[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000820

Length: 1,503

Sequence [FASTA format sequence]
AAAGCAGCTG GTACGGCCCG CAATCCTCAA ACATGTTGGC CTACTGGAGC ATTGCGGGCA
GGCGGCGGCT CTGGGTCCAC TCAGCGCATC CCGCTCTGCG AGGCAGGCAT GAAGGCAGAG
GGCATGTCCC CCTTCCTGGC TCTGGGGCTC CTGGTGGCTG GGCTCTGCTC CAGCGTCCAC
TGCGTCCCCG AAAGCAAACC TGACCCAGAG AATGGGACCC CGAAGGACCA GCACAGCAGG
ACTCCCGTGG ACCCCCACGC CATTGTCCCC AGCAACACCG ACTTCGCCTT CAGCCTCTAC
AAGCAGCTGG TTTCTTTAGA CCCCAGTAAG AACGTCATCT TCTCCCCGCT GAGCGTCTCC
ATAGCCTTGG CCTTCCTGTC TCTGGGGGCC CGAGGCCCCA CCCTGACAGA GCTCCTGGAA
GGCCTCAAGT TCAACCTCAC AAAGACCCCC GAGGCAGAAA TCCACCAGGG CTTCCAGCAC
CTCCTGCAGG CCCTCAGCCA ACCCAGCAAC CTGCTGCAGC TGAACGTGGG CAACGCCATG
TTCGTGGATG AGCATCTGAA GCTGCTGGAC GAGTTCAGGC GAGACGCCCA GGCAAAGTTC
GCCTCCGATG TCTTTTCCAC CAACTTCAAG GATCCCGGGG CTGCCGTCGT GTTCATCAAC
GACTACGTGA AGAACAAAAC GAAGGGGAAA ATCCCGAAGC TGTTCGATGA ACATGCCACC
TTCTCCGTGA TGGTCCTGGT GAATTACATC TACTTTAACG CCAAGTGGAA GACGCCCTTT
GATCCAGAAC ATACTATAGA GTCCACGTTC CAAGTGAGCA AGAACAGGAC AGTGAAGGTG
CCCATGATGA GCCTTCGAGG CCTGGAAACA CCTTACTTCC GGGACGAGGA GCTGGCCTGC
ACGGTGGTGG AGCTCCCGTA CACCAGCAAC GACAGCGCGC TCTTCATCCT CCCTGACGAT
GGCAGGATGG CGGCCGTGGA AGCCAAGCTG CTCCCGGAGA CGCTGAGGAG GTGGAGAGAC
TCCCTGCAGC CCAGACGGAT AGATGCCCTC TACCTGCCAC GGTTTTCTGT CTCCGGCGAC
TATCAACTGA AGGACACCCT TAAGCAGCTG GGCATTCAGA AAGTGTTCAC CCACGAGGCT
GACCTGTCAG GAGTCACAGG GGACAACAAA CTGGGGGTTT CCAAGGTGAT CCACAAGGCG
GTGCTTGATG TGGGCGAGGA GGGCACAGAA GCAGCTGCTG CCACTGGAAT TGCAATGATG
ACCTCGACCC TCTACAGCCT CACTGTTAGT TTTTCCAGTC CCTTTCTGTT CGCCGTAATC
GACAAAGACA CTGGCACTGT CCTCTTTTTG GGCAAAGTCG CTGACCCCAG CCCTGCCTAG
AGCTCCCTTG CTCGTGGCTG GTTCCTCTCN ACCAGGAGCT GAGTGCCCTG GTCCCTGGGG
GCAGGCTGGG CCCTGTGCCC CAAGAAAACC CCATCCTGGC ACTGCCTGCT CACCCTTGGG
AAG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSERPINA3alpha-1-antichymotrypsin precursor [Homo sapiens]. 442e-124O
Contig/Assembly ProteinSERPINA7thyroxine-binding globulin precursor [Homo sapiens]. 3002e-81O
Contig/Assembly ProteinSERPINA9serpin A9 isoform A [Homo sapiens]. 2989e-81O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Homo sapiens]. 2934e-79O
Contig/Assembly ProteinSERPINA6corticosteroid-binding globulin precursor [Homo sapiens]. 2933e-79O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSerpina3nserine protease inhibitor A3N precursor [Mus musculus]. 419e-117O
Contig/Assembly ProteinSerpina3mserine protease inhibitor A3M precursor [Mus musculus]. 413e-115O
Contig/Assembly ProteinSerpina3cserine protease inhibitor A3C precursor [Mus musculus]. 409e-114O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 400e-111O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 400e-111O
Contig/Assembly ProteinSerpina3fserine protease inhibitor A3F [Mus musculus]. 400e-111O
Contig/Assembly ProteinSerpina3iserine (or cysteine) peptidase inhibitor, clade A, member 3I [Mus musculus]. 391e-109O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 2 [Mus musculus]. 388e-108O
Contig/Assembly ProteinSerpina3iPREDICTED: serine protease inhibitor A3F isoform 1 [Mus musculus]. 388e-108O
Contig/Assembly ProteinSerpina3kserine protease inhibitor A3K precursor [Mus musculus]. 387e-107O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480425PREDICTED: similar to Alpha-1-antichymotrypsin precursor (ACT) [Canis familiaris]. 486e-137O
Contig/Assembly ProteinLOC612381PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11 [Canis familiaris]. 2989e-81O
Contig/Assembly ProteinLOC490840PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4 [Canis familiaris]. 2942e-79O
Contig/Assembly ProteinSERPINA1serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 [Canis lupus familiaris]. 2932e-79O
Contig/Assembly ProteinLOC480423PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 9 [Canis familiaris]. 2881e-77O
Contig/Assembly ProteinLOC490838PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 2865e-77O
Contig/Assembly ProteinLOC481007PREDICTED: similar to Thyroxine-binding globulin precursor (T4-binding globulin) [Canis familiaris]. 2802e-75O
Contig/Assembly ProteinLOC612386PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 [Canis familiaris]. 2765e-74O
Contig/Assembly ProteinLOC480424PREDICTED: similar to serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5 [Canis familiaris]. 2663e-71O
Contig/Assembly ProteinLOC612383PREDICTED: similar to Corticosteroid-binding globulin precursor (CBG) (Transcortin) [Canis familiaris]. 1881e-47


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2C-like [Bos taurus]. 539e-153O
Contig/Assembly ProteinLOC784932PREDICTED: endopin 2B-like [Bos taurus]. 534e-152O
Contig/Assembly ProteinSERPINA3-8SERPINA3-8 [Bos taurus]. 526e-149O
Contig/Assembly ProteinSERPINA3-7serpin A3-7 [Bos taurus]. 517e-147O
Contig/Assembly ProteinSERPINA3-6serpin A3-6 [Bos taurus]. 509e-144O
Contig/Assembly ProteinSERPINA3-3serpin A3-3 [Bos taurus]. 489e-138O
Contig/Assembly ProteinSERPINA3-2serpin A3-2 [Bos taurus]. 482e-136O
Contig/Assembly ProteinSERPINA3-1serpin A3-1 precursor [Bos taurus]. 482e-136O
Contig/Assembly ProteinSERPINA3serpin A3-5 [Bos taurus]. 481e-136O
Contig/Assembly ProteinLOC100138846PREDICTED: endopin 2C-like [Bos taurus]. 466e-131O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153899PREDICTED: serpin A3-8 [Sus scrofa]. 571e-163O
Contig/Assembly ProteinLOC100156325PREDICTED: serpin A3-6 [Sus scrofa]. 550e-157O
Contig/Assembly ProteinSERPINA3-3PREDICTED: serpin A3-5 [Sus scrofa]. 536e-152
Contig/Assembly ProteinSERPINA3-2alpha-1-antichymotrypsin 2 [Sus scrofa]. 518e-147O
Contig/Assembly ProteinLOC100622237PREDICTED: serpin A3-8-like, partial [Sus scrofa]. 389e-108O
Contig/Assembly ProteinLOC100155953PREDICTED: serpin A11 [Sus scrofa]. 3079e-84O
Contig/Assembly ProteinSERPINA11PREDICTED: serpin A11 [Sus scrofa]. 3063e-83O
Contig/Assembly ProteinSERPINA1alpha-1-antitrypsin precursor [Sus scrofa]. 2962e-80O
Contig/Assembly ProteinSERPINA7thyroxine-binding globulin precursor [Sus scrofa]. 2919e-79O
Contig/Assembly ProteinLOC100620564PREDICTED: thyroxine-binding globulin-like [Sus scrofa]. 2902e-78O


Assembly Members: 954      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010004H01LVR01_0004_H01.bBP447212 
LVR010008C06LVR01_0008_C06.bBP443166 
LVR010008D10LVR01_0008_D10.bBP444343 
LVR010014G10LVR01_0014_G10.bBP446987 
LVR010015A10LVR01_0015_A10.bBP441650 
LVR010015E05LVR01_0015_E05.bBP444873 
LVR010017C12LVR01_0017_C12.bBP443615 
LVR010019C01LVR01_0019_C01.bBP442796 
LVR010022A01LVR01_0022_A01.bBP440953 
LVR010025H07LVR01_0025_H07.bBP447698 
LVR010025H12LVR01_0025_H12.bBP448086 
LVR010029E07LVR01_0029_E07.bBP445017 
LVR010030H08LVR01_0030_H08.bBP447779 
LVR010031H10LVR01_0031_H10.bBP447933 
LVR010041E06LVR01_0041_E06.bBP444958 
LVR010043E03LVR01_0043_E03.bBP444749 
LVR010043F05LVR01_0043_F05.bBP445755 
LVR010045C05LVR01_0045_C05.bBP443120 
LVR010045F05LVR01_0045_F05.bBP445757 
LVR010045G09LVR01_0045_G09.bBP446935 
LVR010049C06LVR01_0049_C06.bBP443198 
LVR010049F06LVR01_0049_F06.bBP445834 
LVR010051A04LVR01_0051_A04.bBP441215 
LVR010051E02LVR01_0051_E02.bBP444683 
LVR010052B07LVR01_0052_B07.bBP442362 
LVR010054B11LVR01_0054_B11.bBP442670 
LVR010054C07LVR01_0054_C07.bBP443271 
LVR010057E12LVR01_0057_E12.bBP445392 
LVR010059F07LVR01_0059_F07.bBP445913 
LVR010067F05LVR01_0067_F05.bBP445778 
LVR010067F08LVR01_0067_F08.bBP445989 
LVR010072A08LVR01_0072_A08.bBP441544 
LVR010072G08LVR01_0072_G08.bBP446887 
LVR010076C07LVR01_0076_C07.bBP443288 
LVR010079H12LVR01_0079_H12.bBP448131 
LVR010083A09LVR01_0083_A09.bCJ000008 
LVR010085F01LVR01_0085_F01.bCJ000225 
LVR010086G08LVR01_0086_G08.bCJ000325 
LVR010089D02LVR01_0089_D02.bCJ000543 
LVR010090E05LVR01_0090_E05.bCJ000644 
LVR010090E11LVR01_0090_E11.bCJ000650 AK398935
LVR010092D07LVR01_0092_D07.bCJ000794 
LVR010095E11LVR01_0095_E11.bBP445334 
LVR010097H09LVR01_0097_H09.bBP447902 
LVR010099E01LVR01_0099_E01.bBP444639 
LVR010100B04LVR01_0100_B04.bBP442163 AK232615
LVR010100E10LVR01_0100_E10.bBP445264 
LVR010100F02LVR01_0100_F02.bBP445570 
LVR010102C04LVR01_0102_C04.bBP443084 
LVR010103F07LVR01_0103_F07.bBP445933 
LVR010104D03LVR01_0104_D03.bBP443904 
LVR010104F09LVR01_0104_F09.bBP446081 
LVR010104G11LVR01_0104_G11.bBP447128 
LVRM10001F03LVRM1_0001_F03.bBP139885 
LVRM10001G07LVRM1_0001_G07.bBP140502 
LVRM10002A04LVRM1_0002_A04.bBP137598 
LVRM10002A06LVRM1_0002_A06.bBP137673 
LVRM10002B05LVRM1_0002_B05.bBP138106 
LVRM10002B07LVRM1_0002_B07.bBP138186 
LVRM10002C10LVRM1_0002_C10.bBP138776 
LVRM10002E08LVRM1_0002_E08.bBP139622 
LVRM10002F04LVRM1_0002_F04.bBP139928 
LVRM10003B03LVRM1_0003_B03.bCJ001003 
LVRM10003B04LVRM1_0003_B04.bCJ001004 
LVRM10003D05LVRM1_0003_D05.bCJ001023 
LVRM10003G01LVRM1_0003_G01.bCJ001054 
LVRM10003H02LVRM1_0003_H02.bCJ001065 
LVRM10004A03LVRM1_0004_A03.bCJ001075 
LVRM10004B02LVRM1_0004_B02.bCJ001080 
LVRM10004B06LVRM1_0004_B06.bCJ001084 
LVRM10004C05LVRM1_0004_C05.bCJ001094 
LVRM10004C06LVRM1_0004_C06.bCJ001095 
LVRM10004H05LVRM1_0004_H05.bCJ001131 
LVRM10005A04LVRM1_0005_A04.bBP137599 
LVRM10005B03LVRM1_0005_B03.bBP138026 
LVRM10005C05LVRM1_0005_C05.bBP138569 
LVRM10005C08LVRM1_0005_C08.bBP138692 
LVRM10005D12LVRM1_0005_D12.bBP139341 
LVRM10006F09LVRM1_0006_F09.bBP140124 
LVRM10006H09LVRM1_0006_H09.bBP141077 
LVRM10007B09LVRM1_0007_B09.bBP138276 
LVRM10007E11LVRM1_0007_E11.bBP139739 
LVRM10007F10LVRM1_0007_F10.bBP140165 
LVRM10007H06LVRM1_0007_H06.bBP140952 
LVRM10007H12LVRM1_0007_H12.bBP141200 
LVRM10008A05LVRM1_0008_A05.bBP137641 
LVRM10008C08LVRM1_0008_C08.bBP138695 
LVRM10009C08LVRM1_0009_C08.bBP138696 
LVRM10009C11LVRM1_0009_C11.bBP138823 
LVRM10009D05LVRM1_0009_D05.bBP139062 
LVRM10009E07LVRM1_0009_E07.bBP139592 
LVRM10009H06LVRM1_0009_H06.bBP140954 
LVRM10010A05LVRM1_0010_A05.bBP137643 
LVRM10010C08LVRM1_0010_C08.bBP138697 
LVRM10010D09LVRM1_0010_D09.bBP139217 
LVRM10010H04LVRM1_0010_H04.bBP140872 
LVRM10011H10LVRM1_0011_H10.bBP454436 
LVRM10012A09LVRM1_0012_A09.bBP448656 
LVRM10012B05LVRM1_0012_B05.bBP449192 
LVRM10012E07LVRM1_0012_E07.bBP451786 
LVRM10014E11LVRM1_0014_E11.bBP452049 
LVRM10014F10LVRM1_0014_F10.bBP452785 
LVRM10015D12LVRM1_0015_D12.bBP451328 
LVRM10015F01LVRM1_0015_F01.bBP452178 
LVRM10017D06LVRM1_0017_D06.bBP450899 
LVRM10017D08LVRM1_0017_D08.bBP451043 
LVRM10017E07LVRM1_0017_E07.bBP451791 
LVRM10017F03LVRM1_0017_F03.bBP452315 
LVRM10017F04LVRM1_0017_F04.bBP452376 
LVRM10017F08LVRM1_0017_F08.bBP452646 
LVRM10017H12LVRM1_0017_H12.bBP454585 AK394104
LVRM10018A12LVRM1_0018_A12.bBP448868 
LVRM10018F07LVRM1_0018_F07.bBP452577 
LVRM10018F10LVRM1_0018_F10.bBP452789 
LVRM10018H10LVRM1_0018_H10.bBP454443 
LVRM10019B01LVRM1_0019_B01.bBP137956 
LVRM10019C01LVRM1_0019_C01.bBP138442 
LVRM10019C03LVRM1_0019_C03.bBP138500 
LVRM10019D02LVRM1_0019_D02.bBP138945 
LVRM10019E01LVRM1_0019_E01.bBP139386 
LVRM10019G06LVRM1_0019_G06.bBP140469 
LVRM10020B04LVRM1_0020_B04.bBP138071 
LVRM10020C07LVRM1_0020_C07.bBP138658 
LVRM10020D01LVRM1_0020_D01.bBP138909 
LVRM10020D07LVRM1_0020_D07.bBP139146 
LVRM10020G03LVRM1_0020_G03.bBP140359 
LVRM10020H08LVRM1_0020_H08.bBP141041 
LVRM10021A08LVRM1_0021_A08.bBP137762 
LVRM10021B03LVRM1_0021_B03.bCJ001138 
LVRM10021B06LVRM1_0021_B06.bCJ001140 
LVRM10021B10LVRM1_0021_B10.bCJ001143 
LVRM10021C06LVRM1_0021_C06.bCJ001150 
LVRM10021D04LVRM1_0021_D04.bCJ001158 
LVRM10021F01LVRM1_0021_F01.bCJ001177 
LVRM10022B04LVRM1_0022_B04.bBP138072 
LVRM10022B09LVRM1_0022_B09.bBP138281 
LVRM10022C02LVRM1_0022_C02.bBP138470 
LVRM10022C06LVRM1_0022_C06.bBP138619 
LVRM10022D12LVRM1_0022_D12.bBP139349 
LVRM10023C02LVRM1_0023_C02.bBP138471 
LVRM10023F12LVRM1_0023_F12.bBP140251 
LVRM10023H02LVRM1_0023_H02.bBP140795 
LVRM10023H05LVRM1_0023_H05.bBP140916 
LVRM10024B04LVRM1_0024_B04.bBP138073 
LVRM10024B10LVRM1_0024_B10.bBP138326 AK232776
LVRM10024E03LVRM1_0024_E03.bBP139449 
LVRM10024F08LVRM1_0024_F08.bBP140092 
LVRM10024G07LVRM1_0024_G07.bBP140512 
LVRM10024H01LVRM1_0024_H01.bBP140757 
LVRM10024H03LVRM1_0024_H03.bBP140836 
LVRM10025D04LVRM1_0025_D04.bBP139028 
LVRM10026A07LVRM1_0026_A07.bBP137724 
LVRM10026A09LVRM1_0026_A09.bBP137805 
LVRM10026B09LVRM1_0026_B09.bBP138285 
LVRM10026C11LVRM1_0026_C11.bBP138831 
LVRM10026D10LVRM1_0026_D10.bBP139264 
LVRM10026F01LVRM1_0026_F01.bBP139821 
LVRM10026G02LVRM1_0026_G02.bBP140325 
LVRM10026G10LVRM1_0026_G10.bBP140632 
LVRM10026H12LVRM1_0026_H12.bBP141210 
LVRM10027A01LVRM1_0027_A01.bBP137508 
LVRM10027A05LVRM1_0027_A05.bBP137650 
LVRM10027B10LVRM1_0027_B10.bBP138328 
LVRM10027C03LVRM1_0027_C03.bBP138504 
LVRM10027C08LVRM1_0027_C08.bBP138704 
LVRM10027E12LVRM1_0027_E12.bBP139786 
LVRM10027F10LVRM1_0027_F10.bBP140175 
LVRM10027H06LVRM1_0027_H06.bBP140962 
LVRM10027H11LVRM1_0027_H11.bBP141169 
LVRM10028B04LVRM1_0028_B04.bBP138077 
LVRM10028B10LVRM1_0028_B10.bBP138329 
LVRM10029B03LVRM1_0029_B03.bBP138038 
LVRM10029C09LVRM1_0029_C09.b  
LVRM10029E02LVRM1_0029_E02.bBP139418 
LVRM10029F03LVRM1_0029_F03.bBP139901 
LVRM10029G08LVRM1_0029_G08.bBP140559 
LVRM10029G09LVRM1_0029_G09.bBP140596 
LVRM10030E09LVRM1_0030_E09.bBP139672 
LVRM10030F02LVRM1_0030_F02.bBP139859 
LVRM10030F08LVRM1_0030_F08.bBP140096 
LVRM10030G12LVRM1_0030_G12.bBP140721 
LVRM10030H01LVRM1_0030_H01.bBP140762 
LVRM10031A09LVRM1_0031_A09.bBP137810 
LVRM10031A11LVRM1_0031_A11.bBP137888 
LVRM10031C03LVRM1_0031_C03.bBP138508 
LVRM10031C05LVRM1_0031_C05.bBP138585 
LVRM10031D12LVRM1_0031_D12.bBP139357 
LVRM10031E11LVRM1_0031_E11.bBP139751 
LVRM10031F10LVRM1_0031_F10.bBP140178 
LVRM10031G08LVRM1_0031_G08.bBP140561 
LVRM10031H01LVRM1_0031_H01.bBP140763 
LVRM10031H05LVRM1_0031_H05.bBP140923 
LVRM10031H10LVRM1_0031_H10.bBP141131 
LVRM10032C03LVRM1_0032_C03.bBP138509 
LVRM10032D02LVRM1_0032_D02.bBP138954 
LVRM10032F12LVRM1_0032_F12.bBP140259 
LVRM10033A04LVRM1_0033_A04.bCJ001208 
LVRM10033B05LVRM1_0033_B05.bCJ001221 
LVRM10033C11LVRM1_0033_C11.bCJ001237 
LVRM10033D06LVRM1_0033_D06.bCJ001243 
LVRM10033E11LVRM1_0033_E11.bCJ001259 
LVRM10034A08LVRM1_0034_A08.bCJ001298 
LVRM10034B02LVRM1_0034_B02.bCJ001304 
LVRM10034D01LVRM1_0034_D01.bCJ001326 
LVRM10034D07LVRM1_0034_D07.bCJ001332 
LVRM10034D11LVRM1_0034_D11.bCJ001336 
LVRM10034E01LVRM1_0034_E01.bCJ001338 
LVRM10034E07LVRM1_0034_E07.bCJ001343 
LVRM10034F04LVRM1_0034_F04.bCJ001351 
LVRM10034G10LVRM1_0034_G10.bCJ001366 
LVRM10034G12LVRM1_0034_G12.bBW962823 
LVRM10035A06LVRM1_0035_A06.bCJ001382 
LVRM10035A10LVRM1_0035_A10.bCJ001385 
LVRM10035A12LVRM1_0035_A12.bCJ001387 
LVRM10035B10LVRM1_0035_B10.bCJ001397 
LVRM10035C03LVRM1_0035_C03.bCJ001402 
LVRM10035D02LVRM1_0035_D02.bCJ001412 
LVRM10035E02LVRM1_0035_E02.bCJ001422 
LVRM10035E03LVRM1_0035_E03.bCJ001423 
LVRM10035E11LVRM1_0035_E11.bCJ001431 
LVRM10035F04LVRM1_0035_F04.bCJ001436 
LVRM10035F08LVRM1_0035_F08.bCJ001439 
LVRM10035G12LVRM1_0035_G12.bCJ001453 
LVRM10036A12LVRM1_0036_A12.bCJ001474 
LVRM10036C11LVRM1_0036_C11.bCJ001491 
LVRM10036D04LVRM1_0036_D04.bCJ001496 
LVRM10036E04LVRM1_0036_E04.bCJ001507 
LVRM10036G07LVRM1_0036_G07.bCJ001531 
LVRM10036H07LVRM1_0036_H07.bCJ001541 
LVRM10037B09LVRM1_0037_B09.bCJ001563 
LVRM10037B10LVRM1_0037_B10.bCJ001564 
LVRM10037F06LVRM1_0037_F06.bCJ001603 
LVRM10037F10LVRM1_0037_F10.bCJ001607 
LVRM10037G01LVRM1_0037_G01.bCJ001610 
LVRM10038D11LVRM1_0038_D11.bCJ001673 
LVRM10038F10LVRM1_0038_F10.bCJ001695 
LVRM10038H02LVRM1_0038_H02.bCJ001707 
LVRM10039D08LVRM1_0039_D08.bCJ001754 
LVRM10039D09LVRM1_0039_D09.bCJ001755 
LVRM10039E12LVRM1_0039_E12.bCJ001767 
LVRM10039F08LVRM1_0039_F08.bCJ001774 
LVRM10039H02LVRM1_0039_H02.bCJ001791 
LVRM10039H06LVRM1_0039_H06.bCJ001795 
LVRM10040B06LVRM1_0040_B06.bCJ001812 
LVRM10040C08LVRM1_0040_C08.bCJ001825 
LVRM10040C10LVRM1_0040_C10.bCJ001827 
LVRM10040D10LVRM1_0040_D10.bCJ001834 
LVRM10040E11LVRM1_0040_E11.bCJ001843 
LVRM10040F11LVRM1_0040_F11.bBW962862 
LVRM10040F12LVRM1_0040_F12.bBW962863 
LVRM10040H02LVRM1_0040_H02.bCJ001862 
LVRM10041C11LVRM1_0041_C11.bCJ001902 
LVRM10041D01LVRM1_0041_D01.bCJ001904 
LVRM10041G07LVRM1_0041_G07.bCJ001942 
LVRM10042E05LVRM1_0042_E05.bCJ002002 
LVRM10042E10LVRM1_0042_E10.bCJ002007 
LVRM10042H06LVRM1_0042_H06.bCJ002036 
LVRM10043C12LVRM1_0043_C12.bCJ002073 
LVRM10045A01LVRM1_0045_A01.bBW962885 
LVRM10045A08LVRM1_0045_A08.bCJ002209 
LVRM10045F12LVRM1_0045_F12.bCJ002248 
LVRM10047A02LVRM1_0047_A02.bCJ002266 
LVRM10047A12LVRM1_0047_A12.bBW962910 
LVRM10047B04LVRM1_0047_B04.bBW962911 
LVRM10047B05LVRM1_0047_B05.bBW962912 
LVRM10047C01LVRM1_0047_C01.bCJ002284 
LVRM10047D02LVRM1_0047_D02.bCJ002296 
LVRM10047D05LVRM1_0047_D05.bCJ002299 
LVRM10047D12LVRM1_0047_D12.bBW962916 
LVRM10047E06LVRM1_0047_E06.bCJ002307 
LVRM10047F03LVRM1_0047_F03.bCJ002313 
LVRM10048A01LVRM1_0048_A01.bBW962927 
LVRM10048H08LVRM1_0048_H08.bCJ002411 
LVRM10049A10LVRM1_0049_A10.bBP448733 
LVRM10049A11LVRM1_0049_A11.bBP448807 
LVRM10049B05LVRM1_0049_B05.bBP449199 
LVRM10049D06LVRM1_0049_D06.bBP450901 
LVRM10049G01LVRM1_0049_G01.bBP452986 
LVRM10049G06LVRM1_0049_G06.bBP453316 
LVRM10049H04LVRM1_0049_H04.bBP454012 
LVRM10049H06LVRM1_0049_H06.bBP454155 
LVRM10049H07LVRM1_0049_H07.bBP454230 AK232907
LVRM10050C01LVRM1_0050_C01.bBP449720 
LVRM10050D09LVRM1_0050_D09.bBP451119 
LVRM10050D11LVRM1_0050_D11.bBP451260 
LVRM10050G09LVRM1_0050_G09.bBP453536 
LVRM10051A01LVRM1_0051_A01.bBP448153 
LVRM10051B11LVRM1_0051_B11.bBP449610 
LVRM10051F01LVRM1_0051_F01.bBP452184 
LVRM10052A03LVRM1_0052_A03.bBP448265 
LVRM10052E02LVRM1_0052_E02.bBP451463 
LVRM10052E09LVRM1_0052_E09.bBP451918 
LVRM10052F02LVRM1_0052_F02.bBP452249 
LVRM10053B03LVRM1_0053_B03.bBP138042 
LVRM10053B11LVRM1_0053_B11.bBP138377 
LVRM10053D01LVRM1_0053_D01.bBP138915 
LVRM10054A09LVRM1_0054_A09.bBP137813 
LVRM10054B03LVRM1_0054_B03.bBP138043 
LVRM10054D09LVRM1_0054_D09.bBP139228 
LVRM10054D10LVRM1_0054_D10.bBP139272 
LVRM10054F01LVRM1_0054_F01.bBP139826 
LVRM10054F04LVRM1_0054_F04.bBP139947 
LVRM10054G02LVRM1_0054_G02.bBP140333 
LVRM10055B06LVRM1_0055_B06.bBP138166 
LVRM10055C02LVRM1_0055_C02.bBP138479 
LVRM10055D06LVRM1_0055_D06.bBP139117 
LVRM10055D07LVRM1_0055_D07.bBP139158 
LVRM10055F01LVRM1_0055_F01.bBP139827 
LVRM10055H01LVRM1_0055_H01.bBP140767 
LVRM10056A05LVRM1_0056_A05.bBP137655 
LVRM10056A08LVRM1_0056_A08.bBP137773 
LVRM10056A10LVRM1_0056_A10.bBP137850 
LVRM10056D10LVRM1_0056_D10.bBP139274 
LVRM10056E10LVRM1_0056_E10.bBP139716 
LVRM10056F07LVRM1_0056_F07.bBP140061 
LVRM10056H02LVRM1_0056_H02.bBP140808 
LVRM10056H07LVRM1_0056_H07.bBP141014 
LVRM10057C08LVRM1_0057_C08.bBP138714 
LVRM10057F05LVRM1_0057_F05.bBP139988 
LVRM10057F06LVRM1_0057_F06.bBP140023 
LVRM10057F07LVRM1_0057_F07.bBP140062 
LVRM10057F08LVRM1_0057_F08.bBP140103 
LVRM10057G02LVRM1_0057_G02.bBP140336 
LVRM10057G03LVRM1_0057_G03.bBP140371 
LVRM10058A08LVRM1_0058_A08.bBP137775 
LVRM10058A10LVRM1_0058_A10.bBP137852 
LVRM10058C06LVRM1_0058_C06.bBP138632 
LVRM10062B06LVRM1_0062_B06.bBP138170 
LVRM10062H05LVRM1_0062_H05.bBP140932 
LVRM10063A05LVRM1_0063_A05.bBP137659 
LVRM10063B10LVRM1_0063_B10.bBP138342 
LVRM10063C10LVRM1_0063_C10.bBP138802 
LVRM10063G04LVRM1_0063_G04.bBP140414 
LVRM10063H07LVRM1_0063_H07.bBP141019 
LVRM10064A08LVRM1_0064_A08.bBP137778 
LVRM10064B11LVRM1_0064_B11.bBP138385 
LVRM10064D05LVRM1_0064_D05.bBP139084 
LVRM10064F12LVRM1_0064_F12.bBP140269 
LVRM10064H06LVRM1_0064_H06.bBP140977 
LVRM10064H07LVRM1_0064_H07.bBP141020 
LVRM10064H11LVRM1_0064_H11.bBP141183 
LVRM10065C06LVRM1_0065_C06.bBP138636 
LVRM10065D11LVRM1_0065_D11.bBP139325 
LVRM10066F02LVRM1_0066_F02.bBP139873 
LVRM10066F08LVRM1_0066_F08.bBP140109 
LVRM10066F11LVRM1_0066_F11.bBP140228 
LVRM10066H10LVRM1_0066_H10.bBP141143 
LVRM10067A03LVRM1_0067_A03.bBP137586 
LVRM10067B07LVRM1_0067_B07.bBP138217 
LVRM10067D06LVRM1_0067_D06.bBP139126 
LVRM10067D12LVRM1_0067_D12.bBP139371 
LVRM10067F05LVRM1_0067_F05.bBP139995 
LVRM10067H09LVRM1_0067_H09.bBP141103 
LVRM10068B07LVRM1_0068_B07.bBP138218 
LVRM10068D04LVRM1_0068_D04.bBP139046 
LVRM10068D07LVRM1_0068_D07.bBP139168 
LVRM10068H10LVRM1_0068_H10.bBP141145 
LVRM10069C04LVRM1_0069_C04.bBP449921 
LVRM10069D08LVRM1_0069_D08.bBP451049 
LVRM10069G05LVRM1_0069_G05.bBP453252 
LVRM10070C01LVRM1_0070_C01.bBP449724 
LVRM10070D08LVRM1_0070_D08.bBP451050 
LVRM10070E04LVRM1_0070_E04.bBP451593 
LVRM10070H03LVRM1_0070_H03.bBP453950 
LVRM10070H04LVRM1_0070_H04.bBP454017 
LVRM10071A06LVRM1_0071_A06.bBP448467 
LVRM10071C05LVRM1_0071_C05.bBP449990 
LVRM10071E06LVRM1_0071_E06.bBP451727 
LVRM10072A05LVRM1_0072_A05.bBP448402 
LVRM10072A12LVRM1_0072_A12.bBP448875 
LVRM10072B08LVRM1_0072_B08.bBP449406 
LVRM10072B11LVRM1_0072_B11.bBP449613 
LVRM10072D11LVRM1_0072_D11.bBP451266 
LVRM10072F02LVRM1_0072_F02.bBP452253 
LVRM10072F07LVRM1_0072_F07.bBP452583 
LVRM10072H11LVRM1_0072_H11.bBP454522 
LVRM10073A03LVRM1_0073_A03.bBP137588 
LVRM10073A06LVRM1_0073_A06.bBP137701 
LVRM10073B05LVRM1_0073_B05.bBP138138 
LVRM10073B09LVRM1_0073_B09.bBP138305 
LVRM10073G01LVRM1_0073_G01.bBP140306 
LVRM10073H02LVRM1_0073_H02.bBP140815 
LVRM10073H08LVRM1_0073_H08.bBP141064 
LVRM10074B02LVRM1_0074_B02.bBP138018 
LVRM10074C03LVRM1_0074_C03.bBP138519 
LVRM10074D12LVRM1_0074_D12.bBP139374 
LVRM10074F08LVRM1_0074_F08.bBP140112 
LVRM10074G06LVRM1_0074_G06.bBP140493 
LVRM10074H01LVRM1_0074_H01.bBP140778 
LVRM10075B01LVRM1_0075_B01.bBP137979 
LVRM10075C07LVRM1_0075_C07.bBP138684 
LVRM10075D05LVRM1_0075_D05.bBP139090 
LVRM10075D12LVRM1_0075_D12.bBP139375 
LVRM10075E03LVRM1_0075_E03.bBP139469 
LVRM10075E04LVRM1_0075_E04.bBP139506 
LVRM10075G06LVRM1_0075_G06.bBP140494 
LVRM10075G09LVRM1_0075_G09.bBP140612 
LVRM10075G11LVRM1_0075_G11.bBP140696 
LVRM10075H05LVRM1_0075_H05.bBP140940 
LVRM10076B09LVRM1_0076_B09.bBP138308 
LVRM10076C09LVRM1_0076_C09.bBP138768 
LVRM10076D03LVRM1_0076_D03.bBP139010 
LVRM10077A04LVRM1_0077_A04.bBP137631 
LVRM10077E10LVRM1_0077_E10.bBP139729 
LVRM10077F06LVRM1_0077_F06.bBP140034 
LVRM10077F09LVRM1_0077_F09.bBP140155 
LVRM10077H07LVRM1_0077_H07.bBP141028 
LVRM10078A10LVRM1_0078_A10.bBP137866 
LVRM10078C04LVRM1_0078_C04.bBP138562 
LVRM10078C05LVRM1_0078_C05.bBP138604 
LVRM10078C12LVRM1_0078_C12.bBP138896 
LVRM10078D08LVRM1_0078_D08.bBP139206 
LVRM10078F03LVRM1_0078_F03.bBP139922 
LVRM10078G06LVRM1_0078_G06.bBP140497 
LVRM10078G07LVRM1_0078_G07.bBP140538 
LVRM10079C08LVRM1_0079_C08.bBP138729 
LVRM10079C10LVRM1_0079_C10.bBP138813 
LVRM10079F01LVRM1_0079_F01.bBP139840 
LVRM10080B03LVRM1_0080_B03.bBP138060 
LVRM10080B06LVRM1_0080_B06.bBP138182 
LVRM10080D04LVRM1_0080_D04.bBP139053 
LVRM10081F07LVRM1_0081_F07.bCJ002476 
LVRM10081H04LVRM1_0081_H04.bCJ002495 
LVRM10082D07LVRM1_0082_D07.bCJ002541 
LVRM10082E12LVRM1_0082_E12.bCJ002554 
LVRM10082F01LVRM1_0082_F01.bCJ002555 
LVRM10082F09LVRM1_0082_F09.bCJ002563 
LVRM10083D02LVRM1_0083_D02.bCJ002621 
LVRM10084A03LVRM1_0084_A03.bCJ002679 AK394197
LVRM10084A11LVRM1_0084_A11.bCJ002684 
LVRM10084D02LVRM1_0084_D02.bCJ002709 
LVRM10084D05LVRM1_0084_D05.bCJ002712 
