
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000833

Length: 5,494

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 precursor [Homo sapiens]. 25610.0O
Contig/Assembly ProteinC5complement C5 preproprotein [Homo sapiens]. 6720.0O
Contig/Assembly ProteinC4Bcomplement C4-B preproprotein [Homo sapiens]. 6400.0O
Contig/Assembly ProteinLOC100293534complement C4-B-like preproprotein [Homo sapiens]. 6390.0O
Contig/Assembly ProteinC4Acomplement C4-A preproprotein [Homo sapiens]. 6350.0O
Contig/Assembly ProteinC4BPREDICTED: complement C4-A isoform 1 [Homo sapiens]. 6350.0O
Contig/Assembly ProteinC4BPREDICTED: complement C4-A isoform 2 [Homo sapiens]. 629e-179O
Contig/Assembly ProteinA2ML1alpha-2-macroglobulin-like protein 1 precursor [Homo sapiens]. 2483e-65O
Contig/Assembly ProteinCD109CD109 antigen isoform 1 precursor [Homo sapiens]. 2454e-64O
Contig/Assembly ProteinCD109CD109 antigen isoform 3 precursor [Homo sapiens]. 2454e-64O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 [Mus musculus]. 25630.0O
Contig/Assembly ProteinLOC100048759PREDICTED: complement C3-like, partial [Mus musculus]. 24020.0O
Contig/Assembly ProteinHccomplement C5 preproprotein [Mus musculus]. 6820.0O
Contig/Assembly ProteinC4bcomplement C4-B precursor [Mus musculus]. 6360.0O
Contig/Assembly ProteinLOC675521PREDICTED: complement C4-B-like isoform 5 [Mus musculus]. 6330.0O
Contig/Assembly ProteinC4asex-limited protein [Mus musculus]. 613e-175O
Contig/Assembly ProteinCd109CD109 antigen precursor [Mus musculus]. 2445e-64O
Contig/Assembly ProteinA2malpha-2-macroglobulin-P precursor [Mus musculus]. 2353e-61O
Contig/Assembly ProteinGm7298PREDICTED: murinoglobulin-1-like [Mus musculus]. 2177e-56O
Contig/Assembly ProteinPzpalpha-2-macroglobulin precursor [Mus musculus]. 2177e-56O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC476728PREDICTED: similar to Complement C3 precursor [Canis familiaris]. 23650.0O
Contig/Assembly ProteinLOC484960PREDICTED: similar to Complement C3 precursor [Canis familiaris]. 6880.0O
Contig/Assembly ProteinLOC481722PREDICTED: similar to Complement C4 precursor [Canis familiaris]. 567e-161O
Contig/Assembly ProteinC5PREDICTED: similar to complement component 5 [Canis familiaris]. 3314e-90O
Contig/Assembly ProteinLOC474970PREDICTED: similar to CD109 [Canis familiaris]. 2478e-65O
Contig/Assembly ProteinLOC477699PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 2323e-60
Contig/Assembly ProteinLOC486697PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 2301e-59O
Contig/Assembly ProteinLOC611458PREDICTED: similar to pregnancy-zone protein [Canis familiaris]. 2123e-54O
Contig/Assembly ProteinLOC484845PREDICTED: similar to C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Canis familiaris]. 1979e-50
Contig/Assembly ProteinLOC611455PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 1654e-40

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 preproprotein [Bos taurus]. 27770.0O
Contig/Assembly ProteinLOC528040PREDICTED: hemolytic complement-like [Bos taurus]. 10160.0O
Contig/Assembly ProteinLOC528040PREDICTED: hemolytic complement-like [Bos taurus]. 10160.0O
Contig/Assembly ProteinC5complement C5a anaphylatoxin [Bos taurus]. 6900.0O
Contig/Assembly ProteinC4Acomplement C4 [Bos taurus]. 6440.0O
Contig/Assembly ProteinLOC617696PREDICTED: similar to complement component 4A [Bos taurus]. 6370.0O
Contig/Assembly ProteinCD109PREDICTED: thiolester containing protein II-like [Bos taurus]. 2448e-64O
Contig/Assembly ProteinCD109PREDICTED: thiolester containing protein II-like, partial [Bos taurus]. 2448e-64O
Contig/Assembly ProteinA2ML1PREDICTED: alpha-2-macroglobulin-like 1 [Bos taurus]. 2392e-62O
Contig/Assembly ProteinA2Malpha-2-macroglobulin [Bos taurus]. 2185e-56O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 [Sus scrofa]. 32530.0O
Contig/Assembly ProteinC5complement C5 [Sus scrofa]. 6850.0O
Contig/Assembly ProteinLOC100517145PREDICTED: complement C3-like [Sus scrofa]. 6830.0O
Contig/Assembly ProteinC4complement C4 [Sus scrofa]. 6480.0O
Contig/Assembly ProteinA2MPREDICTED: LOW QUALITY PROTEIN: alpha-2-macroglobulin [Sus scrofa]. 2144e-55O
Contig/Assembly ProteinPZPPREDICTED: alpha-2-macroglobulin [Sus scrofa]. 2137e-55O
