[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000847

Length: 949

Sequence [FASTA format sequence]
CGTCAGTGCG GCGGGGCGCG CGAGCAGCGC GGCTGCGGGG TGGGCTGAGC AGAGAGAAGC
TGAGGGGGCG GTAGCGGCAG CGGCGATTCG CGTGCCTGTG CTCAGCTCCT CACGCCGCGG
CCGGGGCCGC CTTCTCCCTC CTTCCTTCCC GCCCCCGAGT GCGGCGGTAC CGCCTCCTTC
AGCGCCGCGC GGCTTCCTCC AGACCTCCGT GCGCGGGTGA GCTCTGTTCT CAGAGGCATT
TGGTGCTGAT CCTGTAACCC AAAAGAGGAA ATTGCTGCCT GAGATCAGCC TTGGTACTGG
TGGCTACCAT GTCCTTAAAG ATCCAGACAA GCAACGTAAC CAACAAGAAT GACCCCAAGT
CTATCAACTC TAGGGTCTTC ATTGGAAACC TCAACACAGC CGTGGTGAAG AAATCTGATG
TGGAGACTAT CTTCTCCAAG TATGGCCGTG TGGCCGGCTG TTCTGTGCAC AAGGGCTATG
CCTTTGTGCA GTATGCCAAC GAGCGCCATG CCCGGGCAGC TGTGCTGGGA GAGAATGGGC
GAGTGCTGGC CGGGCAGACC CTGGACATCA ACATGGCTGG AGAGCCCAAG CCCAACAGAC
CCAAGGGGCT AAAAAGAACA GCATCTGCCA TATACAGTGG CTACAGCTTT GACTATGATT
ACTACCGGGA CGACTTCTAC GACAGGCTCT TCGACTATCG GGGCCGCCTG TCACCAGTGC
CAGTGCCCAG GGCGGTCCCT GTGAAGCGAC CCCGGGTCAC AGTCCCCTTG GTCCGGCGTG
TCAAAACCAC CATACCTGTC AAGCTCTTTG CCCGCTCCAC AGCTATCACC ACCGGCTCAG
CCAAGATCAA GTTAAAGAGC AGTGAACTGC AGGCCATCAA GACAGAGCTG ACCCAAATCC
AGTCCAACAT CGATGCCCTG CTGGGTCGCT TGGAGCAGAT TGCTGAGGA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRALYRNA-binding protein Raly isoform 1 [Homo sapiens]. 2701e-72O
Contig/Assembly ProteinRALYRNA-binding protein Raly isoform 2 [Homo sapiens]. 2662e-71O
Contig/Assembly ProteinRALYLRNA-binding Raly-like protein isoform 1 [Homo sapiens]. 1748e-44O
Contig/Assembly ProteinRALYLRNA-binding Raly-like protein isoform 2 [Homo sapiens]. 1748e-44O
Contig/Assembly ProteinRALYLRNA-binding Raly-like protein isoform 2 [Homo sapiens]. 1748e-44O
Contig/Assembly ProteinRALYLRNA-binding Raly-like protein isoform 2 [Homo sapiens]. 1748e-44O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoproteins C1/C2 isoform a [Homo sapiens]. 1563e-38O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoproteins C1/C2 isoform b [Homo sapiens]. 1563e-38O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoproteins C1/C2 isoform b [Homo sapiens]. 1563e-38O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoproteins C1/C2 isoform a [Homo sapiens]. 1563e-38O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRalyRNA-binding protein Raly long isoform [Mus musculus]. 2831e-76O
Contig/Assembly ProteinRalyRNA-binding protein Raly short isoform [Mus musculus]. 2792e-75O
Contig/Assembly ProteinRalyRNA-binding protein Raly short isoform [Mus musculus]. 2792e-75O
Contig/Assembly ProteinRalyRNA-binding protein Raly short isoform [Mus musculus]. 2792e-75O
Contig/Assembly ProteinRalylRNA-binding Raly-like protein isoform a [Mus musculus]. 1747e-44O
Contig/Assembly ProteinRalylRNA-binding Raly-like protein isoform a [Mus musculus]. 1747e-44O
Contig/Assembly ProteinHnrnpcheterogeneous nuclear ribonucleoproteins C1/C2 isoform 2 [Mus musculus]. 1563e-38O
Contig/Assembly ProteinHnrnpcheterogeneous nuclear ribonucleoproteins C1/C2 isoform 4 [Mus musculus]. 1563e-38O
Contig/Assembly ProteinHnrnpcheterogeneous nuclear ribonucleoproteins C1/C2 isoform 3 [Mus musculus]. 1563e-38O
Contig/Assembly ProteinHnrnpcheterogeneous nuclear ribonucleoproteins C1/C2 isoform 1 [Mus musculus]. 1563e-38O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC485845PREDICTED: similar to RNA-binding protein Raly (hnRNP associated with lethal yellow protein) (Maternally expressed hnRNP C-related protein) [Canis familiaris]. 2815e-76O
Contig/Assembly ProteinLOC487025PREDICTED: similar to autoantigenic hnRNP-associated with lethal yellow isoform 1 [Canis familiaris]. 1741e-43O
Contig/Assembly ProteinLOC475399PREDICTED: similar to Heterogeneous nuclear ribonucleoproteins C1/C2 (hnRNP C1 / hnRNP C2) isoform 17 [Canis familiaris]. 1657e-41O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 27 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 26 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 25 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 24 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 23 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to Heterogeneous nuclear ribonucleoproteins C1/C2 (hnRNP C1 / hnRNP C2) isoform 22 [Canis familiaris]. 1563e-38O
Contig/Assembly ProteinLOC475399PREDICTED: similar to heterogeneous nuclear ribonucleoprotein C isoform b isoform 1 [Canis familiaris]. 1563e-38O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRALYRNA-binding protein Raly [Bos taurus]. 2784e-75O
Contig/Assembly ProteinRALYLRNA-binding Raly-like protein [Bos taurus]. 1741e-43O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoprotein C [Bos taurus]. 1563e-38O
Contig/Assembly ProteinSRSF6serine/arginine-rich splicing factor 6 [Bos taurus]. 53.92e-07O
Contig/Assembly ProteinRBM14RNA-binding protein 14 [Bos taurus]. 53.53e-07O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100514690PREDICTED: RNA-binding protein Raly-like isoform 1 [Sus scrofa]. 2882e-78O
Contig/Assembly ProteinRALYPREDICTED: RNA-binding protein Raly [Sus scrofa]. 2882e-78O
Contig/Assembly ProteinRALYPREDICTED: RNA-binding protein Raly isoform 1 [Sus scrofa]. 2882e-78O
Contig/Assembly ProteinRALYPREDICTED: RNA-binding protein Raly isoform 2 [Sus scrofa]. 2844e-77O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoprotein C (C1/C2) 1 [Sus scrofa]. 1562e-38O
Contig/Assembly ProteinHNRNPCheterogeneous nuclear ribonucleoprotein C (C1/C2) 2 [Sus scrofa]. 1562e-38O
Contig/Assembly ProteinLOC100523119PREDICTED: RNA-binding Raly-like protein-like [Sus scrofa]. 1462e-35O
Contig/Assembly ProteinSRSF6serine/arginine-rich splicing factor 6 [Sus scrofa]. 50.81e-06O


Assembly Members: 25      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10019F08BFLT1_0019_F08.bFS641560 
CBLT10051H04CBLT1_0051_H04.bHX215265 
CLNT10115G05CLNT1_0115_G05.bHX220338 
ITT010050H09ITT01_0050_H09.bBW980470 
ITT010084H08ITT01_0084_H08.bBW983503 
LVRM10027C11LVRM1_0027_C11.bBP138832 
LVRM10160G06LVRM1_0160_G06.bBP453380 AK394311
LVRM10163D04LVRM1_0163_D04.bCJ004093 
LVRM10163F07LVRM1_0163_F07.bCJ004116 
PBL010032G05PBL01_0032_G05.bBW970070 
PST010061F07PST01_0061_F07.bFS701672 
PTG010039C09PTG01_0039_C09.bFS707833 
PTG010073G04PTG01_0073_G04.bFS710658 
PTG010086G11PTG01_0086_G11.bFS711737 
PTG010100C12PTG01_0100_C12.bFS712548 
SPL010090F04SPL01_0090_F04.bCJ021138 
TES010042A06TES01_0042_A06.bCJ032694 
TES010093D12TES01_0093_D12.bCJ036038 
TES010105A02TES01_0105_A02.bCJ036895 
TES010105B05TES01_0105_B05.bCJ036906 
TES010110D07TES01_0110_D07.bFS722286 
TES010110E06TES01_0110_E06.b  
