[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000985

Length: 1,129

Sequence [FASTA format sequence]
TTAAGCCATG AACGAAAGTT TGACCCATTT ATATTAATTA GAGTTGGTAA ATCTCGTGCC
AGCCACCGCG GTCATACGAT TAACCCAAAT TAATAGATCC ACGGCGTAAA GAGTGTTTAA
GAAAAAAAAT CACAGTCCTT TCTAGCTTGA ATGCCTGGTG GCTGAGGCCG CTAGGGAGTC
CCTCCTGTTG GGACCCGCGT GTGACCTTCC CGCCTGCGGA GCGATGCTGC CGGCGGCTGC
AAGCTCCCTG TGGGGGCCGT GTTTCGGGCT TCGGGCCGCT GCGCTCCGCG TCGCCAGGCA
CCAGGGACCG AGACTGTGCG GTGTGCGGTT GATGAGATGC AGCAGCCATC GAAAGGGGGA
GGCTCTTGCT GGGGCCCCCC TGGATAACGC CCCCAAGGAG TATCCCCCCA AAATCCAGCA
GCTGGTTCAG GACATTGCCA GCCTTACGCT CCTGGAGATC TCAGACCTCA ACGAGCTCCT
GAAGAAAACG CTGAAGATCC AGGACGTTGG GTTCATGCCC ATGGGTGCCG TGGCCCCTGG
CGCTCCCCCT GCCGCCGCCG CCCCAGAGGC CGCGGAAGAA GACCTCCCCA AACGGAAGGA
GCAGACGCAT TTCACCGTCC GCCTGACGGA GGCGAAGCCC GTGGACAAGG TGAAGCTGAT
CAAGGAGATT AAAAGCCACA TCCAGGGCAT CAACCTGGTG CAGGCGAAGA AGCTGGTGGA
ATCCCTGCCC CAGGAAATCA AAGCCAACGT GCCCAAAGCT GAGGCTGAGA AGATCAAGGC
GGCCCTGGAG GCGGTGGGCG GCACCGTGGT TCTGGAGTAG GCTTCCCGGA GGACCGTGCA
CAGGGGTCCG GCCCCCCCCT CCCTCCCCGT GTGGGGCGCC ACCTGCTCCC CGCCCAGTGC
CCAGGCTCAG TGGACGGAGA GGCCTTGGAG CAGAACTGGC ACCTGCAGCG CGTGGCCAGC
TCCGTCCTGG GACAGACGGA AGGACCTCCT GAAATGGGGA AGGGGGGCGG CCCCCCCTGG
GCCCCCCGGT GGCAGGGCTC TGGAACCTTC CCAGTCACGC GCCCCCTGGT GGTCTGTGAA
AAAAAAGCGT TTTTAGGCCG CTAAAAAAAA AAAAAAAAAA AAAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPL1239S ribosomal protein L12, mitochondrial precursor [Homo sapiens]. 2589e-69O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMrpl1239S ribosomal protein L12, mitochondrial precursor [Mus musculus]. 2492e-66O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608030PREDICTED: similar to 39S ribosomal protein L12, mitochondrial precursor (L12mt) (MRP-L12) (5c5-2) [Canis familiaris]. 2632e-70O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPL1239S ribosomal protein L12, mitochondrial precursor [Bos taurus]. 2671e-71O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100622784PREDICTED: 39S ribosomal protein L12, mitochondrial-like, partial [Sus scrofa]. 1424e-34O
Contig/Assembly ProteinLOC100624982PREDICTED: 39S ribosomal protein L12, mitochondrial-like, partial [Sus scrofa]. 1247e-29O


Assembly Members: 77      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BMWN10005B01BMWN1_0005_B01.b  
BMWN10018E09BMWN1_0018_E09.bHX206658 
BMWN10034G06BMWN1_0034_G06.bHX207707 
CBLT10050H11CBLT1_0050_H11.bHX215200 
CLNT10010B01CLNT1_0010_B01.bFS657816 
CLNT10047A01CLNT1_0047_A01.bFS660731 
CLNT10098B03CLNT1_0098_B03.bFS664154 
ITT010001C08ITT01_0001_C08.bBW976065 
ITT010005F12ITT01_0005_F12.bBW976470 
ITT010006E06ITT01_0006_E06.bBW976542 
ITT010006G06ITT01_0006_G06.bBW976566 
ITT010016C11ITT01_0016_C11.bBW977432 
ITT010031E12ITT01_0031_E12.bBW978804 
ITT010035E04ITT01_0035_E04.bBW979159 
ITT010058F02ITT01_0058_F02.bBW981173 
ITT010058H01ITT01_0058_H01.bBW981194 
ITT010062A11ITT01_0062_A11.bBW981481 
ITT010068F07ITT01_0068_F07.bBW982077 
ITT010069C11ITT01_0069_C11.bBW982139 
ITT010072A05ITT01_0072_A05.bBW982377 
ITT010081A11ITT01_0081_A11.bBW983166 
ITT010085H05ITT01_0085_H05.bBW983582 
ITT010088F11ITT01_0088_F11.bBW983836 
ITT010089E04ITT01_0089_E04.bBW983910 
ITT010092C09ITT01_0092_C09.bBW984162 
ITT010101A08ITT01_0101_A08.bBW984953 
ITT010103A02ITT01_0103_A02.bBW985131 
KDN010047E01KDN01_0047_E01.bFS674403 
LNG010073H05LNG01_0073_H05.bBP440339 
LNG010075A04LNG01_0075_A04.bBP433300 
LNG010106E01LNG01_0106_E01.bBP436997 
LVRM10194D04LVRM1_0194_D04.bCJ006505 
MLN010012H06MLN01_0012_H06.bCJ008672 
MLN010014F07MLN01_0014_F07.bCJ008820 
MLN010020B03MLN01_0020_B03.bCJ009127 
MLN010024A05MLN01_0024_A05.bCJ009447 
MLN010031B10MLN01_0031_B10.bCJ010032 
MLN010044B03MLN01_0044_B03.bCJ011095 
MLN010049D09MLN01_0049_D09.bCJ011447 
MLN010049G04MLN01_0049_G04.bCJ011475 
MLN010057A01MLN01_0057_A01.bCJ012092 
MLN010085D11MLN01_0085_D11.bCJ014435 
MLN010090H01MLN01_0090_H01.bCJ014881 
MLN010092D02MLN01_0092_D02.bCJ015013 
MLN010093C04MLN01_0093_C04.bCJ015096 
MLN010097A12MLN01_0097_A12.bCJ015413 
OVR010088D09OVR01_0088_D09.bBW967238 AK234571
OVRM10206B01OVRM1_0206_B01.bBP455611 
OVRM10213G03OVRM1_0213_G03.bBP460629 
PTG010061A02PTG01_0061_A02.bFS709717 
PTG010066C04PTG01_0066_C04.bFS710107 
SKNB10020C01SKNB1_0020_C01.bDB801067 
SKNB10023H08SKNB1_0023_H08.bDB801264 
SMG010070G02SMG01_0070_G02.bFS719344 
SMG010091B05SMG01_0091_B05.bFS721108 
SPL010053G08SPL01_0053_G08.bCJ017824 
SPLT10022F01SPLT1_0022_F01.bHX240923 
SPLT10038D11SPLT1_0038_D11.bHX242150 
SPLT10046F09SPLT1_0046_F09.bHX242801 
SPLT10066A07SPLT1_0066_A07.bHX244295 
TCH010102G12TCH01_0102_G12.bCJ029937 
UTR010004C06UTR01_0004_C06.bBP170647 
UTR010004F06UTR01_0004_F06.bBP172251 
UTR010005C09UTR01_0005_C09.bBP170784 
UTR010006C09UTR01_0006_C09.bBP170785 
UTR010007E11UTR01_0007_E11.bBP171944 
UTR010017E10UTR01_0017_E10.bBP171911 AK352169
UTR010022D02UTR01_0022_D02.bBP171027 
UTR010034C04UTR01_0034_C04.bBP170584 
UTR010040F05UTR01_0040_F05.bBP172239 
UTR010040F10UTR01_0040_F10.bBP172457 
UTR010043G12UTR01_0043_G12.bBP173088 
UTR010051H11UTR01_0051_H11.bBP464932 
UTR010083C07UTR01_0083_C07.bCJ037645 
UTR010095C04UTR01_0095_C04.bCJ038747 
UTR010103D03UTR01_0103_D03.bCJ039410 
UTR010106F10UTR01_0106_F10.bCJ039719 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
572A600.081WNACG/T
G6530.919GCG/A


Alignment:      TOP

20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVR01_0088_D09.b : atcctctagtttactgggcattggaatataaaaaagtttgtcxxxxxxxxxxxxxxxxxx
UTR01_0034_C04.b :
LNG01_0106_E01.b :
SPLT1_0022_F01.b :
BMWN1_0005_B01.b :
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b :
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b :
20110601C-000985 : .....................................TTAAGCCATGAACGAAAGTTTGA
---------+---------+---------+---------+---------+---------+ 23
OVR01_0088_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTAAGCCATGAACGAAAGTTTGA
UTR01_0034_C04.b :
LNG01_0106_E01.b :
SPLT1_0022_F01.b :
BMWN1_0005_B01.b :
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b :
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b : nnnna
UTR01_0004_F06.b :
UTR01_0017_E10.b : tt
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b : gaactacgttagcgnacgxxxxxxxxx
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b :
20110601C-000985 : CCCATTTATATTAATTAGAGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAA
---------+---------+---------+---------+---------+---------+ 83
OVR01_0088_D09.b : CCCATTTATATTAATTAGAGTTGGTAAATCTCGTGCCAGCCACCGCGGTCATACGATTAA
UTR01_0034_C04.b : gggggcacxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0106_E01.b : nnnnggatgtacttgacagtt
SPLT1_0022_F01.b : nnnggcgac
BMWN1_0005_B01.b : taa
MLN01_0093_C04.b : nnnggctaggactatnacxxxxxxxxxx
SPLT1_0046_F09.b : nnnc
ITT01_0016_C11.b : n
ITT01_0092_C09.b : nnn
MLN01_0024_A05.b : nnnncctaggactatgacagtttgt
UTR01_0040_F10.b : tggagaacxxxxxxxxxxxxxxxxxxxx
SPLT1_0066_A07.b : nnttagc
MLN01_0012_H06.b : nnttcggctggtacttnacagtttgtcxx
MLN01_0049_D09.b : nnnngggctggactatgacxxxxxxxx
UTR01_0095_C04.b : nnnnggctaggactatnacxxxxxxxx
SPLT1_0038_D11.b : nnnnggcctgntnnnnntgc
BMWN1_0034_G06.b : tttttagcaagttagacgc
MLN01_0049_G04.b : nnnnggctagtacttgacxxxxxxxxx
CLNT1_0047_A01.b : nntttccgttagcgnacgxx
ITT01_0069_C11.b : n
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : at
MLN01_0097_A12.b : nnnnggctagtacttanacxxxxxxxxx
LNG01_0075_A04.b : nnnnnccatggctatgacagtttg
UTR01_0007_E11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0070_G02.b : nnnnnnnnnn
ITT01_0006_E06.b : nn
UTR01_0006_C09.b : gttgxxxxxxxxxxxxxxxxxxxxx
ITT01_0062_A11.b : nnnnggtgaaacaxx
UTR01_0106_F10.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0061_A02.b : tt
ITT01_0081_A11.b : nnn
TCH01_0102_G12.b : nnttagctagtgacttnacxxxxxxx
ITT01_0031_E12.b : nn
MLN01_0044_B03.b : nnnnggctaggacttgacagttt
SMG01_0091_B05.b : ctt
MLN01_0092_D02.b : nnnnngggtaggacttgacagtttg
MLN01_0031_B10.b : nnnnggctaggactatnacxxxxxxx
MLN01_0090_H01.b : nnnnggctagtactatnacxxxxxxx
UTR01_0005_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_B03.b : nntttccgtggacttgacagtttg
UTR01_0040_F05.b : gggtgacttattagxxxxxxxxxxxx
MLN01_0057_A01.b : nnnttgctaggacttgacagtttg
LNG01_0073_H05.b : ggggtgcttggacttgacxxxxxxxxx
UTR01_0103_D03.b : agcttaggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0004_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0017_E10.b : tttggttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_F11.b : nnn
MLN01_0085_D11.b : ngcttggactatgacxxxxxxxxxxxxxx
ITT01_0068_F07.b : nnnggatgaa
ITT01_0101_A08.b :
ITT01_0058_H01.b : n
ITT01_0035_E04.b :
ITT01_0001_C08.b : n
UTR01_0043_G12.b : ttttggtgccxxxxxxxxxxxxxxxxxxxxxx
UTR01_0083_C07.b : nnngggttgtgacttgacxxxxxxx
OVRM1_0206_B01.b : agt
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgtgtttccgacgacc
SPL01_0053_G08.b : nnnnggctagtgacttnacxxx
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b : cctxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0020_C01.b :
BMWN1_0018_E09.b : tt
ITT01_0103_A02.b :
UTR01_0004_C06.b : gxxxxxxxxxxxxxxx
UTR01_0022_D02.b : gggggxxxxxxxxxxx
CLNT1_0098_B03.b : ttgatc
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b :
20110601C-000985 : CCCAAATTAATAGATCCACGGCGTAAAGAGTGTTTAAGAAAAAAAATCACAGTCCTTTCT
---------+---------+---------+---------+---------+---------+ 143
OVR01_0088_D09.b : CCCAAATTAATAGATCCACGGCGTAAAGAGTGTTTAAGAAAAAAAATCACAATAGAGTCT
UTR01_0034_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagagcGTCCTTTCT
LNG01_0106_E01.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCTTTCT
SPLT1_0022_F01.b : ggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaGCTTTCT
BMWN1_0005_B01.b : gccagtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCT
MLN01_0093_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCTTTCT
SPLT1_0046_F09.b : cgcggtacaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCT
ITT01_0016_C11.b : nggactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactggCTTTTCT
ITT01_0092_C09.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
MLN01_0024_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
UTR01_0040_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
SPLT1_0066_A07.b : tagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCT
MLN01_0012_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgGCTTTCT
MLN01_0049_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
UTR01_0095_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
SPLT1_0038_D11.b : agtacnacgcantxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaGCTTTCT
BMWN1_0034_G06.b : cgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCT
MLN01_0049_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
CLNT1_0047_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
ITT01_0069_C11.b : nnggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCT
LVRM1_0194_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
OVRM1_0213_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
PTG01_0066_C04.b : tttggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0097_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
LNG01_0075_A04.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0007_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
SMG01_0070_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0006_E06.b : nngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0006_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0062_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0106_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
PTG01_0061_A02.b : ttttgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0081_A11.b : nggatgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
TCH01_0102_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0031_E12.b : ttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0044_B03.b : gtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
SMG01_0091_B05.b : ttnggataaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0092_D02.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0031_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0090_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0005_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0020_B03.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0040_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0057_A01.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
LNG01_0073_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctTTTTCT
UTR01_0103_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0004_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0017_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0088_F11.b : nggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