LVRM10084E12LVRM1_0084_E12.bCJ002728 
LVRM10085C08LVRM1_0085_C08.bCJ002788 
LVRM10085E01LVRM1_0085_E01.bCJ002805 
LVRM10086B11LVRM1_0086_B11.bCJ002863 
LVRM10086C01LVRM1_0086_C01.bCJ002865 
LVRM10086D07LVRM1_0086_D07.bCJ002881 
LVRM10086G10LVRM1_0086_G10.bBW962962 
LVRM10087E01LVRM1_0087_E01.bCJ002966 
LVRM10087G03LVRM1_0087_G03.bCJ002991 
LVRM10088A07LVRM1_0088_A07.bCJ003015 
LVRM10088F07LVRM1_0088_F07.bCJ003068 
LVRM10088G01LVRM1_0088_G01.bBW962970 
LVRM10088G04LVRM1_0088_G04.bCJ003075 
LVRM10090A03LVRM1_0090_A03.bCJ003180 
LVRM10090B09LVRM1_0090_B09.bBW962980 
LVRM10090C01LVRM1_0090_C01.bBW962981 
LVRM10090D04LVRM1_0090_D04.bCJ003207 
LVRM10090E07LVRM1_0090_E07.bCJ003221 
LVRM10090E09LVRM1_0090_E09.bCJ003222 
LVRM10091E03LVRM1_0091_E03.bCJ003298 
LVRM10091E11LVRM1_0091_E11.bCJ003305 
LVRM10091H05LVRM1_0091_H05.bCJ003333 
LVRM10092A09LVRM1_0092_A09.bCJ003348 
LVRM10092B09LVRM1_0092_B09.bCJ003359 
LVRM10092C10LVRM1_0092_C10.bCJ003372 
LVRM10092D09LVRM1_0092_D09.bCJ003380 
LVRM10092F07LVRM1_0092_F07.bCJ003400 
LVRM10093A03LVRM1_0093_A03.bCJ003424 
LVRM10093B11LVRM1_0093_B11.bCJ003440 
LVRM10093E02LVRM1_0093_E02.bCJ003462 
LVRM10093E10LVRM1_0093_E10.bBW963010 
LVRM10093G11LVRM1_0093_G11.bCJ003486 
LVRM10094F04LVRM1_0094_F04.bCJ003546 
LVRM10094G03LVRM1_0094_G03.bCJ003556 
LVRM10095A10LVRM1_0095_A10.bCJ003582 AK394212
LVRM10095C05LVRM1_0095_C05.bBW963034 
LVRM10095D09LVRM1_0095_D09.bCJ003611 
LVRM10095G06LVRM1_0095_G06.bBW963039 
LVRM10095G08LVRM1_0095_G08.bCJ003640 
LVRM10096C06LVRM1_0096_C06.bBW963047 
LVRM10096C09LVRM1_0096_C09.bCJ003679 
LVRM10096G12LVRM1_0096_G12.bCJ003717 
LVRM10097F06LVRM1_0097_F06.bCJ003785 
LVRM10097F10LVRM1_0097_F10.bCJ003788 
LVRM10097H04LVRM1_0097_H04.bCJ003806 
LVRM10097H12LVRM1_0097_H12.bCJ003813 
LVRM10098B08LVRM1_0098_B08.bCJ003830 
LVRM10098B11LVRM1_0098_B11.bCJ003833 
LVRM10098D01LVRM1_0098_D01.bCJ003842 
LVRM10099A02LVRM1_0099_A02.bCJ003895 
LVRM10101B03LVRM1_0101_B03.bBP138061 
LVRM10101D09LVRM1_0101_D09.bBP139249 
LVRM10101F04LVRM1_0101_F04.bBP139964 
LVRM10101G05LVRM1_0101_G05.bBP140460 
LVRM10101H01LVRM1_0101_H01.bBP140785 
LVRM10101H10LVRM1_0101_H10.bBP141153 
LVRM10102B09LVRM1_0102_B09.bBP138314 
LVRM10102D05LVRM1_0102_D05.bBP139096 
LVRM10102F04LVRM1_0102_F04.bBP139965 
LVRM10102F12LVRM1_0102_F12.bBP140283 
LVRM10103C11LVRM1_0103_C11.bBP450417 
LVRM10103D04LVRM1_0103_D04.bBP450762 
LVRM10103D09LVRM1_0103_D09.bBP451126 
LVRM10103F08LVRM1_0103_F08.bBP452655 
LVRM10103G04LVRM1_0103_G04.bBP453189 
LVRM10104B07LVRM1_0104_B07.bBP449337 
LVRM10104D02LVRM1_0104_D02.bBP450627 
LVRM10104G11LVRM1_0104_G11.bBP453689 
LVRM10105A04LVRM1_0105_A04.bBP448335 
LVRM10105A05LVRM1_0105_A05.bBP448405 
LVRM10105A07LVRM1_0105_A07.b  
LVRM10105B06LVRM1_0105_B06.bBP449273 
LVRM10105D09LVRM1_0105_D09.bBP451128 
LVRM10106D01LVRM1_0106_D01.bBP450563 
LVRM10106F01LVRM1_0106_F01.bBP452192 
LVRM10106F04LVRM1_0106_F04.bBP452388 
LVRM10106G02LVRM1_0106_G02.bBP453061 
LVRM10106G05LVRM1_0106_G05.b  
LVRM10106G08LVRM1_0106_G08.bBP453472 
LVRM10107A05LVRM1_0107_A05.b  
LVRM10107B01LVRM1_0107_B01.bBP448948 
LVRM10107B10LVRM1_0107_B10.bBP449553 
LVRM10107C03LVRM1_0107_C03.bBP449859 
LVRM10107D05LVRM1_0107_D05.bBP450838 
LVRM10107F12LVRM1_0107_F12.bBP452926 
LVRM10107G12LVRM1_0107_G12.bBP453761 
LVRM10108A01LVRM1_0108_A01.bBP448160 
LVRM10108C03LVRM1_0108_C03.bBP449860 
LVRM10108E04LVRM1_0108_E04.bBP451600 
LVRM10108G01LVRM1_0108_G01.bBP452997 
LVRM10108G04LVRM1_0108_G04.bBP453194 
LVRM10108H06LVRM1_0108_H06.bBP454168 
LVRM10109D01LVRM1_0109_D01.bBP450566 
LVRM10109D08LVRM1_0109_D08.bBP451059 
LVRM10109H09LVRM1_0109_H09.bBP454386 
LVRM10110D10LVRM1_0110_D10.bBP451203 
LVRM10111D11LVRM1_0111_D11.bBP451275 
LVRM10111E09LVRM1_0111_E09.bBP451930 
LVRM10111G09LVRM1_0111_G09.bBP453551 
LVRM10112A07LVRM1_0112_A07.bBP448542 
LVRM10112B02LVRM1_0112_B02.bBP449015 
LVRM10112B08LVRM1_0112_B08.bBP449415 
LVRM10112F09LVRM1_0112_F09.bBP452734 
LVRM10112F12LVRM1_0112_F12.bBP452931 
LVRM10112G03LVRM1_0112_G03.bBP453130 
LVRM10112H03LVRM1_0112_H03.bBP453961 
LVRM10113E09LVRM1_0113_E09.bBP451932 
LVRM10113F03LVRM1_0113_F03.bBP452333 
LVRM10113G10LVRM1_0113_G10.bBP453626 
LVRM10113H05LVRM1_0113_H05.bBP454101 
LVRM10114B01LVRM1_0114_B01.bBP448952 
LVRM10114F01LVRM1_0114_F01.bBP452198 
LVRM10114F05LVRM1_0114_F05.bBP452461 
LVRM10114H09LVRM1_0114_H09.bBP454390 
LVRM10115B11LVRM1_0115_B11.bBP449624 
LVRM10115C08LVRM1_0115_C08.bBP450211 
LVRM10115D04LVRM1_0115_D04.bBP450773 
LVRM10116B04LVRM1_0116_B04.bBP449149 
LVRM10116B05LVRM1_0116_B05.bBP449216 
LVRM10116C03LVRM1_0116_C03.bBP449865 
LVRM10116C11LVRM1_0116_C11.bBP450430 
LVRM10116D05LVRM1_0116_D05.bBP450847 
LVRM10116D07LVRM1_0116_D07.bBP450991 
LVRM10116F08LVRM1_0116_F08.bBP452668 
LVRM10116F10LVRM1_0116_F10.bBP452808 
LVRM10116F11LVRM1_0116_F11.bBP452875 
LVRM10116G03LVRM1_0116_G03.bBP453134 
LVRM10116H02LVRM1_0116_H02.bBP453902 
LVRM10117B04LVRM1_0117_B04.bBP449150 
LVRM10117C04LVRM1_0117_C04.bBP449937 
LVRM10117G09LVRM1_0117_G09.bBP453557 
LVRM10117H12LVRM1_0117_H12.bBP454606 
LVRM10118B03LVRM1_0118_B03.bBP449086 
LVRM10118B04LVRM1_0118_B04.bBP449151 
LVRM10118B09LVRM1_0118_B09.bBP449491 
LVRM10118E04LVRM1_0118_E04.bBP451607 
LVRM10118F07LVRM1_0118_F07.bBP452599 
LVRM10118F11LVRM1_0118_F11.bBP452877 
LVRM10119A10LVRM1_0119_A10.bBP448757 
LVRM10119C10LVRM1_0119_C10.bBP450360 
LVRM10119D02LVRM1_0119_D02.bBP450641 
LVRM10119F06LVRM1_0119_F06.bBP452532 
LVRM10119H02LVRM1_0119_H02.bBP453904 
LVRM10120B03LVRM1_0120_B03.bBP449088 
LVRM10120C10LVRM1_0120_C10.bBP450361 
LVRM10120D10LVRM1_0120_D10.bBP451213 
LVRM10120E09LVRM1_0120_E09.bBP451939 
LVRM10120F02LVRM1_0120_F02.bBP452269 
LVRM10120G03LVRM1_0120_G03.bBP453138 
LVRM10120H02LVRM1_0120_H02.bBP453905 
LVRM10120H04LVRM1_0120_H04.bBP454037 
LVRM10121F09LVRM1_0121_F09.bBP452743 
LVRM10122A01LVRM1_0122_A01.bBP448170 
LVRM10122E01LVRM1_0122_E01.bBP451421 
LVRM10122H04LVRM1_0122_H04.bBP454039 
LVRM10122H06LVRM1_0122_H06.bBP454182 
LVRM10122H07LVRM1_0122_H07.bBP454255 
LVRM10123A05LVRM1_0123_A05.bBP448420 
LVRM10123B08LVRM1_0123_B08.bBP449426 
LVRM10123F02LVRM1_0123_F02.bBP452272 
LVRM10124A03LVRM1_0124_A03.bBP448289 
LVRM10124C10LVRM1_0124_C10.bBP450365 
LVRM10124D07LVRM1_0124_D07.bBP450998 
LVRM10124D12LVRM1_0124_D12.bBP451359 
LVRM10124F09LVRM1_0124_F09.bBP452746 
LVRM10124G12LVRM1_0124_G12.bBP453777 
LVRM10125A08LVRM1_0125_A08.bBP448621 
LVRM10125C03LVRM1_0125_C03.bBP449874 
LVRM10125F10LVRM1_0125_F10.bBP452817 
LVRM10126C11LVRM1_0126_C11.bBP450440 
LVRM10126D09LVRM1_0126_D09.bBP451145 
LVRM10126D10LVRM1_0126_D10.bBP451219 
LVRM10126D12LVRM1_0126_D12.bBP451360 
LVRM10126E06LVRM1_0126_E06.bBP451751 
LVRM10126G11LVRM1_0126_G11.bBP453711 
LVRM10126H12LVRM1_0126_H12.bBP454614 
LVRM10127B10LVRM1_0127_B10.bBP449569 
LVRM10127C05LVRM1_0127_C05.bBP450013 
LVRM10127D06LVRM1_0127_D06.bBP450930 
LVRM10127D08LVRM1_0127_D08.bBP451074 
LVRM10127E02LVRM1_0127_E02.bBP451489 
LVRM10127F05LVRM1_0127_F05.bBP452472 
LVRM10127H02LVRM1_0127_H02.bBP453912 
LVRM10128B04LVRM1_0128_B04.bBP449161 
LVRM10128E08LVRM1_0128_E08.bBP451884 
LVRM10128F08LVRM1_0128_F08.bBP452678 
LVRM10128F11LVRM1_0128_F11.bBP452887 
LVRM10128G10LVRM1_0128_G10.bBP453640 
LVRM10128H08LVRM1_0128_H08.bBP454331 
LVRM10129C01LVRM1_0129_C01.bBP449750 
LVRM10129E10LVRM1_0129_E10.bBP452015 
LVRM10129F01LVRM1_0129_F01.bBP452213 
LVRM10130H02LVRM1_0130_H02.bBP453914 
LVRM10130H10LVRM1_0130_H10.bBP454477 
LVRM10133D03LVRM1_0133_D03.bBP450722 
LVRM10133E02LVRM1_0133_E02.bBP451494 
LVRM10133G05LVRM1_0133_G05.bBP453283 
LVRM10133G06LVRM1_0133_G06.bBP453354 
LVRM10133H04LVRM1_0133_H04.bBP454050 
LVRM10134A06LVRM1_0134_A06.bBP448496 
LVRM10134B04LVRM1_0134_B04.bBP449164 
LVRM10134C11LVRM1_0134_C11.bBP450448 
LVRM10135D01LVRM1_0135_D01.bBP450587 
LVRM10135D12LVRM1_0135_D12.bBP451368 
LVRM10136E12LVRM1_0136_E12.bBP452154 
LVRM10137A08LVRM1_0137_A08.bBP448633 
LVRM10137A10LVRM1_0137_A10.bBP448774 
LVRM10137A12LVRM1_0137_A12.bBP448909 
LVRM10137B01LVRM1_0137_B01.bBP448970 
LVRM10137D08LVRM1_0137_D08.bBP451084 
LVRM10137G01LVRM1_0137_G01.bBP453020 
LVRM10137G02LVRM1_0137_G02.bBP453088 
LVRM10137G07LVRM1_0137_G07.bBP453430 
LVRM10137G09LVRM1_0137_G09.bBP453577 
LVRM10137G10LVRM1_0137_G10.bBP453648 
LVRM10137H03LVRM1_0137_H03.bBP453983 
LVRM10137H11LVRM1_0137_H11.bBP454557 
LVRM10138A11LVRM1_0138_A11.bBP448840 
LVRM10138B04LVRM1_0138_B04.bBP449168 
LVRM10138B07LVRM1_0138_B07.bBP449370 
LVRM10138D08LVRM1_0138_D08.bBP451085 
LVRM10138F11LVRM1_0138_F11.bBP452890 
LVRM10138G07LVRM1_0138_G07.bBP453431 
LVRM10138H01LVRM1_0138_H01.bBP453855 
LVRM10139B11LVRM1_0139_B11.bBP449646 
LVRM10139D07LVRM1_0139_D07.bBP451013 
LVRM10139E07LVRM1_0139_E07.bBP451830 
LVRM10140D10LVRM1_0140_D10.bBP451232 
LVRM10140E04LVRM1_0140_E04.bBP451627 
LVRM10140E09LVRM1_0140_E09.bBP451958 
LVRM10140G06LVRM1_0140_G06.bBP453361 
LVRM10140G07LVRM1_0140_G07.bBP453433 
LVRM10140H01LVRM1_0140_H01.bBP453857 
LVRM10140H04LVRM1_0140_H04.bBP454057 
LVRM10141B03LVRM1_0141_B03.bBP449107 
LVRM10141B09LVRM1_0141_B09.bBP449514 
LVRM10141B11LVRM1_0141_B11.bBP449648 
LVRM10141C08LVRM1_0141_C08.bBP450235 
LVRM10141D04LVRM1_0141_D04.bBP450797 
LVRM10141E04LVRM1_0141_E04.bBP451628 
LVRM10141E05LVRM1_0141_E05.bBP451695 
LVRM10141F03LVRM1_0141_F03.bBP452354 
LVRM10141F06LVRM1_0141_F06.bBP452552 
LVRM10141G09LVRM1_0141_G09.bBP453581 
LVRM10141H08LVRM1_0141_H08.bBP454344 
LVRM10141H09LVRM1_0141_H09.bBP454417 
LVRM10141H10LVRM1_0141_H10.bBP454487 
LVRM10142G07LVRM1_0142_G07.bBP453435 
LVRM10143A02LVRM1_0143_A02.bBP448235 
LVRM10143B03LVRM1_0143_B03.bBP449109 
LVRM10143B09LVRM1_0143_B09.bBP449516 
LVRM10143E07LVRM1_0143_E07.b  
LVRM10143G07LVRM1_0143_G07.bBP453436 
LVRM10143H12LVRM1_0143_H12.bBP454629 
LVRM10144A11LVRM1_0144_A11.bBP448846 
LVRM10144B07LVRM1_0144_B07.bBP449375 
LVRM10144D09LVRM1_0144_D09.bBP451162 
LVRM10144F09LVRM1_0144_F09.bBP452765 
LVRM10144G05LVRM1_0144_G05.bBP453292 
LVRM10144G09LVRM1_0144_G09.bBP453584 
LVRM10144H01LVRM1_0144_H01.bBP453861 
LVRM10144H06LVRM1_0144_H06.bBP454203 
LVRM10144H12LVRM1_0144_H12.bBP454630 
LVRM10145B03LVRM1_0145_B03.bBP449111 
LVRM10145D02LVRM1_0145_D02.bBP450665 
LVRM10145D11LVRM1_0145_D11.bBP451309 
LVRM10145E01LVRM1_0145_E01.bBP451438 
LVRM10145E10LVRM1_0145_E10.bBP452031 
LVRM10145F01LVRM1_0145_F01.bBP452228 
LVRM10145F10LVRM1_0145_F10.bBP452836 
LVRM10146A03LVRM1_0146_A03.bBP448307 
LVRM10146C02LVRM1_0146_C02.bBP449826 
LVRM10146C06LVRM1_0146_C06.bBP450098 
LVRM10146C08LVRM1_0146_C08.bBP450240 
LVRM10146F05LVRM1_0146_F05.bBP452489 
LVRM10146G05LVRM1_0146_G05.bBP453294 
LVRM10146H12LVRM1_0146_H12.bBP454632 
LVRM10147D10LVRM1_0147_D10.bBP451238 
LVRM10147E03LVRM1_0147_E03.bBP451569 
LVRM10147H06LVRM1_0147_H06.bBP454206 
LVRM10148A06LVRM1_0148_A06.bBP448510 
LVRM10148C04LVRM1_0148_C04.bBP449964 
LVRM10148D09LVRM1_0148_D09.bBP451166 
LVRM10148H08LVRM1_0148_H08.bBP454351 
LVRM10149B08LVRM1_0149_B08.bBP449451 
LVRM10149B09LVRM1_0149_B09.bBP449521 
LVRM10149C05LVRM1_0149_C05.bBP450033 
LVRM10149C08LVRM1_0149_C08.bBP450243 
LVRM10149C11LVRM1_0149_C11.bBP450461 
LVRM10149D03LVRM1_0149_D03.bBP450734 
LVRM10149F05LVRM1_0149_F05.bBP452492 
LVRM10149G04LVRM1_0149_G04.bBP453231 
LVRM10150A08LVRM1_0150_A08.bBP448645 
LVRM10150C09LVRM1_0150_C09.bBP450317 
LVRM10150D10LVRM1_0150_D10.bBP451241 
LVRM10150G07LVRM1_0150_G07.bBP453443 
LVRM10150G09LVRM1_0150_G09.bBP453590 
LVRM10151C12LVRM1_0151_C12.bBP450533 
LVRM10151E12LVRM1_0151_E12.bBP452167 
LVRM10151H06LVRM1_0151_H06.bBP454210 
LVRM10152A05LVRM1_0152_A05.bBP448446 
LVRM10152D05LVRM1_0152_D05.bBP450882 
LVRM10152D12LVRM1_0152_D12.bBP451383 
LVRM10152E01LVRM1_0152_E01.bBP451444 
LVRM10152E02LVRM1_0152_E02.bBP451509 
LVRM10152F05LVRM1_0152_F05.bBP452494 
LVRM10152G03LVRM1_0152_G03.bBP453164 
LVRM10152H08LVRM1_0152_H08.bBP454355 
LVRM10153B04LVRM1_0153_B04.bBP449183 
LVRM10153C09LVRM1_0153_C09.bBP450320 
LVRM10153E06LVRM1_0153_E06.bBP451777 
LVRM10153G05LVRM1_0153_G05.bBP453300 
LVRM10153H10LVRM1_0153_H10.bBP454499 
LVRM10154B04LVRM1_0154_B04.bBP449184 
LVRM10154B07LVRM1_0154_B07.bBP449382 
LVRM10154C05LVRM1_0154_C05.bBP450038 
LVRM10154D05LVRM1_0154_D05.bBP450884 
LVRM10154D09LVRM1_0154_D09.bBP451172 
LVRM10154E09LVRM1_0154_E09.bBP451972 
LVRM10154E10LVRM1_0154_E10.bBP452039 
LVRM10154H11LVRM1_0154_H11.bBP454573 
LVRM10155A10LVRM1_0155_A10.bBP448791 
LVRM10155A11LVRM1_0155_A11.bBP448856 
LVRM10155B10LVRM1_0155_B10.bBP449594 
LVRM10155C11LVRM1_0155_C11.bBP450466 
LVRM10155D06LVRM1_0155_D06.bBP450956 
LVRM10155E05LVRM1_0155_E05.bBP451707 
LVRM10155G10LVRM1_0155_G10.bBP453666 
LVRM10156H07LVRM1_0156_H07.bBP454287 
LVRM10157A07LVRM1_0157_A07.bBP448582 
LVRM10157C05LVRM1_0157_C05.bBP450041 
LVRM10157C07LVRM1_0157_C07.bBP450178 
LVRM10157E06LVRM1_0157_E06.bBP451781 
LVRM10157E08LVRM1_0157_E08.bBP451907 
LVRM10158A11LVRM1_0158_A11.bBP448859 
LVRM10158G10LVRM1_0158_G10.bBP453669 
LVRM10158H10LVRM1_0158_H10.bBP454504 
LVRM10159B04LVRM1_0159_B04.bBP449188 
LVRM10159B06LVRM1_0159_B06.bBP449319 
LVRM10159C09LVRM1_0159_C09.bBP450326 
LVRM10160F01LVRM1_0160_F01.bBP452235 
LVRM10160F08LVRM1_0160_F08.bBP452709 
LVRM10160F09LVRM1_0160_F09.bBP452779 
LVRM10160G02LVRM1_0160_G02.bBP453106 
LVRM10160H03LVRM1_0160_H03.bBP454004 
LVRM10160H05LVRM1_0160_H05.bBP454144 
LVRM10160H08LVRM1_0160_H08.bBP454362 
LVRM10160H12LVRM1_0160_H12.bBP454645 
LVRM10161A08LVRM1_0161_A08.bBP448653 
LVRM10161A09LVRM1_0161_A09.bBP448723 
LVRM10161B04LVRM1_0161_B04.bBP449190 
LVRM10161C06LVRM1_0161_C06.bBP450111 
LVRM10161C08LVRM1_0161_C08.bBP450255 
LVRM10161E11LVRM1_0161_E11.bBP452116 
LVRM10161G12LVRM1_0161_G12.bBP453811 
LVRM10162B04LVRM1_0162_B04.bBP449191 
LVRM10162B10LVRM1_0162_B10.bBP449600 
LVRM10162B12LVRM1_0162_B12.bBP449710 
LVRM10162C04LVRM1_0162_C04.bBP449976 
LVRM10162E01LVRM1_0162_E01.bBP451451 
LVRM10162H12LVRM1_0162_H12.bBP454647 
LVRM10163E08LVRM1_0163_E08.bCJ004107 
LVRM10163H04LVRM1_0163_H04.bCJ004133 
LVRM10164F01LVRM1_0164_F01.bCJ004193 
LVRM10164F09LVRM1_0164_F09.bBW963096 
LVRM10164F11LVRM1_0164_F11.bCJ004202 
LVRM10165E06LVRM1_0165_E06.bCJ004273 
LVRM10165F11LVRM1_0165_F11.bCJ004288 
LVRM10166B01LVRM1_0166_B01.bCJ004315 
LVRM10166E10LVRM1_0166_E10.bCJ004348 
LVRM10166F09LVRM1_0166_F09.bCJ004358 
LVRM10166H09LVRM1_0166_H09.bCJ004377 
LVRM10166H10LVRM1_0166_H10.bBW963109 
LVRM10166H12LVRM1_0166_H12.bCJ004379 
LVRM10167C03LVRM1_0167_C03.bCJ004399 
LVRM10167C07LVRM1_0167_C07.bCJ004402 
LVRM10167C11LVRM1_0167_C11.bCJ004405 
LVRM10167F12LVRM1_0167_F12.bBW963115 
LVRM10167G02LVRM1_0167_G02.bCJ004439 
LVRM10168A09LVRM1_0168_A09.bCJ004463 
LVRM10168D11LVRM1_0168_D11.bCJ004495 
LVRM10168H07LVRM1_0168_H07.bCJ004532 
LVRM10169C05LVRM1_0169_C05.bCJ004558 
LVRM10169D02LVRM1_0169_D02.bCJ004566 
LVRM10169D05LVRM1_0169_D05.bCJ004569 
LVRM10169F03LVRM1_0169_F03.bCJ004586 
LVRM10169F07LVRM1_0169_F07.bCJ004590 
LVRM10169G06LVRM1_0169_G06.bCJ004600 
LVRM10169G12LVRM1_0169_G12.bBW963132 
LVRM10170A01LVRM1_0170_A01.bCJ004616 
LVRM10170C02LVRM1_0170_C02.bCJ004638 
LVRM10171D03LVRM1_0171_D03.bCJ004730 
LVRM10171D08LVRM1_0171_D08.bCJ004734 
LVRM10173B03LVRM1_0173_B03.bCJ004867 
LVRM10173F05LVRM1_0173_F05.bCJ004912 
LVRM10175H11LVRM1_0175_H11.bCJ005076 
LVRM10176A11LVRM1_0176_A11.bCJ005086 
LVRM10177B08LVRM1_0177_B08.bCJ005181 
LVRM10178A01LVRM1_0178_A01.bCJ005234 
LVRM10178C08LVRM1_0178_C08.bCJ005263 
LVRM10178C11LVRM1_0178_C11.bCJ005266 
LVRM10178D02LVRM1_0178_D02.bCJ005269 
LVRM10178E04LVRM1_0178_E04.bCJ005282 
LVRM10178E05LVRM1_0178_E05.bCJ005283 
LVRM10178F07LVRM1_0178_F07.bBW963178 
LVRM10178F09LVRM1_0178_F09.bCJ005293 
LVRM10179F08LVRM1_0179_F08.bCJ005385 
LVRM10179F12LVRM1_0179_F12.bCJ005389 
LVRM10179H07LVRM1_0179_H07.bCJ005407 
LVRM10179H09LVRM1_0179_H09.bCJ005409 
LVRM10180C05LVRM1_0180_C05.bBW963182 
LVRM10180D12LVRM1_0180_D12.bCJ005455 
LVRM10180E01LVRM1_0180_E01.bBW963184 
LVRM10180H01LVRM1_0180_H01.bCJ005488 
LVRM10180H02LVRM1_0180_H02.bCJ005489 
LVRM10180H07LVRM1_0180_H07.bCJ005494 
LVRM10181C10LVRM1_0181_C10.bBW963188 
LVRM10181D02LVRM1_0181_D02.bCJ005528 
LVRM10181D08LVRM1_0181_D08.bCJ005533 
LVRM10181F12LVRM1_0181_F12.bCJ005559 
LVRM10182C02LVRM1_0182_C02.bCJ005603 
LVRM10182F11LVRM1_0182_F11.bCJ005645 
LVRM10182G09LVRM1_0182_G09.bCJ005655 
LVRM10182H01LVRM1_0182_H01.bCJ005659 
LVRM10182H07LVRM1_0182_H07.bCJ005665 
LVRM10183D09LVRM1_0183_D09.bCJ005696 
LVRM10183F09LVRM1_0183_F09.bBW963213 
LVRM10184A01LVRM1_0184_A01.bCJ005737 
LVRM10184H09LVRM1_0184_H09.bCJ005819 
LVRM10185A04LVRM1_0185_A04.bBW963220 
LVRM10185B06LVRM1_0185_B06.bCJ005839 
LVRM10185E08LVRM1_0185_E08.bCJ005874 
LVRM10185F02LVRM1_0185_F02.bCJ005880 
LVRM10185F07LVRM1_0185_F07.bCJ005884 
LVRM10185F10LVRM1_0185_F10.bCJ005887 
LVRM10185F12LVRM1_0185_F12.bCJ005889 
LVRM10185G02LVRM1_0185_G02.bCJ005891 
LVRM10185H10LVRM1_0185_H10.bCJ005909 
LVRM10186A11LVRM1_0186_A11.bCJ005922 
LVRM10186B01LVRM1_0186_B01.bCJ005924 
LVRM10186B04LVRM1_0186_B04.bCJ005925 
LVRM10186C01LVRM1_0186_C01.bCJ005933 
LVRM10186C03LVRM1_0186_C03.bCJ005935 
LVRM10186D01LVRM1_0186_D01.bCJ005945 
LVRM10186H10LVRM1_0186_H10.bCJ005996 
LVRM10187E02LVRM1_0187_E02.bCJ006043 
LVRM10187F03LVRM1_0187_F03.bCJ006055 
LVRM10187G07LVRM1_0187_G07.bCJ006071 
LVRM10188B06LVRM1_0188_B06.bCJ006098 
LVRM10188F03LVRM1_0188_F03.bCJ006138 
LVRM10189E12LVRM1_0189_E12.bCJ006219 
LVRM10189G11LVRM1_0189_G11.bCJ006240 
LVRM10189H07LVRM1_0189_H07.bCJ006246 
LVRM10191F12LVRM1_0191_F12.bCJ006311 
LVRM10192A02LVRM1_0192_A02.bCJ006329 
LVRM10192F02LVRM1_0192_F02.bCJ006376 
LVRM10192H04LVRM1_0192_H04.bBW963264 
LVRM10192H12LVRM1_0192_H12.bCJ006406 
LVRM10193C10LVRM1_0193_C10.bBW963274 
LVRM10193D08LVRM1_0193_D08.bCJ006436 
LVRM10193G02LVRM1_0193_G02.bCJ006456 
LVRM10193G07LVRM1_0193_G07.bCJ006458 
LVRM10194B05LVRM1_0194_B05.bCJ006484 
LVRM10194E07LVRM1_0194_E07.bCJ006520 
LVRM10194F07LVRM1_0194_F07.bCJ006531 
LVRM10194H03LVRM1_0194_H03.bBW963294 
LVRM10195E04LVRM1_0195_E04.bCJ006601 
LVRM10195E11LVRM1_0195_E11.bCJ006607 
LVRM10195H10LVRM1_0195_H10.bCJ006641 
LVRM10196A05LVRM1_0196_A05.bCJ006647 
LVRM10196B04LVRM1_0196_B04.bCJ006656 
LVRM10196E11LVRM1_0196_E11.bCJ006692 
LVRM10196H06LVRM1_0196_H06.bCJ006717 
LVRM10197E08LVRM1_0197_E08.bCJ006773 
LVRM10198A05LVRM1_0198_A05.bCJ006817 
LVRM10198B12LVRM1_0198_B12.bBW963303 
LVRM10198C01LVRM1_0198_C01.bCJ006834 
LVRM10198D04LVRM1_0198_D04.bCJ006848 
LVRM10198G04LVRM1_0198_G04.bCJ006881 
LVRM10199C01LVRM1_0199_C01.bCJ006923 
LVRM10199H09LVRM1_0199_H09.bCJ006981 
LVRM10199H10LVRM1_0199_H10.bCJ006982 
LVRM10200B07LVRM1_0200_B07.bCJ006998 
LVRM10200C04LVRM1_0200_C04.bCJ007004 
LVRM10200E05LVRM1_0200_E05.bBW963325 
LVRM10201B05LVRM1_0201_B05.bCJ007069 
LVRM10201B08LVRM1_0201_B08.bCJ007072 
LVRM10201E06LVRM1_0201_E06.bCJ007104 
LVRM10201F12LVRM1_0201_F12.bCJ007121 
LVRM10202D04LVRM1_0202_D04.bCJ007178 
LVRM10202E10LVRM1_0202_E10.bCJ007192 
LVRM10202F04LVRM1_0202_F04.bCJ007198 
LVRM10202F11LVRM1_0202_F11.bCJ007205 
LVRM10202F12LVRM1_0202_F12.bBW963335 
LVRM10202H07LVRM1_0202_H07.bCJ007220 
LVRM10203A02LVRM1_0203_A02.bCJ007227 
LVRM10203C05LVRM1_0203_C05.bCJ007252 
LVRM10203D07LVRM1_0203_D07.bCJ007263 
LVRM10203F07LVRM1_0203_F07.bCJ007284 
LVRM10204F05LVRM1_0204_F05.bCJ007365 
LVRM10204G09LVRM1_0204_G09.bCJ007377 
LVRM10204H04LVRM1_0204_H04.bCJ007383 
LVRM10205A05LVRM1_0205_A05.bCJ007394 
LVRM10205B01LVRM1_0205_B01.bCJ007401 
LVRM10205E12LVRM1_0205_E12.bCJ007442 
LVRM10206C07LVRM1_0206_C07.bCJ007494 
LVRM10206D09LVRM1_0206_D09.bCJ007508 
LVRM10206G01LVRM1_0206_G01.bCJ007533 
LVRM10207B06LVRM1_0207_B06.bCJ007569 
LVRM10207D05LVRM1_0207_D05.bCJ007591 
LVRM10207E05LVRM1_0207_E05.bCJ007602 
LVRM10207F07LVRM1_0207_F07.bCJ007615 
LVRM10207F08LVRM1_0207_F08.bCJ007616 
LVRM10207F11LVRM1_0207_F11.bCJ007618 
LVRM10207G07LVRM1_0207_G07.bCJ007626 
LVRM10207H10LVRM1_0207_H10.bCJ007639 
LVRM10208A09LVRM1_0208_A09.bCJ007649 
LVRM10208D05LVRM1_0208_D05.bCJ007680 
LVRM10208G05LVRM1_0208_G05.bCJ007714 
OVRM10007A04OVRM1_0007_A04.bBP145152 
OVRM10007B06OVRM1_0007_B06.bBP146656 
OVRM10060E06OVRM1_0060_E06.bBP150435 

  

SNPs: 9      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
86A3900.042WNCAC/H
G128760.958CGC/R
147C01370.148MSGGC/G
G527390.852GGG/G
174C05170.555MNAGC/S
G533620.445AGG/R
225C4000.043WNAAC/N
G128840.957AAG/K
502C536290.853MNCCC/P
T01180.147TCC/S
581A2600.035BNCAA/Q
G07140.965CGA/R
813A3110.368WNCAA/Q
C2400.632CAC/H
827A060.250MNAAG/K
G1710.750AGG/R
939C020.333MSGCC/A
G040.667GCG/A


Alignment:      TOP

20110601C-000820 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0027_H06.b : gagaaagaanaaaaaacgaaaaacaaacgaaacaaaaaccggga
LVRM1_0092_F07.b :
LVRM1_0198_B12.b :
LVRM1_0024_B10.b :
LVRM1_0068_B07.b :
LVRM1_0115_C08.b :
LVRM1_0178_E05.b :
LVRM1_0034_G12.b :
LVRM1_0023_H02.b :
LVRM1_0105_B06.b :
LVRM1_0039_E12.b :
LVRM1_0094_F04.b :
LVRM1_0186_B04.b :
LVRM1_0083_D02.b :
LVRM1_0162_H12.b :
LVRM1_0068_H10.b :
LVRM1_0148_D09.b :
LVRM1_0143_H12.b :
LVRM1_0026_G02.b : cgacggggaccggaggggcccggggccgaaaaccgcccgcncgacagggcaatcgga
LVRM1_0022_D12.b :
LVRM1_0096_G12.b :
LVRM1_0080_B03.b :
LVRM1_0020_G03.b :
LVRM1_0020_B04.b :
LVRM1_0194_E07.b :
LVRM1_0025_D04.b :
LVRM1_0167_G02.b :
LVRM1_0049_G01.b :
LVRM1_0053_D01.b :
LVRM1_0074_G06.b :
LVRM1_0057_F06.b :
LVRM1_0154_B04.b :
LVRM1_0071_A06.b :
LVRM1_0129_F01.b :
LVRM1_0124_C10.b :
LVRM1_0126_D09.b :
LVRM1_0145_F01.b :
LVRM1_0144_F09.b :
LVRM1_0052_E09.b :
LVR01_0090_E11.b : gcxxxxxxxxxx
LVRM1_0180_H01.b :
LVRM1_0024_G07.b :
LVRM1_0024_H03.b :
LVRM1_0090_E09.b :
LVRM1_0171_D03.b :
LVRM1_0207_G07.b :
LVRM1_0178_F09.b :
LVRM1_0107_D05.b :
LVRM1_0135_D01.b :
LVRM1_0035_C03.b :
LVRM1_0160_F01.b :
LVRM1_0066_F08.b :
LVRM1_0054_D10.b :
LVRM1_0143_A02.b :
LVRM1_0032_F12.b :
LVRM1_0120_H04.b :
LVRM1_0155_B10.b :
OVRM1_0007_A04.b :
LVRM1_0095_G06.b :
LVRM1_0047_B05.b :
LVRM1_0096_C09.b :
LVRM1_0032_D02.b :
LVRM1_0027_A01.b :
LVRM1_0018_A12.b : c
LVRM1_0206_G01.b :
LVRM1_0045_A08.b :
LVRM1_0070_H04.b :
LVRM1_0076_D03.b :
LVRM1_0181_D02.b :
LVRM1_0082_F09.b :
LVRM1_0047_F03.b :
LVRM1_0045_F12.b :
LVRM1_0122_A01.b :
LVRM1_0092_A09.b :
LVRM1_0178_A01.b :
LVRM1_0169_D02.b :
LVRM1_0196_E11.b :
LVRM1_0105_A04.b :
LVRM1_0084_D02.b :
LVRM1_0178_C11.b :
LVRM1_0116_C03.b :
LVRM1_0111_G09.b :
LVRM1_0200_C04.b :
LVRM1_0149_C05.b :
LVRM1_0133_H04.b :
LVRM1_0049_H07.b : nagttgtcxxxx
LVRM1_0124_F09.b :
LVRM1_0102_F04.b :
LVRM1_0189_E12.b :
LVRM1_0084_E12.b :
LVRM1_0036_G07.b :
LVRM1_0114_F01.b :
LVRM1_0073_G01.b :
LVRM1_0153_E06.b :
LVRM1_0021_A08.b :
LVRM1_0151_C12.b :
LVRM1_0116_F10.b :
LVRM1_0128_F08.b :
LVRM1_0141_B03.b :
LVRM1_0102_D05.b :
LVRM1_0080_D04.b :
LVRM1_0015_F01.b :
LVRM1_0003_D05.b :
LVRM1_0108_H06.b :
LVRM1_0049_B05.b :
LVRM1_0031_E11.b :
LVRM1_0157_C07.b :
LVRM1_0112_A07.b :
LVRM1_0141_C08.b :
LVRM1_0019_D02.b :
LVRM1_0051_B11.b :
LVRM1_0144_G09.b :
LVRM1_0159_B06.b :
LVRM1_0140_G07.b :
LVRM1_0144_D09.b :
