[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000833

Length: 5,494

Sequence [FASTA format sequence]
CTACTGGACT TCCCCCCCCA CCCCCGTCCT TTCCCTCTGT CCCTTTGTCC CTCCACCGTC
CCTCCATCAT GGGGTCCACC TCGGGTCCCA GGCTGCTGCT GCTGCTCCTG ACCAGCCTCC
CCCTAGCCCT GGGGGATCCC ATTTACACCA TAATCACCCC CAACGTCCTG CGTCTGGAGA
GTGAGGAGAT GGTGGTGTTG GAGGCCCACG AAGGGCAAGG GGATATTCGG GTTTCGGTCA
CCGTCCATGA CTTCCCGGCC AAGAGACAGG TGCTGTCCAG CGAGACCACG ACGCTGAACA
ACGCCAACAA CTACCTGAGC ACCGTCAACA TCAAGATCCC GGCCAGCAAG GAGTTCAAAT
CAGAGAAGGG GCACAAGTTC GTGACCGTTC AGGCGCTCTT TGGGAACGTC CAGGTGGAGA
AGGTGGTGCT GGTCAGCCTT CAGAGCGGGT ACCTCTTCAT CCAGACGGAC AAGACTATCT
ACACCCCAGG CTCCACGGTC CTCTATCGGA TCTTCACCGT TGACCACAAG CTGCTGCCCG
TGGGCCAGAC CATTGTCGTC ACCATTGAGA CCCCTGAAGG CATTGACATC AAACGGGACT
CCCTGTCATC CCACAACCAG TTTGGCATCT TGGCTTTGTC TTGGAACATC CCAGAGCTGG
TCAACATGGG GCAGTGGAAG ATCCGAGCCC ACTATGAGGA TGCTCCCCAG CAAGTCTTCT
CTGCTGAGTT TGAGGTGAAG GAATATGTGC TGCCCAGTTT TGAGGTCCAA GTGGAGCCTT
CAGAGAAATT CTACTACATC GATGACCCAA ATGGCCTAAC TGTCAACATC ATTGCCAGGT
TCTTGTACGG GGAGAGTGTG GATGGAACAG CTTTCGTCAT CTTTGGGGTC CAGGACGGTG
ACCAGAGGAT TTCATTGTCT CAGTCCCTCA CCCGTGTTCC GATCATTGAT GGGACGGGGG
AAGCCACGCT GAGCCAAGGG GTCTTGCTGA ATGGAGTACA TTATTCCAGT GTCAATGACT
TGGTGGGAAA ATCCATATAT GTATCTGTCA CTGTCATTCT GAACTCAGGC AGCGACATGG
TGGAGGCAGA GCGCACCGGG ATCCCCATCG TGACCTCCCC CTATCAGATC CACTTCACCA
AGACCCCCAA GTTCTTCAAA CCCGCCATGC CCTTCGACCT CATGGTGTAT GTGACGAACC
CCGACGGCTC CCCTGCCCGC CACATCCCGG TGGTGACTGA GGACTTCAAA GTGAGGTCCT
TAACCCAGGA GGACGGTGTG GCCAAACTGA GCATCAACAC ACCCGACAAC CGGAATTCCC
TGCCCATCAC CGTACGCACT GAGAAGGACG GTATCCCAGC TGCACGACAA GCGACCAAGA
CCATGCACGT CCTACCCTAC AACACCCAGG GTAACTCCAA GAACTACCTC CACCTCTCTG
TGCCCCGCGT GGAGCTCAAG CCAGGGGAGA ATCTCAATGT TAACTTCCAC CTGCGCACGG
ACCCCGGCTA CCAAGACAAG ATCCGATACT TTACCTACCT GATCATGAAC AAGGGCAAGC
TGTTGAAGGT GGGACGCCAG CCGCGCGAGT CTGGCCAGGT CGTGGTGGTG CTGCCCTTGA
CCATCACGAC GGACTTCATC CCTTCCTTCC GCCTGGTGGC TTATTACACC CTGATTGCTG
CCAATGGCCA GAGGGAGGTG GTGGCCGATT CCGTATGGGT GGATGTCAAG GACTCATGTG
TGGGCACGCT GGTGGTAAAA GGTGGCGGGA AGCAAGACAA GCAGCATCGG CCTGGGCAAC
AGATGACCCT GGAGATCCAG GGTGACCGAG GGGCCCGAGT GGGGCTGGTG GCCGTGGACA
AGGGCGTGTT TGTGCTGAAT AAGAAAAACA AATTGACCCA GCGTAAGATC TGGGATGTCG
TGGAGAAGGC AGACATTGGT TGCACACCAG GCAGTGGAAA GGACTTTGCC GGAGTCTTCA
CAGATGCAGG GCTGGCCTTC AAGAGCAGCA AGGGCCTACA GACTCCCCAG AGGGCAGATC
TTGAGTGTCC GAAACCAGCC GCCCGCAAAC GCCGTTCCGT GCAGCTCATG GAGAAAAGGA
TGGACAAACT GGGTCAGTAC AGCAAGGAGC TGCGCAGATG TTGTGAGCAT GGCATGCGGG
ACAACCCCAT GAAGTTCTCG TGCCAGCGCC GGGCTCAGTT CATCCAGCAT GGTGATGCCT
GCGTGAAGGC CTTCCTGGAC TGCTGCGAAT ACATCGCAAA GCTGCGGCAG CAGCACAGCC
GCAACAAGCC CCTGGGGCTG GCCAGGAGTG ACCTGGATGA AGAAATAATC CCAGAGGAAG
ACATCATTTC CAGAAGCCAG TTCCCCGAGA GCTGGCTGTG GACCATTGAG GAGTTTAAAG
AACCAGACAA AAATGGAATC TCCACCAAGA CCATGAATGT GTTTTTAAAA GACTCCATCA
CCACTTGGGA GATTCTGGCT GTGAGCTTGT CGGACAAGAA AGGGATCTGC GTGGCTGACC
CCTATGAGGT TGTGGTGAAG CAAGATTTCT TCATCGATCT GCGTCTCCCC TACTCCGTTG
TGCGCAATGA GCAGGTGGAG ATCCGAGCTA TCCTCTATAA CTACAGGGAG GCAGAGGATC
TCAAGGTCAG GGTGGAACTG CTCTACAATC CAGCTTTCTG CAGCCTGGCC ACCGCCAAGA
AGCGCCACCA ACAGACTCTA ACGGTCCCAG CCAAGTCCTC AGTGCCCGTG CCTTACATCA
TTGTGCCCTT GAAGACTGGC CTCCAGGAGG TGGAGGTCAA GGCCGCCGTC TACAACCACT
TCATCAGTGA TGGTGTCAAG AAGACCCTGA AGGTCGTGCC AGAAGGAATG AGAGTCAACA
AAACTGTGGT CACTCGCACA CTGGATCCAG AACATAAGGG CCAACAGGGA GTGCAACGAG
AGGAAATCCC ACCTGCGGAT CTCAGCGACC AAGTCCCAGA CACGGAGTCA GAGACCAAGA
TCCTCCTGCA AGGGACCCCG GTGGCCCAGA TGGTAGAGGA TGCCATCGAC GGGGACCGGC
TGAAGCACCT CATCCAAACC CCCTCCGGCT GTGGGGAGCA GAACATGATC GGCATGACGC
CCACAGTCAT CGCTGTGCAC TACCTGGACA GCACCGAACA ATGGGAGAAG TTCGGCCTGG
AGAAGAGGCA GGAAGCCTTG GAGCTCATCA AGAAGGGGTA CACCCAGCAA CTGGCCTTCA
GACAAAAGAA CTCAGCCTTT GCCGCCTTCC AGGACCGGCT GTCCAGCACC TGGCTGACAG
CCTATGTGGT CAAGGTCTTC GCTATGGCAG CCAACCTCAT CGCCATCGAC TCCCAGGTCC
TCTGTGGGGC CGTCAAATGG CTGATCCTGG AGAAGCAGAA GCCTGATGGA GTCTTCGAGG
AGAATGGGCC CGTGATACAC CAAGAAATGA TTGGTGGCTT CAAGAACACT GAGGAGAAAG
ACGTGTCCCT GACAGCCTTT GTTCTCATCG CGCTGCAGGA GGCTAAAGAC ATCTGTGAAC
CACAGGTCAA TAGCCTGTTG CGCAGCATCA ATAAGGCAAG AGACTTCCTC GCAGACTACT
ACCTAGAATT AAAAAGACCA TATACTGTGG CCATTGCTGG TTATGCCCTG GCTCTATCTG
ACAAGCTGGA TGAGCCCTTC CTCAACAAAC TTCTGAGCAC AGCCAAAGAA AGGAACCGCT
GGGAGGAACC TGGCCAGAAG CTCTACAATG TGGAGGCCAC ATCCTACGCC CTCTTGGCTC
TGCTGGTAGT CAAAGACTTT GACTCTGTCC CTCCTATTGT GCGCTGGCTC AATGAGCAGA
GATACTACGG AGGTGGCTAT GGATCTACCC AGGCCACTTT CATGGTGTTC CAAGCCTTGG
CCCAATACCA GAAGGATGTC CCTGATCACA AGGATCTGAA CCTGGATGTG TCCATCCACC
TGCCCAGCCG CAGCGCTCCA GTCAGGCATC GTATCCTCTG GGAATCTGCT AGCCTTCTGC
GGTCAGAAGA GACAAAAGAA AATGAGAGAT TCACATTAAT AGCTGAAGGG AAAGGGCAAG
GCACCTTGTC GGTGGTGACC ATGTACCACG CCAAGACCAA AGGCAAAACC ACCTGCAAGA
AGTTTGACCT CAAGGTTTCC ATACATCCAG CCCCTGAACC AGTGAAGAAG CCTCAGGAAG
CCAAGAGCTC CATGGTCCTT GACATCTGTA CCAGGTACCT TGGAAACCAG GATGCCACTA
TGTCAATCCT GGATATATCC ATGATGACTG GCTTCTCTCC TGATACTGAA GACCTCAAAC
TGCTGAGCAC TGGTGTGGAC AGATACATCT CTAAGTATGA GCTGAACAAA GCCCTCTCCA
ACAAAAACAC CCTCATCATC TACCTGGACA AGATCTCACA CACCCTGGAG GACTGTATAT
CCTTCAAAGT TCACCAGTAC TTTAATGTGG GGCTTATACA GCCTGGGTCA GTCAAGGTGT
ACTCCTATTA CAACCTGGAT GAGTCTTGCA CCCGGTTCTA CCACCCCGAG AAGGAGGACG
GGATGCTAAA CAAACTCTGC CACAAAGAAA TGTGTCGCTG TGCTGAGGAG AACTGCTTCA
TGCACCATGA CGAAGAGGAG GTCACCCTGG ACGACCGGCT GGAAAGGGCC TGCGAGCCCG
GCGTGGACTA TGTGTACAAG ACCAGACTTC TCAAGAAGGA GCTGTCAGAT GACTTTGACG
ATTACATCAT GGTCATCGAG CAGATCATCA AATCAGGCTC CGATGAAGTG CAGGTTGGAC
AGGAGCGCAG GTTCATCAGC CACATCAAAT GCAGAGAAGC CCTCAAACTA AAGGAGGGGG
GACACTACCT TGTGTGGGGA GTCTCCTCCG ACCTGTGGGG AGAGAAACCC AACATCAGCT
ACATCATTGG GAAGGACACC TGGGTGGAGC TGTGGCCTGA TGGTGATGTA TGCCAAGATG
AGGAGAACCA GAAACAGTGC CAGGACCTGG CCAACTTCTC TGAGAACATG GTCGTCTTTG
GTTGCCCCAA CTGATGCCAC TCCCCCACAG TCTACCCAAT AAAGCTCCAG TTATCTTTCA
CATTTCCCCC CAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAANACGCGG GGCGGCGACC CCCCGTGGGG GGGGGGGAGA GGGGCCCCCA
AAAAAAAAAA AAAAGGGTTG GTTTTGGGAA ACCCCCCGGG GGGGGGGGAG AAAAAAAAAG
TTTTTTTTTG AAAAATTGGA AGGCCTTTTT TTTTTTTTTA ACCCCTTAAA GCGCGGAAAA
AAAAATTTAA ACACACCTGT TCGTTTTTTT TTTTTTTTCA CGGGGGGGGG GGGGGGGGGG
GAGGTTTTTT TTCCTTAAAA AAACCCCCCC CCCC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 precursor [Homo sapiens]. 25610.0O
Contig/Assembly ProteinC5complement C5 preproprotein [Homo sapiens]. 6720.0O
Contig/Assembly ProteinC4Bcomplement C4-B preproprotein [Homo sapiens]. 6400.0O
Contig/Assembly ProteinLOC100293534complement C4-B-like preproprotein [Homo sapiens]. 6390.0O
Contig/Assembly ProteinC4Acomplement C4-A preproprotein [Homo sapiens]. 6350.0O
Contig/Assembly ProteinC4BPREDICTED: complement C4-A isoform 1 [Homo sapiens]. 6350.0O
Contig/Assembly ProteinC4BPREDICTED: complement C4-A isoform 2 [Homo sapiens]. 629e-179O
Contig/Assembly ProteinA2ML1alpha-2-macroglobulin-like protein 1 precursor [Homo sapiens]. 2483e-65O
Contig/Assembly ProteinCD109CD109 antigen isoform 1 precursor [Homo sapiens]. 2454e-64O
Contig/Assembly ProteinCD109CD109 antigen isoform 3 precursor [Homo sapiens]. 2454e-64O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 [Mus musculus]. 25630.0O
Contig/Assembly ProteinLOC100048759PREDICTED: complement C3-like, partial [Mus musculus]. 24020.0O
Contig/Assembly ProteinHccomplement C5 preproprotein [Mus musculus]. 6820.0O
Contig/Assembly ProteinC4bcomplement C4-B precursor [Mus musculus]. 6360.0O
Contig/Assembly ProteinLOC675521PREDICTED: complement C4-B-like isoform 5 [Mus musculus]. 6330.0O
Contig/Assembly ProteinC4asex-limited protein [Mus musculus]. 613e-175O
Contig/Assembly ProteinCd109CD109 antigen precursor [Mus musculus]. 2445e-64O
Contig/Assembly ProteinA2malpha-2-macroglobulin-P precursor [Mus musculus]. 2353e-61O
Contig/Assembly ProteinGm7298PREDICTED: murinoglobulin-1-like [Mus musculus]. 2177e-56O
Contig/Assembly ProteinPzpalpha-2-macroglobulin precursor [Mus musculus]. 2177e-56O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC476728PREDICTED: similar to Complement C3 precursor [Canis familiaris]. 23650.0O
Contig/Assembly ProteinLOC484960PREDICTED: similar to Complement C3 precursor [Canis familiaris]. 6880.0O
Contig/Assembly ProteinLOC481722PREDICTED: similar to Complement C4 precursor [Canis familiaris]. 567e-161O
Contig/Assembly ProteinC5PREDICTED: similar to complement component 5 [Canis familiaris]. 3314e-90O
Contig/Assembly ProteinLOC474970PREDICTED: similar to CD109 [Canis familiaris]. 2478e-65O
Contig/Assembly ProteinLOC477699PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 2323e-60
Contig/Assembly ProteinLOC486697PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 2301e-59O
Contig/Assembly ProteinLOC611458PREDICTED: similar to pregnancy-zone protein [Canis familiaris]. 2123e-54O
Contig/Assembly ProteinLOC484845PREDICTED: similar to C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Canis familiaris]. 1979e-50
Contig/Assembly ProteinLOC611455PREDICTED: similar to Alpha-2-macroglobulin precursor (Alpha-2-M) [Canis familiaris]. 1654e-40


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 preproprotein [Bos taurus]. 27770.0O
Contig/Assembly ProteinLOC528040PREDICTED: hemolytic complement-like [Bos taurus]. 10160.0O
Contig/Assembly ProteinLOC528040PREDICTED: hemolytic complement-like [Bos taurus]. 10160.0O
Contig/Assembly ProteinC5complement C5a anaphylatoxin [Bos taurus]. 6900.0O
Contig/Assembly ProteinC4Acomplement C4 [Bos taurus]. 6440.0O
Contig/Assembly ProteinLOC617696PREDICTED: similar to complement component 4A [Bos taurus]. 6370.0O
Contig/Assembly ProteinCD109PREDICTED: thiolester containing protein II-like [Bos taurus]. 2448e-64O
Contig/Assembly ProteinCD109PREDICTED: thiolester containing protein II-like, partial [Bos taurus]. 2448e-64O
Contig/Assembly ProteinA2ML1PREDICTED: alpha-2-macroglobulin-like 1 [Bos taurus]. 2392e-62O
Contig/Assembly ProteinA2Malpha-2-macroglobulin [Bos taurus]. 2185e-56O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinC3complement C3 [Sus scrofa]. 32530.0O
Contig/Assembly ProteinC5complement C5 [Sus scrofa]. 6850.0O
Contig/Assembly ProteinLOC100517145PREDICTED: complement C3-like [Sus scrofa]. 6830.0O
Contig/Assembly ProteinC4complement C4 [Sus scrofa]. 6480.0O
Contig/Assembly ProteinA2MPREDICTED: LOW QUALITY PROTEIN: alpha-2-macroglobulin [Sus scrofa]. 2144e-55O
Contig/Assembly ProteinPZPPREDICTED: alpha-2-macroglobulin [Sus scrofa]. 2137e-55O
Contig/Assembly ProteinCPAMD8PREDICTED: c3 and PZP-like alpha-2-macroglobulin domain-containing protein 8 [Sus scrofa]. 1922e-48
Contig/Assembly ProteinA2ML1PREDICTED: alpha-2-macroglobulin-like protein 1 [Sus scrofa]. 1822e-45O
Contig/Assembly ProteinCD109PREDICTED: CD109 antigen isoform 1 [Sus scrofa]. 1501e-35O
Contig/Assembly ProteinSLC25A23PREDICTED: calcium-binding mitochondrial carrier protein SCaMC-3 [Sus scrofa]. 1208e-27O


Assembly Members: 90      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010006H08AMP01_0006_H08.bBW955437 
AMP010051H05AMP01_0051_H05.bBW958648 
AMP010054H08AMP01_0054_H08.bBW958893 
AMP010065B12AMP01_0065_B12.bBW959700 
AMP010071E01AMP01_0071_E01.bBW960180 
AMP010087D06AMP01_0087_D06.bBW961349 
AMP010099E08AMP01_0099_E08.bBW962399 
BKFL10117C07BKFL1_0117_C07.bFS656751 
CLNT10005B04CLNT1_0005_B04.bFS657409 
ILNT10046C08ILNT1_0046_C08.bHX230330 
ILNT10096E02ILNT1_0096_E02.bHX234413 
ITT010015C05ITT01_0015_C05.bBW977340 
ITT010054E03ITT01_0054_E03.bBW980800 
LNG010020F09LNG01_0020_F09.bBP438638 
LNG010046A05LNG01_0046_A05.bBP433366 
LNG010067F10LNG01_0067_F10.bBP438754 
LNG010073C12LNG01_0073_C12.bBP435911 
LNG010090E12LNG01_0090_E12.bBP437932 
LNG010105F06LNG01_0105_F06.bBP438446 
LVR010001B06LVR01_0001_B06.bBP442247 
LVR010003D03LVR01_0003_D03.b  
LVR010039F03LVR01_0039_F03.bBP445606 
LVR010051F07LVR01_0051_F07.bBP445906 
LVR010077A04LVR01_0077_A04.bBP441236 
LVR010078C11LVR01_0078_C11.bBP443585 
LVR010079F05LVR01_0079_F05.bBP445786 
LVR010081D06LVR01_0081_D06.bBP444109 
LVR010103F09LVR01_0103_F09.bBP446080 
LVR010106F01LVR01_0106_F01.bBP445499 
LVRM10002C09LVRM1_0002_C09.bBP138734 
LVRM10005D08LVRM1_0005_D08.bBP139178 
LVRM10005F08LVRM1_0005_F08.bBP140083 
LVRM10025G12LVRM1_0025_G12.bFS678441 
LVRM10034E04LVRM1_0034_E04.bCJ001341 
LVRM10035E06LVRM1_0035_E06.bCJ001426 
LVRM10038G08LVRM1_0038_G08.bCJ001702 
LVRM10040G07LVRM1_0040_G07.bCJ001858 
LVRM10044E10LVRM1_0044_E10.bCJ002178 
LVRM10047A07LVRM1_0047_A07.bCJ002270 
LVRM10049G04LVRM1_0049_G04.bBP453181 
LVRM10049H01LVRM1_0049_H01.bBP453821 
LVRM10053B08LVRM1_0053_B08.bBP138250 
LVRM10056A01LVRM1_0056_A01.bBP137516 
LVRM10071F05LVRM1_0071_F05.bBP452451 
LVRM10072F09LVRM1_0072_F09.bBP452725 
LVRM10072G03LVRM1_0072_G03.bBP453120 
LVRM10077E09LVRM1_0077_E09.bBP139692 
LVRM10077G02LVRM1_0077_G02.bBP140345 AK394185
LVRM10079G01LVRM1_0079_G01.bBP140311 
LVRM10080B10LVRM1_0080_B10.bBP138353 
LVRM10086E10LVRM1_0086_E10.bCJ002894 
LVRM10091B08LVRM1_0091_B08.bCJ003271 
LVRM10093F09LVRM1_0093_F09.bCJ003476 
LVRM10095A01LVRM1_0095_A01.bBW963030 
LVRM10096A02LVRM1_0096_A02.bCJ003657 
LVRM10103G07LVRM1_0103_G07.bBP453398 
LVRM10107F07LVRM1_0107_F07.bBP452588 
LVRM10115A07LVRM1_0115_A07.bBP448545 
LVRM10116D01LVRM1_0116_D01.bBP450571 
LVRM10126A09LVRM1_0126_A09.bBP448690 
LVRM10128D09LVRM1_0128_D09.bBP451147 
LVRM10145A07LVRM1_0145_A07.bBP448572 
LVRM10146H10LVRM1_0146_H10.bBP454492 
LVRM10163F01LVRM1_0163_F01.bCJ004111 
LVRM10166D03LVRM1_0166_D03.bCJ004331 
LVRM10169D01LVRM1_0169_D01.bCJ004565 
LVRM10172D12LVRM1_0172_D12.bCJ004817 
LVRM10185C03LVRM1_0185_C03.bCJ005848 
LVRM10195A02LVRM1_0195_A02.bCJ006557 
LVRM10198F09LVRM1_0198_F09.bCJ006875 
LVRM10200B05LVRM1_0200_B05.bBW963319 
LVRM10204G01LVRM1_0204_G01.b  
LVRM10205G01LVRM1_0205_G01.bCJ007453 
LVRM10206C04LVRM1_0206_C04.bCJ007492 
LVRM10208C01LVRM1_0208_C01.bCJ007665 
MLN010045A11MLN01_0045_A11.bCJ011165 AK346730
OVR010095C12OVR01_0095_C12.bBW967752 
SMG010057F08SMG01_0057_F08.bFS718220 
SPLT10039G12SPLT1_0039_G12.bHX242258 
SPLT10055H12SPLT1_0055_H12.b  
TCH010008A10TCH01_0008_A10.bCJ023013 
TCH010021G12TCH01_0021_G12.bCJ024017 
TCH010042C07TCH01_0042_C07.bCJ025571 
TCH010045A01TCH01_0045_A01.bCJ025775 
TCH010049B01TCH01_0049_B01.bCJ026072 
TCH010076A02TCH01_0076_A02.bCJ027880 
TCH010088F02TCH01_0088_F02.bCJ028863 
THY010017H11THY01_0017_H11.bBP169184 
THY010039H03THY01_0039_H03.bBP168342 
UTR010070F01UTR01_0070_F01.bBP464131 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
1973A070.583MSGGA/G
C410.417GGC/G
2141C520.500MSTGC/C
T070.500TGT/C
2558C040.400MSGAC/D
T330.600GAT/D
3590C1400.778BSCTC/L
T040.222CTT/L


Alignment:      TOP

20110601C-000833 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0077_G02.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_F08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_A07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_C01.b : xxxxxxxxxxxxxxxx
LVRM1_0195_A02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_G07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_C12.b : nggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0046_C08.b : nnnnggagcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_B05.b : ncgttg
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ...........CTACTGGACTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
---------+---------+---------+---------+---------+---------+ 49
LVRM1_0077_G02.b : xxxxxxxxxxxCTACTGGACTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0198_F09.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0005_F08.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCACGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0091_B08.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCTGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0047_A07.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCTGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0208_C01.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCTGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0195_A02.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0040_G07.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCTGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0049_H01.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCTGTCCTTTCCCTCTGTCCCTTTGTC
OVR01_0095_C12.b : xxxxxxxxxxxxxxxxxxxCTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
ILNT1_0046_C08.b : xxxxxxxxxxxxxxxxxxaCTTCCCCCCCCACCCCCGTCCTTTCCCTCTGTCCCTTTGTC
LVRM1_0200_B05.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTGTC
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
---------+---------+---------+---------+---------+---------+ 109
LVRM1_0077_G02.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0198_F09.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0005_F08.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0091_B08.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0047_A07.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0208_C01.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0195_A02.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0040_G07.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0049_H01.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
OVR01_0095_C12.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
ILNT1_0046_C08.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
LVRM1_0200_B05.b : CCTCCACCGTCCCTCCATCATGGGGTCCACCTCGGGTCCCAGGCTGCTGCTGCTGCTCCT
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
---------+---------+---------+---------+---------+---------+ 169
LVRM1_0077_G02.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0198_F09.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0005_F08.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0091_B08.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0047_A07.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0208_C01.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0195_A02.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0040_G07.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0049_H01.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
OVR01_0095_C12.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
ILNT1_0046_C08.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
LVRM1_0200_B05.b : GACCAGCCTCCCCCTAGCCCTGGGGGATCCCATTTACACCATAATCACCCCCAACGTCCT
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
---------+---------+---------+---------+---------+---------+ 229
LVRM1_0077_G02.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0198_F09.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0005_F08.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0091_B08.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0047_A07.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0208_C01.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0195_A02.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0040_G07.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0049_H01.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
OVR01_0095_C12.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
ILNT1_0046_C08.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
LVRM1_0200_B05.b : GCGTCTGGAGAGTGAGGAGATGGTGGTGTTGGAGGCCCACGAAGGGCAAGGGGATATTCG
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
---------+---------+---------+---------+---------+---------+ 289
LVRM1_0077_G02.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0198_F09.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0005_F08.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0091_B08.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0047_A07.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0208_C01.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0195_A02.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0040_G07.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0049_H01.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
OVR01_0095_C12.b : AGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
ILNT1_0046_C08.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
LVRM1_0200_B05.b : GGTTTCGGTCACCGTCCATGACTTCCCGGCCAAGAGACAGGTGCTGTCCAGCGAGACCAC
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
---------+---------+---------+---------+---------+---------+ 349
LVRM1_0077_G02.b : GACGCTGAACAACGCCNACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0198_F09.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0005_F08.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0091_B08.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0047_A07.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0208_C01.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0195_A02.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0040_G07.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0049_H01.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
OVR01_0095_C12.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
ILNT1_0046_C08.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
LVRM1_0200_B05.b : GACGCTGAACAACGCCAACAACTACCTGAGCACCGTCAACATCAAGATCCCGGCCAGCAA
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
---------+---------+---------+---------+---------+---------+ 409
LVRM1_0077_G02.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGCGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0198_F09.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0005_F08.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0091_B08.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0047_A07.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0208_C01.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0195_A02.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0040_G07.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0049_H01.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
OVR01_0095_C12.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
ILNT1_0046_C08.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
LVRM1_0200_B05.b : GGAGTTCAAATCAGAGAAGGGGCACAAGTTCGTGACCGTTCAGGCGCTCTTTGGGAACGT
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
---------+---------+---------+---------+---------+---------+ 469
LVRM1_0077_G02.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0198_F09.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0005_F08.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCATAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0091_B08.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAAAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0047_A07.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0208_C01.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGGGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0195_A02.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0040_G07.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0049_H01.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
OVR01_0095_C12.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
ILNT1_0046_C08.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
LVRM1_0200_B05.b : CCAGGTGGAGAAGGTGGTGCTGGTCAGCCTTCAGAGCGGGTACCTCTTCATCCAGACGGA
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
---------+---------+---------+---------+---------+---------+ 529
LVRM1_0077_G02.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0198_F09.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0005_F08.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGGTGACCACCA
LVRM1_0091_B08.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0047_A07.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0208_C01.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0195_A02.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0040_G07.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0049_H01.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
OVR01_0095_C12.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
ILNT1_0046_C08.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
LVRM1_0200_B05.b : CAAGACTATCTACACCCCAGGCTCCACGGTCCTCTATCGGATCTTCACCGTTGACCACAA
SPLT1_0055_H12.b : nnnaaagcgagtagacgxxxxx
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
---------+---------+---------+---------+---------+---------+ 588
LVRM1_0077_G02.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
LVRM1_0198_F09.b : *GCTGCTGCCCGTGGGCCAGACCAATGTCGTCACCATTGAAACACCTGAACGCATCGACA
LVRM1_0005_F08.b : *GCTGCTGCCCGGGGGCCAGACCATTGGCGTCACCATTGAGACCCCTTAAGGCATTGACA
LVRM1_0091_B08.b : AGCTGCTGCCCGTGGGCCAAACCATTGTCGTCACCATTGAGACCCCTGAAAGCATTGACA
LVRM1_0047_A07.b : *TCTGCTGCCCGTGGGCCACACCATTGTCGTCGCTATTGAGACCCCTGAAGGCATTGACA
LVRM1_0208_C01.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGGCCCCTGAAGGCATTGACA
LVRM1_0195_A02.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
LVRM1_0040_G07.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
LVRM1_0049_H01.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
OVR01_0095_C12.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
ILNT1_0046_C08.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
LVRM1_0200_B05.b : *GCTGCTGCCCGTGGGCCAGACCATTGTCGTCACCATTGAGACCCCTGAAGGCATTGACA
SPLT1_0055_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGACCCCTGAAGGCATTGACA
UTR01_0070_F01.b : gctatxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
---------+---------+---------+---------+---------+---------+ 648
LVRM1_0077_G02.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
LVRM1_0198_F09.b : TCAAAAGGGACTCCTTGTTATCCCACAAacatcttgactccatgccttgtgacttgtaca
LVRM1_0005_F08.b : TGAAACGGGACTCCCTGGCATCCCACAccaggttggcatgttggctttttctcagaccat
LVRM1_0091_B08.b : TCAAACGGGACTCCCTGTCATCCCAGAACCAGTTTGGCATCCTGGCTTTGTCTTGGAACC
LVRM1_0047_A07.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCGTGGCTTCGTCTTGGAACA
LVRM1_0208_C01.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGGACA
LVRM1_0195_A02.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
LVRM1_0040_G07.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
LVRM1_0049_H01.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
OVR01_0095_C12.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
ILNT1_0046_C08.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
LVRM1_0200_B05.b : TCAAACGGGACTCCCTGTCATCCCACAACCAGTTTGGCATCTTGGCTTTGTCTTGGAACA
SPLT1_0055_H12.b : TCAAACGGGACTCCCTGTCATCCCACAAagctccagttatctttcaaaaaaaaaaaaaaa
UTR01_0070_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGAACA
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
---------+---------+---------+---------+---------+---------+ 707
LVRM1_0077_G02.b : TCCNAAAGCTGGTCAACATG*GCGCAGTGCAAGATCCGAGCCCACTATGAGGATGCTCCC
LVRM1_0198_F09.b : accaccgcacaggataaatggggacagatgaaaattcaaaacaattaaacgaagagacaa
LVRM1_0005_F08.b : tccacaactggctaacatcgggaacgcgagatccctgcccaccagaaggtagcttccaac
LVRM1_0091_B08.b : TCCCAAGACTGGTCCACCTG*GGGCACTGGAAGATCCGAccccatatgaggaagcccccc
LVRM1_0047_A07.b : TCTCAAACCTGGTCACCATGGGGGCAGTGGAAGATTCAAGCCCACTCTGAGGATGCcccc
LVRM1_0208_C01.b : TCCCAAAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTGCC
LVRM1_0195_A02.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
LVRM1_0040_G07.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
LVRM1_0049_H01.b : TCCCAGAGCTGGTCAACATG*NGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
OVR01_0095_C12.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
ILNT1_0046_C08.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
LVRM1_0200_B05.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
SPLT1_0055_H12.b : aaaaa
UTR01_0070_F01.b : TCCCAGAGCTGGTCAACATG*GGGCAGTGGAAGATCCGAGCCCACTATGAGGATGCTCCC
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAGCAAGTCTTCTCTGCTGAGTTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGGTC
---------+---------+---------+---------+---------+---------+ 767
LVRM1_0077_G02.b : CAGCAAGTCTTCTCTGCTNGAGTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGG
LVRM1_0198_F09.b : accagctcttcttgcgtatattgtagtcaccgtattgcgccgtcact
LVRM1_0005_F08.b : aggacttcatttgttaactttacgtgaacgtattctagtacccactccgtccgtcatttc
LVRM1_0091_B08.b : agcagtcctctccgcgaaagataaagtaaagga
LVRM1_0047_A07.b : gacaactcttctcggctgactttaagtgcacgacaagtg
LVRM1_0208_C01.b : CAGCAAGTCTTCTCTGCTGAGTTTGAGGgtgagg
LVRM1_0195_A02.b : CAGCAAGTCTTCTCTGCTGAGTTTGAG
LVRM1_0040_G07.b : CAGCAAGTCTTCTCTGCTGAGTTTGAGGTGAAGGAATATGT
LVRM1_0049_H01.b : CAGCCAGTCTTCTCTGCTGAGTTTGAGGTGAAAGAATATGTGCTGCCCAGTTTTGAGGTC
OVR01_0095_C12.b : CAGCAAGTCTTCTCTGCTGAGTTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGGTC
ILNT1_0046_C08.b : CAGCAAGTCTTCTCTGCTGAGTTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGGTC
LVRM1_0200_B05.b : CAGCAAGTCTTCTCTGCTGAAGTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGGTC
SPLT1_0055_H12.b :
UTR01_0070_F01.b : CAGCAAGTCTTCTCTGCTGAGTTTGAGGTGAAGGAATATGTGCTGCCCAGTTTTGAGGTC
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAAGTGGAGCCTTCAGAGAAATTCTACTACATCGATGACCCAAATGGCCTAACTGTCAAC
---------+---------+---------+---------+---------+---------+ 827
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b : cgtccctccccaactct
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b : CAAG
OVR01_0095_C12.b : CAAGTGGAGCCTTCAGAGAAATTCTACTACATCGATGACCCAAATGGGCTAACTGTCAAC
ILNT1_0046_C08.b : CAAGTGGAGCCTTCAGAGAAATTCTACTACATCGATGACCCAAATGGCCTAACTGTCAAC
LVRM1_0200_B05.b : CCAGTGGAGCtt
SPLT1_0055_H12.b :
UTR01_0070_F01.b : CAAGTGGAGCCTTCAGAGAAATTCTACTACATCGATGACCCAAATGGCCTAACTGTCAAC
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATCATTGCCAGGTTCTTGTACGGGGAGAGTGTGGATGGAACAGCTTTCGTCATCTTTGGG
---------+---------+---------+---------+---------+---------+ 887
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : ATCATTGCCAGGTTCTTGTACGGGGAGAGTGTGGATGGAACAGCTTTCGTCATCTTTGGG
ILNT1_0046_C08.b : ATCATTGCCAGGTTCTTGTACGGGGAGAGTGTGGATGGAAAAGCTTTCGTCATCTTTGGG
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ATCATTGCCAGGTTCTTGTACGGGGAGAGTGTGGATGGAACAGCTTTCGTCATCTTTGGG
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GTCCAGGACGGTGACCAGAGGATTTCATTGTCTCAGTCCCTCACCCGTGTTCCGATCATT
---------+---------+---------+---------+---------+---------+ 947
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : Ggccaggacggtgaccagaggatttcattgtctcagtccctccccctgtttccgatcatt
ILNT1_0046_C08.b : GTCCAGGACGGGGACCA*AGGATTTCATTGTCTCA*TTCCTCACCCGTGGTCCGATCATG
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : GTCCAGGACGGTGACCAGAGGATTTCATTGTCTCAGTCCCTCACCCGTGTTCCGATCATT
LVRM1_0071_F05.b : nagttgtca
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GATGGGACGGGGGAAGCCACGCTGAGCCAAGGGGTCTTGCTGAATGGAGTACATTATTCC
---------+---------+---------+---------+---------+---------+ 1007
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : gatgggaccggggaaacccaccctgaacccaagggtcttgcctgatggagtacattatcc
ILNT1_0046_C08.b : GAGGGGACGGGGGAgcccagctgaacccaggggtcttgctgaatgaagtactttatccca
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : GATGGGACGGGGGAAGCCACGCTGAGCCAAGGGGTCTTGCTGAATGGAGTACATTATTCC
LVRM1_0071_F05.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATTCC
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AGTGTCAATGACTTGGTGGGAAAATCCATATATGTATCTGTCACTGTCATTCTGAACTCA
---------+---------+---------+---------+---------+---------+ 1067
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b : aatgtccaggaattggtggggaaaa
ILNT1_0046_C08.b : ggtcattgaatgggggaaaaatcataaatgtatctgtccttgccttccgaactcggcacg
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : AGTGTCAATGACTTGGTGGGAAAATCCATATATGTATCTGTCACTGTCATTCTGAACTCA
LVRM1_0071_F05.b : AGTGTCAATGACTTGGTGGGAAAATCCATATATGTATCTGTCACTGTCATTCTGAACTCA
LVRM1_0145_A07.b : nagttgtcxxxxxxxxxxxxxx
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGCAGCGACATGGTGGAGGCAGAGCGCACCGGGATCCCCATCGTGACCTCCCCCTATCAG
---------+---------+---------+---------+---------+---------+ 1127
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : aaatgtgtgaggcaaacgaccggatcccctcgggaccccccctattaaaccttttcccag
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : GGCAGCGACATGGTGGAGGCAGAGCGCACCGGGATCCCCATCGTGACCTCCCCCTATCAG
LVRM1_0071_F05.b : GGCAGCGACATGGTGGAGGCAGAGCGCACCGGGATCCCCATCGTGACCTCCCCCTATCAG
LVRM1_0145_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCATCGTGACCTCCCCCTATCAG
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATCCACTTCACCAAGACCCCCAAGTTCTTCAAACCCGCCATGCCCTTCGACCTCATGGTG
---------+---------+---------+---------+---------+---------+ 1187
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : acccaagtttttaacacccaggcctttaaccctggggaagggaaaacccgaggctcctgg
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ATCCACTTCACCAAGACCCCCAAGTTCTTCAAACCCGCCATGCCCTTCGACCTCATGGTG
LVRM1_0071_F05.b : ATCCACTTCACCAAGACCCCCAAGTTCTTCAAACCCGCCATGCCCTTCGACCTCATGGTG
LVRM1_0145_A07.b : ATCCACTTCACCAAGACCCCCAAGTTCTTCAAACCCGCCATGCCCTTCGACCTCATGGTG
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TATGTGACGAACCCCGACGGCTCCCCTGCCCGCCACATCCCGGTGGTGACTGAGGACTTC
---------+---------+---------+---------+---------+---------+ 1247