MLN01_0085_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctactggTTTTCT
ITT01_0068_F07.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggaaaaaCTTTCT
ITT01_0101_A08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0058_H01.b : aagtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctTTTTCT
ITT01_0035_E04.b : nnggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
ITT01_0001_C08.b : nnnnaatgaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCT
UTR01_0043_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttTTTTCT
UTR01_0083_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactggTTTCT
OVRM1_0206_B01.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCT
ITT01_0089_E04.b : nggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggTTCT
ITT01_0072_A05.b : nnttatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCT
CLNT1_0010_B01.b : cagccggctagagcgtcttacccccagctcggctgtccagccggctagagcgtccttTCT
SPL01_0053_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ITT01_0085_H05.b : ntttatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ITT01_0005_F12.b : ntttagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ITT01_0058_F02.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
ITT01_0006_G06.b : naatatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
UTR01_0051_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT
SKNB1_0020_C01.b : nnnnggggannnnnnaacatacgtggctatggaagcgcctttc
BMWN1_0018_E09.b : tttggcaagtgagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
ITT01_0103_A02.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0004_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0022_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0098_B03.b : cgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0023_H08.b : nnnngggtttnnnnnnngcagcgttggctggct
CBLT1_0050_H11.b : tttt
KDN01_0047_E01.b :
MLN01_0014_F07.b : nnntttgatggactatnaca
20110601C-000985 : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
---------+---------+---------+---------+---------+---------+ 200
OVR01_0088_D09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0034_C04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
LNG01_0106_E01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SPLT1_0022_F01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
BMWN1_0005_B01.b : AGCCCTGTATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGTTACACGCGT
MLN01_0093_C04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SPLT1_0046_F09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0016_C11.b : AG*CTCGTATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0092_C09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGTTCCCTCCTGTTGGGACCCGCGT
MLN01_0024_A05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0040_F10.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SPLT1_0066_A07.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0012_H06.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0049_D09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0095_C04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SPLT1_0038_D11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
BMWN1_0034_G06.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0049_G04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
CLNT1_0047_A01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0069_C11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
LVRM1_0194_D04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
OVRM1_0213_G03.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
PTG01_0066_C04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0097_A12.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
LNG01_0075_A04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0007_E11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SMG01_0070_G02.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0006_E06.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0006_C09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0062_A11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0106_F10.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
PTG01_0061_A02.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0081_A11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
TCH01_0102_G12.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0031_E12.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0044_B03.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SMG01_0091_B05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0092_D02.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0031_B10.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0090_H01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0005_C09.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0020_B03.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0040_F05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0057_A01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
LNG01_0073_H05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0103_D03.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0004_F06.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0017_E10.b : AG*CTTGAATGCCTGGGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0088_F11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
MLN01_0085_D11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0068_F07.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0101_A08.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0058_H01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0035_E04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0001_C08.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0043_G12.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0083_C07.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
OVRM1_0206_B01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0089_E04.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0072_A05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
CLNT1_0010_B01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SPL01_0053_G08.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0085_H05.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0005_F12.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0058_F02.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0006_G06.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0051_H11.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SKNB1_0020_C01.b : AG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
BMWN1_0018_E09.b : AG*CTTGACTGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
ITT01_0103_A02.b : xG*CTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0004_C06.b : xxxCTTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
UTR01_0022_D02.b : xxxxgTGAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
CLNT1_0098_B03.b : xxxcgttAATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGGGACCCGCGT
SKNB1_0023_H08.b : tttacttgATGCCT*GGTGGCTGAGGCCGCTAGGGAGT*CCCTCCTGTTGTGACCCGCGT
CBLT1_0050_H11.b : nggcaggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCGT
KDN01_0047_E01.b : tacccttttaaGT
MLN01_0014_F07.b : gtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-000985 : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
---------+---------+---------+---------+---------+---------+ 260
OVR01_0088_D09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0034_C04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
LNG01_0106_E01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SPLT1_0022_F01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
BMWN1_0005_B01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0093_C04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SPLT1_0046_F09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0016_C11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0092_C09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0024_A05.b : GTGGCCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0040_F10.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SPLT1_0066_A07.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0012_H06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0049_D09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0095_C04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SPLT1_0038_D11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
BMWN1_0034_G06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0049_G04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
CLNT1_0047_A01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0069_C11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
LVRM1_0194_D04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
OVRM1_0213_G03.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
PTG01_0066_C04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0097_A12.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
LNG01_0075_A04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0007_E11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SMG01_0070_G02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0006_E06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0006_C09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0062_A11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0106_F10.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
PTG01_0061_A02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0081_A11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
TCH01_0102_G12.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0031_E12.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0044_B03.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SMG01_0091_B05.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0092_D02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0031_B10.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0090_H01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0005_C09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0020_B03.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0040_F05.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0057_A01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
LNG01_0073_H05.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0103_D03.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0004_F06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0017_E10.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0088_F11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0085_D11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0068_F07.b : GTGACCTTCCCGCCTGAGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0101_A08.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0058_H01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0035_E04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0001_C08.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0043_G12.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGTCGT
UTR01_0083_C07.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
OVRM1_0206_B01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0089_E04.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0072_A05.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
CLNT1_0010_B01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SPL01_0053_G08.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0085_H05.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0005_F12.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0058_F02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0006_G06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0051_H11.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SKNB1_0020_C01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
BMWN1_0018_E09.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
ITT01_0103_A02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0004_C06.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
UTR01_0022_D02.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
CLNT1_0098_B03.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
SKNB1_0023_H08.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCGGCCGCTGCAAGCTCCCTGTGGGGGCCGT
CBLT1_0050_H11.b : GTGACCTTCCCTCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
KDN01_0047_E01.b : GTGACCTTCCCGCCTGCGGAGCGATGCTGCCCCCTGCTGCAAGCTCCCTGTGGGGGCCGT
MLN01_0014_F07.b : xxxxxCTTCCCGCCTGCGGAGCGATGCTGCCGGCGGCTGCAAGCTCCCTGTGGGGGCCGT
20110601C-000985 : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
---------+---------+---------+---------+---------+---------+ 320
OVR01_0088_D09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0034_C04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