Contig/Assembly ProteinCPAMD8PREDICTED: c3 and PZP-like alpha-2-macroglobulin domain-containing protein 8 [Sus scrofa]. 1922e-48
Contig/Assembly ProteinA2ML1PREDICTED: alpha-2-macroglobulin-like protein 1 [Sus scrofa]. 1822e-45O
Contig/Assembly ProteinCD109PREDICTED: CD109 antigen isoform 1 [Sus scrofa]. 1501e-35O
Contig/Assembly ProteinSLC25A23PREDICTED: calcium-binding mitochondrial carrier protein SCaMC-3 [Sus scrofa]. 1208e-27O

Assembly Members: 90      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVRM10077G02LVRM1_0077_G02.bBP140345 AK394185
MLN010045A11MLN01_0045_A11.bCJ011165 AK346730


SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000833 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0077_G02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_A07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_C01.b : xxxxxxxxxxxxxxxx
LVRM1_0195_A02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_G07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_C12.b : nggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0046_C08.b : nnnnggagcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_B05.b : ncgttg
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 49
LVRM1_0200_B05.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTGTC
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 109
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 169
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 229
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 289
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 349
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 409
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 469
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 529
SPLT1_0055_H12.b : nnnaaagcgagtagacgxxxxx
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 588
SPLT1_0055_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACCCCTGAAGGCATTGACA
UTR01_0070_F01.b : gctatxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 648
LVRM1_0198_F09.b : TCAAAAGGGACTCCTTGTTATCCCACAAacatcttgactccatgccttgtgacttgtaca
LVRM1_0005_F08.b : TGAAACGGGACTCCCTGGCATCCCACAccaggttggcatgttggctttttctcagaccat
SPLT1_0055_H12.b : TCAAACGGGACTCCCTGTCATCCCACAAagctccagttatctttcaaaaaaaaaaaaaaa
UTR01_0070_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGAACA
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 707
LVRM1_0198_F09.b : accaccgcacaggataaatggggacagatgaaaattcaaaacaattaaacgaagagacaa
LVRM1_0005_F08.b : tccacaactggctaacatcgggaacgcgagatccctgcccaccagaaggtagcttccaac
SPLT1_0055_H12.b : aaaaa
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 767
LVRM1_0198_F09.b : accagctcttcttgcgtatattgtagtcaccgtattgcgccgtcact
LVRM1_0005_F08.b : aggacttcatttgttaactttacgtgaacgtattctagtacccactccgtccgtcatttc
LVRM1_0091_B08.b : agcagtcctctccgcgaaagataaagtaaagga
LVRM1_0047_A07.b : gacaactcttctcggctgactttaagtgcacgacaagtg
SPLT1_0055_H12.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 827
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b : cgtccctccccaactct
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b : CAAG
LVRM1_0200_B05.b : CCAGTGGAGCtt
SPLT1_0055_H12.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 887
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 947
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : Ggccaggacggtgaccagaggatttcattgtctcagtccctccccctgtttccgatcatt
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0071_F05.b : nagttgtca
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1007
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : gatgggaccggggaaacccaccctgaacccaagggtcttgcctgatggagtacattatcc
ILNT1_0046_C08.b : GAGGGGACGGGGGAgcccagctgaacccaggggtcttgctgaatgaagtactttatccca
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0071_F05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATTCC
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1067
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : aatgtccaggaattggtggggaaaa
ILNT1_0046_C08.b : ggtcattgaatgggggaaaaatcataaatgtatctgtccttgccttccgaactcggcacg
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0145_A07.b : nagttgtcxxxxxxxxxxxxxx
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1127
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : aaatgtgtgaggcaaacgaccggatcccctcgggaccccccctattaaaccttttcccag
