_H01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0099_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0082_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TCH01_0080_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0094_D03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0087_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0099_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PTG01_0021_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0065_H09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0086_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0098_C04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0010_B05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0066_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0147_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCACCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0042_A02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0023_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0050_A01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0049_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0028_B07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0042_G01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0043_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PTG01_0018_F08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0092_G01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0019_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0060_E10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0014_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0101_E09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0115_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0150_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGA
SMG01_0024_C12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0090_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0066_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0025_E04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0103_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCGCAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0007_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0065_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0090_E04.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0094_F05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0047_C06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0082_C09.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0034_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0096_C10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0011_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0102_C05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0020_G10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0044_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0087_H12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0101_D05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0044_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0047_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0095_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0079_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0050_B02.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0071_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0020_A10.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0046_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0039_G08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0097_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0048_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0090_E07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0002_C07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCACCCTCGGACCGCCCCAAGG
MLN01_0036_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0082_G04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0073_G01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0057_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0100_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0023_F09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACGGCGCCCCCGGACCGCCCCAAGG
UTR01_0047_E04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0096_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0100_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0103_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0151_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0007_G01.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0062_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0009_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0099_D11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0061_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0039_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0064_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0089_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0139_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0080_G11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0015_H03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0056_B03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0047_B12.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0088_H03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0100_B07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0088_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0093_B07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0032_F12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0069_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0053_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0074_G02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0107_C08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0061_D01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0103_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0052_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0053_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0052_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0090_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LNG01_0034_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0049_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0012_E12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0001_G09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0034_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0148_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TES01_0077_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0080_H07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0035_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SKNB1_0046_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTCCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0040_A08.b : GCCGGCCGCTCAGCTTCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TES01_0002_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0077_F02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0099_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0030_D11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0130_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0117_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0121_H11.b : GCCTGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0141_A04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0074_C12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0038_A02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0093_G04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0075_A12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0093_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0099_G06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0179_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0052_D06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0049_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0106_D07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0092_E02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0006_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0074_D12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGACCCAAGG
HTMT1_0011_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0004_F05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0006_G01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0036_A11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0011_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0099_C03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0030_B08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0004_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0035_B01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0087_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0097_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0001_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0067_G05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0106_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0073_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRT1_0110_E09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0061_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0101_E11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0015_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0038_E06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TCH01_0087_C07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0044_H01.b : GCCGGCTGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVR01_0062_C03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0095_H06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0054_B06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0072_H11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0187_B04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0004_B02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0004_A08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0084_C09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PTG01_0086_E01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0028_B05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PST01_0026_F07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0033_H10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ITT01_0065_H08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0089_D10.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0062_F07.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0188_H07.b : GCCGGCCGCTCAAAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVRM1_0015_B07.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
OVR01_0055_F04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0042_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0041_E05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0004_B11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PCT01_0025_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PCT01_0019_H09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
CLNT1_0080_H05.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BMWN1_0071_E11.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0049_G11.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
TES01_0057_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PST01_0020_F01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PCT01_0034_E03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
MLN01_0021_D03.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0020_A06.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
SPL01_0071_F12.b : GCCGGACGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
UTR01_0005_H10.b : GGCGGACGCTCAGATCCAGCCCTCGCCACCTCTTCACAGAGCCCTCGGACCGCCCCAAGG
HTMT1_0118_C02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0117_D02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0116_G03.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0129_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0092_G12.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0050_F01.b : GCCGGCCGCTCATAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0024_H02.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
BFLT1_0051_D08.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0086_A05.b : GCCGGCCGCTCAGAGCCAGCCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0065_B09.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