LNG01_0106_E01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SPLT1_0022_F01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
BMWN1_0005_B01.b : GTTTCTGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0093_C04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SPLT1_0046_F09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0016_C11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0092_C09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0024_A05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0040_F10.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SPLT1_0066_A07.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0012_H06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0049_D09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0095_C04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SPLT1_0038_D11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
BMWN1_0034_G06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0049_G04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
CLNT1_0047_A01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0069_C11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
LVRM1_0194_D04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
OVRM1_0213_G03.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
PTG01_0066_C04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0097_A12.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
LNG01_0075_A04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0007_E11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCATGGACCGAGACTGTGCG
SMG01_0070_G02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0006_E06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0006_C09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0062_A11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0106_F10.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
PTG01_0061_A02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0081_A11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
TCH01_0102_G12.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0031_E12.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0044_B03.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SMG01_0091_B05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0092_D02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0031_B10.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0090_H01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0005_C09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0020_B03.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0040_F05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0057_A01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
LNG01_0073_H05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0103_D03.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0004_F06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0017_E10.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCGGGCACCAGGGACCGAGACTGTGCG
ITT01_0088_F11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
MLN01_0085_D11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0068_F07.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0101_A08.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0058_H01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0035_E04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0001_C08.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0043_G12.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0083_C07.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
OVRM1_0206_B01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0089_E04.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0072_A05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
CLNT1_0010_B01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SPL01_0053_G08.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0085_H05.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0005_F12.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0058_F02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0006_G06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0051_H11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SKNB1_0020_C01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
BMWN1_0018_E09.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
ITT01_0103_A02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0004_C06.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
UTR01_0022_D02.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
CLNT1_0098_B03.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
SKNB1_0023_H08.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
CBLT1_0050_H11.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
KDN01_0047_E01.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCATGGACCGAGACTGTGCG
MLN01_0014_F07.b : GTTTCGGGCTTCGGGCCGCTGCGCTCCGCGTCGCCAGGCACCAGGGACCGAGACTGTGCG
20110601C-000985 : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
---------+---------+---------+---------+---------+---------+ 380
OVR01_0088_D09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0034_C04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
LNG01_0106_E01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SPLT1_0022_F01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
BMWN1_0005_B01.b : GTGTGCGGTTGATGAGATGCAGCATCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0093_C04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SPLT1_0046_F09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0016_C11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0092_C09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0024_A05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0040_F10.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SPLT1_0066_A07.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0012_H06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0049_D09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0095_C04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SPLT1_0038_D11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
BMWN1_0034_G06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0049_G04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAATGGGGAGGCTCTTGCTGGGGCCCCCC
CLNT1_0047_A01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0069_C11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
LVRM1_0194_D04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
OVRM1_0213_G03.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
PTG01_0066_C04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0097_A12.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
LNG01_0075_A04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0007_E11.b : GTGTGCGGTTGATGAGATGCATCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SMG01_0070_G02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0006_E06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0006_C09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0062_A11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0106_F10.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
PTG01_0061_A02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0081_A11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
TCH01_0102_G12.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0031_E12.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0044_B03.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SMG01_0091_B05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0092_D02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0031_B10.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0090_H01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0005_C09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0020_B03.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0040_F05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0057_A01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
LNG01_0073_H05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0103_D03.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0004_F06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0017_E10.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0088_F11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0085_D11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0068_F07.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0101_A08.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0058_H01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0035_E04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0001_C08.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0043_G12.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0083_C07.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
OVRM1_0206_B01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0089_E04.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0072_A05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
CLNT1_0010_B01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SPL01_0053_G08.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0085_H05.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0005_F12.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0058_F02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0006_G06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0051_H11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SKNB1_0020_C01.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
BMWN1_0018_E09.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
ITT01_0103_A02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0004_C06.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
UTR01_0022_D02.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
CLNT1_0098_B03.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
SKNB1_0023_H08.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
CBLT1_0050_H11.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
KDN01_0047_E01.b : GTGTGCGGTTGATGAGATGCAGCAGCCGTCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
MLN01_0014_F07.b : GTGTGCGGTTGATGAGATGCAGCAGCCATCGAAAGGGGGAGGCTCTTGCTGGGGCCCCCC
20110601C-000985 : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
---------+---------+---------+---------+---------+---------+ 440
OVR01_0088_D09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0034_C04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGGCATTGCCA
LNG01_0106_E01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SPLT1_0022_F01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
BMWN1_0005_B01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0093_C04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SPLT1_0046_F09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0016_C11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0092_C09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0024_A05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0040_F10.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SPLT1_0066_A07.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0012_H06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0049_D09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0095_C04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SPLT1_0038_D11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
BMWN1_0034_G06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0049_G04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
CLNT1_0047_A01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0069_C11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
LVRM1_0194_D04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
OVRM1_0213_G03.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
PTG01_0066_C04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0097_A12.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
LNG01_0075_A04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0007_E11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SMG01_0070_G02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0006_E06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0006_C09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0062_A11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0106_F10.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
PTG01_0061_A02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0081_A11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