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ccgccatccgggggtgagaaacttcaagggggtctctacccggaaggggtgccaattgat
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : TATGTGACGAACCCCGACGGCTCCCCTGCCCGCCACATCCCGGTGGTGACTGAGGACTTC
LVRM1_0071_F05.b : TATGTGACGAACCCCGACGGCTCCCCTGCCCGCCACATCCCGGTGGTGACTGAGGACTTC
LVRM1_0145_A07.b : TATGTGACGAACCCCGACGGCTCCCCTGCCCGCCACATCCCGGTGGTGACTGAGGACTTC
LVRM1_0035_E06.b : gagtttgtcxxxxxxx
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AAAGTGAGGTCCTTAACCCAGGAGGACGGTGTGGCCAAACTGAGCATCAACACACCCGAC
---------+---------+---------+---------+---------+---------+ 1307
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ctaaccccaaaacggattcgcccctcccgcccttaaaaggggttcccgttaaaaaaaaaa
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : AAAGTGAGGTCCTTAACCCAGGAGGACGGTGTGGCCAAACTGAGCATCAACACACCCGAC
LVRM1_0071_F05.b : AAAGTGAGGTCCTTAGCCCAGGAGGACGGTGTGGCCAAACTGAGCATCAACACACCCGAC
LVRM1_0145_A07.b : AAAGTGAGGTCCTTAACCCAGGAGGACGGTGTGGCCAAACTGAGCATCAACACACCCGAC
LVRM1_0035_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCAACACACCCGAC
TCH01_0049_B01.b : tggggggcatgtgacttnacxxxxxxxxxxx
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AACCGGAATTCCCTGCCCATCACCGTACGCACTGAGAAGGACGGTATCCCAGCTGCACGA
---------+---------+---------+---------+---------+---------+ 1367
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : acgttgtctacccaaacccgggttccaaactcctcttttcccgagaaagcgggaaatcat
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : AACCGGAATTCCCTGCCCATCACCGTACGCACTGAGAAGGACGGTATCCCAGCTGCACGA
LVRM1_0071_F05.b : AACCGGAATTCCCTGCCCATCACCGTACGCACTGAGAAGGACGGTATCCCAGCTGCACGA
LVRM1_0145_A07.b : AACCGGAATTCCCTGCCCATCACCGTACGCACTGAGAAGGACGGTATCCCAGCTGCACGA
LVRM1_0035_E06.b : AACCGGAATTCCCTGCCCATCACCGTACGCACTGAGAAGGACGGTATCCCAGCTGCACGA
TCH01_0049_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgGCTGCACGA
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAAGCGACCAAGAC*CATGCACGTCCTACCCTACAACACCCAGGGTAACTCCAAGAACTA
---------+---------+---------+---------+---------+---------+ 1426
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b : ttttcttc
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : CAAGCGACCAAGACCCATGCACGTCCTACCCTACAACACCCAGGGTAACTCCAAGAACTA
LVRM1_0071_F05.b : CAAGCGACCAAGAC*CATGCACGTCCTACCCTACAACACCCAGGGTAACTCCAAGAACTA
LVRM1_0145_A07.b : CAAGCGACCAAGAC*CATGCACGTCCTACCCTACAACACCCAGGGTAACCCCAAGAACTA
LVRM1_0035_E06.b : CAAGCGACCAAGAC*CATGCACGTCCTACCCTACAACACCCAGGGTAACTCCAAGAACTA
TCH01_0049_B01.b : CAAGCGACCAAGAC*CATGCACGTCCTACCCTACAACACCCAGGGTAACTCCAAGAACTA
LVR01_0051_F07.b : gtgtgtataaaaaattgcaaagtgxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CCTCCACCTCTCTGTGCCCC*GCGTGGAGCTCAAG*CCAGGGGAGAATCTCAATGTTAAC
---------+---------+---------+---------+---------+---------+ 1484
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : CCTCCACCTCTCTGTGCCCCCGCGTGGAGCTCAACCCCAGGGGAGAATCTCAATGTTAAC
LVRM1_0071_F05.b : CCTCCACCTCTCTGTGCCCC*GCGTGGAGCTCAAG*CCAGGGGAGAATCTCAATGTTAAC
LVRM1_0145_A07.b : CCTCCACCTCTCTGTGCCCC*GCGTGGAGCTCAAG*CCAGGGGAGAATCTCAATGTTAAC
LVRM1_0035_E06.b : CCTCCACCTCTCTGTGCCCC*GCGTGGAGCTCAAG*CCAGGGGAGAATCTCAATGTTAAC
TCH01_0049_B01.b : CCTCCACCTCTCTGTGCCCC*GCGTGGAGCTCAAG*CCAGGGGAGAATCTCAATGTTAAC
LVR01_0051_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATGTTAAC
LVR01_0106_F01.b : gggtttataatggctttgtgxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TTCCACCTGCGCACGGACCCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
---------+---------+---------+---------+---------+---------+ 1542
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : TTCCACCTGCGCACGGACCCCGGCTACCAAGAAAAGATTCCGAATACTTTACCTACCTGA
LVRM1_0071_F05.b : TTCCACCTGCGCACGGAACCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
LVRM1_0145_A07.b : TTCCACCTGCGCACGGACCCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
LVRM1_0035_E06.b : TTCCACCTGCGCACGGACCCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
TCH01_0049_B01.b : TTCCACCTGCGCACGGACCCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
LVR01_0051_F07.b : TTCCACCTGCGCACGGACCCCGGCTACCAAGACAAGAT**CCGATACTTTACCTACCTGA
LVR01_0106_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCTGA
LVRM1_0205_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGA
LVRM1_0095_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_D09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
---------+---------+---------+---------+---------+---------+ 1602
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : TTATGAACAAGGGCAAGCTGTTGAAagggggaaccccgcccgccccaagttgggcaaggt
LVRM1_0071_F05.b : TCATGAACAAGGGCCAGATGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVRM1_0145_A07.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVRM1_0035_E06.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
TCH01_0049_B01.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVR01_0051_F07.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVR01_0106_F01.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVRM1_0205_G01.b : TCATGAACAAGGGCAAGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVRM1_0095_A01.b : xxxxxxxxxxxxxxxxGCTGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCA
LVRM1_0128_D09.b : xxxxxxxxxxxxxxxxxxxGTTGAAGGTGGGACGCCAGCCGCGCGAGTCTGGCCAGGTCG
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
---------+---------+---------+---------+---------+---------+ 1662
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : cgtgggggtgcctgcccttgaccaatcccgaacggaatttcatccccttcccttccgccc
LVRM1_0071_F05.b : TGGTGGTGCTGCCCTTGTACATCACGACGGACTTCATCCCTTCCTTTCCGCTGGTGGCTT
LVRM1_0145_A07.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVRM1_0035_E06.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
TCH01_0049_B01.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVR01_0051_F07.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVR01_0106_F01.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVRM1_0205_G01.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVRM1_0095_A01.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVRM1_0128_D09.b : TGGTGGTGCTGCCCTTGACCATCACGACGGACTTCATCCCTTCCTTCCGCCTGGTGGCTT
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
---------+---------+---------+---------+---------+---------+ 1722
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : gggggggccttaataaaccccctgaatttgctggcccaatggggcccagaaggggaaggt
LVRM1_0071_F05.b : ATTACACCCTGATTGCTGCCAATGGGCAAAGGGAGGTGGTGGtccgatcccgtatgggtg
LVRM1_0145_A07.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVRM1_0035_E06.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
TCH01_0049_B01.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVR01_0051_F07.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVR01_0106_F01.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVRM1_0205_G01.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVRM1_0095_A01.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVRM1_0128_D09.b : ATTACACCCTGATTGCTGCCAATGGCCAGAGGGAGGTGGTGGCCGATTCCGTATGGGTGG
LVRM1_0172_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxx
SMG01_0057_F08.b : nccacattnnnnt
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
---------+---------+---------+---------+---------+---------+ 1782
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : gggggggccccaatttccccttatgggggggggggatgttctcaaggggaaacctcctat
LVRM1_0071_F05.b : gatgtcagagaacctgtgtgggcccccgttggtaaaaagg
LVRM1_0145_A07.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTTAAAGGTGGCGGGAAGCAAGACAAGC
LVRM1_0035_E06.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
TCH01_0049_B01.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
LVR01_0051_F07.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
LVR01_0106_F01.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
LVRM1_0205_G01.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
LVRM1_0095_A01.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGtaagctaccaaaca
LVRM1_0128_D09.b : ATGTCAAGGACTCATGTGTGGGCACGCTGGTGGTAAAAGGTGGCGGGAAGCAAGACAAGC
LVRM1_0172_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGGCGGGAAGCAAGACAAGC
SMG01_0057_F08.b : tgagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCAAGACAAGC
LVR01_0039_F03.b : gggggggctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
---------+---------+---------+---------+---------+---------+ 1842
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ggtggttggggggccccccccccctgggggtggggtggataaaaaaaagggggggtgggg
LVRM1_0071_F05.b :
LVRM1_0145_A07.b : AGCATCGGCCTGGGGCACAGATGACCCTGGAGATCCAGGGGTGACCGAGGGCCCGAGTGG
LVRM1_0035_E06.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
TCH01_0049_B01.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVR01_0051_F07.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVR01_0106_F01.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVRM1_0205_G01.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVRM1_0095_A01.b : ccatccgactggccaaccgatcagcctggagatccccggtgacctacgggcatcattggt
LVRM1_0128_D09.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVRM1_0172_D12.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
SMG01_0057_F08.b : AGCATCGGCCTGGGCAACAGATGACCCTGGAGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVR01_0039_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATCCAGGGTGACCGAGGGGCCCGAGTGG
LVRM1_0185_C03.b :
LVRM1_0096_A02.b : ttgtcxxxx
LVRM1_0146_H10.b : nagttgtcx
LVRM1_0077_E09.b : cgttgx
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
---------+---------+---------+---------+---------+---------+ 1901
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b : ggccagggggagagaaaaaaaaacaacg
LVRM1_0071_F05.b :
LVRM1_0145_A07.b : GGCTGGGTGGCCGTGGACAAAGGCGTGTTTGT
LVRM1_0035_E06.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
TCH01_0049_B01.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVR01_0051_F07.b : GGCTGG*TGGCCGCGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVR01_0106_F01.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVRM1_0205_G01.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVRM1_0095_A01.b : tctcaggcccccccgtaaagcgtgcactccgcctgataacgtagagaggaaagacgacgc
LVRM1_0128_D09.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGTAAAACAAATTGACCCAG
LVRM1_0172_D12.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
SMG01_0057_F08.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVR01_0039_F03.b : GGCTGG*TGGCCGTGGACAAGGGCGTGTTTGTGCTGAATAAGAAAAACAAATTGACCCAG
LVRM1_0185_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAATTGACCCAG
LVRM1_0096_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCCAG
LVRM1_0146_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCCAG
LVRM1_0077_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACCCAG
LVRM1_0049_G04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
---------+---------+---------+---------+---------+---------+ 1961
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
TCH01_0049_B01.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVR01_0051_F07.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVR01_0106_F01.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0205_G01.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0095_A01.b : acggatgcnacctcgatatggtgggcccgccaacgcacgagtatgaatgggaacaaaact
LVRM1_0128_D09.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0172_D12.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
SMG01_0057_F08.b : CGTAGGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVR01_0039_F03.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0185_C03.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0096_A02.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0146_H10.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0077_E09.b : CGTAAGATCTGGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0049_G04.b : xxxxxxxxxxtGGATGTCGTGGAGAAGGCAGACATTGGTTGCACACCAGGCAGTGGAAAG
LVRM1_0072_F09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
---------+---------+---------+---------+---------+---------+ 2021
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTNCAGAGCAGCAAGGGCCTACAG
TCH01_0049_B01.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVR01_0051_F07.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVR01_0106_F01.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0205_G01.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0095_A01.b : cccatgtacccatgaccgatacccgcatctgaattgaacacgatcccgtccgctctccgc
LVRM1_0128_D09.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0172_D12.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
SMG01_0057_F08.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVR01_0039_F03.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0185_C03.b : GACTTTGCCGGCGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0096_A02.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0146_H10.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0077_E09.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0049_G04.b : GACTTTGCCGGAGTCTTCACAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
LVRM1_0072_F09.b : xxxxxxxxxxxxxxxxxxxCAGATGCAGGGCTGGCCTTCAAGAGCAGCAAGGGCCTACAG
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
---------+---------+---------+---------+---------+---------+ 2081
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b : ACTCCCCAGAGGGCAGATCTTGA
TCH01_0049_B01.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVR01_0051_F07.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVR01_0106_F01.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0205_G01.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0095_A01.b : aatatctccagttggaagaatggcccaataaggccgaatacccgcgaaatctatagcgcc
LVRM1_0128_D09.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0172_D12.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
SMG01_0057_F08.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVR01_0039_F03.b : ACTCCCCAAAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0185_C03.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0096_A02.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0146_H10.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0077_E09.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0049_G04.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
LVRM1_0072_F09.b : ACTCCCCAGAGGGCAGATCTTGAGTGTCCGAAACCAGCCGCCCGCAAACGCCGTTCCGTG
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
---------+---------+---------+---------+---------+---------+ 2141
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
LVR01_0051_F07.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAATACAGCAAGGAGCTGCGCAGATGC
LVR01_0106_F01.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
LVRM1_0205_G01.b : CAGCTCATGGAGAAAAGGATGGACAAACTGAGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0095_A01.b : tcccgccactataccccagacaacaaaaacgcaaccgcaacccaactcagacgccccaga
LVRM1_0128_D09.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0172_D12.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
SMG01_0057_F08.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
LVR01_0039_F03.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
LVRM1_0185_C03.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
LVRM1_0096_A02.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0146_H10.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0077_E09.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0049_G04.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGT
LVRM1_0072_F09.b : CAGCTCATGGAGAAAAGGATGGACAAACTGGGTCAGTACAGCAAGGAGCTGCGCAGATGC
AMP01_0051_H05.b : nnnccagataannttagagatatcttagggctgctcxxxxxxxx
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
---------+---------+---------+---------+---------+---------+ 2201
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : TGTGAGCATGGCATGCGGGAC*ACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVR01_0051_F07.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVR01_0106_F01.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0205_G01.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCNGGCTCAGTTC
LVRM1_0095_A01.b : cccctatatccagcacaaaaaagacaccgccggaaggacagtaaggccccacacgcctct
LVRM1_0128_D09.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0172_D12.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