LVR01_0043_F05.b : ccttt
LVR01_0092_D07.b : gcattatx
LVR01_0022_A01.b : ggcxxxx
LVR01_0072_G08.b : ggctxxxxx
LVR01_0102_C04.b : c
LVR01_0008_D10.b : catt
LVR01_0090_E05.b : cxxxxxxx
LVRM1_0065_D11.b :
LVRM1_0163_H04.b :
LVRM1_0185_H10.b :
LVRM1_0084_A03.b :
LVRM1_0042_E05.b :
LVRM1_0026_F01.b :
LVRM1_0183_D09.b :
LVRM1_0125_C03.b :
LVRM1_0188_B06.b :
LVRM1_0012_B05.b :
LVRM1_0064_H07.b :
LVRM1_0173_F05.b :
LVRM1_0095_D09.b :
LVRM1_0195_H10.b :
LVRM1_0167_C07.b :
LVRM1_0095_A10.b :
LVRM1_0167_C03.b :
LVRM1_0012_A09.b :
LVRM1_0179_H09.b :
LVRM1_0130_H02.b :
LVRM1_0184_A01.b :
LVRM1_0129_C01.b :
LVRM1_0182_C02.b :
LVRM1_0181_C10.b :
LVRM1_0073_A03.b :
LVRM1_0086_C01.b :
LVRM1_0108_G01.b :
LVRM1_0192_A02.b :
LVRM1_0169_G12.b :
LVRM1_0021_B10.b :
LVRM1_0134_B04.b :
LVRM1_0095_G08.b :
LVRM1_0087_E01.b :
LVRM1_0146_C06.b :
LVRM1_0096_C06.b :
LVRM1_0107_C03.b :
LVRM1_0066_F02.b :
LVRM1_0021_C06.b :
LVRM1_0119_H02.b :
LVRM1_0162_C04.b :
LVRM1_0017_H12.b :
LVRM1_0108_C03.b :
LVRM1_0062_B06.b :
LVRM1_0091_H05.b :
LVRM1_0054_B03.b :
LVRM1_0067_B07.b :
LVRM1_0169_C05.b :
LVRM1_0093_E10.b :
LVRM1_0171_D08.b :
LVRM1_0187_G07.b :
LVRM1_0178_F07.b :
LVRM1_0134_C11.b :
LVRM1_0167_C11.b :
LVRM1_0194_B05.b :
LVRM1_0093_A03.b :
LVRM1_0185_F07.b :
LVRM1_0119_D02.b :
LVRM1_0017_F04.b :
LVRM1_0053_B03.b :
LVRM1_0004_A03.b :
LVRM1_0169_G06.b :
LVRM1_0166_E10.b :
LVRM1_0041_C11.b :
LVRM1_0017_F03.b :
LVRM1_0045_A01.b :
LVRM1_0088_G04.b :
LVRM1_0092_B09.b :
LVRM1_0145_B03.b :
LVRM1_0099_A02.b :
LVRM1_0047_B04.b :
LVRM1_0164_F01.b :
LVRM1_0183_F09.b :
LVRM1_0066_H10.b :
LVRM1_0120_F02.b :
LVRM1_0064_H11.b :
LVRM1_0042_E10.b :
LVRM1_0090_D04.b :
LVRM1_0021_B03.b :
LVRM1_0119_A10.b :
LVRM1_0175_H11.b :
LVRM1_0062_H05.b :
LVRM1_0112_G03.b :
LVRM1_0178_D02.b :
LVRM1_0093_B11.b :
LVRM1_0071_C05.b :
LVRM1_0186_A11.b :
LVRM1_0126_C11.b :
LVRM1_0182_G09.b :
LVRM1_0005_C08.b :
LVRM1_0010_H04.b :
LVRM1_0007_F10.b :
LVRM1_0064_B11.b :
LVRM1_0048_H08.b :
LVRM1_0087_G03.b :
LVRM1_0090_C01.b :
LVRM1_0161_B04.b :
LVRM1_0023_H05.b :
LVRM1_0052_A03.b :
LVRM1_0189_H07.b :
LVRM1_0069_C04.b :
LVRM1_0181_D08.b :
LVRM1_0166_F09.b :
LVRM1_0066_F11.b :
LVRM1_0146_A03.b :
LVRM1_0067_D06.b :
LVRM1_0166_H12.b :
LVRM1_0129_E10.b :
LVRM1_0170_A01.b :
LVRM1_0186_C01.b :
LVRM1_0135_D12.b :
LVRM1_0020_D01.b :
LVRM1_0093_G11.b :
LVRM1_0202_E10.b :
LVRM1_0104_D02.b :
LVRM1_0152_G03.b :
LVRM1_0168_H07.b :
LVRM1_0094_G03.b :
LVRM1_0176_A11.b :
LVRM1_0027_A05.b :
LVRM1_0076_C09.b :
LVRM1_0085_C08.b :
LVRM1_0084_A11.b :
LVRM1_0063_C10.b :
LVRM1_0195_E04.b :
LVRM1_0072_F02.b :
LVRM1_0081_H04.b :
LVRM1_0085_E01.b :
LVRM1_0107_A05.b :
LVRM1_0152_F05.b :
LVRM1_0024_H01.b :
LVRM1_0187_E02.b :
LVRM1_0203_A02.b :
LVRM1_0076_B09.b :
LVRM1_0166_H10.b :
LVRM1_0020_D07.b :
LVRM1_0182_H01.b :
LVRM1_0208_G05.b :
LVRM1_0064_H06.b :
LVRM1_0133_E02.b :
LVRM1_0180_E01.b :
LVRM1_0186_B01.b :
LVRM1_0186_C03.b :
LVRM1_0186_D01.b :
LVRM1_0204_H04.b :
LVRM1_0058_A08.b :
LVRM1_0058_C06.b :
LVRM1_0118_F07.b :
LVRM1_0048_A01.b :
LVRM1_0207_E05.b :
LVRM1_0057_G03.b :
LVRM1_0122_H04.b :
LVRM1_0054_A09.b :
LVRM1_0178_E04.b :
LVRM1_0198_D04.b :
LVRM1_0052_E02.b :
LVRM1_0051_A01.b :
LVRM1_0187_F03.b :
LVRM1_0185_F02.b :
LVRM1_0194_H03.b :
LVRM1_0185_F12.b :
LVRM1_0124_A03.b :
LVRM1_0147_E03.b :
LVRM1_0024_E03.b :
LVRM1_0185_A04.b :
LVRM1_0173_B03.b :
LVRM1_0185_E08.b :
LVRM1_0122_E01.b :
LVRM1_0189_G11.b :
LVRM1_0198_A05.b :
LVRM1_0056_F07.b :
LVRM1_0185_G02.b :
LVRM1_0162_B04.b :
LVRM1_0128_B04.b :
LVRM1_0055_C02.b :
LVRM1_0180_C05.b :
LVRM1_0082_D07.b :
LVRM1_0205_A05.b :
LVRM1_0134_A06.b :
LVRM1_0075_E03.b :
LVRM1_0185_B06.b :
LVRM1_0203_C05.b :
LVRM1_0070_C01.b :
LVRM1_0103_G04.b :
LVRM1_0112_B08.b :
LVRM1_0159_B04.b :
LVRM1_0118_B04.b :
LVRM1_0198_C01.b :
LVRM1_0193_G07.b :
LVRM1_0208_D05.b :
LVRM1_0008_A05.b :
LVRM1_0107_F12.b :
LVRM1_0118_B03.b :
LVRM1_0027_F10.b :
LVRM1_0103_D04.b :
LVRM1_0116_B04.b :
LVRM1_0093_E02.b :
LVRM1_0196_B04.b :
LVRM1_0090_E07.b :
LVRM1_0091_E11.b :
LVRM1_0203_D07.b :
LVRM1_0047_A02.b :
LVRM1_0192_H04.b :
LVRM1_0182_H07.b :
LVRM1_0043_C12.b :
LVRM1_0204_F05.b :
LVRM1_0207_B06.b :
LVRM1_0038_H02.b :
LVRM1_0145_E01.b :
LVRM1_0026_A07.b :
LVRM1_0041_D01.b :
LVRM1_0118_E04.b :
LVRM1_0169_F03.b :
LVRM1_0167_F12.b :
LVRM1_0196_A05.b :
LVRM1_0201_B08.b :
LVRM1_0145_D02.b :
LVRM1_0049_H06.b :
LVRM1_0200_E05.b :
LVRM1_0056_E10.b :
LVRM1_0047_C01.b :
LVRM1_0090_A03.b :
LVRM1_0179_H07.b :
LVRM1_0197_E08.b :
LVRM1_0163_E08.b :
LVRM1_0040_H02.b :
LVRM1_0107_B01.b :
LVRM1_0024_B04.b :
LVRM1_0086_D07.b :
LVRM1_0047_A12.b :
LVRM1_0202_H07.b :
LVRM1_0201_E06.b :
LVRM1_0039_H02.b :
LVRM1_0116_D07.b :
LVRM1_0162_E01.b :
LVRM1_0115_D04.b :
LVRM1_0105_A05.b :
LVRM1_0028_B04.b :
LVRM1_0125_A08.b :
LVRM1_0166_B01.b :
LVRM1_0116_F08.b :
LVRM1_0193_D08.b :
LVRM1_0195_E11.b :
LVRM1_0202_F04.b :
LVRM1_0067_F05.b :
LVRM1_0126_H12.b :
LVRM1_0127_E02.b :
LVRM1_0165_E06.b :
LVRM1_0050_C01.b :
LVRM1_0127_C05.b :
LVRM1_0037_F06.b :
LVRM1_0098_B11.b :
LVRM1_0104_B07.b :
LVRM1_0074_C03.b :
LVRM1_0075_E04.b :
LVRM1_0091_E03.b :
LVRM1_0178_C08.b :
LVRM1_0075_B01.b :
LVRM1_0202_F12.b :
LVRM1_0069_G05.b :
LVRM1_0112_F12.b :
LVRM1_0146_H12.b :
LVRM1_0108_G04.b :
LVRM1_0026_A09.b :
LVRM1_0056_A05.b :
LVRM1_0169_D05.b :
LVRM1_0086_B11.b :
LVRM1_0196_H06.b :
LVRM1_0073_B05.b :
LVRM1_0201_B05.b :
LVRM1_0067_A03.b :
LVRM1_0072_A05.b :
LVRM1_0152_E01.b :
LVRM1_0021_B06.b :
LVRM1_0026_G10.b :
LVRM1_0075_G06.b :
LVRM1_0207_D05.b :
LVRM1_0065_C06.b :
LVRM1_0112_B02.b :
LVRM1_0123_F02.b :
LVRM1_0127_F05.b :
LVRM1_0145_D11.b :
LVRM1_0004_C05.b :
LVRM1_0055_D07.b :
LVRM1_0117_C04.b :
LVRM1_0200_B07.b :
LVRM1_0018_F07.b :
LVRM1_0202_D04.b :
LVRM1_0133_G06.b :
LVRM1_0035_E02.b :
LVRM1_0072_D11.b :
LVRM1_0072_H11.b :
LVRM1_0157_C05.b :
LVRM1_0034_E01.b :
LVRM1_0040_B06.b :
LVRM1_0098_B08.b :
LVRM1_0101_H10.b :
LVRM1_0047_D02.b :
LVRM1_0106_D01.b :
LVRM1_0040_C08.b :
LVRM1_0116_G03.b :
LVRM1_0194_F07.b :
LVRM1_0027_C08.b :
LVRM1_0206_C07.b :
LVRM1_0097_F06.b :
LVRM1_0128_F11.b :
LVRM1_0162_B12.b :
LVRM1_0041_G07.b :
LVRM1_0102_F12.b :
LVRM1_0116_B05.b :
LVRM1_0074_F08.b :
LVRM1_0184_H09.b :
LVRM1_0166_H09.b :
LVRM1_0009_H06.b :
LVRM1_0148_A06.b :
LVRM1_0035_F04.b :
LVRM1_0038_F10.b :
LVRM1_0105_A07.b :
LVRM1_0127_D06.b :
LVRM1_0149_D03.b :
LVRM1_0077_A04.b :
LVRM1_0007_H06.b :
LVRM1_0164_F09.b :
LVRM1_0039_H06.b :
LVRM1_0201_F12.b :
LVRM1_0007_E11.b :
LVRM1_0036_D04.b :
LVRM1_0070_E04.b :
LVRM1_0072_A12.b :
LVRM1_0160_F09.b :
LVRM1_0024_F08.b :
LVRM1_0037_B10.b :
LVRM1_0181_F12.b :
LVRM1_0186_H10.b :
LVRM1_0058_A10.b :
LVRM1_0108_E04.b :
LVRM1_0050_D11.b :
LVRM1_0026_D10.b :
LVRM1_0047_E06.b :
LVRM1_0169_F07.b :
LVRM1_0179_F12.b :
LVRM1_0068_D07.b :
LVRM1_0111_D11.b :
LVRM1_0035_D02.b :
LVRM1_0049_H04.b :
LVRM1_0056_A08.b :
LVRM1_0152_E02.b :
LVRM1_0056_H02.b :
LVRM1_0078_C04.b :
LVRM1_0192_H12.b :
LVRM1_0034_B02.b :
LVRM1_0123_B08.b :
LVRM1_0158_H10.b :
LVRM1_0026_H12.b :
LVRM1_0074_B02.b :
LVRM1_0207_H10.b :
LVRM1_0070_D08.b :
LVRM1_0003_B04.b :
LVRM1_0004_B02.b :
LVRM1_0026_C11.b :
LVRM1_0116_D05.b :
LVRM1_0092_D09.b :
LVRM1_0165_F11.b :
LVRM1_0168_D11.b :
LVRM1_0204_G09.b :
LVRM1_0106_G05.b :
LVRM1_0121_F09.b :
LVRM1_0047_D05.b :
LVRM1_0092_C10.b :
LVRM1_0009_D05.b :
LVRM1_0112_H03.b :
LVRM1_0034_F04.b :
LVRM1_0003_H02.b :
LVRM1_0141_F03.b :
LVRM1_0153_B04.b :
LVRM1_0206_D09.b :
LVRM1_0047_D12.b :
LVRM1_0208_A09.b :
LVRM1_0035_E03.b :
LVRM1_0097_H12.b :
LVRM1_0098_D01.b :
LVRM1_0101_G05.b :
LVRM1_0152_D12.b :
LVRM1_0056_A10.b :
LVRM1_0137_A10.b :
LVRM1_0075_C07.b :
LVRM1_0191_F12.b :
LVRM1_0004_H05.b :
LVRM1_0203_F07.b :
LVRM1_0021_D04.b :
LVRM1_0034_D01.b :
LVRM1_0037_F10.b :
LVRM1_0039_F08.b :
LVRM1_0069_D08.b :
LVRM1_0072_B08.b :
LVRM1_0113_F03.b :
LVRM1_0122_H07.b :
LVRM1_0003_B03.b :
LVRM1_0073_H02.b :
LVRM1_0082_E12.b :
LVRM1_0182_F11.b :
LVRM1_0118_B09.b :
LVRM1_0160_H03.b :
LVRM1_0035_A06.b :
LVRM1_0036_H07.b :
LVRM1_0109_H09.b :
LVRM1_0146_C02.b :
LVRM1_0075_D05.b :
LVRM1_0075_H05.b :
LVRM1_0103_C11.b :
LVRM1_0049_D06.b :
LVRM1_0106_G08.b :
LVRM1_0109_D01.b :
LVRM1_0161_A09.b :
LVRM1_0205_E12.b :
LVRM1_0207_F08.b :
LVRM1_0028_B10.b :
LVRM1_0078_F03.b :
LVRM1_0115_B11.b :
LVRM1_0116_F11.b :
LVRM1_0202_F11.b :
LVRM1_0038_D11.b :
LVRM1_0054_F01.b :
LVRM1_0180_D12.b :
LVRM1_0207_F07.b :
LVRM1_0036_A12.b :
LVRM1_0071_E06.b :
LVRM1_0149_B08.b :
LVRM1_0199_H10.b :
LVRM1_0056_H07.b :
LVRM1_0017_D08.b :
LVRM1_0207_F11.b :
LVRM1_0114_F05.b :
LVRM1_0034_A08.b :
LVRM1_0118_F11.b :
LVRM1_0155_E05.b :
LVRM1_0116_C11.b :
LVRM1_0088_F07.b :
LVRM1_0009_E07.b :
LVRM1_0032_C03.b :
LVRM1_0054_F04.b :
LVRM1_0114_H09.b :
LVRM1_0034_D07.b :
LVRM1_0117_G09.b :
LVRM1_0161_C06.b :
LVRM1_0029_B03.b :
LVRM1_0035_A12.b :
LVRM1_0073_H08.b :
LVRM1_0103_F08.b :
LVRM1_0193_C10.b :
LVRM1_0034_E07.b :
LVRM1_0031_C03.b :
LVRM1_0039_D08.b :
LVRM1_0055_H01.b :
LVRM1_0199_H09.b :
LVRM1_0117_H12.b :
LVRM1_0033_B05.b :
LVRM1_0035_B10.b :
LVRM1_0101_D09.b :
LVRM1_0130_H10.b :
LVRM1_0029_F03.b :
LVRM1_0154_C05.b :
LVRM1_0031_H01.b :
LVRM1_0035_G12.b :
LVRM1_0111_E09.b :
LVRM1_0137_B01.b :
LVRM1_0140_H01.b :
LVRM1_0004_B06.b :
LVRM1_0023_F12.b :
LVRM1_0075_G09.b :
LVRM1_0079_F01.b :
LVRM1_0164_F11.b :
LVRM1_0029_E02.b :
LVRM1_0037_B09.b :
LVRM1_0151_H06.b :
LVRM1_0033_D06.b :
LVRM1_0034_G10.b :
LVRM1_0149_B09.b :
LVRM1_0077_E10.b :
LVRM1_0077_F06.b :
LVRM1_0008_C08.b :
LVRM1_0113_E09.b :
LVRM1_0112_F09.b :
LVRM1_0122_H06.b :
LVRM1_0057_F05.b :
LVRM1_0103_D09.b :
LVRM1_0035_F08.b :
LVRM1_0073_B09.b :
LVRM1_0007_B09.b :
LVRM1_0007_H12.b :
LVRM1_0158_G10.b :
LVRM1_0031_C05.b :
LVRM1_0035_A10.b :
LVRM1_0054_D09.b :
LVRM1_0143_B03.b :
LVRM1_0120_B03.b :
LVRM1_0031_A09.b :
LVRM1_0109_D08.b :
LVRM1_0017_D06.b :
OVRM1_0007_B06.b :
LVRM1_0009_C08.b :
LVRM1_0057_G02.b :
LVRM1_0133_G05.b :
LVRM1_0141_E04.b :
LVRM1_0159_C09.b :
LVRM1_0078_A10.b :
LVRM1_0080_B06.b :
LVRM1_0005_A04.b :
LVRM1_0124_D07.b :
LVRM1_0022_B04.b :
LVRM1_0075_G11.b :
LVRM1_0078_C05.b :
LVRM1_0137_G01.b :
LVRM1_0056_D10.b :
LVRM1_0154_D05.b :
LVRM1_0078_G07.b :
LVRM1_0126_E06.b :
LVRM1_0137_H03.b :
LVRM1_0140_E04.b :
LVRM1_0144_H01.b :
LVRM1_0157_A07.b :
LVRM1_0105_D09.b :
LVRM1_0155_A11.b :
LVRM1_0017_E07.b :
LVRM1_0036_C11.b :
LVRM1_0123_A05.b :
LVRM1_0138_B04.b :
LVRM1_0155_A10.b :
LVRM1_0156_H07.b :
LVRM1_0067_D12.b :
LVRM1_0035_E11.b :
LVRM1_0050_D09.b :
LVRM1_0057_C08.b :
LVRM1_0101_H01.b :
LVRM1_0145_E10.b :
LVRM1_0161_C08.b :
LVRM1_0063_G04.b :
LVRM1_0158_A11.b :
LVRM1_0141_D04.b :
LVRM1_0072_F07.b :
LVRM1_0075_D12.b :
LVRM1_0141_E05.b :
LVRM1_0030_F02.b :
LVRM1_0160_G02.b :
LVRM1_0004_C06.b :
LVRM1_0144_H06.b :
LVRM1_0012_E07.b :
LVRM1_0017_F08.b :
LVRM1_0157_E06.b :
LVRM1_0034_D11.b :
LVRM1_0137_A08.b :
LVRM1_0138_H01.b :
LVRM1_0153_C09.b :
LVRM1_0149_C11.b :
LVRM1_0030_F08.b :
LVRM1_0031_H05.b :
LVRM1_0149_F05.b :
LVRM1_0078_G06.b :
LVRM1_0154_E10.b :
LVRM1_0120_H02.b :
LVRM1_0140_G06.b :
LVRM1_0139_D07.b :
LVRM1_0150_C09.b :
LVRM1_0077_F09.b :
LVRM1_0124_G12.b :
LVRM1_0152_A05.b :
LVRM1_0019_C03.b :
LVRM1_0019_E01.b :
LVRM1_0141_F06.b :
LVRM1_0144_G05.b :
LVRM1_0154_E09.b :
LVRM1_0155_C11.b :
LVRM1_0033_C11.b :
LVRM1_0139_E07.b :
LVRM1_0079_C08.b :
LVRM1_0126_G11.b :
LVRM1_0140_H04.b :
LVRM1_0031_A11.b :
LVRM1_0049_A11.b :
LVRM1_0144_B07.b :
LVRM1_0150_G09.b :
LVRM1_0019_C01.b :
LVRM1_0022_C02.b :
LVRM1_0074_D12.b :
LVRM1_0063_A05.b :
LVRM1_0029_G08.b :
LVRM1_0072_B11.b :
LVRM1_0050_G09.b :
LVRM1_0143_E07.b :
LVRM1_0146_F05.b :
LVRM1_0031_G08.b :
LVRM1_0078_D08.b :
LVRM1_0018_F10.b :
LVRM1_0120_G03.b :
LVRM1_0154_H11.b :
LVRM1_0107_G12.b :
LVRM1_0141_H08.b :
LVRM1_0104_G11.b :
LVRM1_0144_A11.b :
LVRM1_0161_E11.b :
LVRM1_0018_H10.b :
LVRM1_0002_A04.b :
LVRM1_0125_F10.b :
LVRM1_0055_B06.b :
LVRM1_0128_H08.b :
LVRM1_0137_D08.b :
LVRM1_0077_H07.b :
LVRM1_0137_A12.b :
LVRM1_0137_G07.b :
LVRM1_0113_G10.b :
LVRM1_0162_B10.b :
LVRM1_0160_H08.b :
LVRM1_0029_G09.b :
LVRM1_0029_C09.b :
LVRM1_0161_G12.b :
LVRM1_0022_B09.b :
LVRM1_0155_G10.b :
LVRM1_0005_C05.b :
LVRM1_0110_D10.b :
LVRM1_0152_D05.b :
LVRM1_0031_F10.b :
LVRM1_0113_H05.b :
LVRM1_0142_G07.b :
LVRM1_0160_F08.b :
LVRM1_0002_A06.b :
LVRM1_0078_C12.b :
LVRM1_0127_B10.b :
LVRM1_0137_G09.b :
LVRM1_0150_A08.b :
LVRM1_0049_G06.b :
LVRM1_0143_G07.b :
LVRM1_0147_D10.b :
LVRM1_0148_H08.b :
LVRM1_0154_D09.b :
LVRM1_0160_H05.b :
LVRM1_0030_E09.b :
LVRM1_0143_B09.b :
LVRM1_0126_D10.b :
LVRM1_0150_G07.b :
LVRM1_0138_B07.b :
LVRM1_0079_C10.b :
LVRM1_0141_G09.b :
LVRM1_0010_A05.b :
LVRM1_0107_B10.b :
LVRM1_0119_C10.b :
LVRM1_0145_F10.b :
LVRM1_0144_H12.b :
LVRM1_0138_A11.b :
LVRM1_0120_E09.b :
LVRM1_0150_D10.b :
LVRM1_0015_D12.b :
LVRM1_0141_B11.b :
LVRM1_0138_G07.b :
LVRM1_0149_C08.b :
LVRM1_0141_H10.b :
LVRM1_0023_C02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0139_B11.b :
LVRM1_0140_E09.b :
LVRM1_0137_G10.b :
LVRM1_0031_H10.b :
LVRM1_0031_D12.b :
LVRM1_0120_D10.b :
LVRM1_0138_F11.b :
LVRM1_0137_H11.b :
LVRM1_0157_E08.b :
LVRM1_0161_A08.b :
LVRM1_0146_C08.b :
LVRM1_0120_C10.b :
LVRM1_0001_F03.b :
LVRM1_0140_D10.b :
LVRM1_0002_F04.b :
LVRM1_0128_E08.b :
LVRM1_0030_G12.b :
LVRM1_0063_H07.b :
LVRM1_0064_D05.b :
LVRM1_0002_E08.b :
LVRM1_0006_H09.b :
LVRM1_0001_G07.b :
LVR01_0041_E06.b : ctttttg
LVRM1_0002_C10.b :
LVR01_0025_H07.b : xxxx
LVR01_0095_E11.b : ccctttagg
LVR01_0104_G11.b : ttttttttggct
LVR01_0030_H08.b : cxxxxxxx
LVR01_0014_G10.b : catxxxxx
LVR01_0104_D03.b : gtttgtttaggct
LVR01_0054_C07.b : gcttttg
LVR01_0089_D02.b : gcaxxx
LVR01_0015_E05.b : ctt
LVR01_0045_G09.b : ccxxxxx
LVR01_0085_F01.b : gagcttt
LVR01_0079_H12.b : ggcatxxxxx
LVR01_0100_F02.b : gccxxxxxx
LVR01_0083_A09.b : taagcatt
LVR01_0031_H10.b : cttttgg
LVR01_0015_A10.b : ttagggctttg
LVR01_0029_E07.b : tttx
LVR01_0059_F07.b : ggcctttt
LVR01_0051_E02.b : ggggaggtgttagggct
LVR01_0043_E03.b : ggcctatag
LVR01_0045_F05.b : ccatxxxxx
LVR01_0067_F05.b : gcxxxxxx
LVR01_0086_G08.b : attttgg
LVR01_0052_B07.b : ccatta
LVR01_0097_H09.b : ttttttttttaggcat
LVR01_0076_C07.b : xxxxxxxxxx
LVR01_0054_B11.b : tttttttttttttttggct
LVR01_0004_H01.b : ggcattg
LVR01_0025_H12.b : attttc
LVR01_0049_F06.b : gtggttttttttaagcat
LVR01_0045_C05.b : ccxxxxxx
LVR01_0100_E10.b : cxxxxxx
LVR01_0067_F08.b : gcxxxxxxx
LVR01_0104_F09.b : gtttttccttgcat
LVR01_0019_C01.b : cataxxxx
LVR01_0049_C06.b : gggttaaatncaagcat
LVR01_0051_A04.b : gggtgtttttttttggca
LVR01_0100_B04.b : gccxxxxx
LVR01_0017_C12.b : gcatttag
LVR01_0057_E12.b : gcxxxxxx
LVR01_0099_E01.b : gtagcatt
LVR01_0103_F07.b : gtgtttaatgcatagtgxxx
LVR01_0072_A08.b : gcaacatc
LVR01_0008_C06.b : gggctax
LVRM1_0119_F06.b :
LVRM1_0027_C03.b : cccccccccccccccccccnngnaccggccgggggcgccccgccggc
LVRM1_0198_G04.b :
LVRM1_0108_A01.b :
LVRM1_0082_F01.b :
LVRM1_0106_F04.b :
LVRM1_0126_D12.b :
LVRM1_0040_E11.b :
LVRM1_0052_F02.b :
LVRM1_0040_D10.b :
LVRM1_0040_F11.b :
LVRM1_0039_D09.b :
LVRM1_0030_H01.b :
LVRM1_0199_C01.b :
LVRM1_0154_B07.b :
LVRM1_0137_G02.b :
LVRM1_0095_C05.b :
LVRM1_0068_D04.b :
LVRM1_0097_H04.b :
LVRM1_0168_A09.b :
LVRM1_0067_H09.b :
LVRM1_0070_H03.b :
LVRM1_0088_A07.b :
LVRM1_0084_D05.b :
LVRM1_0063_B10.b :
LVRM1_0086_G10.b :
LVRM1_0097_F10.b :
LVRM1_0192_F02.b :
LVRM1_0101_B03.b :
LVRM1_0185_F10.b :
LVRM1_0006_F09.b :
LVRM1_0064_F12.b :
LVRM1_0180_H02.b :
LVRM1_0020_C07.b :
LVRM1_0160_H12.b :
LVRM1_0005_D12.b :
LVRM1_0088_G01.b :
LVRM1_0147_H06.b :
LVRM1_0148_C04.b :
LVRM1_0090_B09.b :
LVRM1_0117_B04.b :
LVRM1_0179_F08.b :
LVRM1_0180_H07.b :
LVRM1_0027_H11.b :
LVRM1_0003_G01.b :
LVRM1_0106_F01.b :
LVRM1_0116_H02.b :
LVRM1_0081_F07.b :
LVRM1_0057_F07.b :
LVRM1_0149_G04.b :
LVRM1_0026_B09.b :
LVRM1_0036_E04.b :
LVRM1_0124_D12.b :
LVRM1_0073_A06.b :
LVRM1_0106_G02.b :
LVRM1_0074_H01.b :
LVRM1_0033_A04.b :
LVRM1_0040_F12.b :
LVRM1_0010_C08.b :
LVRM1_0055_F01.b :
LVRM1_0057_F08.b :
LVRM1_0040_C10.b :
LVRM1_0054_G02.b :
LVRM1_0102_B09.b :
LVRM1_0153_G05.b :
LVRM1_0127_D08.b :
LVRM1_0155_D06.b :
LVRM1_0101_F04.b :
LVRM1_0146_G05.b :
LVRM1_0033_E11.b :
LVRM1_0019_B01.b :
LVRM1_0010_D09.b :
LVRM1_0051_F01.b :
LVRM1_0022_C06.b :
LVRM1_0014_F10.b :
LVRM1_0153_H10.b :
LVRM1_0136_E12.b :
LVRM1_0049_A10.b :
LVRM1_0141_B09.b :
LVRM1_0151_E12.b :
LVRM1_0141_H09.b :
LVRM1_0002_B07.b :
LVRM1_0002_B05.b :
LVRM1_0127_H02.b :
LVRM1_0114_B01.b :
LVRM1_0205_B01.b :
LVRM1_0027_E12.b :
LVRM1_0021_F01.b :
LVRM1_0009_C11.b :
LVRM1_0128_G10.b :
LVRM1_0193_G02.b :
LVRM1_0138_D08.b :
LVRM1_0055_D06.b :
LVRM1_0053_B11.b :
LVRM1_0019_G06.b :
LVRM1_0170_C02.b :
LVRM1_0152_H08.b :
LVRM1_0011_H10.b :
LVRM1_0133_D03.b :
LVRM1_0020_H08.b :
LVRM1_0037_G01.b :
LVRM1_0064_A08.b :
LVRM1_0042_H06.b :
LVRM1_0014_E11.b :
LVRM1_0005_B03.b :
LVRM1_0027_B10.b :
LVRM1_0188_F03.b :
LVRM1_0177_B08.b :
OVRM1_0060_E06.b :
20110601C-000820 : ..............................AAAGCAGCTGGTACGGCCCGCAATCCTCAA
---------+---------+---------+---------+---------+---------+ 30
LVRM1_0027_H06.b : acaagcaaaataaaaaacaaaacattgtcaAAAGCAGCTGGTACGGCCCGCAATCCTCAA
LVRM1_0092_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_B10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
LVRM1_0068_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_C08.b : aaatttccgag
LVRM1_0178_E05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_G12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_H02.b : gxxxxxxxxxxxxxxxxxx
LVRM1_0105_B06.b : aaatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_E12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_H10.b : agttttgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_H12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_G02.b : cgcggggcggcncaaaatcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_D12.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_G12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_G03.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_B04.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_D04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_G02.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_G01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_D01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_G06.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_F06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_B04.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_A06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0129_F01.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_H01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_G07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_H03.b : accttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_D03.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_G07.b : gggxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_F09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_D05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_C03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0066_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_D10.b : nagtttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_F12.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_B10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0007_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_G06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B05.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_C09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_D02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_A12.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
LVRM1_0206_G01.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_A08.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_D03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_F09.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_F03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_A01.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_A09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_A01.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_A04.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_D02.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_C11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_C03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C04.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgggcag
LVRM1_0124_F09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_E12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_E12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_G07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_F01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_G01.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A08.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_F10.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_F08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_D05.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_D04.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_F01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_B05.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_E11.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_A07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_D02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_B11.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_B06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_G07.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_F05.b : ttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_C04.b : cttattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_D10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_H04.b : gaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_A03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_E05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_F01.b : gttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_D09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_C03.b : cagttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_B06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_B05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_H07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_F05.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_D09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_H10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_C07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_A10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_C03.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_A09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_H09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_H02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0129_C01.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_C02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_C10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_A03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_C01.b : ttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_G01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_B10.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_E01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_C06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_C03.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0066_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_C06.b : agtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_H02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_C04.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_H12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_C03.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_H05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_B03.b : naattgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_C05.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_D08.b : agttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_G07.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_F07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_B05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_A03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_F07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_A03.b : agtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_C11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_A01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_B09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_A02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_F09.b : xxxxxxxxxxxx