TCH01_0102_G12.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0031_E12.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0044_B03.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SMG01_0091_B05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0092_D02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0031_B10.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0090_H01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0005_C09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0020_B03.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0040_F05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0057_A01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
LNG01_0073_H05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0103_D03.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0004_F06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0017_E10.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0088_F11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
MLN01_0085_D11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0068_F07.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0101_A08.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0058_H01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0035_E04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0001_C08.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0043_G12.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0083_C07.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
OVRM1_0206_B01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0089_E04.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0072_A05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
CLNT1_0010_B01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SPL01_0053_G08.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0085_H05.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0005_F12.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0058_F02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0006_G06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0051_H11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SKNB1_0020_C01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
BMWN1_0018_E09.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
ITT01_0103_A02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0004_C06.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
UTR01_0022_D02.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
CLNT1_0098_B03.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
SKNB1_0023_H08.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
CBLT1_0050_H11.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
KDN01_0047_E01.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCATCTGGTTCAGGACATTGCCA
MLN01_0014_F07.b : TGGATAACGCCCCCAAGGAGTATCCCCCCAAAATCCAGCAGCTGGTTCAGGACATTGCCA
20110601C-000985 : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
---------+---------+---------+---------+---------+---------+ 500
OVR01_0088_D09.b : GCCTTACGCTCCTGGAGATCTCACACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0034_C04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
LNG01_0106_E01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SPLT1_0022_F01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
BMWN1_0005_B01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAATATCC
MLN01_0093_C04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SPLT1_0046_F09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0016_C11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0092_C09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0024_A05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0040_F10.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SPLT1_0066_A07.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0012_H06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0049_D09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0095_C04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SPLT1_0038_D11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
BMWN1_0034_G06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0049_G04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
CLNT1_0047_A01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0069_C11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
LVRM1_0194_D04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
OVRM1_0213_G03.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
PTG01_0066_C04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0097_A12.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
LNG01_0075_A04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0007_E11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SMG01_0070_G02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0006_E06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0006_C09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0062_A11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0106_F10.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
PTG01_0061_A02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0081_A11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
TCH01_0102_G12.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0031_E12.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0044_B03.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SMG01_0091_B05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0092_D02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0031_B10.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0090_H01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0005_C09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0020_B03.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0040_F05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0057_A01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
LNG01_0073_H05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0103_D03.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0004_F06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAGCGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0017_E10.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0088_F11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0085_D11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0068_F07.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0101_A08.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0058_H01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0035_E04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGGGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0001_C08.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0043_G12.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0083_C07.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
OVRM1_0206_B01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0089_E04.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0072_A05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
CLNT1_0010_B01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SPL01_0053_G08.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0085_H05.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0005_F12.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0058_F02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCTTGAAGAAAACGCTGAAGATCC
ITT01_0006_G06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0051_H11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SKNB1_0020_C01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
BMWN1_0018_E09.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
ITT01_0103_A02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0004_C06.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
UTR01_0022_D02.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
CLNT1_0098_B03.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
SKNB1_0023_H08.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
CBLT1_0050_H11.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
KDN01_0047_E01.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
MLN01_0014_F07.b : GCCTTACGCTCCTGGAGATCTCAGACCTCAACGAGCTCCTGAAGAAAACGCTGAAGATCC
20110601C-000985 : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
---------+---------+---------+---------+---------+---------+ 560
OVR01_0088_D09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGAGCTCCTCCTGCCGCCGCCG
UTR01_0034_C04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCACCGCCG
LNG01_0106_E01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SPLT1_0022_F01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
BMWN1_0005_B01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0093_C04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SPLT1_0046_F09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0016_C11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0092_C09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0024_A05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0040_F10.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SPLT1_0066_A07.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0012_H06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0049_D09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0095_C04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SPLT1_0038_D11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
BMWN1_0034_G06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0049_G04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
CLNT1_0047_A01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0069_C11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
LVRM1_0194_D04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
OVRM1_0213_G03.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
PTG01_0066_C04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0097_A12.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
LNG01_0075_A04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0007_E11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SMG01_0070_G02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0006_E06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0006_C09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0062_A11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0106_F10.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
PTG01_0061_A02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0081_A11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
TCH01_0102_G12.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0031_E12.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0044_B03.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SMG01_0091_B05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0092_D02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0031_B10.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0090_H01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0005_C09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0020_B03.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0040_F05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0057_A01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
LNG01_0073_H05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0103_D03.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0004_F06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0017_E10.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0088_F11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0085_D11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0068_F07.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0101_A08.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0058_H01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0035_E04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0001_C08.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0043_G12.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0083_C07.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
OVRM1_0206_B01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0089_E04.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0072_A05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
CLNT1_0010_B01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SPL01_0053_G08.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0085_H05.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0005_F12.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0058_F02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0006_G06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0051_H11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGAGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SKNB1_0020_C01.b : AGGACGTTGGGTTCATGCCCAGGGNTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
BMWN1_0018_E09.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