SMG01_0057_F08.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVR01_0039_F03.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0185_C03.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0096_A02.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0146_H10.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0077_E09.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0049_G04.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
LVRM1_0072_F09.b : TGTGAGCATGGCATGCGGGACAACCCCATGAAGTTCTCGTGCCAGCGCCGGGCTCAGTTC
AMP01_0051_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
---------+---------+---------+---------+---------+---------+ 2261
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : ATCCAGCATGGTGATGCCTGCGTGAAG*CCTTTCTGGACTGCTGCGAATACATCGGCAAG
LVR01_0051_F07.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVR01_0106_F01.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0205_G01.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGNCAAG
LVRM1_0095_A01.b : ataacacccagtaccagacatgcagagtgaacgcgacagccacgaaccataacagagcca
LVRM1_0128_D09.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0172_D12.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
SMG01_0057_F08.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCANAG
LVR01_0039_F03.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0185_C03.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0096_A02.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0146_H10.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0077_E09.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0049_G04.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
LVRM1_0072_F09.b : ATCCAGCATGGTGATGCCTGCGTGAAGGCCTTCCTGGACTGCTGCGAATACATCGCAAAG
AMP01_0051_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_F01.b : tcxxxxxxx
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
---------+---------+---------+---------+---------+---------+ 2321
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGCCCGGAAGTGACCTGAATGAA
LVR01_0051_F07.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGTCAAGAGTGNACTGNATGAA
LVR01_0106_F01.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0205_G01.b : CTGCGGCAGCAGC
LVRM1_0095_A01.b : aaaactctcaataaccccaaaacgcacgaaccaccaatactcaaccaacaaactaggagc
LVRM1_0128_D09.b : CTGCGGCAGCAGCACAGCCGGCAACAGCCCCTGGGGCTGGCCAGGAGTGACCTGGnatga
LVRM1_0172_D12.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
SMG01_0057_F08.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGNATGAA
LVR01_0039_F03.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0185_C03.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0096_A02.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0146_H10.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0077_E09.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0049_G04.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0072_F09.b : CTGCGGCAGCAGCACAGCCGCAACAAGCCTCTGGGGCTGGCCAGGAGTGACCTGGATGAA
AMP01_0051_H05.b : xxxxxxCAGCAGCACAGCCGCAACAAGCCCCTGGGGCTGGCCAGGAGTGACCTGGATGAA
LVRM1_0163_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGACCTGGATGAA
LVRM1_0093_F09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
---------+---------+---------+---------+---------+---------+ 2380
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : NAAATAtcccgaaggaagaatcattttccgaagaccgttccccgaaagctggctgtggac
LVR01_0051_F07.b : GAAATAATCCCAGAGGAAGACATCAATTTNCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVR01_0106_F01.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAAAGCTGGCTGTG
LVRM1_0205_G01.b :
LVRM1_0095_A01.b : gccgcgccgcggtgaaaaagacccatcggagggtccatgcggacaaataacgcccccatt
LVRM1_0128_D09.b : gaat
LVRM1_0172_D12.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
SMG01_0057_F08.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVR01_0039_F03.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0185_C03.b : GAAATAATCTCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0096_A02.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0146_H10.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0077_E09.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0049_G04.b : GAAATAATCCCTGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0072_F09.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
AMP01_0051_H05.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0163_F01.b : GAAATAATCCCAGAGGAAGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVRM1_0093_F09.b : xxxxxxxxxxxxxxxxxxGACATCA*TTTCCAGAAGCCAGTTCCCCGAGAGCTGGCTGTG
LVR01_0003_D03.b : tttaggtgacctacntagacxxxxx
LVRM1_0044_E10.b :
LVR01_0081_D06.b : ctttttgggtggxxxxxxxx
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
---------+---------+---------+---------+---------+---------+ 2439
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : atttgaggattttaaggaccggacaaaaaggaatcccccccaagacccggaatggttttt
LVR01_0051_F07.b : GAACATTGAGGAGTTTAAAGAAACAAACAAAAATGGGATCCTCCACCAAGACCATGAATG
LVR01_0106_F01.b : GAACATTGAGGAAGTTTAAAGAACCAGACAAAAATGAAATCTCCACCAAGACCATGAATG
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
SMG01_0057_F08.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACAAAGACCATGAATG
LVR01_0039_F03.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0185_C03.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0096_A02.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0146_H10.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0077_E09.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0049_G04.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0072_F09.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
AMP01_0051_H05.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0163_F01.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVRM1_0093_F09.b : GACCATTGAGGA*GTTTAAAGAACCAGACAAAAATGGAATCTCCACCAAGACCATGAATG
LVR01_0003_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0044_E10.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggG
LVR01_0081_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
---------+---------+---------+---------+---------+---------+ 2498
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : taaaactccaccccactttggaaaatttgggcggaaacttgtcgaaaaaaaagggatttg
LVR01_0051_F07.b : TGGTTTTtaaaagactcca
LVR01_0106_F01.b : TGTTTTTAAAAGACTCCATCACCACTTtgggaaaattccggctgtgagcctggtccggaa
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
SMG01_0057_F08.b : TGTTTTTAAAAactccatcaccacttgggaaaatctgctggtaactttgtcgaacaaaaa
LVR01_0039_F03.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGAATTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0185_C03.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0096_A02.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0146_H10.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0077_E09.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0049_G04.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0072_F09.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
AMP01_0051_H05.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0163_F01.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0093_F09.b : TGTTTTTAAAAGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVR01_0003_D03.b : TGTTTTTAAA*GACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCCGAAAAT
LVRM1_0044_E10.b : TGTTTTTAAAAGACTCCATCACCACTTGGGGGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVR01_0081_D06.b : xxxxxxxxxxxGACTCCATCACCACTTGGGAGA*TTCTGGCTGTGAGCTTGTCGGACAAG
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
---------+---------+---------+---------+---------+---------+ 2557
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b : ggggttgaacccttg
LVR01_0051_F07.b :
LVR01_0106_F01.b : caaaaaaggggattctggcttggctgaacccctatggagggttgtgggtggagcccaaaa
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b : AAAGGGATCTGCGT
SMG01_0057_F08.b : ggaatttgcggggctgaacccttataaggttgggtgaaacaaaatttcttcaatgatttg
LVR01_0039_F03.b : AAAGGGATCTGCGTGGCTGACCCCCTATGAGGTTGTGGggaaccaaaaatttcttctcca
LVRM1_0185_C03.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAAGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0096_A02.b : AAAAGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAgatttcttcgtcgca
LVRM1_0146_H10.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0077_E09.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0049_G04.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0072_F09.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
AMP01_0051_H05.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0163_F01.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0093_F09.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVR01_0003_D03.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCTTCGA
LVRM1_0044_E10.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVR01_0081_D06.b : AAAGGGATCTGCGTGGCTGACC*CCTATGAGGTTGTGGTGAAGCAAGATTTCTTCATCGA
LVRM1_0034_E04.b : gagttgtcxxxxxxx
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
---------+---------+---------+---------+---------+---------+ 2617
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b : tttctttccattcaattctgccttccccccctactctcgtttttggccccaaatgaacca
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : gtttccccccaacccgttgggccaagggccagggggaaatcccaactttcctctaaactt
LVR01_0039_F03.b : atctgcgtctccccttacttccgtttgtgcccaatgaccaagtgggaaatcccaactatt
LVRM1_0185_C03.b : TCTGCGTCTCCCCTACTCCGTTGTGCGNCATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0096_A02.b : ctggcgtctcacgtatccagtgtgcgccatgaacaggggcagatcgaaccacccctataa
LVRM1_0146_H10.b : CCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0077_E09.b : CCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0049_G04.b : CCTGCGTCTCCCCTACTCCGTTGTGCGCTATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0072_F09.b : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
AMP01_0051_H05.b : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0163_F01.b : CCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTG
LVRM1_0093_F09.b : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVR01_0003_D03.b : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCACGTGGAGATCCAAGCTATCCTCTA
LVRM1_0044_E10.b : CCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVR01_0081_D06.b : TCTGCGTCTCCCCTACTCCGTTGTGCGCAATGAGCAGGTGGAGATCCGAGCTATCCTCTA
LVRM1_0034_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGAGCTATCCTCTA
LVRM1_0038_G08.b : gatttgtcxxxxx
LVRM1_0002_C09.b : cxxxxxxxxxxxxxxxxxxxx
TCH01_0042_C07.b : nnnnggcttggactatnacxxxxxxxxxxxx
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
---------+---------+---------+---------+---------+---------+ 2676
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b : gggggggaaaaattcccaaacctttttccccctcctaaaaaatatccagggggga
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : cagggggggcaaaaatttcaggggcggggggaaatgtcttaaaatccatttttgggccgg
LVR01_0039_F03.b : cctctataaccaccaaggaaggcgaaggatctcaaggccagggggggaactgcccctaca
LVRM1_0185_C03.b : TAACTACGGGGA
LVRM1_0096_A02.b : gt
LVRM1_0146_H10.b : TAACTACAAGGAG*GCAGAAGATCTCA*AGG
LVRM1_0077_E09.b : TNACTACAGGGAGGGCAGAGGATCTCA*GGTCAGGGTGGAACTGCTCTACnac
LVRM1_0049_G04.b : TAACTACAGGGAG*GCAGAGGATCT
LVRM1_0072_F09.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
AMP01_0051_H05.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
LVRM1_0163_F01.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
LVRM1_0093_F09.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
LVR01_0003_D03.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCACCTT
LVRM1_0044_E10.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
LVR01_0081_D06.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCTT
LVRM1_0034_E04.b : TAACTACAGGGAG*GCAGAGGATCTCAAGGTCAGGGTGGAACTGCTCTACAATCCAGCCT
LVRM1_0038_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACAATCCAGCTT
LVRM1_0002_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtatggTACAATCCAGCTT
TCH01_0042_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAATCCAGCTT
LVRM1_0166_D03.b :
THY01_0017_H11.b : att
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
---------+---------+---------+---------+---------+---------+ 2736
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ggccccccaaaaaaccccccaaaaaaatttaagggtccccccaattctttgggcgcgggc
LVR01_0039_F03.b : tcccacctttccgccagcatggccacccccaaaaaaagccccccccaacaaaatctttaa
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCctacgg
AMP01_0051_H05.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0163_F01.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0093_F09.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVR01_0003_D03.b : TCTGCACCCTGGCCACCGCCGATAACCGCCACCAACAGACTCTAACGGTCCCACCCAAGT
LVRM1_0044_E10.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVR01_0081_D06.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0034_E04.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0038_G08.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0002_C09.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
TCH01_0042_C07.b : TCTGCAGCCTGGCCACCGCCAAGAAGCGCCACCAACAGACTCTAACGGTCCCAGCCAAGT
LVRM1_0166_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0017_H11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F05.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
---------+---------+---------+---------+---------+---------+ 2796
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ttaaaattttggccctaaaaaaaggcccccaagggggagggaagggggccctgaaaaaca
LVR01_0039_F03.b : cgggtcccaacccaagtcctccagtggccggtgcccttaatttattgtggccctttaaaa
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0163_F01.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0093_F09.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVR01_0003_D03.b : CCTCACTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCACGAGGTGGAGG
LVRM1_0044_E10.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAACACTGGCCTCCAGGATGTGGAGG
LVR01_0081_D06.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0034_E04.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0038_G08.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0002_C09.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
TCH01_0042_C07.b : CCTCAGTGCCCGTGCCTTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVRM1_0166_D03.b : xxxxxxxxxxxxxxxxxTACATCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
THY01_0017_H11.b : xxxxxxxxxxxxxxxxxxxggTCATTGTGCCCTTGAAGACTGGCCTCCAGGAGGTGGAGG
LVR01_0079_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACTGGCCTCCAGGAGGTGGAGG
LVR01_0077_A04.b : gactctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_F09.b : ggttctttagcttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
---------+---------+---------+---------+---------+---------+ 2856
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : tttttttttggggggttaaaaaacaacaaaggtgcgcaaaaaaaaaaaaaaaaaaaaggg
LVR01_0039_F03.b : aaatgggcccccataaaggggggtaggaaaaagggccccctctccctcctccccccttca
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0163_F01.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0093_F09.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVR01_0003_D03.b : TCAAGGCCGCCGTCTACCACCACTTCATCAGTGATGGTGTCAAGAACACCCTGAAGGTCG
LVRM1_0044_E10.b : TCAAAGCCGCCGTCTACCACCACTTCATCACTGATGGTGTtgagagaagccctgaaggac
LVR01_0081_D06.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0034_E04.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0038_G08.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0002_C09.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
TCH01_0042_C07.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVRM1_0166_D03.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
THY01_0017_H11.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVR01_0079_F05.b : TCAAGGCCGCCGTCTACAACCACTTCATCAGTGATGGTGTCAAGAAGACCCTGAAGGTCG
LVR01_0077_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCAAGAAGACCCTGAAGGTCG
LVR01_0103_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAAGACCCTGAAGGTCG
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b : tttttccgtaatcaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C11.b :
AMP01_0087_D06.b : taaggtatcttxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
---------+---------+---------+---------+---------+---------+ 2916
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : gtccccccccggttttaaaaaaaggcccccggggggtcaaaaaaataaacccgtgttttt
LVR01_0039_F03.b : aaccatgtttgggggtggttccaaaaaaaaaccctttataggggccgggccaccaaaagg