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0145_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCATCGTGACCTCCCCCTATCAG
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1187
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : acccaagtttttaacacccaggcctttaaccctggggaagggaaaacccgaggctcctgg
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1247
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ccgccatccgggggtgagaaacttcaagggggtctctacccggaaggggtgccaattgat
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0035_E06.b : gagtttgtcxxxxxxx
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1307
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ctaaccccaaaacggattcgcccctcccgcccttaaaaggggttcccgttaaaaaaaaaa
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVRM1_0035_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCAACACACCCGAC
TCH01_0049_B01.b : tggggggcatgtgacttnacxxxxxxxxxxx
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1367
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : acgttgtctacccaaacccgggttccaaactcctcttttcccgagaaagcgggaaatcat
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
TCH01_0049_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgGCTGCACGA
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1426
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ttttcttc
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVR01_0051_F07.b : gtgtgtataaaaaattgcaaagtgxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1484
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVR01_0051_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATGTTAAC
LVR01_0106_F01.b : gggtttataatggctttgtgxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1542
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
LVR01_0106_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTGA
LVRM1_0205_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
LVRM1_0095_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_D09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1602
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : TTATGAACAAGGGCAAGCTGTTGAAagggggaaccccgcccgccccaagttgggcaaggt
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1662
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : cgtgggggtgcctgcccttgaccaatcccgaacggaatttcatccccttcccttccgccc
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1722
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : gggggggccttaataaaccccctgaatttgctggcccaatggggcccagaaggggaaggt
LVRM1_0172_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxx
SMG01_0057_F08.b : nccacattnnnnt
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1782
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : gggggggccccaatttccccttatgggggggggggatgttctcaaggggaaacctcctat
LVRM1_0071_F05.b : gatgtcagagaacctgtgtgggcccccgttggtaaaaagg
LVRM1_0172_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGGCGGGAAGCAAGACAAGC
SMG01_0057_F08.b : tgagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCAAGACAAGC
LVR01_0039_F03.b : gggggggctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1842
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ggtggttggggggccccccccccctgggggtggggtggataaaaaaaagggggggtgggg
LVRM1_0071_F05.b :
LVRM1_0095_A01.b : ccatccgactggccaaccgatcagcctggagatccccggtgacctacgggcatcattggt
LVR01_0039_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVRM1_0185_C03.b :
LVRM1_0096_A02.b : ttgtcxxxx
LVRM1_0146_H10.b : nagttgtcx
LVRM1_0077_E09.b : cgttgx
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1901
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ggccagggggagagaaaaaaaaacaacg
LVRM1_0071_F05.b :
LVRM1_0095_A01.b : tctcaggcccccccgtaaagcgtgcactccgcctgataacgtagagaggaaagacgacgc
LVRM1_0185_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAATTGACCCAG
LVRM1_0096_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCCAG
LVRM1_0146_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCCAG
LVRM1_0077_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACCCAG
LVRM1_0049_G04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 1961
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0095_A01.b : acggatgcnacctcgatatggtgggcccgccaacgcacgagtatgaatgggaacaaaact
LVRM1_0072_F09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2021