ITT01_0103_A02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0004_C06.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
UTR01_0022_D02.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
CLNT1_0098_B03.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
SKNB1_0023_H08.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
CBLT1_0050_H11.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
KDN01_0047_E01.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
MLN01_0014_F07.b : AGGACGTTGGGTTCATGCCCATGGGTGCCGTGGCCCCTGGCGCTCCCCCTGCCGCCGCCG
20110601C-000985 : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
---------+---------+---------+---------+---------+---------+ 619
OVR01_0088_D09.b : CCCCAGAGGCCGCGGAAGAAGAACTCCCCAAACGGAAGGAGCAGACGCATTTCACCGTTC
UTR01_0034_C04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
LNG01_0106_E01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SPLT1_0022_F01.b : CCCCAGAAGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
BMWN1_0005_B01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCATACGCTTTTCACCGT*C
MLN01_0093_C04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SPLT1_0046_F09.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0016_C11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0092_C09.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0024_A05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0040_F10.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SPLT1_0066_A07.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0012_H06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0049_D09.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGTAGACGCATTTCACCGT*C
UTR01_0095_C04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SPLT1_0038_D11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
BMWN1_0034_G06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0049_G04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
CLNT1_0047_A01.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0069_C11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
LVRM1_0194_D04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
OVRM1_0213_G03.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
PTG01_0066_C04.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0097_A12.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
LNG01_0075_A04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAGGGAGCAGACGCATTTCACCGT*C
UTR01_0007_E11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SMG01_0070_G02.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0006_E06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0006_C09.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0062_A11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0106_F10.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
PTG01_0061_A02.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0081_A11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
TCH01_0102_G12.b : CCCTAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0031_E12.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0044_B03.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SMG01_0091_B05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0092_D02.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0031_B10.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0090_H01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0005_C09.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0020_B03.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0040_F05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0057_A01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
LNG01_0073_H05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0103_D03.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0004_F06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0017_E10.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0088_F11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0085_D11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0068_F07.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0101_A08.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0058_H01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0035_E04.b : CCCCAGAGGCCGCGGAAGAAGCCCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0001_C08.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0043_G12.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0083_C07.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
OVRM1_0206_B01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0089_E04.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0072_A05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
CLNT1_0010_B01.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SPL01_0053_G08.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0085_H05.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0005_F12.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0058_F02.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0006_G06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0051_H11.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SKNB1_0020_C01.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
BMWN1_0018_E09.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
ITT01_0103_A02.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0004_C06.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
UTR01_0022_D02.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
CLNT1_0098_B03.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
SKNB1_0023_H08.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
CBLT1_0050_H11.b : CCCCAGAGGCCACGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
KDN01_0047_E01.b : CCCCATAGGCCGCGGAAGAAGACCTCCCCAGACGGAAGGAGCAGACGCATTTCACCGT*C
MLN01_0014_F07.b : CCCCAGAGGCCGCGGAAGAAGACCTCCCCAAACGGAAGGAGCAGACGCATTTCACCGT*C
20110601C-000985 : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
---------+---------+---------+---------+---------+---------+ 678
OVR01_0088_D09.b : CGCCTGACTGATGCGAATCCCGTGGAAAAGGTAAAGCTGATCAAGGAGAATTAAAAGCCA
UTR01_0034_C04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
LNG01_0106_E01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SPLT1_0022_F01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAAGAG**ATAAAAGCCA
BMWN1_0005_B01.b : CGCCTGACGGATGCGAAGCCCGTGGACAATGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0093_C04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SPLT1_0046_F09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0016_C11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0092_C09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0024_A05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0040_F10.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SPLT1_0066_A07.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0012_H06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0049_D09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0095_C04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SPLT1_0038_D11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
BMWN1_0034_G06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0049_G04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
CLNT1_0047_A01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGACCAAGGAG*ATTAAAAGCCA
ITT01_0069_C11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
LVRM1_0194_D04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
OVRM1_0213_G03.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
PTG01_0066_C04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATNCAGGAG*ATTAAAAGCCA
MLN01_0097_A12.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
LNG01_0075_A04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0007_E11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SMG01_0070_G02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0006_E06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0006_C09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0062_A11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0106_F10.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
PTG01_0061_A02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0081_A11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
TCH01_0102_G12.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0031_E12.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0044_B03.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SMG01_0091_B05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0092_D02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAGGCCA
MLN01_0031_B10.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0090_H01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0005_C09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0020_B03.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0040_F05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0057_A01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
LNG01_0073_H05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0103_D03.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0004_F06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0017_E10.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0088_F11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0085_D11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0068_F07.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0101_A08.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0058_H01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0035_E04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0001_C08.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0043_G12.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0083_C07.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
OVRM1_0206_B01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0089_E04.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0072_A05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
CLNT1_0010_B01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SPL01_0053_G08.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0085_H05.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0005_F12.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0058_F02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0006_G06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0051_H11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SKNB1_0020_C01.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
BMWN1_0018_E09.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
ITT01_0103_A02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
UTR01_0004_C06.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*GTTAAAAGCCA
UTR01_0022_D02.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
CLNT1_0098_B03.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
SKNB1_0023_H08.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
CBLT1_0050_H11.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
KDN01_0047_E01.b : CGCCTGACGGAGGCTAATCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
MLN01_0014_F07.b : CGCCTGACGGAGGCGAAGCCCGTGGACAAGGTGAAGCTGATCAAGGAG*ATTAAAAGCCA
20110601C-000985 : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
---------+---------+---------+---------+---------+---------+ 738
OVR01_0088_D09.b : CATCCGGGGCATCAACtggtgcaagcgaataagctgggggaattccctggccccagaaaa
UTR01_0034_C04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
LNG01_0106_E01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SPLT1_0022_F01.b : CATCCAGGGCATCAACCTGGTGCAGaaactggtggaatcctgccccaagaaatcaaagcc
BMWN1_0005_B01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCATGAAAT
MLN01_0093_C04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SPLT1_0046_F09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0016_C11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0092_C09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0024_A05.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0040_F10.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SPLT1_0066_A07.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0012_H06.b : CATCCAGGGCACCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0049_D09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0095_C04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SPLT1_0038_D11.b : CATCCAGGGCATCAACCTGGTGCAGA******AGCTGGTGGAATCCCTGCCCCAGGAAAT
BMWN1_0034_G06.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0049_G04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
CLNT1_0047_A01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0069_C11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
LVRM1_0194_D04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