KDN01_0065_D04.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
LVRM1_0198_A01.b : GCCGGCCGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
PBL01_0021_E02.b : xxxxxxxGCTCAGAGCCAGCCCTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
ADR01_0068_F08.b : xxxxxxxxxxxxxxxxxxxxCTTCGCCACCTCTTCACAGCGCCCTCGGACCGCCCCAAGG
HTMT1_0062_C11.b : cgcgcccctctgagccagcccttccccacctcttgcctgtgtCCTCGGACCGCCCCAAGG
CBLT1_0030_E08.b : tgcctcgtccagccaattcctccctacctgctctgtgtggcccaTCGGACCGCCCCAAGg
HTMT1_0001_D11.b : nnnnnggatacctataggatttatgaattGCCCCAAGG
CBLT1_0008_F03.b : ttttttagaggxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0013_H07.b : ttttaggcaggtagacgxxxxxxxxxxxx
HTMT1_0021_B01.b : tttttggcaggtagaggccxxxxxxxx
HTMT1_0021_B03.b : ttttggcaagtagacgccgtaxxxxx
AMP01_0015_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0051_F05.b :
BKFL1_0005_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0070_H03.b :
PCT01_0004_G09.b :
HTMT1_0027_G06.b :
ILNT1_0044_D04.b :
SPL01_0053_A04.b :
MLN01_0005_A04.b :
BMWN1_0083_D02.b :
HTMT1_0145_A01.b :
SKNB1_0028_G12.b :
AMP01_0033_H10.b :
BMWN1_0016_G11.b :
BKFL1_0032_F06.b :
BKFL1_0043_A02.b :
DCI01_0055_B06.b :
SPLT1_0084_B09.b :
HTMT1_0127_A07.b :
CBLT1_0060_A08.b :
ILNT1_0054_G02.b :
ILNT1_0041_D07.b :
HTMT1_0066_C09.b :
BKFL1_0016_D10.b :
CBLT1_0067_B08.b :
CBLT1_0068_E07.b :
CBLT1_0051_H08.b :
CBLT1_0052_C11.b :
ILNT1_0086_B09.b :
BMWN1_0058_E10.b :
HTMT1_0050_G08.b :
HTMT1_0079_H11.b :
HTMT1_0024_D01.b :
SPLT1_0055_H04.b :
SPLT1_0019_A04.b :
ILNT1_0090_H04.b :
ILNT1_0083_C02.b :
SPLT1_0089_F11.b :
20110601C-000819 : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
---------+---------+---------+---------+---------+---------+ 233
LVRM1_0026_G06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0076_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0073_G06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0041_C12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0011_D11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0034_H06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0077_E11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0081_F01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0079_B04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCGGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0125_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0034_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0041_H03.b : CCACCGCCACCGCTCCCGCGCCGCG*GGGGGGGGCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0080_B09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AACCTCCCG*CCAT
BMWN1_0032_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0073_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0078_D10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0017_A08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0072_H06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0073_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0079_E08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0059_E11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0150_H04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0034_D06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0030_H04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0040_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0116_E03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0151_F12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0006_F03.b : CCACCGCTACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0026_E01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0094_E07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0146_B04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0029_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0035_G07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0127_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0116_B05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0009_E03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0026_B08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0103_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0086_D08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0033_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0073_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0096_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0094_F04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0035_A07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0057_H12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0017_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0026_B10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0018_B10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0071_F10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0030_E07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0055_A02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0098_E02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0079_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0083_A03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0034_C03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0125_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0085_A03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0018_F03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0086_F03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0065_B07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0041_B05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0061_A05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0091_A02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0087_F06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0061_F12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0014_A04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0025_G06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0126_D03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0023_G12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0082_A09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0092_D07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0046_D06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0132_H12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0027_A11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0023_E02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0031_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0090_C03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0088_G10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0089_E07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0071_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0017_E11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0061_F07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0014_G03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0147_A12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0033_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0057_A02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0058_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0056_B06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0027_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0024_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0091_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0068_G10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0088_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0013_C07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0033_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0084_E03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0100_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0054_D07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0015_A10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0074_H04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0002_G11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0045_E12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0047_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0070_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0097_E05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0054_B08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0056_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0052_A12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0039_D02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0002_F09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0058_E02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0133_E08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0019_F04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0039_H06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0061_G11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0047_F04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0093_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0082_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0053_B09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0037_B08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0024_H03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0052_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0100_E10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0108_E05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0048_E12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
SPLT1_0046_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0032_E03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0096_G01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0014_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0052_D08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0038_H07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
HTMT1_0098_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0025_D12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0056_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0012_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0020_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0038_C12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0055_E01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0060_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0056_A07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0026_C03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0038_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0085_B04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0049_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0086_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0085_D04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0013_D04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0090_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0101_G05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0023_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0035_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0064_A09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0100_G05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPL01_0021_F11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0008_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0069_C02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0035_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0040_F09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0049_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0056_E08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0064_F02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0144_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0009_E08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0058_G01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*GACCTCCCG*CCAT
OVRT1_0127_E12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0105_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0050_E08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SMG01_0060_H09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0056_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCGCCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0051_C07.b : CCACCGCCACCGCTCCCGCGTCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LNG01_0103_E02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0104_A01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0056_H07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRT1_0094_D08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0077_H02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0065_C04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