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0095_A01.b : cccatgtacccatgaccgatacccgcatctgaattgaacacgatcccgtccgctctccgc
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2081
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0095_A01.b : aatatctccagttggaagaatggcccaataaggccgaatacccgcgaaatctatagcgcc
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2141
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
LVRM1_0095_A01.b : tcccgccactataccccagacaacaaaaacgcaaccgcaacccaactcagacgccccaga
AMP01_0051_H05.b : nnnccagataannttagagatatcttagggctgctcxxxxxxxx
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2201
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
LVRM1_0095_A01.b : cccctatatccagcacaaaaaagacaccgccggaaggacagtaaggccccacacgcctct
AMP01_0051_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2261
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
LVRM1_0095_A01.b : ataacacccagtaccagacatgcagagtgaacgcgacagccacgaaccataacagagcca
AMP01_0051_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_F01.b : tcxxxxxxx
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2321
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
LVRM1_0095_A01.b : aaaactctcaataaccccaaaacgcacgaaccaccaatactcaaccaacaaactaggagc
LVRM1_0163_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGACCTGGATGAA
LVRM1_0093_F09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2380
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : NAAATAtcccgaaggaagaatcattttccgaagaccgttccccgaaagctggctgtggac
LVRM1_0205_G01.b :
LVRM1_0095_A01.b : gccgcgccgcggtgaaaaagacccatcggagggtccatgcggacaaataacgcccccatt
LVRM1_0128_D09.b : gaat
LVR01_0003_D03.b : tttaggtgacctacntagacxxxxx
LVRM1_0044_E10.b :
LVR01_0081_D06.b : ctttttgggtggxxxxxxxx
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2439
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : atttgaggattttaaggaccggacaaaaaggaatcccccccaagacccggaatggttttt
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVR01_0003_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0044_E10.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggG
LVR01_0081_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2498
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : taaaactccaccccactttggaaaatttgggcggaaacttgtcgaaaaaaaagggatttg
LVR01_0051_F07.b : TGGTTTTtaaaagactcca
LVR01_0106_F01.b : TGTTTTTAAAAGACTCCATCACCACTTtgggaaaattccggctgtgagcctggtccggaa
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
SMG01_0057_F08.b : TGTTTTTAAAAactccatcaccacttgggaaaatctgctggtaactttgtcgaacaaaaa
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2557
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : ggggttgaacccttg
LVR01_0051_F07.b :
LVR01_0106_F01.b : caaaaaaggggattctggcttggctgaacccctatggagggttgtgggtggagcccaaaa
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
SMG01_0057_F08.b : ggaatttgcggggctgaacccttataaggttgggtgaaacaaaatttcttcaatgatttg
LVRM1_0034_E04.b : gagttgtcxxxxxxx
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2617
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b : tttctttccattcaattctgccttccccccctactctcgtttttggccccaaatgaacca
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : gtttccccccaacccgttgggccaagggccagggggaaatcccaactttcctctaaactt
LVR01_0039_F03.b : atctgcgtctccccttacttccgtttgtgcccaatgaccaagtgggaaatcccaactatt
LVRM1_0096_A02.b : ctggcgtctcacgtatccagtgtgcgccatgaacaggggcagatcgaaccacccctataa
LVRM1_0034_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGAGCTATCCTCTA
LVRM1_0038_G08.b : gatttgtcxxxxx
LVRM1_0002_C09.b : cxxxxxxxxxxxxxxxxxxxx
TCH01_0042_C07.b : nnnnggcttggactatnacxxxxxxxxxxxx
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2676
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b : gggggggaaaaattcccaaacctttttccccctcctaaaaaatatccagggggga
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : cagggggggcaaaaatttcaggggcggggggaaatgtcttaaaatccatttttgggccgg
LVR01_0039_F03.b : cctctataaccaccaaggaaggcgaaggatctcaaggccagggggggaactgcccctaca
LVRM1_0096_A02.b : gt
LVRM1_0038_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACAATCCAGCTT
LVRM1_0002_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtatggTACAATCCAGCTT
TCH01_0042_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATCCAGCTT
LVRM1_0166_D03.b :
THY01_0017_H11.b : att
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2736