LVRM1_0066_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_F02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_H11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_D04.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_B03.b : agtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_A10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_H11.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_G03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_A11.b : cgttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_C11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_G09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_H04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_H05.b : nagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_A03.b : nagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_H07.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0069_C04.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D08.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0066_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_H12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0129_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_A01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_C01.b : xxxxxxxxxxx
LVRM1_0135_D12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_D01.b : ccttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_E10.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_D02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_G03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_C09.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_A11.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_E04.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_H04.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_F05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_H01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_B09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_D07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_G05.b : txxxxxxxxxxxxxx
LVRM1_0064_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_E02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_E01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_D01.b : gggxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_H04.b : xxxxxxxxxxxxxxxxxx
LVRM1_0058_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_C06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_F07.b : cagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_A01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_E05.b : gggxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_G03.b : nagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_H04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_E04.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_A01.b : agtttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_F03.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_F12.b : xxxxxxxxxxxxxxxxx
LVRM1_0124_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_E03.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_E03.b : agttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_A04.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_G11.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_A05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_B04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_B04.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_C02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_C05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_A06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_E03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_B08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_C01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_D05.b : xxxxxxxxxxxxxxxxx
LVRM1_0008_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_F12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_D04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_B04.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_E02.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_B04.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_A02.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_H04.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_H07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_B06.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_E01.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_A07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_D01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_E04.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_F03.b : aattgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_F12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B08.b : gxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_D02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_E05.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_E10.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_C01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_A03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_H07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_E08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_B04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_E06.b : gtxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_D07.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_E01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_D04.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_A05.b : naatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_B04.b : acgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_A08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_B01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_F08.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_C01.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_F06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_E04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_E03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_B01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0069_G05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_F12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_H12.b : caatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_A09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A05.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_B11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_E01.b : nagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_B06.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_G10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_G06.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_D05.b : gxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_B02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_F02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_C05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_D07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_C04.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_B07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_F07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_D04.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_G06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_D11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_H11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_B06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_B08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_D01.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_C08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_G03.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_F06.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_F11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_B12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_G07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_F12.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_B05.b : cagtgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_F08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_H09.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_A06.b : aaatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_F10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_A07.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_A04.b : acgtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_D04.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_E04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_F08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_B10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_A10.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_E04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_D11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_D10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_F07.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_D11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_D02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A08.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_H02.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C04.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_B02.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_B08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_H10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_H12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_B02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_H10.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B04.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_B02.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_C11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_D05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_F11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G09.b : gxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_D05.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_H03.b : tagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_H02.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_F03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B04.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_H12.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_D01.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_D12.b : caattgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A10.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_A10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_C07.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_D04.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_D01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0069_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_F03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_H02.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_E12.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_F11.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B09.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_H03.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_A06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_H09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_C02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_D05.b : cgttgacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_H05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_C11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_G08.b : naatgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_D01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_B10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_F03.b : agttgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_B11.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_F11.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_D11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_E06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_H10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_H07.b : caatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_F05.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_F11.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_E05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_C11.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_F07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_C03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_F04.b : tagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_H09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_D07.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_G09.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_A12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_H08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_C10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_D08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_H09.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_H12.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_B10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_F03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_C05.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_G12.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_H01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_B06.b : agtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_F12.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_G09.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_F01.b : agttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_E02.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_B09.b : gcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_H06.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_D06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_E10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F06.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_E09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_F09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_H06.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_F05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_B09.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_A10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_D09.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_B03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_D06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0007_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_E04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_A10.b : acgtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B06.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_D07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_B04.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_G11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C05.b : agttgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_G01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_D10.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_D05.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_G07.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_H03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_E04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_H01.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_A07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_D09.b : cattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_E07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_C11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_A05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_B04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_A10.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_D12.b : agattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E11.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_D09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_H01.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_A11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_D12.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_C06.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_E07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_D11.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_A08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_H01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_C09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_G06.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_E10.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_H02.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_G06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_D07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_G12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_C03.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_E01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_F06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_G05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_E09.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_C11.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_C11.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_C08.b : agttgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_H04.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A11.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_C01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_D12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_G08.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_G08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D08.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_F10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_H11.b : agttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_H08.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_G11.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_H10.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_F10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_B06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_H08.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_H07.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_A12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_G07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_B10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_H08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_G09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_C09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_B09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_G10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_C05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_D05.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_A06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C12.b : acgtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_B10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_G09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_A08.b : caattgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_D10.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_D09.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_E09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_B09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_C10.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_G09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_B10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_C10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_D12.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_B11.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_C02.b : nnnnnnnnnnnnnnnnncatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_G10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_H10.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_D12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_D10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_F11.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_A08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_C10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_F04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_D05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_H09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_G07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_E06.b : tggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_E11.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G11.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_D03.b : tcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C07.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E05.b : tgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_F01.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_A09.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_H10.b : tgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_A10.b : gtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_F07.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E02.b : taggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E03.