UTR010007H09UTR01_0007_H09.bBP173455 AK239888
UTR010034A08UTR01_0034_A08.bBP169692 
UTR010061C08UTR01_0061_C08.bBP463425 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
51A1500.750W-
C320.250
146C200.087W-
T1920.913
372A1700.680WSAGG/R
C440.320CGG/R


Alignment:      TOP

20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0160_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_A02.b :
TES01_0105_B05.b :
UTR01_0007_H09.b : cttttggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0050_H09.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxx
ITT01_0084_H08.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_F04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0093_D12.b :
CBLT1_0051_H04.b : nnnnncgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0019_F08.b : nggactcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_C11.b : acxxxxxxxxxxxxxxxxxxx
PBL01_0032_G05.b : natcaacaxxxxxxxxxxxxxxxxx
PTG01_0086_G11.b : nnccgccttnnnnnttgagtxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_C08.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_A08.b : tggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0115_G05.b : nnnnccgttcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0039_C09.b : tttttggataaacaxxxxxxxxxxxxxxxxx
PTG01_0100_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PTG01_0073_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0110_D07.b : ctatattt
TES01_0110_E06.b : tttttttttt
TES01_0042_A06.b :
PST01_0061_F07.b :
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ......................CGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
---------+---------+---------+---------+---------+---------+ 38
LVRM1_0160_G06.b : xxxxxxxxxxxxxxxxxxxxxxCTGGAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
TES01_0105_A02.b : tttttcctgctgtggcacagaGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
TES01_0105_B05.b : ttttgcctgcgttggctcTGGAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
UTR01_0007_H09.b : xxxxxxxxxxxxxxxxxxxxxgaGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
ITT01_0050_H09.b : xxxxxxxxxxxxxxxxxxxxxxxGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
ITT01_0084_H08.b : xxxxxxxxxxxxxxxxxxxxxxxGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
SPL01_0090_F04.b : xxxxxxxxxxxxxxxxxxxxxxxGTCAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
TES01_0093_D12.b : tttttccttacgttggctacGGANTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
CBLT1_0051_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxGAGTGCGGCGGGGCTCGCGAGCAGCGCGGCTGCGG
BFLT1_0019_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxtAGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
LVRM1_0027_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
PBL01_0032_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCTAGCAGCGCGGCTGCGG
PTG01_0086_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
UTR01_0061_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
UTR01_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
CLNT1_0115_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
PTG01_0039_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
PTG01_0100_C12.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
PTG01_0073_G04.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
TES01_0110_D07.b : ataatatttacccacgttggctcggggagGCGGAGGGGCGCGCGAGCAGCGCGGCTGCGG
TES01_0110_E06.b : aattttacctcacgctggccactggggaaGCGGCGGGGCGCGCGAGC*GCGCGGCTGCGG
TES01_0042_A06.b : agcgttggctctggagtgGGCGGGGCGCGCGAGCAGCGCGGCTGCGG
PST01_0061_F07.b : nccgcgttggcactggagtgcggGGGGCGCGCGAGCAGCGCGGCTGCGG
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
---------+---------+---------+---------+---------+---------+ 98
LVRM1_0160_G06.b : GGTGGGCTGAGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0105_A02.b : GGCGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0105_B05.b : GGTGGGCTGAGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
UTR01_0007_H09.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
ITT01_0050_H09.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
ITT01_0084_H08.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
SPL01_0090_F04.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0093_D12.b : GGTGGGCTGAGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
CBLT1_0051_H04.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
BFLT1_0019_F08.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
LVRM1_0027_C11.b : GGTGGGCTGAGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PBL01_0032_G05.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PTG01_0086_G11.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
UTR01_0061_C08.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
UTR01_0034_A08.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
CLNT1_0115_G05.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PTG01_0039_C09.b : GGTGGGCTGAGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PTG01_0100_C12.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PTG01_0073_G04.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0110_D07.b : GGTGGGCTGAGCACA*AGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0110_E06.b : GGTGGGCTGAGCCCAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
TES01_0042_A06.b : GGAGGGCTGGGCCGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
PST01_0061_F07.b : GGTGGGCTGAGCAGAGAGAAGCTGAGGGGGCGGTAGCGGCAGCGGCGATTCGCGTGCCTG
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
---------+---------+---------+---------+---------+---------+ 158
LVRM1_0160_G06.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0105_A02.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0105_B05.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
UTR01_0007_H09.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
ITT01_0050_H09.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
ITT01_0084_H08.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCACCCCCGA
SPL01_0090_F04.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0093_D12.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
CBLT1_0051_H04.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
BFLT1_0019_F08.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
LVRM1_0027_C11.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
PBL01_0032_G05.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
PTG01_0086_G11.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
UTR01_0061_C08.b : TGCTTAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCCTCCCGCCCCCGA
UTR01_0034_A08.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
CLNT1_0115_G05.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCCTCCCGCCCCCGA
PTG01_0039_C09.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
PTG01_0100_C12.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
PTG01_0073_G04.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0110_D07.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0110_E06.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
TES01_0042_A06.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
PST01_0061_F07.b : TGCTCAGCTCCTCACGCCGCGGCCGGGGCCGCCTTCTCCCTCCTTCCTTCCCGCCCCCGA
LVRM1_0163_D04.b : cccttgtcxxx
LVRM1_0163_F07.b : cgttgtcxxx
20110601C-000847 : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
---------+---------+---------+---------+---------+---------+ 217
LVRM1_0160_G06.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
TES01_0105_A02.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
TES01_0105_B05.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
UTR01_0007_H09.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
ITT01_0050_H09.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
ITT01_0084_H08.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
SPL01_0090_F04.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
TES01_0093_D12.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
CBLT1_0051_H04.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
BFLT1_0019_F08.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
LVRM1_0027_C11.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PBL01_0032_G05.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PTG01_0086_G11.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
UTR01_0061_C08.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
UTR01_0034_A08.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
CLNT1_0115_G05.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PTG01_0039_C09.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PTG01_0100_C12.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PTG01_0073_G04.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
TES01_0110_D07.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACTTCCGTGCGCG*GG
TES01_0110_E06.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACTTCCGTGCGCG*GG
TES01_0042_A06.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
PST01_0061_F07.b : GTGCGGCGGTACCGCCTCCTTCAGCGCCGCGCGGCTTCCTCCAGACCTCCGTGCGCG*GG
LVRM1_0163_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAGTGG
LVRM1_0163_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAGTGG
20110601C-000847 : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
---------+---------+---------+---------+---------+---------+ 277
LVRM1_0160_G06.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0105_A02.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0105_B05.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
UTR01_0007_H09.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
ITT01_0050_H09.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
ITT01_0084_H08.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
SPL01_0090_F04.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0093_D12.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
CBLT1_0051_H04.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
BFLT1_0019_F08.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
LVRM1_0027_C11.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PBL01_0032_G05.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PTG01_0086_G11.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGGTG
UTR01_0061_C08.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
UTR01_0034_A08.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
CLNT1_0115_G05.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PTG01_0039_C09.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PTG01_0100_C12.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PTG01_0073_G04.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0110_D07.b : TGAGCTCTGTTCTCAAAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0110_E06.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
TES01_0042_A06.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
PST01_0061_F07.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
LVRM1_0163_D04.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
LVRM1_0163_F07.b : TGAGCTCTGTTCTCAGAGGCATTTGGTGCTGATCCTGTAACCCAAAAGAGGAAATTGCTG
20110601C-000847 : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
---------+---------+---------+---------+---------+---------+ 337
LVRM1_0160_G06.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0105_A02.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0105_B05.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
UTR01_0007_H09.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
ITT01_0050_H09.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
ITT01_0084_H08.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
SPL01_0090_F04.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0093_D12.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
CBLT1_0051_H04.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
BFLT1_0019_F08.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
LVRM1_0027_C11.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PBL01_0032_G05.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PTG01_0086_G11.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
UTR01_0061_C08.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
UTR01_0034_A08.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
CLNT1_0115_G05.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PTG01_0039_C09.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PTG01_0100_C12.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PTG01_0073_G04.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0110_D07.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0110_E06.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
TES01_0042_A06.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
PST01_0061_F07.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
LVRM1_0163_D04.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
LVRM1_0163_F07.b : CCTGAGATCAGCCTTGGTACTGGTGGCTACCATGTCCTTAAAGATCCAGACAAGCAACGT
20110601C-000847 : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
---------+---------+---------+---------+---------+---------+ 396
LVRM1_0160_G06.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
TES01_0105_A02.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