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ggccccccaaaaaaccccccaaaaaaatttaagggtccccccaattctttgggcgcgggc
LVR01_0039_F03.b : tcccacctttccgccagcatggccacccccaaaaaaagccccccccaacaaaatctttaa
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0166_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0017_H11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F05.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2796
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ttaaaattttggccctaaaaaaaggcccccaagggggagggaagggggccctgaaaaaca
LVR01_0039_F03.b : cgggtcccaacccaagtcctccagtggccggtgcccttaatttattgtggccctttaaaa
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
LVR01_0079_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTGGCCTCCAGGAGGTGGAGG
LVR01_0077_A04.b : gactctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_F09.b : ggttctttagcttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2856
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : tttttttttggggggttaaaaaacaacaaaggtgcgcaaaaaaaaaaaaaaaaaaaaggg
LVR01_0039_F03.b : aaatgggcccccataaaggggggtaggaaaaagggccccctctccctcctccccccttca
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
LVR01_0077_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAAGAAGACCCTGAAGGTCG
LVR01_0103_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGACCCTGAAGGTCG
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b : tttttccgtaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C11.b :
AMP01_0087_D06.b : taaggtatcttxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2916
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : gtccccccccggttttaaaaaaaggcccccggggggtcaaaaaaataaacccgtgttttt
LVR01_0039_F03.b : aaccatgtttgggggtggttccaaaaaaaaaccctttataggggccgggccaccaaaagg
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
LVRM1_0044_E10.b : gcgcccagaggagggccaatcgaagagactgtggtcattcgcataaggaaatcccaccct
LVRM1_0103_G07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0054_E03.b : nngggtgaacaxxxxxx
AMP01_0006_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 2976
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ctgcccccttctacgagggaaagaaaaacctctttgggaagcccgggtgtatataaatta
LVR01_0039_F03.b : aaaagggggaaattccacacaaaaaacagggggggtatccccctcccccccccacccccg
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
LVRM1_0044_E10.b : gcggtccagcagtgattgggacaagagggactctcatcgggcggatattgccaaactatt
ITT01_0054_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCGGATCTCAGCGACCAAGTCC
AMP01_0006_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCTCAGCGACCAAGTCC
LVR01_0078_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGCGACCAAGTCC
AMP01_0087_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3035
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : atttnggggggagaaaccccccccccccccgtggggggaaaaaaatagaacaccccattc
LVR01_0039_F03.b : tggaggtccaccaagataaactaagaaagtgggggcgtccacaaacattggggggggggt
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : agacancgagtcagagaccagatcctcctgcagggaccccggtggcccaganntgtagag
LVRM1_0044_E10.b : gtttcagcaccgaaagagtcccccggcacaggtgtcgttacgcaccccatgttaccgcga
LVRM1_0080_B10.b : acgtgaaataagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3094
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : tttttcttttcgcnaaaagaaaatttttgtaggagaaacct
LVR01_0039_F03.b : gggggtgttaaaaccggaggggga
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : atgccatcgacggggaccgctgaagcactcatccaaccccctncggctgtggggagcaga
LVRM1_0163_F01.b : GAGGATGCC
LVRM1_0044_E10.b : gggggaccgtgtggagatagtccgccacagcgtgatccacttaagtcgcccacacgtaca
LVRM1_0086_E10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A09.b : nagttgtcxxxxx
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3154
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : actgatcggatgacccccacgtcatgctgtgcactactgnacgccacgaacatgggagag
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVRM1_0044_E10.b : aattttgtgtgccaacccaccgcgggacgtccgcggagtataatgtgatcagcgcccacg
LVRM1_0126_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTGGACAGCAC
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3214
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ttcgcctgnaaagnaggcagagcctgnagctatcagaaaggtaccccagcactggcctca
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVRM1_0044_E10.b : cgtataatacattataaattgtaccgagcgcaggatgtcgtatagcgtgccgcgcgcata