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_G08.b : gtgactaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B07.b : cgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_H09.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B11.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H01.b : gtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_H12.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_F06.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F09.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_C06.b : agtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_A04.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_C12.b : ggccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_E01.b : ngtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_A08.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_F06.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_C03.b : gggcgggggggtccgaacgtggcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_F04.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_D12.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_E11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_D10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_F11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_D09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_H01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_B07.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_G02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_D04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_H04.b : gagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0067_H09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_H03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_A07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_D05.b : aattgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_B10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_G10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_F10.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_F02.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_F10.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_H02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_C07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_D12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_C04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_B04.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_H07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_G01.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_F01.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_H02.b : caatgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_F07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_G04.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_B09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_E04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_D12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_A06.b : cgttgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_G02.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_H01.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_A04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_F12.b : nagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_C10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_B09.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_G05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_D08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_D06.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_G05.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_E11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_B01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_D09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_F10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_A10.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_B09.b : aaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_H09.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_E12.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_F01.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_G02.b :
LVRM1_0138_D08.b : nagttgtcxxxx
LVRM1_0055_D06.b : nagttgtacx
LVRM1_0053_B11.b : agttgtcx
LVRM1_0019_G06.b : agttgacx
LVRM1_0170_C02.b :
LVRM1_0152_H08.b :
LVRM1_0011_H10.b :
LVRM1_0133_D03.b :
LVRM1_0020_H08.b :
LVRM1_0037_G01.b :
LVRM1_0064_A08.b :
LVRM1_0042_H06.b :
LVRM1_0014_E11.b :
LVRM1_0005_B03.b :
LVRM1_0027_B10.b :
LVRM1_0188_F03.b :
LVRM1_0177_B08.b :
OVRM1_0060_E06.b :
20110601C-000820 : ACATGTTGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
---------+---------+---------+---------+---------+---------+ 87
LVRM1_0027_H06.b : ACATGTTGGCCTACTGGATCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0092_F07.b : xctTGTTGGCCTACTG*AGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0198_B12.b : ctggGTTGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_B10.b : ccttGTTGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0068_B07.b : xxxxxTTGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0115_C08.b : cactgaaGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_E05.b : xxxxggcGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_G12.b : xxxxxxxGGCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0023_H02.b : xxxxxxxxxCCTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0105_B06.b : xxxxxxxxxxxTACTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_E12.b : xxxxxxxxxxxxaCTG*AGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0094_F04.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_B04.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0083_D02.b : xxxxxxxxxxxxxgGGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_H12.b : xxxxxxxxxxxxxxGGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0068_H10.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0148_D09.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_H12.b : xxxxxxxxxxxxxxGGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_G02.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0022_D12.b : xxxxxxxxxxxxxxTGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0096_G12.b : xxxxxxxxxxxxxxxTGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0080_B03.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0020_G03.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCATTCAGCGC
LVRM1_0020_B04.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0194_E07.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0025_D04.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0167_G02.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_G01.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0053_D01.b : xxxxxxxxxxxxxxxGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_G06.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_F06.b : xxxxxxxxxxxxxxxGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_B04.b : xxxxxxxxxxxxxtgGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0071_A06.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0129_F01.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_C10.b : xxxxxxxxxxxxxttGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_D09.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_F01.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_F09.b : xxxxxxxxxxxactgGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0052_E09.b : xxxxxxxxxxxxxxxGGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0090_E11.b : xxxxxxxxxxxxxxxGCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVRM1_0180_H01.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_G07.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_H03.b : xxxxxxxxxxxxgcagCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_E09.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0171_D03.b : xxxxxxxxxxxxxxxxGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_G07.b : xxxxxxxxxxxxxxxxGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_F09.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_D05.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0135_D01.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_C03.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_F01.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0066_F08.b : xxxxxxxxxxxxxxxxGAGCATTGCGGGCAG*GCGGTG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_D10.b : xxxxxxxggggatcgaGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_A02.b : xxxxxxxxxxxxxxxxGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0032_F12.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_H04.b : xxxxxxxxgttgcctcGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_B10.b : xxxxxxxxxxxxxxxxGAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
OVRM1_0007_A04.b : xxxxxxxxxxxxxxxxCAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0095_G06.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_B05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAACGC
LVRM1_0096_C09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0032_D02.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_A01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCTCTCAGCGC
LVRM1_0018_A12.b : cggcccctggaaagcccAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0206_G01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGAGC
LVRM1_0045_A08.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0070_H04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0076_D03.b : xxxxxxxxxxxxxxxxxTGGATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0181_D02.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0082_F09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_F03.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0045_F12.b : xxxxxxxxxxxxxxxxtAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0122_A01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0092_A09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_A01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_D02.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0196_E11.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0105_A04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0084_D02.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_C11.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_C03.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0111_G09.b : xxxxxxxxxxxxxxggaAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0200_C04.b : xxxxxxxxxxxxxxxxxTGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_C05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0133_H04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_H07.b : cggcccctggaaagcccAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_F09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0102_F04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0189_E12.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0084_E12.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_G07.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0114_F01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_G01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0153_E06.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_A08.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0151_C12.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_F10.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_F08.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_B03.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0102_D05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0080_D04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0015_F01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0003_D05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_H06.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_B05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_E11.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0157_C07.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_A07.b : xxxxxxxxxxxxxxxtaAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_C08.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0019_D02.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0051_B11.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_G09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0159_B06.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_G07.b : xxxxxxxxxxxxxxtttAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_D09.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0043_F05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0092_D07.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0022_A01.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0072_G08.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0102_C04.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0008_D10.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0090_E05.b : xxxxxxxxxxxxxxxxxAGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVRM1_0065_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0163_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0084_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0042_E05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_F01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0183_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0125_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0188_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0012_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0173_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0095_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0195_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0167_C07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0095_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0167_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0012_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0179_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0130_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0184_A01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0129_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0182_C02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0181_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGGNTCCACTCAGCGC
LVRM1_0086_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_G01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0192_A02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0134_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0095_G08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0087_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0096_C06.b : xxxxxxxxxxxxxxxxxxGCATTGTGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0066_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_C06.b : xxxxxxxxxxxxxxxxxaGCGTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0119_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_C04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0062_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0091_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0067_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0093_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0171_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0187_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0134_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0167_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0194_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0093_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0119_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_F04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0053_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0041_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0045_A01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0088_G04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0092_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*CCCACTCAGCGC
LVRM1_0145_B03.b : xxxxxxxxxxxxxxxxxxTCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0099_A02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0164_F01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0183_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0066_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_H11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0042_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0119_A10.b : xxxxxxxxxxxxxxxxxxGGATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0175_H11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0062_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0093_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0071_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_C11.b : xxxxxxxxxxxxxxxxxxTCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0182_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0005_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0010_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0007_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0048_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0087_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCGG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0023_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCGCTCAGCGC
LVRM1_0052_A03.b : xxxxxxxxxxxxxxxxxgGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0189_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0069_C04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0181_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0066_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCAGGG*TCCACTCAGCGC
LVRM1_0067_D06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0129_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0170_A01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0135_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0020_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0093_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0104_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0168_H07.b : xxxxxxxxxxxxxxxxxxGCATTGAGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0094_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0176_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0076_C09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0085_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0084_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0063_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0195_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0081_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0085_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_A05.b : xxxxxxxxxxxxxxxxxxGCATTGAGGGCAA*GCAGCG*GCTCTGGG*TCCACTCACCGC
LVRM1_0152_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0187_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0203_A02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0076_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0020_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0182_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0208_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0133_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0180_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_B01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0204_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0058_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0058_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0048_A01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_E05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0122_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0198_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0052_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0051_A01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0187_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0194_H03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0147_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_A04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0173_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0122_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0189_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0198_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_G02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0055_C02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0180_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0082_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0205_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0134_A06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0203_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0070_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0103_G04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0159_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0198_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0193_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0208_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0008_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0103_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0093_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0196_B04.b : xxxxxxxxxxxxxxxtggGGATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0091_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0203_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGACG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_A02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0192_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0182_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0043_C12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0204_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0038_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_A07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0041_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0167_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0196_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0201_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0200_E05.b : xxxxxxxxxxxxxxxxtcGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0179_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0197_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0163_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCA*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_B01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCCC
LVRM1_0086_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_A12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0201_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_E01.b : xxxxxxxxxxxxxxxxxxTCATTGCGGGCAA*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0115_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0105_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0028_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0125_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_B01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0193_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0195_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_F04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0067_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0165_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0050_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0037_F06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0098_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0104_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0091_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0178_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_B01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCTGGCAA*GCGGCA*GCTCTGGG*TCCACTCAGCGC
LVRM1_0069_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_G04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0086_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0196_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0201_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0067_A03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0065_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_B02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0123_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0055_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0117_C04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0200_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0018_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0133_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_H11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0157_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0098_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_C08.b : xxxxxxxxxxxxxxxxtaCCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_G03.b : xxxxxxxxxxxxxxxxxxGCATCGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0194_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0206_C07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0097_F06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_B12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0041_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0102_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0184_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0166_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0009_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0148_A06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*CCCACTCAGCGC
LVRM1_0035_F04.b : xxxxxxxxxxxxxxxxxtGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0038_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0105_A07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGA*TCCACTCAGCAC
LVRM1_0127_D06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_D03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0077_A04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0007_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0164_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0201_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0007_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0070_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_A12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0024_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0037_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0181_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0186_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0058_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCA*GCTCTGGG*TCCACTCAGCGC
LVRM1_0050_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0169_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0179_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0068_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0111_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_C04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0192_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_B02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0123_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0158_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_B02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0070_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0003_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_B02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0092_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0165_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0168_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0204_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAACGA
LVRM1_0121_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0092_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0009_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_H03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_F04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0003_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0153_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0206_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0047_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0208_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0097_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0098_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_C07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0191_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0203_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0037_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0069_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0113_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0122_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0003_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0082_E12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0182_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_H03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_A06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0109_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_C02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0103_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_D06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_G08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0109_D01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0205_E12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0028_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0115_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0202_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0038_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_F01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0180_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_A12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0071_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_B08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0199_H10.b : xxxxxxxxxxxxxxxxtaCCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0207_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0114_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0118_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_E05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0088_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0009_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0032_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_F04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0114_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0117_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_A12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0103_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0193_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0055_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0199_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0117_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0033_B05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0130_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0111_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_B01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0023_F12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0079_F01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0164_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0037_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0151_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0033_D06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0077_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0077_F06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0008_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0113_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0112_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0122_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0103_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0007_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0007_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0158_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_B03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0109_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_D06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
OVRM1_0007_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0009_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_G02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0133_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0159_C09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0080_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0005_A04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0022_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_G01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0056_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGACG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCAGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_H03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_E04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0157_A07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0105_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0123_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0156_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0067_D12.b : xxxxxxxxxxxxxxxxxxGGATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0035_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0050_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0063_G04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0158_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_D04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0075_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_E05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0030_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_G02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0004_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_H06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*CCCACTCAGCGC
LVRM1_0012_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0017_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0157_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0034_D11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0153_C09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0030_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_H02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0139_D07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0150_C09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0077_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0019_C03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TC*ACTCAGCGC
LVRM1_0019_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_F06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_G05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0033_C11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0139_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0079_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_H04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0150_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0019_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0022_C02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0063_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_G08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0072_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0050_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCAGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_G08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0018_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*ACTCTGGG*TCCACTCAGCGC
LVRM1_0120_G03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_H11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0104_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0018_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_A04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0125_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0055_B06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_D08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0077_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCAGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_A12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0113_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0162_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0029_C09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCGAGCTCTGGG*ACCACTCAGCGC
LVRM1_0161_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0022_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0005_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0110_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0152_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0113_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0142_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_A06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0078_C12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0150_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_G06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0147_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0148_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_D09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_H05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0030_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0143_B09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0150_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0079_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0010_A05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0107_B10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0119_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0145_F10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0144_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_A11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0150_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0015_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_C08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0023_C02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0139_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_E09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0031_D12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_F11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_H11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0157_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0161_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_C08.b : xxxxxxxxxxxxxxxtggGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0120_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0001_F03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0140_D10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_F04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0030_G12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0063_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_D05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_E08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0006_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0001_G07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0041_E06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAACAC
LVRM1_0002_C10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0025_H07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0095_E11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0104_G11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0030_H08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0014_G10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0104_D03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0054_C07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0089_D02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0015_E05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0045_G09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0085_F01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0079_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0100_F02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAACGC
LVR01_0083_A09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0031_H10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0015_A10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0029_E07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCGG*GCGGCG*GCTCTGGG*TCCACTCGGCGC
LVR01_0059_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0051_E02.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0043_E03.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0045_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0067_F05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0086_G08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACACAGCAC
LVR01_0052_B07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0097_H09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0076_C07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0054_B11.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0004_H01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0025_H12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0049_F06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0045_C05.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0100_E10.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0067_F08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0104_F09.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0019_C01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0049_C06.b : xxxxxxxxxxxxxxxxxtGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0051_A04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGTAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0100_B04.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0017_C12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0057_E12.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0099_E01.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVR01_0103_F07.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0072_A08.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCAC
LVR01_0008_C06.b : xxxxxxxxxxxxxxxxxxGCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0119_F06.b : xxxxxxxxxxxxxxxxxxxCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_C03.b : xxxxxxxxxxxxxxxxxxxGATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0198_G04.b : xxxxxxxxxxxxxxxxxtaCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0108_A01.b : xxxxxxxxxxxxxxxxxxtCATTGCGGGCAG*ACGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0082_F01.b : xxxxxxxxxxxxxxxxxtcCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_F04.b : xxxxxxxxxxxxxxxxxxxCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0126_D12.b : xxxxxxxxxxxxxxxxxxtCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_E11.b : xxxxxxxxxxxxxxxxxxcCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0052_F02.b : xxxxxxxxxxxxxxxxxxtCATTGCGGGCAGAGCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_D10.b : xxxxxxxxxxxxxxxxxxcCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_F11.b : xxxxxxxxxxxxxxxxxxtCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0039_D09.b : xxxxxxxxxxxxxxxxxxcCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0030_H01.b : xxxxxxxxxxxxxxtggtcCATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0199_C01.b : xxxxxxxxxxxxxxxxxtctATTGCGGGCAA*ACGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0154_B07.b : xxxxxxxxxxxxxxxxxxxxATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0137_G02.b : xxxxxxxgttggcctactggATTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0068_D04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACCCAGCGC
LVRM1_0097_H04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0168_A09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0067_H09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0070_H03.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0088_A07.b : xxxxxxxxxxxxxxxxxxattTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0084_D05.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0063_B10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0086_G10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0097_F10.b : xxxxxxxxxxxxxxxxxxgcgTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0192_F02.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_B03.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0185_F10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0006_F09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0064_F12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0180_H02.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCCCTGGG*TCCACTCAGCGC