TES01_0105_B05.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
UTR01_0007_H09.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
ITT01_0050_H09.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
ITT01_0084_H08.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCATCATTGGAAACCTCAACA
SPL01_0090_F04.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGGAACCTCAACA
TES01_0093_D12.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
CBLT1_0051_H04.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
BFLT1_0019_F08.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
LVRM1_0027_C11.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
PBL01_0032_G05.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
PTG01_0086_G11.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
UTR01_0061_C08.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
UTR01_0034_A08.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
CLNT1_0115_G05.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
PTG01_0039_C09.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
PTG01_0100_C12.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
PTG01_0073_G04.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
TES01_0110_D07.b : AACCAACAAGAATGACCCCAAGTCTATCAAACTCTAGGGTCTTCATTGGAAACCTCAACA
TES01_0110_E06.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
TES01_0042_A06.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
PST01_0061_F07.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTAGGGTCTTCATTGGAAACCTCAACA
LVRM1_0163_D04.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
LVRM1_0163_F07.b : AACCAACAAGAATGACCCCAAGTCTATCA*ACTCTCGGGTCTTCATTGGAAACCTCAACA
20110601C-000847 : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
---------+---------+---------+---------+---------+---------+ 456
LVRM1_0160_G06.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0105_A02.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0105_B05.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
UTR01_0007_H09.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
ITT01_0050_H09.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
ITT01_0084_H08.b : CAACCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
SPL01_0090_F04.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0093_D12.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
CBLT1_0051_H04.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
BFLT1_0019_F08.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
LVRM1_0027_C11.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PBL01_0032_G05.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PTG01_0086_G11.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
UTR01_0061_C08.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
UTR01_0034_A08.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
CLNT1_0115_G05.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PTG01_0039_C09.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PTG01_0100_C12.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PTG01_0073_G04.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0110_D07.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0110_E06.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
TES01_0042_A06.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
PST01_0061_F07.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
LVRM1_0163_D04.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
LVRM1_0163_F07.b : CAGCCGTGGTGAAGAAATCTGATGTGGAGACTATCTTCTCCAAGTATGGCCGTGTGGCCG
20110601C-000847 : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
---------+---------+---------+---------+---------+---------+ 514
LVRM1_0160_G06.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
TES01_0105_A02.b : GCTATTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
TES01_0105_B05.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
UTR01_0007_H09.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
ITT01_0050_H09.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
ITT01_0084_H08.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
SPL01_0090_F04.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
TES01_0093_D12.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
CBLT1_0051_H04.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
BFLT1_0019_F08.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
LVRM1_0027_C11.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PBL01_0032_G05.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PTG01_0086_G11.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
UTR01_0061_C08.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
UTR01_0034_A08.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
CLNT1_0115_G05.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PTG01_0039_C09.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PTG01_0100_C12.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PTG01_0073_G04.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
TES01_0110_D07.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCTGTATGCCAACGAGCGCCctggccc
TES01_0110_E06.b : GCTGTTCTGTGCTACTAAGGGCTATGCCTTTGTGCAGTATGCTAACGAGCGCCATGCCCG
TES01_0042_A06.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
PST01_0061_F07.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
LVRM1_0163_D04.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
LVRM1_0163_F07.b : GCTGTTCTGTGCAC**AAGGGCTATGCCTTTGTGCAGTATGCCAACGAGCGCCATGCCCG
20110601C-000847 : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
---------+---------+---------+---------+---------+---------+ 574
LVRM1_0160_G06.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
TES01_0105_A02.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
TES01_0105_B05.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
UTR01_0007_H09.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
ITT01_0050_H09.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
ITT01_0084_H08.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
SPL01_0090_F04.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
TES01_0093_D12.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
CBLT1_0051_H04.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
BFLT1_0019_F08.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
LVRM1_0027_C11.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
PBL01_0032_G05.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
PTG01_0086_G11.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