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : TGCCAGAAAGGATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0163_F01.b : TGCCAGAAGGAATGAGAGTCAACAGAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0093_F09.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVR01_0003_D03.b : TGCCACAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0044_E10.b : gcgcccagaggagggccaatcgaagagactgtggtcattcgcataaggaaatcccaccct
LVR01_0081_D06.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0034_E04.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0038_G08.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0002_C09.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
TCH01_0042_C07.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0166_D03.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
THY01_0017_H11.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVR01_0079_F05.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVR01_0077_A04.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVR01_0103_F09.b : TGCCAGAAGGAATGAGAGTCAACAAAACTGTGGTCACTCGCACACTGGATCCAGAACATA
LVRM1_0103_G07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0054_E03.b : nngggtgaacaxxxxxx
AMP01_0006_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
---------+---------+---------+---------+---------+---------+ 2976
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : ctgcccccttctacgagggaaagaaaaacctctttgggaagcccgggtgtatataaatta
LVR01_0039_F03.b : aaaagggggaaattccacacaaaaaacagggggggtatccccctcccccccccacccccg
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : *GGGCCAACAGGNAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCCAGTCC
LVRM1_0163_F01.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCAGATCTCGCCGACCGAGTCC
LVRM1_0093_F09.b : ATGGCCAACACGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVR01_0003_D03.b : AGGGCCAACATGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVRM1_0044_E10.b : gcggtccagcagtgattgggacaagagggactctcatcgggcggatattgccaaactatt
LVR01_0081_D06.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVRM1_0034_E04.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVRM1_0038_G08.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVRM1_0002_C09.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
TCH01_0042_C07.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCAGATCTCAGCGACCAAGTCC
LVRM1_0166_D03.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
THY01_0017_H11.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVR01_0079_F05.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVR01_0077_A04.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVR01_0103_F09.b : AGGGCCAACAGGGAGTGCAACGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
LVRM1_0103_G07.b : xxxxxxxxxxxxxxxxxxxxxGAGAGGAAATCCCACCTGCGGATCTCAGCGACCAAGTCC
ITT01_0054_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCGGATCTCAGCGACCAAGTCC
AMP01_0006_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCTCAGCGACCAAGTCC
LVR01_0078_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGCGACCAAGTCC
AMP01_0087_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
---------+---------+---------+---------+---------+---------+ 3035
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : atttnggggggagaaaccccccccccccccgtggggggaaaaaaatagaacaccccattc
LVR01_0039_F03.b : tggaggtccaccaagataaactaagaaagtgggggcgtccacaaacattggggggggggt
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : agacancgagtcagagaccagatcctcctgcagggaccccggtggcccaganntgtagag
LVRM1_0163_F01.b : CAGAGACGGAGTCAGAGAACAAAATCCCCCTGCCAGGGAACCCCGGTGGCCCAGAGGGTA
LVRM1_0093_F09.b : CATACACGGAGTCAGAGACCAAGATCCTCCTGCAAAGG*ACCCCTGTGGCCCATATGGTA
LVR01_0003_D03.b : CAGACACGGAGTCATAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0044_E10.b : gtttcagcaccgaaagagtcccccggcacaggtgtcgttacgcaccccatgttaccgcga
LVR01_0081_D06.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0034_E04.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0038_G08.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0002_C09.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
TCH01_0042_C07.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0166_D03.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
THY01_0017_H11.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVR01_0079_F05.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVR01_0077_A04.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVR01_0103_F09.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0103_G07.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
ITT01_0054_E03.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
AMP01_0006_H08.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVR01_0078_C11.b : CAGACACGGAGTCAGAGACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
AMP01_0087_D06.b : xxxxxxxxxxxxxxxxxACCAAGATCCTCCTGCAAGGG*ACCCCGGTGGCCCAGATGGTA
LVRM1_0080_B10.b : acgtgaaataagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
---------+---------+---------+---------+---------+---------+ 3094
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b : tttttcttttcgcnaaaagaaaatttttgtaggagaaacct
LVR01_0039_F03.b : gggggtgttaaaaccggaggggga
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : atgccatcgacggggaccgctgaagcactcatccaaccccctncggctgtggggagcaga
LVRM1_0163_F01.b : GAGGATGCC
LVRM1_0093_F09.b : AAGGATGCCATCCGATGGTGACCGGCTGAATCACCTCATCCAAACTCCCTCC
LVR01_0003_D03.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCAGCTGTGG
LVRM1_0044_E10.b : gggggaccgtgtggagatagtccgccacagcgtgatccacttaagtcgcccacacgtaca
LVR01_0081_D06.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0034_E04.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0038_G08.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0002_C09.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
TCH01_0042_C07.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0166_D03.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
THY01_0017_H11.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVR01_0079_F05.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVR01_0077_A04.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCCCCGGCTGTGG
LVR01_0103_F09.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0103_G07.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
ITT01_0054_E03.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
AMP01_0006_H08.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVR01_0078_C11.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
AMP01_0087_D06.b : GAGGATGCCATC*GACGGGGACCGGCTGAAGCACCTCATCCAAACCCCCTCCGGCTGTGG
LVRM1_0080_B10.b : xxxxxxxxCATC*GACGGGGACCGGCTGAAGCACCTCATCCAA*CCCCCTCCGGCTGTGG
LVRM1_0086_E10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A09.b : nagttgtcxxxxx
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
---------+---------+---------+---------+---------+---------+ 3154
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : actgatcggatgacccccacgtcatgctgtgcactactgnacgccacgaacatgggagag
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : GGAGCACAACATGATCAGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0044_E10.b : aattttgtgtgccaacccaccgcgggacgtccgcggagtataatgtgatcagcgcccacg
LVR01_0081_D06.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0034_E04.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0038_G08.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0002_C09.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
TCH01_0042_C07.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0166_D03.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
THY01_0017_H11.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVR01_0079_F05.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVR01_0077_A04.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVR01_0103_F09.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0103_G07.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
ITT01_0054_E03.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
AMP01_0006_H08.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVR01_0078_C11.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
AMP01_0087_D06.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0080_B10.b : GGAGCAGAACATGATCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0086_E10.b : xxxxxxxxxxxxxxTCGGCATGACGCCCACAGTCATCGCTGTGCACTACCTGGACAGCAC
LVRM1_0126_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTGGACAGCAC
LNG01_0067_F10.b :
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
---------+---------+---------+---------+---------+---------+ 3214
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ttcgcctgnaaagnaggcagagcctgnagctatcagaaaggtaccccagcactggcctca
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : CGAACAATGGGAGAAGTTCGGCCTGTAGAAAAGGCAGGAAACCTTGGAGCTCATCAAGAA
LVRM1_0044_E10.b : cgtataatacattataaattgtaccgagcgcaggatgtcgtatagcgtgccgcgcgcata
LVR01_0081_D06.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCCAGAA
LVRM1_0034_E04.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGGA
LVRM1_0038_G08.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0002_C09.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
TCH01_0042_C07.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0166_D03.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
THY01_0017_H11.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVR01_0079_F05.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVR01_0077_A04.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGGGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVR01_0103_F09.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0103_G07.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
ITT01_0054_E03.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
AMP01_0006_H08.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVR01_0078_C11.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
AMP01_0087_D06.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0080_B10.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0086_E10.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LVRM1_0126_A09.b : CGAACAATGGGAGAAGTTCGGCCTGGAGAAGAGGCAGGAAGCCTTGGAGCTCATCAAGAA
LNG01_0067_F10.b : ttttngga
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
---------+---------+---------+---------+---------+---------+ 3273
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : acaaaaactcagcttgccgcttcagaaccgctgtcacactgntgaagactagggtaaggc
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : AGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAACCTTTGCCGCCTTCA**GG
LVRM1_0044_E10.b : gtcgttcgaataacagcat
LVR01_0081_D06.b : AGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGGA
LVRM1_0034_E04.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0038_G08.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0002_C09.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
TCH01_0042_C07.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0166_D03.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
THY01_0017_H11.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVR01_0079_F05.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVR01_0077_A04.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVR01_0103_F09.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0103_G07.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
ITT01_0054_E03.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
AMP01_0006_H08.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVR01_0078_C11.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
AMP01_0087_D06.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0080_B10.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0086_E10.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LVRM1_0126_A09.b : GGGGTACACCCAGCAACTGGCCTTCAGACAAAAGAACTCAGCCTTTGCCGCCTTCCAGG*
LNG01_0067_F10.b : tggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_A05.b : ttt
AMP01_0054_H08.b : nnnnccagataatntaagggaataataxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B12.b : ctatagcgactcttxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
---------+---------+---------+---------+---------+---------+ 3333
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ctcctatgaacaacccccccctcactccgtccctgggggcccaggtgttccgaaaacaaa
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : AACGGCTGTCTAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0044_E10.b :
LVR01_0081_D06.b : ACGGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0034_E04.b : *ACGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0038_G08.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0002_C09.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
TCH01_0042_C07.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0166_D03.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
THY01_0017_H11.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVR01_0079_F05.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVR01_0077_A04.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVR01_0103_F09.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0103_G07.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
ITT01_0054_E03.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
AMP01_0006_H08.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTAGTCAAGGTCTTCGCTATGGCAGCCA
LVR01_0078_C11.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
AMP01_0087_D06.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0080_B10.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0086_E10.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LVRM1_0126_A09.b : ACCGGCTGTCCAGCACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LNG01_0067_F10.b : xxxxxxxtggatcgACCTGGCTGACAGCCTATGTGGTCAAGGTCTTCGCTATGGCAGCCA
LNG01_0046_A05.b : ttttcttttagctttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b :
LNG01_0105_F06.b :
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
---------+---------+---------+---------+---------+---------+ 3392
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b : ccttgactccggaaaggcccgaacccaaattgggtccaaaaaaaaaaacacctttct
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCCTCAAATGGCTGATCCTGGAaa
LVRM1_0044_E10.b :
LVR01_0081_D06.b : ACCTCTTCGCCATCGACTCCCAAGTCCTCTGGTGGGCCGTCCAATGGGTTAATCCTGGAG
LVRM1_0034_E04.b : ACCTCATCGC
LVRM1_0038_G08.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0002_C09.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
TCH01_0042_C07.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0166_D03.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
THY01_0017_H11.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVR01_0079_F05.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVR01_0077_A04.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVR01_0103_F09.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0103_G07.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
ITT01_0054_E03.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
AMP01_0006_H08.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVR01_0078_C11.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
AMP01_0087_D06.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0080_B10.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0086_E10.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LVRM1_0126_A09.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LNG01_0067_F10.b : ACCTCATCGCCATCGACTCCCAGGTCCTCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
LNG01_0046_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxgCTGTGGGGCCGTCAAATGGCTGATCC*TGGAG
AMP01_0054_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAG
AMP01_0065_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G01.b :
TCH01_0076_A02.b : nnnnggataggaxxxxxxxxxxxx
LNG01_0105_F06.b : nnnnnggctag
LVRM1_0072_G03.b :
TCH01_0021_G12.b :
AMP01_0099_E08.b :
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
---------+---------+---------+---------+---------+---------+ 3452
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : aaccaaagccctgatgggattcttcgaaggaaaaaggggccccgtgatacccccaaaaaa
LVRM1_0044_E10.b :
LVR01_0081_D06.b : AAACAGAAGCTTGATGGAGTCTTCGAGGAaaatg
LVRM1_0034_E04.b :
LVRM1_0038_G08.b : AAGCAGA
LVRM1_0002_C09.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
TCH01_0042_C07.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0166_D03.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