OVRM1_0213_G03.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
PTG01_0066_C04.b : CATCCAGGGGCATCACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0097_A12.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
LNG01_0075_A04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0007_E11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SMG01_0070_G02.b : CATCCAGGGCATCAACCTAGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0006_E06.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0006_C09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0062_A11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0106_F10.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
PTG01_0061_A02.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0081_A11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
TCH01_0102_G12.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0031_E12.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0044_B03.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SMG01_0091_B05.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0092_D02.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0031_B10.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0090_H01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0005_C09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0020_B03.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0040_F05.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0057_A01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
LNG01_0073_H05.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0103_D03.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0004_F06.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0017_E10.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0088_F11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0085_D11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0068_F07.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0101_A08.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0058_H01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0035_E04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0001_C08.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0043_G12.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0083_C07.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
OVRM1_0206_B01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0089_E04.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0072_A05.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
CLNT1_0010_B01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SPL01_0053_G08.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0085_H05.b : CATCCAGGGCATCAACCTGGTGCATGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0005_F12.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0058_F02.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0006_G06.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0051_H11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SKNB1_0020_C01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
BMWN1_0018_E09.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
ITT01_0103_A02.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0004_C06.b : CATCCAGCGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
UTR01_0022_D02.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
CLNT1_0098_B03.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
SKNB1_0023_H08.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
CBLT1_0050_H11.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
KDN01_0047_E01.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
MLN01_0014_F07.b : CATCCAGGGCATCAACCTGGTGCAGGCGAAGAAGCTGGTGGAATCCCTGCCCCAGGAAAT
20110601C-000985 : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
---------+---------+---------+---------+---------+---------+ 795
OVR01_0088_D09.b : ttaaagccaacttgcacccaagctgaggctgaaaatatcaaggtggcccctgaagtcgat
UTR01_0034_C04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
LNG01_0106_E01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SPLT1_0022_F01.b : acgtgccaaaagctgaggctgaaaaaattaaaggcggccttgaggcggggggcgggcacc
BMWN1_0005_B01.b : CAAAGCCAACGTTGCCCAAAGCTGATGCTGAGAAAA*CAA*GGCGGCCCTGGAGGCCGT*
MLN01_0093_C04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SPLT1_0046_F09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0016_C11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0092_C09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCCGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0024_A05.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0040_F10.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SPLT1_0066_A07.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0012_H06.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0049_D09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0095_C04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SPLT1_0038_D11.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
BMWN1_0034_G06.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCTGAGAAGATCAA*NGCGGCCCTGGAGGCGGT*
MLN01_0049_G04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
CLNT1_0047_A01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0069_C11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
LVRM1_0194_D04.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
OVRM1_0213_G03.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
PTG01_0066_C04.b : CAAAGCCAACG*TGCCAAAAGCTGAGGCTGAGAAGATCAAAGGCGGCCCTGGAGGCGGTG
MLN01_0097_A12.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAAAAGATCAA*GGCGGCCCTGGAGGCGGT*
LNG01_0075_A04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0007_E11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SMG01_0070_G02.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCCGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0006_E06.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0006_C09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0062_A11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0106_F10.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
PTG01_0061_A02.b : CAAAGCCAACG*TGCCCAAAGCTGAAGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0081_A11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
TCH01_0102_G12.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0031_E12.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0044_B03.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SMG01_0091_B05.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0092_D02.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0031_B10.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0090_H01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0005_C09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0020_B03.b : CAAAGCCAACG*TGGCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0040_F05.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0057_A01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
LNG01_0073_H05.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0103_D03.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0004_F06.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0017_E10.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0088_F11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
MLN01_0085_D11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0068_F07.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0101_A08.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0058_H01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCAGCCCTGGAGGCGGT*
ITT01_0035_E04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0001_C08.b : CAAAGCCGACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0043_G12.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0083_C07.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAAATCAA*GGCGGCCCTGGAGGCGGT*
OVRM1_0206_B01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0089_E04.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0072_A05.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
CLNT1_0010_B01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SPL01_0053_G08.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0085_H05.b : CAAAGCCAACG*TGCCCAAAGCTGATGCTGATAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0005_F12.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0058_F02.b : CAAAGCCAACG*TGCCCAAAGCAGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0006_G06.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0051_H11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SKNB1_0020_C01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
BMWN1_0018_E09.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
ITT01_0103_A02.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0004_C06.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
UTR01_0022_D02.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
CLNT1_0098_B03.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
SKNB1_0023_H08.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
CBLT1_0050_H11.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
KDN01_0047_E01.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGTTGCCCTGGAGGCGGT*
MLN01_0014_F07.b : CAAAGCCAACG*TGCCCAAAGCTGAGGCTGAGAAGATCAA*GGCGGCCCTGGAGGCGGT*
20110601C-000985 : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
---------+---------+---------+---------+---------+---------+ 852
OVR01_0088_D09.b : gggcgacaccgtggtttttggaaaaggctccccggaggaacgggtaaagggatcggggtc
UTR01_0034_C04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
LNG01_0106_E01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SPLT1_0022_F01.b : ttggttcttgattaagccttcccgaaggaacgtgcacagggttccggccccccccccctt
BMWN1_0005_B01.b : GGGCGGCAC*CGTGGTTCTGGAATAAGCTTC*CCTGATGATCGTGCACAG*GGGTCCCGC
MLN01_0093_C04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SPLT1_0046_F09.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGANGACCGTGCACAG*GGGTCCGGC
ITT01_0016_C11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0092_C09.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0024_A05.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0040_F10.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SPLT1_0066_A07.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCCGGAGACCGTGCACAG*GGGTCCGGC
MLN01_0012_H06.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0049_D09.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0095_C04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SPLT1_0038_D11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
BMWN1_0034_G06.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAAGACCGTGCACAG*GGGTCCGGC
MLN01_0049_G04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
CLNT1_0047_A01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0069_C11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
LVRM1_0194_D04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAAGACCGTGCACAG*GGGTCCGGC
OVRM1_0213_G03.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAG*ACCGTGCACAG*GGGTCCGGC
PTG01_0066_C04.b : GGGCGGCAC*CGTGGTTCTGGATTAGGCTTCCCCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0097_A12.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
LNG01_0075_A04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAAGGACGTGCACAG*GGGTCCGGG
UTR01_0007_E11.b : GGGCGGCAC*CGTGGTTCTGGAGTAAGCTTC*CCGGAGGACCGTGCACAG*GTGTCCGGC
SMG01_0070_G02.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGAACGTGCACAGGGGGTCCGGC
ITT01_0006_E06.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0006_C09.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0062_A11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0106_F10.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
PTG01_0061_A02.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAAGAACGTGCACAG*GGGTCCGGC
ITT01_0081_A11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
TCH01_0102_G12.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0031_E12.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*TCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0044_B03.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SMG01_0091_B05.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0092_D02.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0031_B10.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0090_H01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGG*
UTR01_0005_C09.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAGGGGGTCCGGC
MLN01_0020_B03.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0040_F05.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0057_A01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