UTR01_0061_C08.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
UTR01_0034_A08.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
CLNT1_0115_G05.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
PTG01_0039_C09.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
PTG01_0100_C12.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
PTG01_0073_G04.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
TES01_0110_D07.b : ggtcatcttgtcctgggaaaaaaaagggctagtgctggcccgggcaaaccctggaacttc
TES01_0110_E06.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
TES01_0042_A06.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACTT
PST01_0061_F07.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
LVRM1_0163_D04.b : GGCAGCTGTagcagaagacaatgggcaaaatgggcgcagacgcaacacggaaacgaaaat
LVRM1_0163_F07.b : GGCAGCTGTGCTGGGAGAGAATGGGCGAGTGCTGGCCGGGCAGACCCTGGACATCAACAT
20110601C-000847 : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
---------+---------+---------+---------+---------+---------+ 633
LVRM1_0160_G06.b : GGCTGGAGAGCCCAAGCCCTACAGACCCAAGGGGGCTAAAAAGAACAGCATCTGCCATAT
TES01_0105_A02.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
TES01_0105_B05.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
UTR01_0007_H09.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
ITT01_0050_H09.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
ITT01_0084_H08.b : GGCTGGAGAGCCCAAGCCCAACAGA*CCAAGGGG*CTAAGAAGAACAGCATCTGCCATAT
SPL01_0090_F04.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
TES01_0093_D12.b : GGCTGGAGAGCC*AAGCCCAACAGACCCAAGGG**CTAAAAAGA*CAGCATCTGCCATAT
CBLT1_0051_H04.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
BFLT1_0019_F08.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
LVRM1_0027_C11.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
PBL01_0032_G05.b : GGCTGGAGAGCCCA*GCCCAACAGACCCAAGGGGGCTAAAA*GAACAGCATCTGCCATAT
PTG01_0086_G11.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
UTR01_0061_C08.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
UTR01_0034_A08.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
CLNT1_0115_G05.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
PTG01_0039_C09.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAANAAGAACAGCATCTGCCATAT
PTG01_0100_C12.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
PTG01_0073_G04.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
TES01_0110_D07.b : aacatgggttggaagagccctaggcccaacaaaacccaaggggcttaaaaaaaaaagcat
TES01_0110_E06.b : GGCTGGAGAGCCCTAACCCATCAGAACCATAGGG*CTAAAAAGAACAGCATCTGCCATAT
TES01_0042_A06.b : GGCTGGAGAGCCCATGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
PST01_0061_F07.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
LVRM1_0163_D04.b : agctggcgagaggcgcagcaagagacggcaaggtgtctacaaaccatacgcgagaaaata
LVRM1_0163_F07.b : GGCTGGAGAGCCCAAGCCCAACAGACCCAAGGGG*CTAAAAAGAACAGCATCTGCCATAT
20110601C-000847 : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
---------+---------+---------+---------+---------+---------+ 691
LVRM1_0160_G06.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGGGGACGACTTCTACGACAGGCTCTT
TES01_0105_A02.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAAGCTCTT
TES01_0105_B05.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
UTR01_0007_H09.b : ACAGTGGCTACCAGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
ITT01_0050_H09.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
ITT01_0084_H08.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
SPL01_0090_F04.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
TES01_0093_D12.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACAACAGGCTCCT
CBLT1_0051_H04.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
BFLT1_0019_F08.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
LVRM1_0027_C11.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
PBL01_0032_G05.b : ACAGGGGCTAC*AGCTTTGACTATGATTACTACCGGGGACGACTTCTACGACAGGCTCTT
PTG01_0086_G11.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
UTR01_0061_C08.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
UTR01_0034_A08.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
CLNT1_0115_G05.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
PTG01_0039_C09.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTNACGG*GACGACTTCTACGACAGGCTCTT
PTG01_0100_C12.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
PTG01_0073_G04.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
TES01_0110_D07.b : ctggccttataagatggggtaacagctttggactaagaatttacctacggggacagactt
TES01_0110_E06.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACtaacggttcct
TES01_0042_A06.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
PST01_0061_F07.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
LVRM1_0163_D04.b : aaaccggcgagagctctgcctaacgcctacacacacgaggcaaacgataaccagacctcc
LVRM1_0163_F07.b : ACAGTGGCTAC*AGCTTTGACTATGATTACTACCGG*GACGACTTCTACGACAGGCTCTT
20110601C-000847 : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
---------+---------+---------+---------+---------+---------+ 750
LVRM1_0160_G06.b : CGACTATTGGGGGCGCCTGTCACCAGTGCAAGTGCCCAGAGCGGTTCCCTGTGAAGCGAC
TES01_0105_A02.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGTT*CCCGGTGAAGCGAC
TES01_0105_B05.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCCAGGCGGT*CCCTGTGAAGCGAC
UTR01_0007_H09.b : CGACTATCCGGGCCCCCTGTTACCAGCGCCCGCGCCCACGGCGGT*CCCTGTGAACCGAC
ITT01_0050_H09.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
ITT01_0084_H08.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
SPL01_0090_F04.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
TES01_0093_D12.b : CAACTATCGGGGggcgctggtcaccaatgccaattgcccagggccggtccccgtgaaacg
CBLT1_0051_H04.b : CNACTATCGGGGCCGCCTGTCACCAATGCCAGTGCCCCAGGCGGT*CCCTGTGAAGCGAC
BFLT1_0019_F08.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
LVRM1_0027_C11.b : CGACTATCGGGGCCGCCTGTCAACAATGCCAGCGCCCCAGGCGGG*CCCTGTGAAGCGAC
PBL01_0032_G05.b : CCACTATCGGGGCCCCCTGTCACCAGGGCCATTGCCAAGGGCGT**CCCTGTGAACCGAC
PTG01_0086_G11.b : CGACTATCGGGGGCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
UTR01_0061_C08.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
UTR01_0034_A08.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
CLNT1_0115_G05.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
PTG01_0039_C09.b : CGACTATCGGGGGCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
PTG01_0100_C12.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
PTG01_0073_G04.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAACGAC
TES01_0110_D07.b : ctcaaaaaaggccctttcaattaacggggcccccctgtcccccagtgcccaatgcccagg