THY01_0017_H11.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVR01_0079_F05.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVR01_0077_A04.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVR01_0103_F09.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0103_G07.b : AAGCAGTAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
ITT01_0054_E03.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
AMP01_0006_H08.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVR01_0078_C11.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
AMP01_0087_D06.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0080_B10.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0086_E10.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0126_A09.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LNG01_0067_F10.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LNG01_0046_A05.b : AAGCAGAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
AMP01_0054_H08.b : AAGCATAAGCCTGATGGAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
AMP01_0065_B12.b : xxxxxxxxxxxxxxxxxAGTCTTCGAGGAGAATGGGCCCGTGATACACCAAGAAATGATT
LVRM1_0204_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGATT
TCH01_0076_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATT
LNG01_0105_F06.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_G03.b : cagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0021_G12.b :
AMP01_0099_E08.b : gggataxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
---------+---------+---------+---------+---------+---------+ 3512
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : atgaattggtgggccttttcaaaaccctgaaagaaaaaaaaaactgtgtccccctgaacc
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b : GTTGGCTTaagacactgaggaaa
TCH01_0042_C07.b : GGTGGCTTTCAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0166_D03.b : GGTGGCTTTCAGAACACTGAGGAGAAAGACGTG
THY01_0017_H11.b : GGTGGCTTCAAGAACACTGANGAGAAAGACGTGTCCCTGACAGNCTTTGTTCTCATCGCG
LVR01_0079_F05.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVR01_0077_A04.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVR01_0103_F09.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0103_G07.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
ITT01_0054_E03.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
AMP01_0006_H08.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVR01_0078_C11.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
AMP01_0087_D06.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0080_B10.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0086_E10.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0126_A09.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LNG01_0067_F10.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LNG01_0046_A05.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
AMP01_0054_H08.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
AMP01_0065_B12.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAACCTTTGTTCTCATCGCG
LVRM1_0204_G01.b : GGTGGCTTCTAGAACGCTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
TCH01_0076_A02.b : GGTGGCTTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LNG01_0105_F06.b : xxxxxxaTCAAGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
LVRM1_0072_G03.b : xxxxxxxxxxxGAACACTGAGGAGAAAGACGTGTCCCTGACAGCCTTTGTTCTCATCGCG
TCH01_0021_G12.b : ntttaggctaggacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0206_C04.b :
LNG01_0020_F09.b :
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b :
TCH01_0008_A10.b :
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
---------+---------+---------+---------+---------+---------+ 3572
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : ccccctttttttttcttttttccgccccttcccgggaaggggcctaaaaaaaaaactttt
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0166_D03.b :
THY01_0017_H11.b : CTGCANGAGGGCTAAGACATCTGTGAACCTACAGTCA*TAGCCTGTTGCGCAGCATNCAT
LVR01_0079_F05.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVR01_0077_A04.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVR01_0103_F09.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0103_G07.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
ITT01_0054_E03.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0006_H08.b : CTGCANGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVR01_0078_C11.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0087_D06.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCGTCAAT
LVRM1_0080_B10.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0086_E10.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0126_A09.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LNG01_0067_F10.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LNG01_0046_A05.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0054_H08.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0065_B12.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0204_G01.b : CTGCACGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAACATCAAT
TCH01_0076_A02.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LNG01_0105_F06.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
LVRM1_0072_G03.b : CTGCAGGAGGCTAAAGACATCTGTGAACCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
TCH01_0021_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCACAGGTCAATAGCCTGTTGCGCAGCATCAAT
AMP01_0099_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G12.b : nnnnnnnnnnnnnnnnnnnnnnnccgaaaaagcattgtcaaaacagctggtacggtcctc
LVRM1_0206_C04.b : xxxxxxxxxxxxxxxx
LNG01_0020_F09.b : gcatcatgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_A07.b : aatgtcxxxxxxxxxxxxxxxx
LVRM1_0005_D08.b : cxxxxxxxxxxxxxxxxxxxxxx
TCH01_0088_F02.b : ttgtggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0008_A10.b : tgttngggattggacttgacxxxxxxxxxxxxxxx
LVRM1_0116_D01.b : taatgtcx
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b :
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
---------+---------+---------+---------+---------+---------+ 3632
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : gttggttaaaaccccaaagagggttccaaaaaaaaaccccccgtgggtttttgcccgccc
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : AAAGCAAGAGACTTCCTCGCAGACTACTACCTTAGAATAAAAAGACAATATACTGTGGGC
LVRM1_0166_D03.b :
THY01_0017_H11.b : AAGGC*AGAGACTTCCTCGCAGACTACTACCTAGAATTANNAAGACA*TATACTGTGGCC
LVR01_0079_F05.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAAGACATATACTGTGGCC
LVR01_0077_A04.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVR01_0103_F09.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0103_G07.b : AAGGCAAGAGACTTCCTTGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
ITT01_0054_E03.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
AMP01_0006_H08.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGAACATATACTGTGGCC
LVR01_0078_C11.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
AMP01_0087_D06.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0080_B10.b : AAGGCAAGAGACTTCCTTGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0086_E10.b : AAGGCAAGAGACTTCCTTGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0126_A09.b : AAGGCAAGAGACTTCCTTGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LNG01_0067_F10.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LNG01_0046_A05.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
AMP01_0054_H08.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTANAAAGACCATATACTGTGGCC
AMP01_0065_B12.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0204_G01.b : AAGGCAAGAAACTTCCTTGCATACTACTACCTAGAATTAAGAAGACCATATACTGTGGCC
TCH01_0076_A02.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LNG01_0105_F06.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0072_G03.b : AAGGCAAGAGACTTCCTTGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
TCH01_0021_G12.b : AAGGCAAGAGACTTCCTCGCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
AMP01_0099_E08.b : xxxxxxxxxxxxxxxxxxxCAGACTACTACCTAGAATTAAAAAGACCATATACTGTGGCC
LVRM1_0025_G12.b : gattctcaagaatgttggcctactgACTACCTAGAATTAAA*AGACCATATACTGTGGCC
LVRM1_0206_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAATTAAAAAGACCATATACTGTGGCC
LNG01_0020_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctagTAAAAAGACCATATACTGTGGCC
LVRM1_0115_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGTGGCC
LVRM1_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGCGGCC
TCH01_0088_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACCATATACTGTGGCC
TCH01_0008_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATATACTGTGGCC
LVRM1_0116_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTGGCC
LVRM1_0107_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_G01.b : a
CLNT1_0005_B04.b : nnggttgttnnngggccccgttcgcg
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
---------+---------+---------+---------+---------+---------+ 3692
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b : ccccacacccaccaccattaatatataaag
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAgctggatgaaccctcctccaaaaactctg
LVRM1_0166_D03.b :
THY01_0017_H11.b : ATTGCTGGTT
LVR01_0079_F05.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCNNACAACTT
LVR01_0077_A04.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCCCTCACAACTT
LVR01_0103_F09.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0103_G07.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTc
ITT01_0054_E03.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
AMP01_0006_H08.b : ATTGCTGGTTATGCCCTGGCTCTATCTGAACAGCTGGATGAAGCCTTCCTCAACAAACTT
LVR01_0078_C11.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
AMP01_0087_D06.b : ATTGCTGGTTATGCCCTGGCTCTATCTGANCAGCTGGATGAGCCCTTCCTNCACAAACTT
LVRM1_0080_B10.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACNAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0086_E10.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0126_A09.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LNG01_0067_F10.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LNG01_0046_A05.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
AMP01_0054_H08.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGGAGAGCCCTTCCTCAACAAACTT
AMP01_0065_B12.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0204_G01.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
TCH01_0076_A02.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LNG01_0105_F06.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0072_G03.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
TCH01_0021_G12.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
AMP01_0099_E08.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0025_G12.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0206_C04.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LNG01_0020_F09.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0115_A07.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0005_D08.b : ATAGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
TCH01_0088_F02.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
TCH01_0008_A10.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0116_D01.b : ATTGCTGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0107_F07.b : xxxxxxGGTTATGCCCTGGCTCTATCTGACAAGCTGGATGAGCCCTTCCTCAACAAACTT
LVRM1_0079_G01.b : gttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTT
CLNT1_0005_B04.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTT
LVRM1_0053_B08.b :
LVRM1_0169_D01.b :
THY01_0039_H03.b :
LNG01_0090_E12.b :
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
---------+---------+---------+---------+---------+---------+ 3751
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : agccaagccaaaaaaaggacccctggaaggaacctgcccgaacctctacaagtgggagcc
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGG
LVR01_0077_A04.b : CTGAGCACAGCCAAAGAAAGGAACCCGCTGGGAGAACCCTGG*CAGAAGCTCTACAATGT
LVR01_0103_F09.b : CTGAGCACAGCCAAAGAAAGGAAAC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0103_G07.b : tg
ITT01_0054_E03.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
AMP01_0006_H08.b : CTGAGCACAGCCAA*GAAAGGAACC*GCTGGGAGGAACCTGGCCAGAACCTCTACAATGG
LVR01_0078_C11.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
AMP01_0087_D06.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACNATGT
LVRM1_0080_B10.b : CTGAGCACAGCCCAAGAAAGGAACC*GCTGGGGAGGACCTGGCCAGAAGCTCTACCATGT
LVRM1_0086_E10.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0126_A09.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACTATGT
LNG01_0067_F10.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LNG01_0046_A05.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
AMP01_0054_H08.b : CTGAGCACAGCCAAAGAAACGGACC*GCTGGGTAGGACCTGGCCAGAAGCTCTACAATGT
AMP01_0065_B12.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0204_G01.b : CTGAGCACAACCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
TCH01_0076_A02.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LNG01_0105_F06.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0072_G03.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
TCH01_0021_G12.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGTTCTACAATGT
AMP01_0099_E08.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0025_G12.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0206_C04.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LNG01_0020_F09.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0115_A07.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0005_D08.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
TCH01_0088_F02.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
TCH01_0008_A10.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0116_D01.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0107_F07.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0079_G01.b : CTGAGCACAGCCNAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
CLNT1_0005_B04.b : CTGAGCACAGCCAAAGAAAGGAACC*GCTGGGAGGAACCTGGCCAGAAGCTCTACAATGT
LVRM1_0053_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D01.b : x
THY01_0039_H03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_E12.b : tttagncag
LVRM1_0056_A01.b :
TCH01_0045_A01.b :
LVR01_0001_B06.b :
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
---------+---------+---------+---------+---------+---------+ 3809
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : caattctaacccctcttggtctgcgggtaaccaagacttgaacctgtccctctattgggg
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b : GGAG*GCCACATCCTACGCCCNTCT*GGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTN
LVR01_0103_F09.b : GGAG*GCCACATCCTACGCCCCTCTTGGCTCTGCTGGTAGTCAAAGACTTTtgaatctgt
LVRM1_0103_G07.b :
ITT01_0054_E03.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGGTAGTCAAGACTTTGACTCTGTC
AMP01_0006_H08.b : GGAA*GCC*CATCCTACGCCC*TCTTGGCTttccggtaatcaaaaaattgaccctgaccc
LVR01_0078_C11.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
AMP01_0087_D06.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0080_B10.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGGTAGTCAAGACTTTGACTCTGTC
LVRM1_0086_E10.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0126_A09.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCNAAGACTTTGACTCTGTC
LNG01_0067_F10.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LNG01_0046_A05.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
AMP01_0054_H08.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCCAAGACTTTGACTCTGGT
AMP01_0065_B12.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCCGTC
LVRM1_0204_G01.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
TCH01_0076_A02.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LNG01_0105_F06.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0072_G03.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
TCH01_0021_G12.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
AMP01_0099_E08.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0025_G12.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0206_C04.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LNG01_0020_F09.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0115_A07.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0005_D08.b : GGAGAGCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTG
TCH01_0088_F02.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
TCH01_0008_A10.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0116_D01.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0107_F07.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0079_G01.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACCCTGTC
CLNT1_0005_B04.b : GGAG*GCCACATCCTACGCCC*TCTTGGCTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0053_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTGCTGGTAGTCAAAGACTTTGACTCTGTC
LVRM1_0169_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGACTCTGTC
THY01_0039_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGACTCTGTC
LNG01_0090_E12.b : cacgaaaagacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A01.b : cgttgtcxxxxxxxxx
TCH01_0045_A01.b : nttgcttggacttaaacxxxxxx
LVR01_0001_B06.b : aactg
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
---------+---------+---------+---------+---------+---------+ 3869
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b : ctggctcatgaacgaaatcatcggaggggcttggg
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b : CCTCCTA
LVR01_0103_F09.b : cccctctattgtgcgctgggctcaatgaagcaaagatactaagggaggtgggctattgga
LVRM1_0103_G07.b :
ITT01_0054_E03.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
AMP01_0006_H08.b : tcctattggggcctggtccagggacctaaatactaccgagggggctaaggattcacccga
LVR01_0078_C11.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
AMP01_0087_D06.b : CCTCCTATTGTGCGCTGGGCTCATGAGCAGAGATACTACCGAGGTGGCTATGGATCTACC
LVRM1_0080_B10.b : CCTCCTAn
LVRM1_0086_E10.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGgtactg
LVRM1_0126_A09.b : CCTCCTATTGTGCGCTGGGTCAATGAGCAGAGATACTACGGAGGTGGCTACGGATCTACC
LNG01_0067_F10.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LNG01_0046_A05.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
AMP01_0054_H08.b : CCTCCTATTGTGCGCTGGCTCAATGGACAGAGATACTACCGAGGTGGCTATGGATCCACC
AMP01_0065_B12.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0204_G01.b : CCTCCTATTGTGCGCTGGCTCAGTGATCATAGATACTACGGAGGTGGCTACGGATCTACC
TCH01_0076_A02.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LNG01_0105_F06.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0072_G03.b : CCTCCTATTGTGCGCTGGCTCTATGAGCAGAGATACTACGGAGGTGGCTACCGATCTACC
TCH01_0021_G12.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
AMP01_0099_E08.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0025_G12.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0206_C04.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LNG01_0020_F09.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0115_A07.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTACGGATCTACC
LVRM1_0005_D08.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
TCH01_0088_F02.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
TCH01_0008_A10.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0116_D01.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0107_F07.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTACGGATCTACC
LVRM1_0079_G01.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
CLNT1_0005_B04.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0053_B08.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0169_D01.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
THY01_0039_H03.b : CCTCCTATTGTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LNG01_0090_E12.b : xxxxxxxxxxTGCGCTGGCTCAATGAGCAGAGATACTACGGAGGTGGCTATGGATCTACC
LVRM1_0056_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactggCTACC
TCH01_0045_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTACC
LVR01_0001_B06.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0015_C05.b :
BKFL1_0117_C07.b :
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
---------+---------+---------+---------+---------+---------+ 3929
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : atctccccaggcccacttttcatggggggttcccaaagcccttgggcccaaaaaaccaaa
LVRM1_0103_G07.b :
ITT01_0054_E03.b : CANGCCACTTTCATGGTGTTNC*AGCCTTGGNNCCATACCAGAA*GATGTCCCTGATCAC
AMP01_0006_H08.b : ccattttcaaggggttctagcctggcccaaactaaagagattccggtccaccatttaaaa
LVR01_0078_C11.b : CCAGCCACTTTCATGt
AMP01_0087_D06.b : CAGGCCACTTTCATGGTGTcccagccctggccccatacagaaggatgtccctgaatccca
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b : CAGGCCACTTTCATGGTGgttcaagacttggc
LNG01_0067_F10.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LNG01_0046_A05.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
AMP01_0054_H08.b : CAGGCCACTTTCATGGTGGTCCCAGGCTTGGCCCCATAACAGAAAGATGGCCCTGATCCC
AMP01_0065_B12.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAN
LVRM1_0204_G01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCGGAAGGATGTCCCTGATCAC
TCH01_0076_A02.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LNG01_0105_F06.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0072_G03.b : CAGTCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAATGATGTCCCTGATCAC
TCH01_0021_G12.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
AMP01_0099_E08.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0025_G12.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0206_C04.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LNG01_0020_F09.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0115_A07.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0005_D08.b : CAGGCCACTATCATGGTGTTCCAAGCCTTGACCCAATACCAGAAGGATGTCCCTGATCAC
TCH01_0088_F02.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
TCH01_0008_A10.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0116_D01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0107_F07.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0079_G01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
CLNT1_0005_B04.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0053_B08.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0169_D01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
THY01_0039_H03.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LNG01_0090_E12.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVRM1_0056_A01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
TCH01_0045_A01.b : CAGGCCACTTTCATGGTGTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
LVR01_0001_B06.b : xxxxxxxxxxxxxxxxxxTTCCAAGCCTTGGCCCAATACCAGAAGGATGTCCCTGATCAC
ITT01_0015_C05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0117_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
---------+---------+---------+---------+---------+---------+ 3989
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : aaaaggaaggtccccttgaattcacaaagggaatttttaaaaaccttggggaagggtgtt
LVRM1_0103_G07.b :
ITT01_0054_E03.b : Aggatctgaacctggnatgtgtcatcacctgcccagcgcagcgctcagtcaggctcgtat
AMP01_0006_H08.b : tgaagttttaacaaatgactctcgaacctgtttcggacacttacttggtgaccgaaacct
LVR01_0078_C11.b :
AMP01_0087_D06.b : ggatctgacctggatgcgtcattcactgcccgccgcagggttcaatcaggaatcgaatct
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LNG01_0046_A05.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
AMP01_0054_H08.b : CAGGATCCGAACCTGGATGTGTtcctcccctggcccagcgcagcgcttcaattcaggatt
AMP01_0065_B12.b : CANGATCTGAACCTGGATGTGTCCATCCACCCTGCCAGCCGCAGCGCTCCAGTCAAGCAT
LVRM1_0204_G01.b : AAGGATCAGAACCTGGATGTGTCCATCCACCTGCCCAACCGCAGCGCTCCAGTCAGGCGT
TCH01_0076_A02.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LNG01_0105_F06.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0072_G03.b : AAGGATTTGAACCTGGATGTGTCCcttcccctgtccagtccgcttggtcctgttaggcat
TCH01_0021_G12.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
AMP01_0099_E08.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0025_G12.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0206_C04.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LNG01_0020_F09.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0115_A07.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0005_D08.b : AAGGATCTGAACCTGGATGTGTACATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
TCH01_0088_F02.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
TCH01_0008_A10.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0116_D01.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0107_F07.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0079_G01.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
CLNT1_0005_B04.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0053_B08.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0169_D01.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
THY01_0039_H03.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LNG01_0090_E12.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVRM1_0056_A01.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
TCH01_0045_A01.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
LVR01_0001_B06.b : AAGGATCTGAACCTGGATGTGTCCATCCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
ITT01_0015_C05.b : xxxxxxxxxxxCCTGGATGTGTCCTTTCACCTGCCCAGCCGCAGCGCTCCAGTCAGGCAT
BKFL1_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
---------+---------+---------+---------+---------+---------+ 4049
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0103_G07.b :
ITT01_0054_E03.b : ctctggaatctgctagcttctgcggtcgagagacaaagaaatgaaagatccataatagct
AMP01_0006_H08.b : tctgtatgagaacacaataaaaatatacttatact
LVR01_0078_C11.b :
AMP01_0087_D06.b : ctggaacctgctagcttcggcggtccaaaagccaaagaaaatgaaaattccctaattcct
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LNG01_0046_A05.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
AMP01_0054_H08.b : ctatcctccggggaatcgctaggcttccgcgggccgaanaataccaaagaaaatgagaga
AMP01_0065_B12.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0204_G01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCGTAAGAGACAAAAGAAAATGAGATA
TCH01_0076_A02.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LNG01_0105_F06.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0072_G03.b : ccgtatcctctgggaaactgccagcacttctgcgtgtccgtacatgataagccaagcgga
TCH01_0021_G12.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
AMP01_0099_E08.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0025_G12.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAGAGAAAATGAGAGA
LVRM1_0206_C04.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LNG01_0020_F09.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0115_A07.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0005_D08.b : CGCATCCTCTGGGAATCTGCTATCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
TCH01_0088_F02.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
TCH01_0008_A10.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0116_D01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACGAAAGAAAATGAGAGA
LVRM1_0107_F07.b : CGTATCCTCTGGGAGTCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0079_G01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
CLNT1_0005_B04.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0053_B08.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0169_D01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
THY01_0039_H03.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LNG01_0090_E12.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVRM1_0056_A01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
TCH01_0045_A01.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
LVR01_0001_B06.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
ITT01_0015_C05.b : CGTATCCTCTGGGAATCTGCTAGCCTTCTGCGGTCAGAAGAGACAAAAGAAAATGAGAGA
BKFL1_0117_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGA
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
---------+---------+---------+---------+---------+---------+ 4108
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b : nnn
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gagggaagggcaggcacttgtcggtgtgacctgtacccgccaaacaagggaaaaccccgc
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b : gagggaaaggcaggcccttgtcggggtgacagtcccgcccaacaaaggcaaccccgtgca
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LNG01_0046_A05.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
AMP01_0054_H08.b : tccccttaataactgaagggaaaggccacgcaccctgtcgggggggggccatgtaccacg
AMP01_0065_B12.b : TTCACATAAATAGCTGAAAGGAAAGGGGCAGGGCACCTTGTCGGTGGTGACCCTGTACCA
LVRM1_0204_G01.b : TTCACATTAATAGCTGAAGGGACAGGG*CGAGGCACCTTTGTCGTGGTGACAATGTACGA
TCH01_0076_A02.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LNG01_0105_F06.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0072_G03.b : tagattcccattattctgctcaagctaaagggtcaagccccctggtcggtggggaccatg
TCH01_0021_G12.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
AMP01_0099_E08.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0025_G12.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0206_C04.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LNG01_0020_F09.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0115_A07.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0005_D08.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
TCH01_0088_F02.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
TCH01_0008_A10.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0116_D01.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0107_F07.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0079_G01.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
CLNT1_0005_B04.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0053_B08.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0169_D01.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
THY01_0039_H03.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LNG01_0090_E12.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVRM1_0056_A01.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
TCH01_0045_A01.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LVR01_0001_B06.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
ITT01_0015_C05.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
BKFL1_0117_C07.b : TTCACATTAATAGCTGAAGGGAAAGGG*CAAGGCACCTTGTCGGTGGTGACCATGTACCA
LNG01_0073_C12.b :
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
---------+---------+---------+---------+---------+---------+ 4167
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : agagtttgacctcaggttcctatccnccccgaaccgtgaaacctcggaaccaaactctgg
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b : aagttgacccaggttccatatccccctgaacctgaa
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LNG01_0046_A05.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGGTTTTCCATACATC
AMP01_0054_H08.b : cccagaccaaaggcaaaccacctgcaagaagtttgacctcaggtttccatacatgcagcc
AMP01_0065_B12.b : CGCCAAAAACAAAAGCAAAACAACCTGGCAGAAGTTTGACCTCAAGGTTT**CATACATC
LVRM1_0204_G01.b : CGCCAAGAC*AAAGGCAAAACCCCCTGCAAAAAATTTGACCGCAAGGTTTCCggacatcc
TCH01_0076_A02.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LNG01_0105_F06.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTNCAGG*TTTCCATACATC
LVRM1_0072_G03.b : ttccctggcaaggattaaggggtaaacgactcggggctagatttgagccccaaggtttgc
TCH01_0021_G12.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
AMP01_0099_E08.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0025_G12.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0206_C04.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LNG01_0020_F09.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0115_A07.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0005_D08.b : CGCCAAGACCAAAGGCAAGACCATCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATT
TCH01_0088_F02.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
TCH01_0008_A10.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0116_D01.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0107_F07.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0079_G01.b : CGCCNAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
CLNT1_0005_B04.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0053_B08.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0169_D01.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
THY01_0039_H03.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LNG01_0090_E12.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVRM1_0056_A01.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
TCH01_0045_A01.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LVR01_0001_B06.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
ITT01_0015_C05.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
BKFL1_0117_C07.b : CGCCAAGACCAAAGGCAAAACCACCTGCAAGAAGTTTGACCTCAAGG*TTTCCATACATC
LNG01_0073_C12.b : tgttntggcctggctataacxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
---------+---------+---------+---------+---------+---------+ 4227