LVRM1_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0160_H12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0005_D12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0088_G01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0147_H06.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0148_C04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0090_B09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0117_B04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0179_F08.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0180_H07.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_H11.b : xxxxxxxxxxxxxxxxxxtccTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0003_G01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_F01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0116_H02.b : xxxxxxxxxxxxxxxxxxxxxTTGCGCGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0081_F07.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_F07.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0149_G04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0026_B09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0036_E04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0124_D12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0073_A06.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0106_G02.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0074_H01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0033_A04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_F12.b : xxxxxxxxxxxxxxxxxxtccTTGCGGGCAA*GAGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0010_C08.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0055_F01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0057_F08.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0040_C10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0054_G02.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0102_B09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0153_G05.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_D08.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0155_D06.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0101_F04.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0146_G05.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0033_E11.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0019_B01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0010_D09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0051_F01.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0022_C06.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0014_F10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0153_H10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0136_E12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0049_A10.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_B09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0151_E12.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0141_H09.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_B07.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0002_B05.b : xxxxxxxxxxxxxxxxxxxxxTTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0127_H02.b : xxxxxxxxxxxxxxxxxxxxxxTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0114_B01.b : xxxxxxxxxxxxxxxxxxxxxxTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0205_B01.b : xxxxxxxxxxxxxxxxxxxxxgTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0027_E12.b : xxxxxxxxxxxxxxxxxxxxxgTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0021_F01.b : xxxxxxxxxxxxxxxxxxxxxxTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0009_C11.b : xxxxxxxxxxxxxxxxxxxxxxTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0128_G10.b : xxxxxxxxxxxxxxxxxxxxxgTGCGGGCAG*GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0193_G02.b : GCGGCG*GCTCTGGG*TCCACTCAGCGC
LVRM1_0138_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggACTCAGCGC
LVRM1_0055_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCGC
LVRM1_0053_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCGC
LVRM1_0019_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCGC
LVRM1_0170_C02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_H08.b :
LVRM1_0011_H10.b :
LVRM1_0133_D03.b :
LVRM1_0020_H08.b :
LVRM1_0037_G01.b :
LVRM1_0064_A08.b :
LVRM1_0042_H06.b :
LVRM1_0014_E11.b :
LVRM1_0005_B03.b :
LVRM1_0027_B10.b :
LVRM1_0188_F03.b :
LVRM1_0177_B08.b :
OVRM1_0060_E06.b :
20110601C-000820 : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
---------+---------+---------+---------+---------+---------+ 145
LVRM1_0027_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0092_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0198_B12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0068_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0115_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_G12.b : GTCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0023_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0105_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0094_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0083_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0068_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0148_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0022_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0096_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0080_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0020_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0020_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0194_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0025_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0167_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCACG*TCCCCCTTCCTGGCTCTGG
LVRM1_0053_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0071_A06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0129_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAAGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0052_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0090_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0171_D03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0135_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0066_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_A02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0032_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
OVRM1_0007_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0095_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0096_C09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0032_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0018_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0206_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0045_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0070_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0076_D03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0181_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0082_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0045_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0122_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0092_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0196_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0105_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0084_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCCGGCTCTGG
LVRM1_0116_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0111_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0200_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0133_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0102_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0189_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0084_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0036_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0114_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0153_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0151_C12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0102_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0080_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0015_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0003_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0157_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_A07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0051_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0159_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0043_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0092_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCCGGCTCTGG
LVR01_0022_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0072_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0102_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0008_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0090_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0065_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0163_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCCGG
LVRM1_0185_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0084_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0042_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0183_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0125_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0188_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0012_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0173_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0095_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0195_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0167_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0095_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0167_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0012_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0179_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0130_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0184_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0129_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0182_C02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0181_C10.b : ATCCCGCTCTGCGTAGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0086_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0192_A02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0134_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0095_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0087_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0096_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0066_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0119_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_C04.b : ATCCCGCCCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0062_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0091_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0093_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0171_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0187_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0134_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0167_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0194_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0093_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0119_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0053_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0041_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0045_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0088_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0092_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0099_A02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0164_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0183_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0066_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0042_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0119_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0175_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0062_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0093_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0071_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0182_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0005_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCGGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0010_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0007_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_B11.b : ATCCCGCTCTGCG*AGGCAGACATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0048_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0087_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0023_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGACTGTGG
LVRM1_0052_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0189_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0069_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0181_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0066_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0129_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0170_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0135_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0020_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0093_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0104_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0168_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0094_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0176_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0076_C09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0085_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0084_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0063_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0195_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0081_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0085_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_A05.b : ATCCCGCTCTGCG*AGGCACGCATGAAAGCAGAGGGCATG*TCCCCCTTCCTGGATCTGG
LVRM1_0152_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0187_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0203_A02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0076_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0020_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0182_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0208_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0133_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0204_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0058_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0058_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0048_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0122_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0198_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0052_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0051_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0187_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0194_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0147_E03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_E03.b : ATCCCGCTCTGCG*AGGCGGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCCGGCTCTGG
LVRM1_0173_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0122_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0189_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0198_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_C02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0082_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0205_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0134_A06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_E03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCCGGCTCTGG
LVRM1_0203_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0070_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0103_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_B08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0159_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0198_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0193_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0208_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0008_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0103_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0093_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0196_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0091_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0203_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_A02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0192_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0182_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0043_C12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATGCCCCCCCTTCCTGGCTCTGG
LVRM1_0204_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0038_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_A07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0041_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0167_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0196_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0201_B08.b : GTCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0200_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0179_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0197_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0163_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0086_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0201_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0115_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0105_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0028_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0125_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0193_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0195_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_F05.b : ATCCCGCTCTACG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0165_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0050_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0037_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0098_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0104_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0091_E03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0178_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_F12.b : ATCCCGCTCTGCT*AGGCATGCATGAATGCAGAGGACATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0069_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0086_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0196_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0201_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_A03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0065_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_B02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0123_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0117_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0200_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0018_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0133_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0157_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0098_B08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTAG
LVRM1_0116_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0194_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0206_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0097_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_B12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0041_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0102_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCGTG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0184_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0166_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0009_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0148_A06.b : ATCCCGCTCCGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0038_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0105_A07.b : ATCCCGCTCTGCG*AGGCATGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_D03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0077_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0007_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0164_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0201_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0007_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0036_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0070_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_F09.b : ATCCCGCTCTGCG*A****GGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0024_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0037_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0181_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0186_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0058_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0050_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0169_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0179_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0068_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0111_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TTCCCCTTCCTGGCTCTGG
LVRM1_0056_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0192_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_B02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0123_B08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0158_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_B02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0070_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0003_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_B02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0092_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0165_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0168_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0204_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_G05.b : ATCCCGCTCTGCGAGAGCAAGCATGAAAGCACAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0121_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0092_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0009_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0003_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0153_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0206_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0047_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0208_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_E03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0097_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0098_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCCTCCTGGCTCTGG
LVRM1_0152_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0191_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0203_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0037_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0069_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_B08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0113_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0122_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0003_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0082_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0182_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_A06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0036_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0109_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_C02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0103_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0109_D01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0205_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0028_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0115_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0202_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0038_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0036_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0071_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_B08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0199_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0207_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0114_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0118_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0088_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0009_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0032_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0114_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0117_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0103_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0193_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0199_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0117_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0033_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0130_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0111_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCCCTGG
LVRM1_0140_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0023_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0079_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCTTTCCTGGCTCTGG
LVRM1_0164_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0037_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0151_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0033_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGGAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0077_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0077_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0008_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0113_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0112_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0122_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0103_D09.b : ATCCCGCTCTGCG*****AGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0007_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0007_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0158_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0109_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_D06.b : ATCCCGCTCCGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
OVRM1_0007_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0009_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0133_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0159_C09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0080_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0005_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0022_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*CCCCCCTTCCTGGCTCTGG
LVRM1_0078_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0056_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0157_A07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0105_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0036_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0123_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0156_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0035_E11.b : ATCCCGCTCTGCG*****AGGCATGAAGGCAGAGGGCGTG*TCCCCCTTCCTGGCTCTGG
LVRM1_0050_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0063_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0158_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0075_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0030_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0004_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0012_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0017_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0157_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0034_D11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0153_C09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0030_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0139_D07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0150_C09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0077_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0033_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0139_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0079_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0150_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0022_C02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0063_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0072_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0050_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_E07.b : ATCCCGCTCTGCG*A****GGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0018_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_G03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0104_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0018_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0125_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_B06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0077_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_A12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0113_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0162_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0029_C09.b : ATCCCGCTCTGCG*AGGCAGGTATGAAGGAAGATGGCATG*TACCCCTTCCTGGCTCTGG
LVRM1_0161_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0022_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0005_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0110_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0113_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0142_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_A06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0078_C12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0150_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0147_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0148_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_H05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0030_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0143_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0150_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0079_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0010_A05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0107_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0119_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0145_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0144_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_A11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0150_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0015_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0023_C02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0139_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_E09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_G10.b : ACCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0031_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0157_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0161_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0120_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0001_F03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0140_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0030_G12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0063_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_E08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0006_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0001_G07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0041_E06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCCGG
LVRM1_0002_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0025_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0095_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0104_G11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0030_H08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0014_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0104_D03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0054_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0089_D02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0015_E05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0045_G09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0085_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0079_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0100_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0083_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0031_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0015_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0029_E07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0059_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0051_E02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0043_E03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0045_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0067_F05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0086_G08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0052_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0097_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0076_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0054_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0004_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0025_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0049_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0045_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0100_E10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0067_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0104_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0019_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0049_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0051_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0100_B04.b : ATCCCGCTCTGCG*A****GGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0017_C12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0057_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0099_E01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0103_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0072_A08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVR01_0008_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0119_F06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_C03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0198_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0108_A01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0082_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0126_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0052_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_D10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_F11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0039_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0030_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0199_C01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0154_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0137_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0095_C05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0068_D04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0097_H04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0168_A09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0067_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0070_H03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0088_A07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0084_D05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0063_B10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0086_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0097_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0192_F02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_B03.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0185_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0006_F09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0064_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0020_C07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0160_H12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0005_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0088_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0147_H06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0148_C04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0090_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0117_B04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0179_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0180_H07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_H11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0003_G01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0116_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0081_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_F07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0149_G04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0026_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*CCCCCCTTCCTGGCTCTGG
LVRM1_0036_E04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0124_D12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0073_A06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0106_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0074_H01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0033_A04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_F12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0010_C08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0057_F08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0040_C10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0054_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0102_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0153_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0155_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0101_F04.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0146_G05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0033_E11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0010_D09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0051_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0022_C06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0014_F10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0153_H10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0136_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0049_A10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_B09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0151_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0141_H09.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_B07.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0002_B05.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0127_H02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0114_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0205_B01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0027_E12.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0021_F01.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0009_C11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0128_G10.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0193_G02.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0138_D08.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0055_D06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0053_B11.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0019_G06.b : ATCCCGCTCTGCG*AGGCAGGCATGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0170_C02.b : xxxxxxxxxxxxxxxxxxxxxxxTGAAGGCAGAGGGCATG*TCCCCCTTCCTGGCTCTGG
LVRM1_0152_H08.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_H10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_D03.b :
LVRM1_0020_H08.b :
LVRM1_0037_G01.b :
LVRM1_0064_A08.b :
LVRM1_0042_H06.b :
LVRM1_0014_E11.b :
LVRM1_0005_B03.b :
LVRM1_0027_B10.b :
LVRM1_0188_F03.b :
LVRM1_0177_B08.b :
OVRM1_0060_E06.b :
20110601C-000820 : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
---------+---------+---------+---------+---------+---------+ 203
LVRM1_0027_H06.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0092_F07.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0198_B12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0024_B10.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0068_B07.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0115_C08.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0178_E05.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0034_G12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0023_H02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0105_B06.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0039_E12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0094_F04.b : G*GCCCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0186_B04.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0083_D02.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0162_H12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0068_H10.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0148_D09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0143_H12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0026_G02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0022_D12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0096_G12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0080_B03.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0020_G03.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0020_B04.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0194_E07.b : G*GCTCCTGGTGGCTGGGCTCTGCCC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0025_D04.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0167_G02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0049_G01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0053_D01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0074_G06.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0057_F06.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0154_B04.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0071_A06.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0129_F01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0124_C10.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0126_D09.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0145_F01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0144_F09.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0052_E09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVR01_0090_E11.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAGGCAAACCTGA
LVRM1_0180_H01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0024_G07.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0024_H03.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0090_E09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0171_D03.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0207_G07.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0178_F09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGACCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0107_D05.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0135_D01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0035_C03.b : G*CTTCCTGGTGGCTGGGCTCCGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0160_F01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0066_F08.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0054_D10.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0143_A02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0032_F12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0120_H04.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0155_B10.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
OVRM1_0007_A04.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0095_G06.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0047_B05.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0096_C09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0032_D02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0027_A01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0018_A12.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0206_G01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0045_A08.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0070_H04.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0076_D03.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0181_D02.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0082_F09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0047_F03.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0045_F12.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0122_A01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0092_A09.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0178_A01.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0169_D02.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0196_E11.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0105_A04.b : G*GCTCCTGGTGGCTGGGCTCTGCTC*CAGCGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0084_D02.b : G*CCTCCTGGTGGCTGGGCTCTGCTC*CAGGGTCCACTGCGTCCCCGAAAGCAAACCTGA
LVRM1_0178_C11.b : G*