TES01_0110_E06.b : cgactaatcggggccacctgtttccattgccagagccccagggcggtccctgtgaaagcg
TES01_0042_A06.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
PST01_0061_F07.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
LVRM1_0163_D04.b : aaaagacaaaatcaacacatcaagaccttgagaccaacggcagacgagatacaagagtta
LVRM1_0163_F07.b : CGACTATCGGGGCCGCCTGTCACCAGTGCCAGTGCCCAGGGCGGT*CCCTGTGAAGCGAC
20110601C-000847 : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
---------+---------+---------+---------+---------+---------+ 808
LVRM1_0160_G06.b : CCCGGGTCAC*AGTCCCCTTGGTCCCGCGTtgtcaaaccac
TES01_0105_A02.b : CCCGGTTCCC*AGTCCCTTTGGTCCGGGGTGGTCAAACCAC*CATACCTGTCAAGTCCTT
TES01_0105_B05.b : CCCCGGTCAC*AGTCCCCCTTGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCCT
UTR01_0007_H09.b : CCCGGGTCACCAGCCCCTTTGGTCCCGCGTGCCAAAACCAC*CATACCTGgtcaagc
ITT01_0050_H09.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
ITT01_0084_H08.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAGAACCAC*CATACCTGTCAAGCTCTT
SPL01_0090_F04.b : CCCGGGTCAC*AGTCCCCTTGGGTCGGCGTGGTCAAACCAC*CATACCTNGTCACCTCTT
TES01_0093_D12.b : accccgggttcaaaatcccccttggtcccggcttgtccaaaccacccatacctggtaaag
CBLT1_0051_H04.b : CCCGGGTCAC*ATTCCCCTTGGTCCCGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
BFLT1_0019_F08.b : CCCGGGTCAC*AGTCCCCTTGGGCCGGCGTGTCNAAACCAC*CATACCCTGTCAGCTCTT
LVRM1_0027_C11.b : CCg
PBL01_0032_G05.b : CCCGGGTCCCAGCCCCttggcccgggtggcaaacccaccgaacctgtcagttcttgcccc
PTG01_0086_G11.b : CC*GGGTCAC*AGTCCCCTGGGTCCG*CGTGTCAAAACACC*ATacctgtcagctttttg
UTR01_0061_C08.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCACCCATACCTGTCAAGCTCTT
UTR01_0034_A08.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
CLNT1_0115_G05.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
PTG01_0039_C09.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
PTG01_0100_C12.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC**ATACCTGTCAAGCTCTT
PTG01_0073_G04.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
TES01_0110_D07.b : ggcggtcccccggtaaaccaaccccggggtaaatgccccccttggcctcgggcttgtcaa
TES01_0110_E06.b : accctgggtcaaattccccttggtcccgtcttgtcaaaccccccatacctgtcaagcttc
TES01_0042_A06.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CCTACCTGTCAAGCTCTT
PST01_0061_F07.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTCAAAACCAC*CATACCTGTCAAGCTCTT
LVRM1_0163_D04.b : ctagggcggcaggcaaaacgtcaaagagcaccccccattaggtcaagaaatacaacaata
LVRM1_0163_F07.b : CCCGGGTCAC*AGTCCCCTTGGTCCGGCGTGTAAAACCGAC**ATACCTGTCAAGCTCTT
20110601C-000847 : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
---------+---------+---------+---------+---------+---------+ 865
LVRM1_0160_G06.b :
TES01_0105_A02.b : TGCCC*GCTCCAagcttattaccacgggttcaaccaaaatcaagttaaaaagcatggaac
TES01_0105_B05.b : TTGCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCCAGA*TCAAagttaaagaccatgg
UTR01_0007_H09.b :
ITT01_0050_H09.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
ITT01_0084_H08.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCGAGA*TCATGTTAATGAGCAGTGA
SPL01_0090_F04.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
TES01_0093_D12.b : ccccttggcccgcttccaaagcctttaaccaccggggtcaaccaaaattcaaggttaaaa
CBLT1_0051_H04.b : TGCCC*GCTCCAAAACTATCA*CCACCGGgctctaccagaataaatttaaagaacaatga
BFLT1_0019_F08.b : TGCCC*GCTCCACAGCTATCA*CCACGGGCTCAGCCCAGA*TCAAGTacggcaaaaagaa
LVRM1_0027_C11.b :
PBL01_0032_G05.b : gctccaaattttcacccccgggtcgaccaagaaaagttaaaaagaattaactggagggcc
PTG01_0086_G11.b : gccgctccaaagctattacccccggctcagccaaaatcaagttaaaaacaatgaacttgc
UTR01_0061_C08.b : TGCCCCGCTCCACAGCTATCA*CCCCCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
UTR01_0034_A08.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCACCCCAGATTCAAGTTAAAGAGCAGTGA
CLNT1_0115_G05.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCCAGA*TCAAGTTTAAGAGCAGTGA
PTG01_0039_C09.b : TTGCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAAA*TCAAGTTAA*GAGCATGGA
PTG01_0100_C12.b : TTCCC*GCTCCAAAGCTATCAACAACGGGCTCACCCAAGA*TCAAGTTAAAAACCAGTGG
PTG01_0073_G04.b : TGCCC*GCTCCACAGCTATCA*CACCGGGCTCAGCCNAGA*TCCAGTTAAAGAGCAGTGG
TES01_0110_D07.b : atccccaatttctggcaaacccttttttcccgctctccaatgttatactccccgggttcc
TES01_0110_E06.b : ttggccccatccccaattttctataccgggttcatccatgattaagttaaaagagtcatt
TES01_0042_A06.b : TGCCC*GCTCCACAGCTTTCA*CCACCGGCTCAGCCCAGA*TCAAGTTTAAGAACAGTGA
PST01_0061_F07.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
LVRM1_0163_D04.b : tgataaaacagagcaaaagaggcggcgcacacaatggaagtgaagtgcaggcaggtaagg
LVRM1_0163_F07.b : TGCCC*GCTCCACAGCTATCA*CCACCGGCTCAGCCAAGA*TCAAGTTAAAGAGCAGTGA
20110601C-000847 : ACTGCAGGCCATCAAGACAGAGCTGACCCAAATCCAGTCCAACATCGATGCCCTGCTGGG
---------+---------+---------+---------+---------+---------+ 925
LVRM1_0160_G06.b :
TES01_0105_A02.b : tgccgggcctccaaaagaaacctaacccaaaacaagtccaacatcaatgccccgctgggt
TES01_0105_B05.b : acttgcagccttcaagacggagcggacccaaatcaagtccaacttcaatgccctgcttgg
UTR01_0007_H09.b :
ITT01_0050_H09.b : ACTGCAGGCCCATCAGACAGAGCTGACCCAGATNCAGTCCAACATCGATGCCCTGCTGGG
ITT01_0084_H08.b : ACTGCATGCCATCGAGACGGAGCTGACTCAGATCTAGTCTAACATCGATGCCCTGCTGGA
SPL01_0090_F04.b : ACTGCAGGCCATTCAGACAGAGCTGACCCCAGATCAGTCCAACATCGATGCCCTGCTGGG
TES01_0093_D12.b : aaccattgaactggcaggccattcaaaaacaaagcttaacccaaattcaattcccaaatt
CBLT1_0051_H04.b : actcccggccattaagaataagctgacccatatcaattcaacatcatagcctctctgggt
BFLT1_0019_F08.b : gggcgaaggtggcaacgggcgtggcagtaccaacgncaaccggcggtgccggcaacggcg
LVRM1_0027_C11.b :
PBL01_0032_G05.b : ctcaaaaagaactgacccaaatcaggtccaaactcatggcctgtttgggtcccttggaac
PTG01_0086_G11.b : aggcctccaaacggacctgaaccaaatcaggttccaactcaaagccctgctgggtccctt
UTR01_0061_C08.b : ACTGCAGGGCATCAAGACAGAagctgacccagatcaagtccaacttccatgccctggctg
UTR01_0034_A08.b : ACTGCAGGCCATCAAGACAGAGCTG
CLNT1_0115_G05.b : ACTGCAGGCCATCAAGACAGAGCTGACCCAAATTCAGTCaatatcaatgcctgctgggtc
PTG01_0039_C09.b : ATTGCAGGCCATCAAGACAGAGCTGACCCCAATCAAGTCCAACTTCCAGGCCCGGCTGGG
PTG01_0100_C12.b : ACTGCAGGCCATCCAGAAAGAACTGACCCCAATCAAGTTCAACATCCATGCCCTGCTggg
PTG01_0073_G04.b : ACTGCAAGCCATCAAGAAAGAGCTGACCCAAATCCAGTCCA*CATCAATGCCCTGCTggg
TES01_0110_D07.b : tccaataattcattttaaaaacatcgtaaatttccgggcctataaaataaaaaggtctcc
TES01_0110_E06.b : gaaattgtaagcccctcagaataggacctgaccctgattcatgtccccaatttcattgcc
TES01_0042_A06.b : AATGGAGGCCCTCCAGAACGAGCCGAACCCAATCAAGTCCAACTTCTATGCCCTGCTGGG
PST01_0061_F07.b : ACTGCAGGCCATCAAGACAGAGCTGACCCAGATCAAGTCCA*CATCGATGCCCTGCTGGG
LVRM1_0163_D04.b : ccacaaagaaaagcccctaccgatggggggaccgtatatgctaactgatgcataacataa
LVRM1_0163_F07.b : ACTGCgagccaccaaactaagctgacccagataagtccaacatcgagccctgctgggtgc