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gcttaatttgtcagacttgaaacgagcgcctttaccggaaatccgggaaggtttcccgag
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCNAGAGCTCCATGGTCCTTGACATCT
LNG01_0046_A05.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
AMP01_0054_H08.b : ctgaaccagtgaagagcctcaggaagccagagctccatggtccttgacatctgtaccacg
AMP01_0065_B12.b : CAGCCCCTGGACCAGTGAAGGAGGCTCCNGGAGACAAAAACTTCAGGGTCCCTGACATCT
LVRM1_0204_G01.b : ggcccgtgaa
TCH01_0076_A02.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LNG01_0105_F06.b : CAGCCCCTGAACCAGTGAAGAAGCCTCANGAAAGCCAGAGCTCCATGGTCCTTGACATCT
LVRM1_0072_G03.b : aggaatcccagcaccctggatatattgcagaactcctcgtgtactccaagcgcccatggg
TCH01_0021_G12.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
AMP01_0099_E08.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0025_G12.b : CAACCCCTGAACCAGTGAAAAAGCCTCAGGAAGCCAAAAGCTCCATGGTCCTTGACATCT
LVRM1_0206_C04.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LNG01_0020_F09.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0115_A07.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0005_D08.b : CAGCCCCTCGACCAGTGAAGAAGCCTTAGGAAGCCAAGAGCTACATGGTCCTTGACATCT
TCH01_0088_F02.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
TCH01_0008_A10.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0116_D01.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0107_F07.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0079_G01.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCNAGAGCTCCATGGTCCTTGACATCT
CLNT1_0005_B04.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0053_B08.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0169_D01.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
THY01_0039_H03.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LNG01_0090_E12.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVRM1_0056_A01.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
TCH01_0045_A01.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
LVR01_0001_B06.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
ITT01_0015_C05.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTTGACATCT
BKFL1_0117_C07.b : CAGCCCCTGAACCAGTGAAGAAGCCTCAGGAAGCCAAGAGCTCCATGGTCCTCGACATCT
LNG01_0073_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCTCCATGGTCCTTGACATCT
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
---------+---------+---------+---------+---------+---------+ 4286
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : gaaaccaagcggggcggggggaactcttttggggaaaactcccaaacccctcctggaatc
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : GTACCAGtaccttggaaacaggatgccctatgtcaatctggattatcatgatgactggct
LNG01_0046_A05.b : GTACCAGGTAACTTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
AMP01_0054_H08.b : taccttgaaaaccagaatgcactatgtcatcctgaataaaccctggatgacggcctctct
AMP01_0065_B12.b : GGACAGGGTA*CTTTGGAAACCAGGATGCCctatgtccaatctggaaaaaatcccgaaga
LVRM1_0204_G01.b :
TCH01_0076_A02.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LNG01_0105_F06.b : GTACCANGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0072_G03.b : tc
TCH01_0021_G12.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
AMP01_0099_E08.b : GTACCAGGTACCCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0025_G12.b : GTACCAGGTA*CCTTGGAAACCAAAATGCCACTATGTCAATCCTGCATATTGCCATGATG
LVRM1_0206_C04.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LNG01_0020_F09.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0115_A07.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0005_D08.b : GTACCACGTA*CCTTGAAAACCATGATGCCACTATGTCAATGCTGGATATATCCATGATG
TCH01_0088_F02.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
TCH01_0008_A10.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0116_D01.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0107_F07.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0079_G01.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTNCATCCTGGATATATCCATGATG
CLNT1_0005_B04.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0053_B08.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0169_D01.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
THY01_0039_H03.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LNG01_0090_E12.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVRM1_0056_A01.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAACCCTGGATATACCCATGATG
TCH01_0045_A01.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LVR01_0001_B06.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
ITT01_0015_C05.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
BKFL1_0117_C07.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
LNG01_0073_C12.b : GTACCAGGTA*CCTTGGAAACCAGGATGCCACTATGTCAATCCTGGATATATCCATGATG
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b :
ILNT1_0096_E02.b :
20110601C-000833 : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
---------+---------+---------+---------+---------+---------+ 4345
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b : acccgggggatttttttctttttgtgg
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : ctctctgatatgaagactcaactgctgagcctggtgtgacgaatctctctaatatactga
LNG01_0046_A05.b : ACTGGGCTTCCCTCCTGATACTGAAGACCTCCAACTGgctgaacactgggggttggacaa
AMP01_0054_H08.b : cggaaactgaaaactccactgttgaaccctggttgtgaccaatcatctctagttggacta
AMP01_0065_B12.b : cctggttcccctccgaaaacggaaaaccccaactgctgaaccttggtggggaccaattct
LVRM1_0204_G01.b :
TCH01_0076_A02.b : ACTGG*CTTCTCTCCTGATACTGAAGAAACTCAACTGCTGAGCACTGGTGTGGACAGATA
LNG01_0105_F06.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0072_G03.b :
TCH01_0021_G12.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
AMP01_0099_E08.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0025_G12.b : ACTGG*ATTCTCTCCTGATACTGAAGACC*TCAACTGCTGAGCACTGGTGTGGACAa
LVRM1_0206_C04.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGG
LNG01_0020_F09.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0115_A07.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAG
LVRM1_0005_D08.b : ACTGG*CGTCTATCCTGATACTGGAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
TCH01_0088_F02.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
TCH01_0008_A10.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0116_D01.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGAa
LVRM1_0107_F07.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0079_G01.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCANACTGCTGAGCACTGGTGTGGACAGATA
CLNT1_0005_B04.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0053_B08.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0169_D01.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
THY01_0039_H03.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LNG01_0090_E12.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVRM1_0056_A01.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCGAACTGCTGAGCACTGGTGTGGACAGATA
TCH01_0045_A01.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LVR01_0001_B06.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
ITT01_0015_C05.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
BKFL1_0117_C07.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
LNG01_0073_C12.b : ACTGG*CTTCTCTCCTGATACTGAAGACCTCAAACTGCTGAGCACTGGTGTGGACAGATA
MLN01_0045_A11.b :
SPLT1_0039_G12.b :
AMP01_0071_E01.b : n
ILNT1_0096_E02.b :
20110601C-000833 : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
---------+---------+---------+---------+---------+---------+ 4405
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : aaaaccctctcaaaaaaaccctctatctctggaaaaattcccaccctgaagatgtatcct
LNG01_0046_A05.b : aaaccatctctaaatttagaacctgaacaaaaaccccctccccaaaaaaaaacccccccc
AMP01_0054_H08.b : gacaagtcctctccaaaaaacccccttttattaacgggaaagatccccccccccggagga
AMP01_0065_B12.b : tccctaagttgagctgaaaaaaccccttcaaaaaaaacccctcttctttacgtgaaaaaa
LVRM1_0204_G01.b :
TCH01_0076_A02.b : CATCTCTAAGTATGAGCTGAACAAAGCCCCTCTCCAC*AAAACACCCTCATCATCTACCT
LNG01_0105_F06.b : CATCTCNTAGTATGAGCTGAACAAAGCCCCTCTCNAC*AAAACACCCTCATCATCTACCT
LVRM1_0072_G03.b :
TCH01_0021_G12.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAAC*AAAAACACCTCATCATCTACCT
AMP01_0099_E08.b : CATCTCNTAGTATGAGCTGAAACAAGCCCTCTCCANC*AAAACACCCTCATCATCTACCC
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LVRM1_0115_A07.b :
LVRM1_0005_D08.b : CATCTCTAACTATGAGCTGCACATAGCCCTTTTCATCAAAGACACTCTCATTATCTACCT
TCH01_0088_F02.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
TCH01_0008_A10.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LVRM1_0116_D01.b :
LVRM1_0107_F07.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCCAACAAAACACCCTCATCATCTATCT
LVRM1_0079_G01.b : CATCTCTNAGTATGAGCTGAAACAAGCCCTCTCCCNACAAAACACCCTCATCATCTACCT
CLNT1_0005_B04.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LVRM1_0053_B08.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCGACAAAAACACCCTCATCATCTACCT
LVRM1_0169_D01.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
THY01_0039_H03.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LNG01_0090_E12.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LVRM1_0056_A01.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
TCH01_0045_A01.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LVR01_0001_B06.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
ITT01_0015_C05.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
BKFL1_0117_C07.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
LNG01_0073_C12.b : CATCTCTAAGTATGAGCTGAACAAAGCCCTCTCCAACAAAAACACCCTCATCATCTACCT
MLN01_0045_A11.b : nnnngggctgtactatgacxxxx
SPLT1_0039_G12.b : nnn
AMP01_0071_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
ILNT1_0096_E02.b :
20110601C-000833 : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
---------+---------+---------+---------+---------+---------+ 4465
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : tcagttcccgaacttagggggcttaacccggggcatcaggggacctttaaccgggaattt
LNG01_0046_A05.b : ttctccttccctggaaaaaaatttcccccccccccccgggaagaaaatgttttttccctt
AMP01_0054_H08.b : cgttatcc
AMP01_0065_B12.b : ttccccccccggaggatgttttcctttaaagtccccaaatttaaggggggcttaaacccc
LVRM1_0204_G01.b :
TCH01_0076_A02.b : GGACAAGATCTCC*ACACCCTGGAGGACTGTATATCCCTTCAAGTTCACCAGTACTTTAA
LNG01_0105_F06.b : GGACAgatctccacaccctggnagactgtatatcctcaaaagtcacagtactttaatgtg
LVRM1_0072_G03.b :
TCH01_0021_G12.b : GGAC*AGATCTCACACACCCTGGAAGACTGTATATCCTTCAAAGTTTCACAGTACTTTAA
AMP01_0099_E08.b : TGGACAGATCTCCCACACCCTGAAGGACTGTATATCCTTCAAgttcaccaataacttaat
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCCTTCAAGTTCACCAGTACTTTAA
LVRM1_0115_A07.b :
LVRM1_0005_D08.b : GGACAAGA
TCH01_0088_F02.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
TCH01_0008_A10.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACCTTAA
LVRM1_0116_D01.b :
LVRM1_0107_F07.b : GGAn
LVRM1_0079_G01.b : GGACNAGATCTCACACACCCCGNAGGACTGTATATCCTTCAAAGGTCACCAGTAC
CLNT1_0005_B04.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
LVRM1_0053_B08.b : GGACAAGATCTCACACACCCTGGGAGACTGTATGTCCTTTCAAGTTCACCAGTACTTTAA
LVRM1_0169_D01.b : GGACAAGATCTCACACACCCTGAAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
THY01_0039_H03.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
LNG01_0090_E12.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
LVRM1_0056_A01.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
TCH01_0045_A01.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
LVR01_0001_B06.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
ITT01_0015_C05.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
BKFL1_0117_C07.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
LNG01_0073_C12.b : GGACAAGATCTCACACACCCTGGAGGACTGTATATCCTTCAAAGTTCACCAGTACTTTAA
MLN01_0045_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAA
SPLT1_0039_G12.b : nncgcgagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAA
AMP01_0071_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0096_E02.b :
20110601C-000833 : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
---------+---------+---------+---------+---------+---------+ 4525
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : gccctgttcccccaaaaggaggggttaacctgcccaaaagtcctgctagaaatttccctc
LNG01_0046_A05.b : ttcaaaattttcccccaagtaattttttttatg
AMP01_0054_H08.b :
AMP01_0065_B12.b : ggggtcatcagggtatccccattaaaccgggaaacctgccc
LVRM1_0204_G01.b :
TCH01_0076_A02.b : TGTGGGGCTTAAACAACCCGGGTCAGTCAAGGggacccctataaaaccgggaggatcctg
LNG01_0105_F06.b : ggcttaacagcctggtcagtcaggtgtactcctataacactgnatgatcttgcacccgtt
LVRM1_0072_G03.b :
TCH01_0021_G12.b : TGTGGGGGCTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACNACCTGGATGAGTC
AMP01_0099_E08.b : gtggggctataccgcctgggccagtcaaggggtactcctattcaaccctggatgaatcct
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTTACACCTGGATGAGTC
TCH01_0008_A10.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGATTC
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b : TGTGGGGCTTATACAGCCTGGGTCAATCAAGGTGTACTCCTATTTACACCTGGATGAGTC
LVRM1_0053_B08.b : TGTGGGGGCTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACTGGGATGAGTC
LVRM1_0169_D01.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGT
THY01_0039_H03.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
LNG01_0090_E12.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
LVRM1_0056_A01.b : TGTGGGGCTTATACAGCCTGGGTCAGTCGAGGTGTACTCCTATTACAACCTGGATGAGTC
TCH01_0045_A01.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
LVR01_0001_B06.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
ITT01_0015_C05.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
BKFL1_0117_C07.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
LNG01_0073_C12.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
MLN01_0045_A11.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
SPLT1_0039_G12.b : TGTGGGGCTTATACAGCCTGGGTCAGTCAAGGTGTACTCCTATTACAACCTGGATGAGTC
AMP01_0071_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACCTGGATGAGTC
ILNT1_0096_E02.b :
20110601C-000833 : TTGCACCCGGTTCTACCACCCCGAGAA*GGAGGACGGGATGCTAAACAAACTCTGCCACA
---------+---------+---------+---------+---------+---------+ 4584
LVRM1_0077_G02.b :
LVRM1_0198_F09.b :
LVRM1_0005_F08.b :
LVRM1_0091_B08.b :
LVRM1_0047_A07.b :
LVRM1_0208_C01.b :
LVRM1_0195_A02.b :
LVRM1_0040_G07.b :
LVRM1_0049_H01.b :
OVR01_0095_C12.b :
ILNT1_0046_C08.b :
LVRM1_0200_B05.b :
SPLT1_0055_H12.b :
UTR01_0070_F01.b :
LVRM1_0071_F05.b :
LVRM1_0145_A07.b :
LVRM1_0035_E06.b :
TCH01_0049_B01.b :
LVR01_0051_F07.b :
LVR01_0106_F01.b :
LVRM1_0205_G01.b :
LVRM1_0095_A01.b :
LVRM1_0128_D09.b :
LVRM1_0172_D12.b :
SMG01_0057_F08.b :
LVR01_0039_F03.b :
LVRM1_0185_C03.b :
LVRM1_0096_A02.b :
LVRM1_0146_H10.b :
LVRM1_0077_E09.b :
LVRM1_0049_G04.b :
LVRM1_0072_F09.b :
AMP01_0051_H05.b :
LVRM1_0163_F01.b :
LVRM1_0093_F09.b :
LVR01_0003_D03.b :
LVRM1_0044_E10.b :
LVR01_0081_D06.b :
LVRM1_0034_E04.b :
LVRM1_0038_G08.b :
LVRM1_0002_C09.b :
TCH01_0042_C07.b :
LVRM1_0166_D03.b :
THY01_0017_H11.b :
LVR01_0079_F05.b :
LVR01_0077_A04.b :
LVR01_0103_F09.b :
LVRM1_0103_G07.b :
ITT01_0054_E03.b :
AMP01_0006_H08.b :
LVR01_0078_C11.b :
AMP01_0087_D06.b :
LVRM1_0080_B10.b :
LVRM1_0086_E10.b :
LVRM1_0126_A09.b :
LNG01_0067_F10.b : aaaaaaccctaacgcgaggggcgcggggttgtaaactccaagggaaattaaagccgaaca
LNG01_0046_A05.b :
AMP01_0054_H08.b :
AMP01_0065_B12.b :
LVRM1_0204_G01.b :
TCH01_0076_A02.b : gacccggtctaccaccccgagaggaggagggatgctaaacaatttgtccaaaaaaattgt
LNG01_0105_F06.b : ctacaccccaaaggaggacggatgctaacaactctgcccaagaaatggtccctgctgaga
LVRM1_0072_G03.b :
TCH01_0021_G12.b : TTGCACCCGGTTCTACCACCCCGAAAAGGgagacggatgctaaccaaactctgcacaaaa
AMP01_0099_E08.b : gcccccgggttctcccccccgaaaaggaagaagggaagccaaacaaactttgccaacaaa
LVRM1_0025_G12.b :
LVRM1_0206_C04.b :
LNG01_0020_F09.b : TTGCCCCCGGGTCTACCCCCCCGAGAAAGGAAGACGGGATGCTAAACAAACTCGGCCACA
LVRM1_0115_A07.b :
LVRM1_0005_D08.b :
TCH01_0088_F02.b : TTGCACCCGGTTCTACCACCCCGAGAAGGGA*GACGGGATGCTAAACAAACTCTGCCACA
TCH01_0008_A10.b : TTGCACCCGGTTCTACCACCCCGAGNA*GGAGGACGGGATGCTAAAC*AACTCTGCCACC
LVRM1_0116_D01.b :
LVRM1_0107_F07.b :
LVRM1_0079_G01.b :
CLNT1_0005_B04.b : TTGCACCCGGGTCTACCACCCCGAGAAAGGA*GACGGGATGCTAAACAAACTCGGCCACA
LVRM1_0053_B08.b : T
LVRM1_0169_D01.b :
THY01_0039_H03.b : TTGCACCCGGTTCTACCACCCCGAGAA*GGAGGACGGGATGCTAAACAAACTCTGCCACA
LNG01_0090_E12.b : TTGCACCCGGTTCTACAACCCGAAGAA**GAGGACGGGATGCTAAACAAACTCTGCCACA
LVRM1_0056_A01.b : TTGCACCCGGTTCTACTACCCCGAGAA*GGAGGACGGGATGCCTAAAAAACTCTGCCACA
TCH01_0045_A01.b : TTGCACCCGGTTCTACCACCCCGAGAA*GGAGGACGGGATGCTAAACAAACTCTGCCACA