LNG01_0067_F10.b : ttttngga
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3273
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : acaaaaactcagcttgccgcttcagaaccgctgtcacactgntgaagactagggtaaggc
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVRM1_0044_E10.b : gtcgttcgaataacagcat
LNG01_0067_F10.b : tggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_A05.b : ttt
AMP01_0054_H08.b : nnnnccagataatntaagggaataataxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B12.b : ctatagcgactcttxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3333
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ctcctatgaacaacccccccctcactccgtccctgggggcccaggtgttccgaaaacaaa
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVRM1_0044_E10.b :
LNG01_0046_A05.b : ttttcttttagctttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3392
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ccttgactccggaaaggcccgaacccaaattgggtccaaaaaaaaaaacacctttct
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVRM1_0044_E10.b :
LNG01_0046_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxgCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
AMP01_0054_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAG
AMP01_0065_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b : nnnnggataggaxxxxxxxxxxxx
LNG01_0105_F06.b : nnnnnggctag
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3452
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : aaccaaagccctgatgggattcttcgaaggaaaaaggggccccgtgatacccccaaaaaa
LVRM1_0044_E10.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b : AAGCAGA
LVRM1_0204_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGATT
TCH01_0076_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATT
LNG01_0105_F06.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_G03.b : cagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0021_G12.b :
AMP01_0099_E08.b : gggataxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3512
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : atgaattggtgggccttttcaaaaccctgaaagaaaaaaaaaactgtgtccccctgaacc
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b : GTTGGCTTaagacactgaggaaa
TCH01_0021_G12.b : ntttaggctaggacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3572
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : ccccctttttttttcttttttccgccccttcccgggaaggggcctaaaaaaaaaactttt
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
LVRM1_0166_D03.b :
TCH01_0021_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b : nnnnnnnnnnnnnnnnnnnnnnnccgaaaaagcattgtcaaaacagctggtacggtcctc
LVRM1_0206_C04.b : xxxxxxxxxxxxxxxx
LNG01_0020_F09.b : gcatcatgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_A07.b : aatgtcxxxxxxxxxxxxxxxx
LVRM1_0005_D08.b : cxxxxxxxxxxxxxxxxxxxxxx
TCH01_0088_F02.b : ttgtggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0008_A10.b : tgttngggattggacttgacxxxxxxxxxxxxxxx
LVRM1_0116_D01.b : taatgtcx
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3632
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : gttggttaaaaccccaaagagggttccaaaaaaaaaccccccgtgggtttttgcccgccc
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
LVRM1_0166_D03.b :
LVRM1_0025_G12.b : gattctcaagaatgttggcctactgACTACCTAGAATTAAA*AGACCATATACTGTGGCC
LVRM1_0206_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAATTAAAAAGACCATATACTGTGGCC
LNG01_0020_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctagTAAAAAGACCATATACTGTGGCC
LVRM1_0115_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGTGGCC
LVRM1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGCGGCC
TCH01_0088_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGTGGCC
TCH01_0008_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATATACTGTGGCC
LVRM1_0116_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTGGCC
LVRM1_0107_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_G01.b : a
CLNT1_0005_B04.b : nnggttgttnnngggccccgttcgcg
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3692
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : ccccacacccaccaccattaatatataaag
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAgctggatgaaccctcctccaaaaactctg
LVRM1_0166_D03.b :
THY01_0017_H11.b : ATTGCTGGTT
LVRM1_0079_G01.b : gttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTT
CLNT1_0005_B04.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3751
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : agccaagccaaaaaaaggacccctggaaggaacctgcccgaacctctacaagtgggagcc
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVRM1_0103_G07.b : tg
LVRM1_0053_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D01.b : x
THY01_0039_H03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_E12.b : tttagncag
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3809
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : caattctaacccctcttggtctgcgggtaaccaagacttgaacctgtccctctattgggg
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVRM1_0103_G07.b :
AMP01_0006_H08.b : GGAA*GCC*CATCCTACGCCC*TCTTGGCTttccggtaatcaaaaaattgaccctgaccc
LVRM1_0053_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0169_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGACTCTGTC
THY01_0039_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACTCTGTC
LNG01_0090_E12.b : cacgaaaagacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A01.b : cgttgtcxxxxxxxxx
TCH01_0045_A01.b : nttgcttggacttaaacxxxxxx
LVR01_0001_B06.b : aactg
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3869
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : ctggctcatgaacgaaatcatcggaggggcttggg
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b : CCTCCTA
LVR01_0103_F09.b : cccctctattgtgcgctgggctcaatgaagcaaagatactaagggaggtgggctattgga
LVRM1_0103_G07.b :
AMP01_0006_H08.b : tcctattggggcctggtccagggacctaaatactaccgagggggctaaggattcacccga
LVRM1_0080_B10.b : CCTCCTAn
LVRM1_0056_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactggCTACC
TCH01_0045_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACC
LVR01_0001_B06.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3929
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : atctccccaggcccacttttcatggggggttcccaaagcccttgggcccaaaaaaccaaa
LVRM1_0103_G07.b :
AMP01_0006_H08.b : ccattttcaaggggttctagcctggcccaaactaaagagattccggtccaccatttaaaa
AMP01_0087_D06.b : CAGGCCACTTTCATGGTGTcccagccctggccccatacagaaggatgtccctgaatccca
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b : CAGGCCACTTTCATGGTGgttcaagacttggc
ITT01_0015_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0117_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 3989
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : aaaaggaaggtccccttgaattcacaaagggaatttttaaaaaccttggggaagggtgtt
LVRM1_0103_G07.b :
ITT01_0054_E03.b : Aggatctgaacctggnatgtgtcatcacctgcccagcgcagcgctcagtcaggctcgtat
AMP01_0006_H08.b : tgaagttttaacaaatgactctcgaacctgtttcggacacttacttggtgaccgaaacct
LVR01_0078_C11.b :
AMP01_0087_D06.b : ggatctgacctggatgcgtcattcactgcccgccgcagggttcaatcaggaatcgaatct
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
AMP01_0054_H08.b : CAGGATCCGAACCTGGATGTGTtcctcccctggcccagcgcagcgcttcaattcaggatt
LVRM1_0072_G03.b : AAGGATTTGAACCTGGATGTGTCCcttcccctgtccagtccgcttggtcctgttaggcat
BKFL1_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4049
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0103_G07.b :
ITT01_0054_E03.b : ctctggaatctgctagcttctgcggtcgagagacaaagaaatgaaagatccataatagct
AMP01_0006_H08.b : tctgtatgagaacacaataaaaatatacttatact
LVR01_0078_C11.b :
AMP01_0087_D06.b : ctggaacctgctagcttcggcggtccaaaagccaaagaaaatgaaaattccctaattcct
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
AMP01_0054_H08.b : ctatcctccggggaatcgctaggcttccgcgggccgaanaataccaaagaaaatgagaga
LVRM1_0072_G03.b : ccgtatcctctgggaaactgccagcacttctgcgtgtccgtacatgataagccaagcgga
BKFL1_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGA
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4108
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : nnn
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gagggaagggcaggcacttgtcggtgtgacctgtacccgccaaacaagggaaaaccccgc
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b : gagggaaaggcaggcccttgtcggggtgacagtcccgcccaacaaaggcaaccccgtgca
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
AMP01_0054_H08.b : tccccttaataactgaagggaaaggccacgcaccctgtcgggggggggccatgtaccacg
LVRM1_0072_G03.b : tagattcccattattctgctcaagctaaagggtcaagccccctggtcggtggggaccatg
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4167
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : agagtttgacctcaggttcctatccnccccgaaccgtgaaacctcggaaccaaactctgg