20110601C-000847 : TCGCTTGGAGCAGATTGCTGAGGA....................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : cccttggaaacaaatgctgaagaaacaaaaacccactccaaagggcaaaaaaagggcaaa
TES01_0105_B05.b : gcgcttggaaccaattgcttaggaccaaaaagccatccaaacggcaaaaaaaaggccaag
UTR01_0007_H09.b :
ITT01_0050_H09.b : TCGCTTGGAGCAaatttgctgagagcagaaagcaatcccaggcgcaaaaaaaaggcgaag
ITT01_0084_H08.b : TCGCTTGGAGCAgggtgactgagagcagatagccnatccagacggcaaaancagggctat
SPL01_0090_F04.b : TCGCTTGGAGCAGATTGCTGAGGAgcagaaagccatccagacggcaaaaaaaggccaagg
TES01_0093_D12.b : ccaatgccctggctggggtccccttgaaacaaaattggcctaagaaacaaaaaagccaca
CBLT1_0051_H04.b : cccttggaccaaattgcgaatgaccaaatgccattctttacccccataaaaggcaaatgt
BFLT1_0019_F08.b : gtggtaacaccggcggtggccatggtgctggcatttccattggtggtggcaatgctgttg
LVRM1_0027_C11.b :
PBL01_0032_G05.b : caattgcctaagaacaaaaagcccaccccacgccaaaataaaggcgaaaggtgcgccccc
PTG01_0086_G11.b : ggaacaaattgcttaagaaccaaaacccaatcccaaacgcaaaaaaaagggcaaaggggg
UTR01_0061_C08.b : ggtcgcttggaacaaaattgctgaagaacaaaaagcccaatccaaacggaaaaaaaaaag
UTR01_0034_A08.b :
CLNT1_0115_G05.b : ccttggacaaattgctgaggaacaaaacccattccgaacggcaaaaaaaggccaaagtgg
PTG01_0039_C09.b : Tcccttggaaccaaattgctgaagaaccaaaagcaaatcccaacggcaaaaaaaagggca
PTG01_0100_C12.b : tcccttggaaccaattgcttaaagaccaaagcccatcccaaacggaaaaaaaagggccaa
PTG01_0073_G04.b : tgccttgaacaaattgctaaggagcaaaaggccaatcaaacggcaaaaaaaagggcaagg
TES01_0110_D07.b : ccatttactagtccaatccctagaccccctggtgggtccctttggaaaatttttgctaag
TES01_0110_E06.b : cctgctgggtccccttggaaacaaaattgcttaaggagtcaaaaagccaattcccaacac
TES01_0042_A06.b : TCCCTTGGAacaaaatgccgaagaagcaaaaagcccatcccaaccgccaaaaaaaagggc
PST01_0061_F07.b : TCGCTTGGAGCAgatgctgaggagcaaaagccaatccagaggcaaaaaaaaaggcgaagg
LVRM1_0163_D04.b : ggcagtgcgc
LVRM1_0163_F07.b : cctgaaataaatcgctcatgagccaaagccgc
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : ggggccccgcggggggaatggcaccgccctccgcggggcggcaaccgccgggggaaaacc
TES01_0105_B05.b : ggggcaccggcaattgcatggccaccgcccacgccgggggggcccccggggggttacaca
UTR01_0007_H09.b :
ITT01_0050_H09.b : gtgcancgncggtggcantggcancgccacggcggtgccggcaccgncgtggtaccannc
ITT01_0084_H08.b : gtcggcagcgcggtggcagtggcatcgcagcggcagtggcgaagcaggcgtggtacaaca
SPL01_0090_F04.b : tggcaccgccggtggcattggcacccgcacccgcggttggcgcaacggcggtggtaacac
TES01_0093_D12.b : ccccaaacggcaaaaaaaaaaggggcaaaagggtgcacccgccgggtggcaaattgccaa
CBLT1_0051_H04.b : gcactcgcagttgcattgtcaacccactcccgtgcctcacaccaccgtatatcaacatcc
BFLT1_0019_F08.b : ggggcggaattggcataattgtgggcaatacccgcccccagcccctcagaggaccggctt
LVRM1_0027_C11.b :
PBL01_0032_G05.b : gtgggcttgggccccgcacccccgtggggcctccccgggggaaccacgccggggcatggg
PTG01_0086_G11.b : acccgggtggccattgccaccgcccccggctgtggccacccgcgggggtaaccacggggg
UTR01_0061_C08.b : ggccaaagggggcccccggcgggggcattgggccgccgcccccggcggggggcggccacc
UTR01_0034_A08.b :
CLNT1_0115_G05.b : caccgccgtggcattggcaccgcaacggcggtggcgcaccccggtggaccccggggtggc
PTG01_0039_C09.b : aaggggggaaccgccgggggcattggcaccgccaacggcggggggggccaccgcgggtga
PTG01_0100_C12.b : aggggcacccgcggtgggcatggccaccgccccccccgtggcccccgcccccgtgttaaa
PTG01_0073_G04.b : gtggcacgccgtggcattgccacggcaccgccgtggccgcacggcgtggtaacacggcgt
TES01_0110_D07.b : gaatcataaaatctcatatccatagttaaattaataagcataatttgtccatcccccgct
TES01_0110_E06.b : gctaaaaaaatagggcaaaaggtggctcctctcggtgggtttagttaaatcttatattgt
TES01_0042_A06.b : aaaggtggcaacggcggtggccttggcaaacggcacccgccgggggcggcacccgcgggg
PST01_0061_F07.b : tggcancggcggtggcaatggcancgcaacggcgttgcggcaacggcggtggtaacaccg
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : ggcggggcagtggggcggaaattcaatgggtggggcaaggtggggggggggcactggaaa
TES01_0105_B05.b : cgggggggcagggggccgggccttcccgtggggggacatgtctggggtggccccagtgca
UTR01_0007_H09.b :
ITT01_0050_H09.b : gcggttgcantggtgctggcattccaagtggtntgccattgctggtggtgccgccagggc
ITT01_0084_H08.b : gcgtggcatgatgctggcatacaatgatggtgcaatgctggtgtggcgcaaggcaaaaag
SPL01_0090_F04.b : cggcggtggccatggggctgg
TES01_0093_D12.b : ccgccaatcggcgggtgagctgccaccgtgctggtggtgaacccccgccctggtggacat
CBLT1_0051_H04.b : tttaatatgtgcaaaactcctaagtgtatcataatttataatgctctcaagctatattaa
BFLT1_0019_F08.b : cggaggaggcaccccccgggaaaacccagctccaaataacggcaccagaggggctgctaa
LVRM1_0027_C11.b :
PBL01_0032_G05.b : ctcggcaatcccaggggtgtgaactcgggggggcgccaagtacaaatgggggataacccc
PTG01_0086_G11.b : gggcaagggcgtgggatttcccttgggggggcaattcttgggggggcccatggcaaaagg
UTR01_0061_C08.b : ggcggggggtaaccacccgccgggggggagggggggctggggcccccccccggggggggg
UTR01_0034_A08.b :
CLNT1_0115_G05.b : atgttccggcttccctgggggtgccatccgggggggcgcatgcaatatgtgggattccgg
PTG01_0039_C09.b : aaaccggggggggacagggggttgggattcccaggggggggacatctgggggggggccca
PTG01_0100_C12.b : accgcgggggcaagggggtcggaatttcccgtgggggggcaagcttggggggggggcatg
PTG01_0073_G04.b : ggcatgggggtggcattcccgtgtggtggcatgctggggggccacatggcataagggggc
TES01_0110_D07.b : tagcacttatactaacttcttctggtggtgggtacacattctgttgtgataactatcaac
TES01_0110_E06.b : gggtggtggactaattgtgagggtaaaactacccgccgtgggtaatatgggtctgcacca
TES01_0042_A06.b : gttaaccatccccggaggccttggggccgggaatttccccaggtggagggaatccccggg
PST01_0061_F07.b : ccgtggcagtggtgctgacaatccaatgtggtggccatgctggtgggggcgccatggcca
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : aatggggacataaccggcacccccccctaaagaaaaggcttctaaggagggcccccccgg
TES01_0105_B05.b : atttggggggcataaccggccccccccccaaaaaaaaccgtttttggaggggccccccca
UTR01_0007_H09.b :
ITT01_0050_H09.b : acataatgggtgcaataaccggccccaaccccccaaaggacacggcttctgaagcggccc
ITT01_0084_H08.b : tgtgcattatcggccccaccctccaaaggacggttctgagcagaccccccgggaaaacca
SPL01_0090_F04.b :
TES01_0093_D12.b : tggttctctggacatttccaagttggtgtggttggcaatttctctggtgtaggtccacca
CBLT1_0051_H04.b : acatcttcatgacaccntactaaaattattattcactcatctcaccctgataaacacttg
BFLT1_0019_F08.b : ccccggggaaaactggaacccccccgataacaaacccgaggaggggccttcaaaaacccc
LVRM1_0027_C11.b :
PBL01_0032_G05.b : ccccccccccaaaaaaacccttttaggggggccccccgggaaaaccccccctcaaaaggc
PTG01_0086_G11.b : gggggaaaaaccgccccaaccccctcaaaagaaacttttttagacaggcccccccagaaa
UTR01_0061_C08.b : gggggaaggggcggggggggggggggggccaggggggcacaataggtgggggggggccaa
UTR01_0034_A08.b :
CLNT1_0115_G05.b : cccccccccaaaagaacgttttgagggggcccccggggaaccgcccaaaaacccaaaggg
PTG01_0039_C09.b : ttggcaaaagggggggaaaaccggcccccccccctaaagagaaacggttttggagggggc
PTG01_0100_C12.b : gccaatatggtggcaaaaccgcccccccccccccccaaaaaaaaggttctgaggaagggc
PTG01_0073_G04.b : attaccgccccaaccctcaaagaacggtttcaaggggcccccccggaaaaccagctcaaa
TES01_0110_D07.b : agcggcatattggactactcatatctccccattgggcggacatattcatattggggacca
TES01_0110_E06.b : tcacccggggtgggcggacatctctggggggtgtacccacaggcacaatatggagggcat
TES01_0042_A06.b : gggggccgaaatgtgctataatgtgggtcaaatcccggcccccctccccctcaaaagaaa
PST01_0061_F07.b : atagggtggcattaaccggccccaacccctcaaaagaaaggcttctgaggagccaccccc
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : gaaaaacaaggctccaattcggcaaagaaaggggggcatcccaccggagaaaacgtgggc