LNG01_0073_H05.b : GGGCGGCAC*CGTGGTTCTGGAGTANGCTTC*CCGGAGGACCGTGCACAG*GGGGTCCGG
UTR01_0103_D03.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0004_F06.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0017_E10.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0088_F11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
MLN01_0085_D11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0068_F07.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0101_A08.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAAGACCGTGCACAG*GGGTCCGGC
ITT01_0058_H01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0035_E04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0001_C08.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0043_G12.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0083_C07.b : GGGCGGCAC*CGTGATTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
OVRM1_0206_B01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0089_E04.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0072_A05.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
CLNT1_0010_B01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SPL01_0053_G08.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0085_H05.b : GGGCGGCAC*CGTGGTTCTGGAGTAAGCTTC*TCGGAAGACCGTGCTCAG*GTGTCCGGC
ITT01_0005_F12.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0058_F02.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0006_G06.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0051_H11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SKNB1_0020_C01.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
BMWN1_0018_E09.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
ITT01_0103_A02.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0004_C06.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
UTR01_0022_D02.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
CLNT1_0098_B03.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
SKNB1_0023_H08.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
CBLT1_0050_H11.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
KDN01_0047_E01.b : GGGCGGCACTCGTGGTTCTGGATTAGGCTTC*CCGGAGGACTCTGCTCAG*GGGTCCGGC
MLN01_0014_F07.b : GGGCGGCAC*CGTGGTTCTGGAGTAGGCTTC*CCGGAGGACCGTGCACAG*GGGTCCGGC
20110601C-000985 : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
---------+---------+---------+---------+---------+---------+ 908
OVR01_0088_D09.b : cccccccttcctccccctgggggggggcctctggtttctcgaacaatgtcccagtttcaa
UTR01_0034_C04.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCTCCGCCCAGTGCCCA*GGCTC
LNG01_0106_E01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SPLT1_0022_F01.b : ccccgtggggggggccccttgctcccgcccaatggccaggctcaatggaagaaaaggctt
BMWN1_0005_B01.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCTCCTGCTTCCCaaacaattccctggttta
MLN01_0093_C04.b : *CCCCCCCCTCCCTCCCC*Gccggtgacagggctctggacccttccaggtcacgcgcccc
SPLT1_0046_F09.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0016_C11.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCCTGCTCCCGCCCAGTGCCCA*GGCTC
ITT01_0092_C09.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0024_A05.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0040_F10.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SPLT1_0066_A07.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGGCACCTGCTCCCCGCCCAGTGCCCC*AGCTC
MLN01_0012_H06.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0049_D09.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0095_C04.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SPLT1_0038_D11.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*AGCTC
BMWN1_0034_G06.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGAACAGTGCCCA*GGCTC
MLN01_0049_G04.b : *CCCC*CCCTCCCTCCCC*GTGTGGAGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
CLNT1_0047_A01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0069_C11.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
LVRM1_0194_D04.b : *CCCCCCCTCCTCCCC
OVRM1_0213_G03.b : *CCCC**CCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCC
PTG01_0066_C04.b : **CCCCCCCTCCCTTCCC*GGGTGGGGGGCCACCTGGTCCCCGgcccaatgcccaagctt
MLN01_0097_A12.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCATTGCCaagcttcn
LNG01_0075_A04.b : *CCCCCCCTTCACTCCAC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GACTC
UTR01_0007_E11.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGACCAATGCCCA*GGCTC
SMG01_0070_G02.b : *CCCCCCCT**CCTCCCC*GTGTGGGGCGCCCACTGCTCCCCGGCCAGTGCCCA*GCCTC
ITT01_0006_E06.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0006_C09.b : CCCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGACCAGTGCCCA*GGCTC
ITT01_0062_A11.b : *CCCC*CCCTCCCTCCCCCGTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0106_F10.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTT
PTG01_0061_A02.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0081_A11.b : *CCCCCCCCTCCCTCCCC*GTG**GGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
TCH01_0102_G12.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0031_E12.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0044_B03.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SMG01_0091_B05.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0092_D02.b : **CCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0031_B10.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0090_H01.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0005_C09.b : CCCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGACCAGTGCCCA*GGCTC
MLN01_0020_B03.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0040_F05.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0057_A01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
LNG01_0073_H05.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0103_D03.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCCCCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0004_F06.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0017_E10.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0088_F11.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
MLN01_0085_D11.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0068_F07.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0101_A08.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0058_H01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0035_E04.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0001_C08.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0043_G12.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0083_C07.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGACCAGTGCCCA*GGCTC
OVRM1_0206_B01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCC
ITT01_0089_E04.b : *CCCT*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0072_A05.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
CLNT1_0010_B01.b : *CCCC*CCCTCCCCTCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SPL01_0053_G08.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCggtggcagggctctg
ITT01_0085_H05.b : *CCCCCCCCTCCCTCTCC*GTGTGGGGCGCAACTGGCTCCCCGCCCAGTGCCCAAGGCTC
ITT01_0005_F12.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0058_F02.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
ITT01_0006_G06.b : *CCCCCCCCTCCCTCTCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0051_H11.b : *CCCC**CCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SKNB1_0020_C01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
BMWN1_0018_E09.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGACCAGTGCCCA*GGCTC
ITT01_0103_A02.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0004_C06.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
UTR01_0022_D02.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
CLNT1_0098_B03.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
SKNB1_0023_H08.b : *CCCC*CCCTCCCTCCCCCGTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
CBLT1_0050_H11.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
KDN01_0047_E01.b : *CCCC*CCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCtaggtccaagctca
MLN01_0014_F07.b : *CCCCCCCCTCCCTCCCC*GTGTGGGGCGCCACCTGCTCCCCGCCCAGTGCCCA*GGCTC
20110601C-000985 : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
---------+---------+---------+---------+---------+---------+ 967
OVR01_0088_D09.b : tggaactaaagagtcttgtaaacaaaaattgttcctggcaatgcgtggccaagttccctt
UTR01_0034_C04.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCCGCTCCGTCC
LNG01_0106_E01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SPLT1_0022_F01.b : tggaaaaaaaatgggcccgcccccggggggcctcccttccggggaaaaaaggaaggaccc
BMWN1_0005_B01.b : ttggaacgaaacgccttggaacaaaaattggaccttcaaacgcttggtccctctccttct
MLN01_0093_C04.b : ctggtggcctggtgaaaaaaagcgttgttcaggccaaaaaaaaaaaaaaaaaaaaxxxnn
SPLT1_0046_F09.b : AATGGACGGAGA*GGCCTTGGAGCAAAACTGGGCACTGCAGCGCGTGGGCAGCTCCCTCC
ITT01_0016_C11.b : AGTGGACGGAGA*GGCCTTGGAGCAAAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0092_C09.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0024_A05.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0040_F10.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SPLT1_0066_A07.b : AGTGGACCGAAA*GCCTTGGGAGCAAAACTGGCACCTGCAGCGCGTGGCCAGCTCCCTTC
MLN01_0012_H06.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0049_D09.b : AGTGGAACGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAACTCCGTCC
UTR01_0095_C04.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SPLT1_0038_D11.b : AGTGGACGGAGA*GGCCTTGGAACAGAACTGGCACCTGCAGCGCGTGCCCACCTCCGTCC
BMWN1_0034_G06.b : AGTGGAAGGAAAAGGCCTTGAAACAAAAATGGCACCTGCAGCGGGTTGCCAGCTCCCTCC
MLN01_0049_G04.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
CLNT1_0047_A01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0069_C11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : cagtggaacggaaaggccttggaaccaaaatgggcacctgcaaggggggggccagttccc
MLN01_0097_A12.b : tggaacgaaaagcccttgaaacaaaatggcncctgncacccgtggnancccccctcctgg
LNG01_0075_A04.b : AGTGGAagcacagttcctggaccgaaaatgcacctgcacagccggcccactccttcctgg
UTR01_0007_E11.b : ACTGGACTGAGA*GGCCTTGGAGCAa
SMG01_0070_G02.b : AATGAACGGAAA*GGCCTTGGAACAAAACTGGCACTTGCAGCGCGTGGCagcttcgtcct
ITT01_0006_E06.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0006_C09.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0062_A11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0106_F10.b : CATGGACGGAGA*GCCCTTGGAGCAAAACTGGCACCTGCAACGCGGGGCCAGCTtcctcc
PTG01_0061_A02.b : AGTGGACGGAAAAGG*CTTGGAGCAGAACTGGCACCTGCAACGCGTGGGCAGCTCCGTCC
ITT01_0081_A11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
TCH01_0102_G12.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0031_E12.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0044_B03.b : AGTGGACTGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SMG01_0091_B05.b : AGTGGACGGAGAAGGCTTTGGAGCAAAACTGGCACCTGCAGCGCGTGGCCAGCTTCCGTC
MLN01_0092_D02.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0031_B10.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0090_H01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGGCACTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0005_C09.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0020_B03.b : ATTGGACGGAGA*GGCCTTGGAACAAAACTGGCACCTGCAGCGCGTGGC*AGCTCCGTCC
UTR01_0040_F05.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCCGTC
MLN01_0057_A01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
LNG01_0073_H05.b : AGTGGACGGAGAGGCCCTTGGAGCAAAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0103_D03.b : AGTGGACGGAGAGGGCCTTGGAGCAAAATGGGCACCTGCAGCGCGTGGCCAGCTTCGTCC
UTR01_0004_F06.b : AGTGGACGGAGAAGCCTTGTAAGCAGAACTGGCACCTGCAACGCGTGGGCAGCTCCCTCC
UTR01_0017_E10.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0088_F11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
MLN01_0085_D11.b : AATGGACGGAGAGGGCCTTGGAGCAGAACTGGGACCTGGCACGCGTGGCCAGCTCCTTCC
ITT01_0068_F07.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0101_A08.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCCGCTCCGTCC
ITT01_0058_H01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0035_E04.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0001_C08.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0043_G12.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0083_C07.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGGCAGCTCCGTCC
OVRM1_0206_B01.b :
ITT01_0089_E04.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0072_A05.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
CLNT1_0010_B01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SPL01_0053_G08.b : gaaccttccaggtcacgcgccccctggtggcctgtgagaaaaaagcgttgttgaggcgct