SMG01_0067_H01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0027_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPL01_0098_C07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0063_A04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0080_E11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0029_G07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPL01_0015_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0023_A12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0023_A07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0049_H09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ADR01_0074_C06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0069_C03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0074_D11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0097_A03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0094_G08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0020_F10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ITT01_0075_G03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRT1_0098_G12.b : CCATCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0104_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ADR01_0041_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
SPLT1_0017_A05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0043_F11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGGGGGCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0111_G04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0079_B03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LNG01_0011_C09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LNG01_0017_G12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0148_G03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0096_G11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0079_B07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTCAGCCATCCCG*CCAT
OVR01_0057_F11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0197_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAC
LVRM1_0153_C05.b : CCACCGCCACCGCTCCCGCACCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0130_D12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRM1_0187_B06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
LVRM1_0153_G03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCGT
LVRM1_0004_H09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRM1_0128_A08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRM1_0210_H09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0149_C02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0120_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
PBL01_0029_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0108_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRM1_0027_A09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
PBL01_0034_G12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0005_D02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0113_E02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0074_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0123_F08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AACCTCCCG*CCAT
UTR01_0028_C10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0121_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0024_H02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0007_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0044_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0045_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0042_A10.b : CCACCGCCACCGCTCCCGCGCCGCT*GGGGGGGCCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0066_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0008_A05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0088_G05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0006_A08.b : GCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCGT
UTR01_0042_G03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCCCCCG*CCAT
UTR01_0005_A08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCGT
CBLT1_0074_D10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0008_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0015_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0038_B11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0008_A11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0150_G07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0012_E01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0101_D06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0055_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0069_A05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0049_F06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0040_G10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0105_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0017_D10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0072_G09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0053_E12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0055_E10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0099_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0060_E07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0081_F11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0081_E09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0014_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0022_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0021_F11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0009_B04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0001_D12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0049_E10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ITT01_0008_F06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
HTMT1_0041_G04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0066_C11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0073_G07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0112_E11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0042_B06.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0023_F06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0030_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0096_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0046_F02.b : CCACCGCCACCGCTCGGGGGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0040_D10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0106_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0091_A09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0132_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0081_D06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0041_G12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0039_G09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0006_A09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0049_A05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0034_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0023_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0049_A10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0083_A01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0036_B01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0021_E03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0018_H11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0062_B05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0025_F07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0085_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0032_G10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0142_C04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0059_H01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
CLNT1_0004_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0066_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0003_H09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0008_H08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0122_F03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0090_E04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0108_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0060_E06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0074_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0046_E10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0063_A06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0086_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0137_C08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0083_G09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0051_G02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0074_C12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0017_D09.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0004_E01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0021_F03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0013_A11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0016_B12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ADR01_0032_G05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ITT01_0039_D12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0052_E06.b : CCACCGTCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0061_C03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0139_H03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
CBLT1_0007_C05.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0023_H06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0039_H04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0053_H10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPL01_0064_B03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0072_G06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ITT01_0014_A07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0095_C07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
HTMT1_0048_H02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0047_D01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0034_D03.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0105_B02.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0008_A01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
CBLT1_0017_C01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0014_A11.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0085_A04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0056_H05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0091_G09.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0046_G12.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0036_D04.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0095_C05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0038_A07.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0122_C01.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ITT01_0071_H01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
ITT01_0003_E07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
HTMT1_0048_A10.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0086_G01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0077_C04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
ILNT1_0028_G06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
BMWN1_0010_H12.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVR01_0095_H03.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
OVRT1_0039_F04.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
MLN01_0044_E01.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
CBLT1_0040_B08.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0079_E10.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SPLT1_0076_B06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0048_D05.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0032_B06.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
UTR01_0035_F07.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
HTMT1_0111_B08.b : CCACCGCCACCGCTCCCGCGCCGCT*GACGCCACCACCGCTCCTC*AGCCTCCCG*CCAT
SMG01_0037_C11.b : CCACCGCCACCGCTCCCGCGCCGCT*GCCGCCACCACCGCTCCTC*AGCCTCCCA*CCAT
O