TES01_0105_B05.b : ggaaaaacccgccctatataacgcaaaaaggggggctctaacaccccggggaagaggggg
UTR01_0007_H09.b :
ITT01_0050_H09.b : cccccgggaaaaccagggcttccaaatacgccaacaaaaagggccgccaacccacccagg
ITT01_0084_H08.b : aggccaaaaacccccaaaagagggggtaaccccccggaaaattgaccaccctataaaacg
SPL01_0090_F04.b :
TES01_0093_D12.b : ctaagcacaatttattgggtggacgaataatccggcctactcatacgcccctatgaagat
CBLT1_0051_H04.b : ccacatccgattatattgttctacacacgctcctcacgatctacggcttaatcctaagca
BFLT1_0019_F08.b : tgcagggagatggccaccgccaaaaagggtgtcctttacggttgggcccacccgtgaacc
LVRM1_0027_C11.b :
PBL01_0032_G05.b : ccaaaggggggctcaacccccggaaaaagtggagcccccacataaacccggagggggttt
PTG01_0086_G11.b : aaccatgtctaaaatagccccaaaaaaggggtcctcccccccgggaaaaagggggccccc
UTR01_0061_C08.b : taaccc
UTR01_0034_A08.b :
CLNT1_0115_G05.b : ggctccccaccgggaaggggcccccaaaaaccgggagggctctaatacccccaagggacc
PTG01_0039_C09.b : ccccccgggaaaacacagcttaaaaatcgccaaagagagggtttaccccccgggaaaagt
PTG01_0100_C12.b : ccccccgggaaaaacaggtcccaaaaaacccacaaaaaggggtctctaacccccgggaaa
PTG01_0073_G04.b : tacgcaaaaaggggtctaaccccgggaaaagtgggccccccaaaaacccggagggggctt
TES01_0110_D07.b : cttgcttcattatggtgggttttataattctactcccccccactcttaaagaaattcttc
TES01_0110_E06.b : taatccgcccctccccccctcctataaaaacctgtttttaaagaaaggagcctcctcccg
TES01_0042_A06.b : acgggtttctatggggggaccccccccagagaaaacccactgtccttaatttaaggcata
PST01_0061_F07.b : ggaagaacccaggctcaaataaggccacagaagggctgtaaccccggagggaaactggag
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b : ccccggataaaccggagaaggggctttcttaacccccacggggtgagccccc
TES01_0105_B05.b : caccccgtaactacccggaaggggccctgtataccccccgaaagagtaggcccccgcgaa
UTR01_0007_H09.b :
ITT01_0050_H09.b : aaaaatgggacccacccgaaaaaaaccgagaaagggccttccataaaccccacaaggaaa
ITT01_0084_H08.b : aaaagggctttttaaacccttggaggtgccccccggaaagggggttttcggtgggccccc
SPL01_0090_F04.b :
TES01_0093_D12.b : atacgacctttttataatatggaggcgcacctccacgataataagatacaaatacgtctt
CBLT1_0051_H04.b : gcaatctgtaccacggaaattgatcctcaaagccagcaaaacagagcctcataatatttg
BFLT1_0019_F08.b : cccccggggctccaggaaatgggaaggacctctccctcttcaacaggcatttttgggggg
LVRM1_0027_C11.b :
PBL01_0032_G05.b : ctaaaccccctcaagtgtcccccccaagaggggtctttgggggggcccccgtgtcccccg
PTG01_0086_G11.b : cgaataaacccgggaagggggccttttaaacccccccagaaatggcccccccaaaaaagg
UTR01_0061_C08.b :
UTR01_0034_A08.b :
CLNT1_0115_G05.b : cccaggaaggggttttgggggccccctgtcccccggggagagaagagaccccccccaacg
PTG01_0039_C09.b : gtgaaccccctaaaacccgcgagggggcctctcaaaacccacaaaaaggtgcccccccga
PTG01_0100_C12.b : aagggggaccccccaataaaaacgcgaagagggcctgctcaaccccccccaagaggaggc
PTG01_0073_G04.b : caaaaccccaagattagtcccccggaaagggttttttgggtgaccccccggccccccggg
TES01_0110_D07.b : ttagtaagaacgccccccccgagaaaaaactcaccccagataataaaatcaataaagagg
TES01_0110_E06.b : aattaaaaacaagcttctcaatagaacgcccataaagaggtgtctccaccttctaccttg
TES01_0042_A06.b : aaagaaggggctctttcccacccctgggtaaaattggaccactcccggaaaaacacccgg
PST01_0061_F07.b : ccacccgaaacaaccggagagggccttgcaaacccccgagggtgtaggccccgcagaagg
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b :
TES01_0105_B05.b : aggtggtttttcct
UTR01_0007_H09.b :
ITT01_0050_H09.b : gtccccccgcaaaagggggtctttacgggggggcccccccggacccccccggggcacaaa
ITT01_0084_H08.b : ggaaccccccgggcaaaaagaggaagagccccccctcccaggaatgtggg
SPL01_0090_F04.b :
TES01_0093_D12.b : aataaatctcgcaataacataagagtggctatcttt
CBLT1_0051_H04.b : tccatactatcaatatacacttaaaaatatantgaaccccccacccggtaatacaccata
BFLT1_0019_F08.b : atttgtgcccccaaccccttgggtggccccccaaagaaaatattctctttctttcc
LVRM1_0027_C11.b :
PBL01_0032_G05.b : gagaaaagaagagaactccctctccccaaaaactggggatggtctctcccctccgggaga
PTG01_0086_G11.b : gtgttttttggggtggacccccccgtagccccccccggtcaaaaaagaggggaagccccc
UTR01_0061_C08.b :
UTR01_0034_A08.b :
CLNT1_0115_G05.b : gatatggggttgtcccccctgggcgggagatatctctcccccccctttttttttgggnnn
PTG01_0039_C09.b : aagagggtgttttggtgggccaccctggaccccccgggtaaaaaaggggggaccctctcc
PTG01_0100_C12.b : cccccagaaagggggtgttttttgtggggaccccccttggaccccccggggcagaaagaa
PTG01_0073_G04.b : taaaaaaagggggagcctccccccccaagcatttgggggttttgcccccctttggggacc
TES01_0110_D07.b : tctcttcctcccctctaagaaaaagtgtgcactctcattatatccattaggtgagtgtgt
TES01_0110_E06.b : gataataagtgtggacacctctagataaaacactctagaaggatggccgtgctgtaataa
TES01_0042_A06.b : aagtagtggcctctccctataccaccccaaggataaaggccaccccagaaaatgggtgtc
PST01_0061_F07.b : ggtccttcccggtggacccccgtggacccccgggtccaagaagtggaaggcctccctcct
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b :
TES01_0105_B05.b :
UTR01_0007_H09.b :
ITT01_0050_H09.b : aagtgagggccccccccttccc
ITT01_0084_H08.b :
SPL01_0090_F04.b :
TES01_0093_D12.b :
CBLT1_0051_H04.b : tactgattnatgattgagantaaatacnactancccnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0019_F08.b :
LVRM1_0027_C11.b :
PBL01_0032_G05.b : aaagaagaaactcccctcccccacccgtttgtagtggggggagatgaaaaaaaaaaaaaa
PTG01_0086_G11.b : ccctcccccacggg
UTR01_0061_C08.b :
UTR01_0034_A08.b :
CLNT1_0115_G05.b : nnnnaaagagagaaggggcctcctattataagcacacccgc
PTG01_0039_C09.b : cccaagaggggtgcggaggggtcgcccacccctcggagagagaagaaatatcctccccca
PTG01_0100_C12.b : gggagggaccccccctctccacaaagaata
PTG01_0073_G04.b : agagaaattccctctccccaccgggttttttgt
TES01_0110_D07.b : tttttatactcagtctcgaatga
TES01_0110_E06.b : cactccccgatcgatgtgtgc
TES01_0042_A06.b : attactccgggtggcacccctcttgtggg
PST01_0061_F07.b : cacagaggatttggggggattggccccccactctgtgggccgaaggaagatctcactcct
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b :
TES01_0105_B05.b :
UTR01_0007_H09.b :
ITT01_0050_H09.b :
ITT01_0084_H08.b :
SPL01_0090_F04.b :
TES01_0093_D12.b :
CBLT1_0051_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0019_F08.b :
LVRM1_0027_C11.b :
PBL01_0032_G05.b : nnnnnnnnnnnnncnncncnangagcgagagttattaatgctctccnnnt
PTG01_0086_G11.b :
UTR01_0061_C08.b :
UTR01_0034_A08.b :
CLNT1_0115_G05.b :
PTG01_0039_C09.b : cacgtgtgttttgtggggaggggaaaaataaaaaaaaattctntctaatccttatttatt
PTG01_0100_C12.b :
PTG01_0073_G04.b :
TES01_0110_D07.b :
TES01_0110_E06.b :
TES01_0042_A06.b :
PST01_0061_F07.b : cccaccg
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :
20110601C-000847 : ............................................................
---------+---------+---------+---------+---------+---------+ 949
LVRM1_0160_G06.b :
TES01_0105_A02.b :
TES01_0105_B05.b :
UTR01_0007_H09.b :
ITT01_0050_H09.b :
ITT01_0084_H08.b :
SPL01_0090_F04.b :
TES01_0093_D12.b :
CBLT1_0051_H04.b : nnnn
BFLT1_0019_F08.b :
LVRM1_0027_C11.b :
PBL01_0032_G05.b :
PTG01_0086_G11.b :
UTR01_0061_C08.b :
UTR01_0034_A08.b :
CLNT1_0115_G05.b :
PTG01_0039_C09.b : t
PTG01_0100_C12.b :
PTG01_0073_G04.b :
TES01_0110_D07.b :
TES01_0110_E06.b :
TES01_0042_A06.b :
PST01_0061_F07.b :
LVRM1_0163_D04.b :
LVRM1_0163_F07.b :