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b : aagttgacccaggttccatatccccctgaacctgaa
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
AMP01_0054_H08.b : cccagaccaaaggcaaaccacctgcaagaagtttgacctcaggtttccatacatgcagcc
LVRM1_0072_G03.b : ttccctggcaaggattaaggggtaaacgactcggggctagatttgagccccaaggtttgc
LNG01_0073_C12.b : tgttntggcctggctataacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4227
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gcttaatttgtcagacttgaaacgagcgcctttaccggaaatccgggaaggtttcccgag
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
AMP01_0054_H08.b : ctgaaccagtgaagagcctcaggaagccagagctccatggtccttgacatctgtaccacg
LVRM1_0204_G01.b : ggcccgtgaa
LVRM1_0072_G03.b : aggaatcccagcaccctggatatattgcagaactcctcgtgtactccaagcgcccatggg
LNG01_0073_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCTCCATGGTCCTTGACATCT
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4286
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gaaaccaagcggggcggggggaactcttttggggaaaactcccaaacccctcctggaatc
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : GTACCAGtaccttggaaacaggatgccctatgtcaatctggattatcatgatgactggct
AMP01_0054_H08.b : taccttgaaaaccagaatgcactatgtcatcctgaataaaccctggatgacggcctctct
AMP01_0065_B12.b : GGACAGGGTA*CTTTGGAAACCAGGATGCCctatgtccaatctggaaaaaatcccgaaga
LVRM1_0204_G01.b :
LVRM1_0072_G03.b : tc
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4345
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : acccgggggatttttttctttttgtgg
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : ctctctgatatgaagactcaactgctgagcctggtgtgacgaatctctctaatatactga
AMP01_0054_H08.b : cggaaactgaaaactccactgttgaaccctggttgtgaccaatcatctctagttggacta
AMP01_0065_B12.b : cctggttcccctccgaaaacggaaaaccccaactgctgaaccttggtggggaccaattct
LVRM1_0204_G01.b :
LVRM1_0072_G03.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b : n
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4405
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : aaaaccctctcaaaaaaaccctctatctctggaaaaattcccaccctgaagatgtatcct
LNG01_0046_A05.b : aaaccatctctaaatttagaacctgaacaaaaaccccctccccaaaaaaaaacccccccc
AMP01_0054_H08.b : gacaagtcctctccaaaaaacccccttttattaacgggaaagatccccccccccggagga
AMP01_0065_B12.b : tccctaagttgagctgaaaaaaccccttcaaaaaaaacccctcttctttacgtgaaaaaa
LVRM1_0204_G01.b :
LVRM1_0072_G03.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LVRM1_0115_A07.b :
LVRM1_0116_D01.b :
MLN01_0045_A11.b : nnnngggctgtactatgacxxxx
SPLT1_0039_G12.b : nnn
AMP01_0071_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4465
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : tcagttcccgaacttagggggcttaacccggggcatcaggggacctttaaccgggaattt
LNG01_0046_A05.b : ttctccttccctggaaaaaaatttcccccccccccccgggaagaaaatgttttttccctt
AMP01_0054_H08.b : cgttatcc
AMP01_0065_B12.b : ttccccccccggaggatgttttcctttaaagtccccaaatttaaggggggcttaaacccc
LVRM1_0204_G01.b :
LNG01_0105_F06.b : GGACAgatctccacaccctggnagactgtatatcctcaaaagtcacagtactttaatgtg
LVRM1_0072_G03.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b : GGACAAGA
LVRM1_0116_D01.b :
LVRM1_0107_F07.b : GGAn
MLN01_0045_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAA
SPLT1_0039_G12.b : nncgcgagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAA
AMP01_0071_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4525
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : gccctgttcccccaaaaggaggggttaacctgcccaaaagtcctgctagaaatttccctc
LNG01_0046_A05.b : ttcaaaattttcccccaagtaattttttttatg
AMP01_0054_H08.b :
AMP01_0065_B12.b : ggggtcatcagggtatccccattaaaccgggaaacctgccc
LVRM1_0204_G01.b :
TCH01_0076_A02.b : TGTGGGGCTTAAACAACCCGGGTCAGTCAAGGggacccctataaaaccgggaggatcctg
LNG01_0105_F06.b : ggcttaacagcctggtcagtcaggtgtactcctataacactgnatgatcttgcacccgtt
LVRM1_0072_G03.b :
AMP01_0099_E08.b : gtggggctataccgcctgggccagtcaaggggtactcctattcaaccctggatgaatcct
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
AMP01_0071_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACCTGGATGAGTC
ILNT1_0096_E02.b :
---------+---------+---------+---------+---------+---------+ 4584
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : aaaaaaccctaacgcgaggggcgcggggttgtaaactccaagggaaattaaagccgaaca
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b : gacccggtctaccaccccgagaggaggagggatgctaaacaatttgtccaaaaaaattgt
LNG01_0105_F06.b : ctacaccccaaaggaggacggatgctaacaactctgcccaagaaatggtccctgc