ITT01_0085_H05.b : ATTGGACGGATA*GGCCTTGGAACAAAACTGGCACCTGCAacggcgtggctagtcccgcc
ITT01_0005_F12.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0058_F02.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0006_G06.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0051_H11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCCTCC
SKNB1_0020_C01.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
BMWN1_0018_E09.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
ITT01_0103_A02.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0004_C06.b : AGTGGACGGAGA*GGCCTTGGAGCAAAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
UTR01_0022_D02.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
CLNT1_0098_B03.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
SKNB1_0023_H08.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
CBLT1_0050_H11.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
KDN01_0047_E01.b : ttggacggatatggccttggagcagaattggcacttgcacagcgtgggccagcttccgta
MLN01_0014_F07.b : AGTGGACGGAGA*GGCCTTGGAGCAGAACTGGCACCTGCAGCGCGTGGCCAGCTCCGTCC
20110601C-000985 : TGGGACAGACGGAAGGACCTCCTGAAATGGGGAAGGG**GGGCGGC*CCCCCCTGGG*CC
---------+---------+---------+---------+---------+---------+ 1023
OVR01_0088_D09.b : tctggggacaactgagaggaccccctcaaaaattgggagggggggcgggtctacttcgtg
UTR01_0034_C04.b : TGTGACAGACGGAAGGACCT*CCTGAGATGGGGAggg**gggcggc*cgcgcctggg*cc
LNG01_0106_E01.b : TGGGACAGACGGAAGGACCTCCCTGAGATGGGAgggg**gggcggc*cgcccctggg*cc
SPLT1_0022_F01.b : ccataaagggggaggggggnntnnttnnnnnnacctgccgttacacaccagaaaggtatt
BMWN1_0005_B01.b : tggacaaaacgaaaggactccctgagattgggaggggggttgtctctcctttacacaata
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b : TGGGACAGACGGAAGGACCTCCTagatggggaaggggggnnnng
ITT01_0016_C11.b : TGGGACAGACGGAAGGACCT*CCTGAGATGGGGAAGG**GGGGCcgnnncnncctgnncc
ITT01_0092_C09.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAAGGG**GGGCGGnnnnnnntggnncnn
MLN01_0024_A05.b : TGGGACAGACGGAAGGACCTCTGAatggggaaaggggggcggnnnnnncngggnncnncg
UTR01_0040_F10.b : TGGGACAGACGGAAGGACCTCC
SPLT1_0066_A07.b : TGGGAAAGACGGGAGGACCT*CCTGAAATGGGGAGGG**GGGCcgttcttnt
MLN01_0012_H06.b : TGGGACAGACGGAAGGACCTCTGAatggggaaaggggggncggcnnnncntggnccnccn
MLN01_0049_D09.b : TGGGACAGACGGAAGGACTCCTGAGAtnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b : TGGGACAGACGGAAAGACCTCTGAGAGGGGggaaggggggcnnnnnnnnnnnngnnnnnn
SPLT1_0038_D11.b : TGGGACAAACGGAAGGACCT*CCTGAGATGGGGAGGG**GGGGnnnnnnnnnnnnnnnnn
BMWN1_0034_G06.b : TGGGACAAACAGAAAGACCT*CCTGAAATGGGGAGGG**GGGGCtnttnntttgttnntt
MLN01_0049_G04.b : TGGGACAGACGGAAGGA*CTCCTGAAGGGGGGAAGGG**Ggggtnnnnnnnnngnnnnan
CLNT1_0047_A01.b : TGGGACAGACNGAAGGACCT*CCTGAGATGGGGAggg**gggcggc*cgcccctggg*cc
ITT01_0069_C11.b : TGGGACAGACGGAAAGACCTCCTGAGATGGGGAGGGG**GGGCGGCCNCCCCTTGGGCCC
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : tcctgggaaaaaacgaaagacccccggaaaggggagaggggggccccccccccctgnccc
MLN01_0097_A12.b : aaanaagganagacnccctaaaaggggaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : gaccaaagttagacctcctcaaagggaagagaactacctaccttcccccttatgctggaa
UTR01_0007_E11.b :
SMG01_0070_G02.b : gggacaaacgaaagacccctgaaagggggaaggggggggccccccccctggcccccccgg
ITT01_0006_E06.b : TGGGACAGACGGAAGGACTCCTGAaggggggagggggggggggcgnng
UTR01_0006_C09.b : TGGGACAac
ITT01_0062_A11.b : TGGGACAGACGGAAGGACTCtgaaggggggggggggggggggnnncnnnnnngg
UTR01_0106_F10.b : ctgggacaaaaggaaggaccctcccttaatggggagggggggcctccctccccttgtact
PTG01_0061_A02.b : TGGGACAAACGAAAGGAC*TCCTGAAATGGGGAAggg**ggcgnccnccccctggccccc
ITT01_0081_A11.b : TGGGACAGACGGAAAGACCTCCTGAATGGGGAAGGGG**GGGgcg
TCH01_0102_G12.b : TGGGACAGACNGAAGGACTCtgaaggggggaaggggggggcgggccnnncnngggccngc
ITT01_0031_E12.b : TGGGACAGACGGAAAGACCTCCTGANATGGGGAAGGG**GGGCG
MLN01_0044_B03.b : TGGGACAGACCGAAAGACCTCTGAatgggggaaggggggnnnnnnnnnnnnnnnnnaggg
SMG01_0091_B05.b : TGGGACAAACGGAAAGAACTCCTGAAATGGGGAAGGG**GGGCGGgcnnnnnng
MLN01_0092_D02.b : TGGGACAGACGGAAGGACCTCTGAgatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0031_B10.b : TGGGACAGACGGAAGGACCTCCTGgatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : TGGGACAGACGGAAGGACCTCTGAgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b : TGAGACAGACGGAAGGACCTCCTGAAtgggaaaggggggcgggccgc
MLN01_0020_B03.b : TGGGACAGACGGAAGGACTTCTGAAATGGGGagggggnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b : TGGGACAGACGGAAGGACTT*CCTGAGATGGGGAG
MLN01_0057_A01.b : TGGGACAGACGGAAGGACCTCCGANAGGGGGAAAGGG**GGcnnncnnnngnnnnnnncn
LNG01_0073_H05.b : TGGGAC*GAAGGAAGGACCTCCTGAAATGGGGGAGGG**GGgcnnnnnnnnnnnnnncnn
UTR01_0103_D03.b : TGGGACAAACGGAggacttctgagatgggggaggggggnnnnnnnnnnttgnnnnnnnng
UTR01_0004_F06.b : TGGGAACAACGGAAGGACCTCCTTGATATGGGGAggg**ggggcggccgcgcctggggcc
UTR01_0017_E10.b : TGGGACAGACGGAAGGACCTCC
ITT01_0088_F11.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAAGGG**GGCGGCC*CCCCCTTGGC*CC
MLN01_0085_D11.b : TGTGACAGACGGGAAGACCTCCTGAGATGGGGAGGGG**GGGGCGC*CTCCCCTGGG*CC
ITT01_0068_F07.b : TGGGACAGACGGAAGGA*CTCCTGAGAGGGAAGGGGG**GGGCGGC*CNCNCCTGGG*CC
ITT01_0101_A08.b : TGGGACAGACCGAAAGACCTCCTGAAAATGGGAgggg**ggcgggc**cccccctgg*cc
ITT01_0058_H01.b : TGGGACAGACGGAAGGACCTCCTGAATGGGGAAGGGG**GGGCGGCCCCGCCTAGGC*CC
ITT01_0035_E04.b : TGGGACAGACGGAAGGACCTCCTG*AGATGGGAAggg**gggcggccncnnctggnc*cc
ITT01_0001_C08.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAgggg**gggcggc*cgcgcctggg*cc
UTR01_0043_G12.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAAggggggggcggccgccccctggggcc
UTR01_0083_C07.b : TGGGACAGACGGAAAGACCTCTGAatggggaaggggggcgnnnnnnnngggncnnnggng
OVRM1_0206_B01.b :
ITT01_0089_E04.b : TGGGACAGACGGAAGGACTCCTGAGATGGGGGAGGGG**GGgcgnnnnnnnnnnnnnnnn
ITT01_0072_A05.b : TGGGACAGACGGAAGGACCTCCCTGAGATGGG*Aggg**gggcggc*cgcncctggg*nc
CLNT1_0010_B01.b : TGGGACAGACGGAAGGACCTCCTGAAATGGGGAGGGG**GGCGGCC**CCCCCTGGG*CC
SPL01_0053_G08.b : gaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0085_H05.b : ctggggacatatcgaaagacccccctgaaatggggaaggagggcgggcttctcttgattc
ITT01_0005_F12.b : TGGGACAGACGGAAAGGACTCCTGAGAGGGGGAAGGG**GGGgcgnnnnnnng
ITT01_0058_F02.b : TGGGACAGACGGAAGGA*CTCCTGAATGGGGAAgggg**gggcgnc*cccccctggg*cc
ITT01_0006_G06.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGAAAGGG**GGGCGGNNCGCNCCTGGG*CC
UTR01_0051_H11.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAgggg**gggcggccgcgcctgggc*cc
SKNB1_0020_C01.b : TGGGACAGAACGAAGGACTCtanatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0018_E09.b : TGGGACAGACGGAGGGAACTCCTGAAATGGGGAAggg**gggcggccccccctgggc*cc
ITT01_0103_A02.b : TGGGACAGACGGAAGGACTCCTGAAGGGGgaaagggggggcggnnnnnnnn
UTR01_0004_C06.b : TGGGACAGACGGAAAGACCT*CCTGAGATGGGGAggg**gggcggc*cgcgcctggg*cc
UTR01_0022_D02.b : TGGGACAGACGGAANGACCT*CCTGAGATGGGGAGGG**GGGCGGC*Cg
CLNT1_0098_B03.b : TGGGACAGACGGAAGGACCTCTGANAGGGGAAGGGGG**Ggcgncnnccctggggccccc
SKNB1_0023_H08.b : TGGGACAGACGGAAGactctgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0050_H11.b : TGGGACAGACGGAAGGACTCCTGAGATGGGGGAGGGG**GGnnnnnnnnnnnnng
KDN01_0047_E01.b : ctgggacagactggaggacctctccatatggggatggggggggctctccttaggctctgc
MLN01_0014_F07.b : TGGGACAGACGGAAGGACCTCCTGAGATGGGGAGGGG**GGGCGCC*CCCNCCTGGG*CC
20110601C-000985 : CCCCGGTGGC*AGGGCTCTGGAACCTTCCCAGT*CACGCGCCCCCTGG**T*GGTCTGTG
---------+---------+---------+---------+---------+---------+ 1078
OVR01_0088_D09.b : atctctcatgggcgctggttttcttaaacctttcgattcacacacccatctcctattgat
UTR01_0034_C04.b : cgccggTGGC*AGGG
LNG01_0106_E01.b : cgccg*TGGC*AGGGCTCTGGAACCTTCCA*GT*CACGCGCCCCCTGG**T*GGCCTGTG
SPLT1_0022_F01.b : gggagacgtggccccggggtgtgtggtgtgaggagaggatgagaggctcggaagagaggc
BMWN1_0005_B01.b : ttttaccctttcccctatatttccttataacctactcctattggcgcttaaataaaaatc
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : ccccgngggcnggctttgggaccttcccggtcccgcccccccggggggccggttgggnaa
ITT01_0092_C09.b : cnngnggnngggnnngggaancttnngggcncccgccccctggggcccgggggaaaaaac
MLN01_0024_A05.b : gnggngggggtntggaacctncagggcnggcgcccccggggggctgggaaaaaaaagcgt
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : ggggcngggntctggncctttccggtccgcgcccctggtgttctgtgagaaaaagccttg
MLN01_0049_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b : ngnnggnnngnntntgggnacntnnngggnnnnggncccctggggggnnggggggaaaaa
SPLT1_0038_D11.b : n
BMWN1_0034_G06.b : ttgtnnntnntttatgtgtttatataatntntannntnnttaattngnaatattttggtt
MLN01_0049_G04.b : aaaaaggagaggaaatgaaattgaggaattgtttgnttttggggatttggaaaaaaggtt
CLNT1_0047_A01.b : cgccggTGGC*AGGGCTCTGGAACTTCCCA*GT*CACGCGCCCCCTGG**T*GGTCTGTG
ITT01_0069_C11.b : CCCCGGTGGC*GGGGCTCTGGAACCTTCCAGGTTCACCCGCCCCCTGG**TTGGTCGGTG
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : ccccgtgggagggctctcaaaccctccgattaccccgccccccgggggggttgtaaaaaa
MLN01_0097_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : cctatccaaggttcggaggccttcccctacccaagaaagcctcctaaatcgaagcaaatt
UTR01_0007_E11.b :
SMG01_0070_G02.b : tggaggggttttgaaacttcccgtcccccgcccccgggggtcggggaaaaaaaacctttt
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b : cctcgggtttccggtttttttgtacctctcctcttttagcctcccctctgaggtgttttt
PTG01_0061_A02.b : cggggccggggttcgaaaccttccagcaagccccccccggtggtctgtaaaaaaaacttt
ITT01_0081_A11.b :
TCH01_0102_G12.b : ggggggagggcnctggnacctccccggtccgcgccccctggtggcctgtgagaaaaagcc
ITT01_0031_E12.b :
MLN01_0044_B03.b : nnnntggggntnnngtggnggtnngggnngnnnnnaagtattgttggggggccaaantta
SMG01_0091_B05.b :
MLN01_0092_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b : ncnntnnncngcnnccgngnngnngangcgccccgggccccgggggggggggcggggccc
LNG01_0073_H05.b : nnnnttnnnnnnnnnnnnnanntttatttttaaatnnaannntataatattattataaaa
UTR01_0103_D03.b : nnggngggnttttggaatttttttggttgggtgntccttgggggttgttgggaaaaaaag
UTR01_0004_F06.b : cgcccgtgggaagggctc
UTR01_0017_E10.b :
ITT01_0088_F11.b : CCCCGGTGGC*GGGGCTCTGGAAaccttccaggtcaagcgccccctggtggcctgtgaga
MLN01_0085_D11.b : Ctttggttgcatgggttttggaacctttcacgtcttcctcccctctggttggctgtttat
ITT01_0068_F07.b : CGCCGGTGGC*AGGGCTCTGGAACCctccaggtcacccgcccctgggtgcctgggaaaaa
ITT01_0101_A08.b : cccccgTGGC*AGGGCTCTGGAACCTTCCGGTCCCGC***CCCCCCGG**GTGGCCTGGG
ITT01_0058_H01.b : CGCCGGTGGC*AGGCCTCTGGGAACTTCCCAGT*CACGCGCCCCCTGG**T*GGTCTGTG
ITT01_0035_E04.b : ccccggggnc*ggggcTCTGGAACTTTCCCGGTCCGCG***CCCCCTG**GGGGTCTGTG
ITT01_0001_C08.b : cgccggTGGC*AGGGCTCCTGGAACCTTCCAGNTCACGCGCCCCCTGT**T*GGTCTGTG
UTR01_0043_G12.b : gcccggTGGCCAGGGCTCTGGGACCCTTCCAGGTCACGCGCCCCCCTGGTTGGTCCTGTG
UTR01_0083_C07.b : ggnggggnnngggaannttnngggnngggggnnnnggggggngggggggaaaaagggnng
OVRM1_0206_B01.b :
ITT01_0089_E04.b : nnngnggnnnggnnnngggnnntnngggggnggggggnnggggtggtgnggtgggtgtgg
ITT01_0072_A05.b : cgccggcggc*AGGGCTCTGGAACCTTCCANGT*CACGCGCCCCCTGG**T*GGTCTGTG
CLNT1_0010_B01.b : TGCCGGTGGC*AGGGCTCTGGAACTTTCCGG***CACCCCGCCCCCTG**GTGTTCTGGT
SPL01_0053_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0085_H05.b : tccccttcggtggtgatttggaaccttctcaggtacctctctccctgttggccttggaca
ITT01_0005_F12.b :
ITT01_0058_F02.b : ccccggtggcgggctctggaccttcccggtccgccgcccctgggggtcgtgngaaacgcc
ITT01_0006_G06.b : CCGCGGTGGC*AGGGCTCTGGAACCTTCCG*GT*CACGCGCCCCCTGG**T*GGGCTGTG
UTR01_0051_H11.b : gccggggggc*AGGGTTCTGGAACCTTTCCAGGTCACCCCGCCCCCTGG*TGGGTCTGTG
SKNB1_0020_C01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0018_E09.b : gcccggtggcagggcttttgaacccttccaggtccccccccccccggtgggcctgggaaa
ITT01_0103_A02.b :
UTR01_0004_C06.b : cgccgggggc*AGGGCTCtgaaactttccggt
UTR01_0022_D02.b :
CLNT1_0098_B03.b : cggtggcaggctctgggaaccttcaggtcacgcgccccctggtgtccggtaaaaaaaagc
SKNB1_0023_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0050_H11.b :
KDN01_0047_E01.b : ttgggacgtgtttcttgaaccttctagtttcgcggccccctgggggtctttcagaaaaat
MLN01_0014_F07.b : CGCCCGTGGC*NGGGCTCTGGAACCTTCCNNGT*CACGCGCCCCCTGG**T*GGCCTGTG
20110601C-000985 : AAAAAAAAGCGTTTTT****AGGCCGCTAAAAAAAAAAAAAAAAAAAAAAAAAAA.....
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b : cagcaaataaaaattccttcatattcattcctcttagaaaaacaatcataaatagccctt
UTR01_0034_C04.b :
LNG01_0106_E01.b : AGAAAAAACGTTGTTG****AGCGCTGaaaaaaaaaaaaaaaaaaaaaaggccacatgtc
SPLT1_0022_F01.b : gccggcaaagattcttgactcgcgaggccaggggaacaagagtcggtaggtcaggggcgg
BMWN1_0005_B01.b : tattttcccaccccaactcattaaactataccaaatatattaatcccctccttattcatc
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : ccccgttttttcggccctcnncnctcntcgtcttgcgcccttcctgcngggcccccttgt
ITT01_0092_C09.b : gtggtgaggccctgaaannaaaaaaaaaaaaaaaaaaggcccagggccccaacttaggtc
MLN01_0024_A05.b : tgttgagcgcttaaaaaaaaaaaaaaaaaaaaggccaatgtgcctaaacttaagtccggg
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : ttaggcgcgaaaaaaaaaaaaaaaaaaaggcccagggctcaaccgaggtcccggccctct
MLN01_0049_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b : gggttgtttaggggtttgaaaannnnnnnnnnnnngnnnnnaggggnnnnttggttgaaa
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : tttaaatatgttttataatgataaaggatttatataaatgaaaaataaatttagttatat
MLN01_0049_G04.b : cttgtttattataaggggggttggtggnccaccttgggttgngaatgaagggaaattgtg
CLNT1_0047_A01.b : AAAAAAAAcgttgttgagccctgaaaannnnnnnnnnnnnnnnnnnnnnaaaggcccttt
ITT01_0069_C11.b : AGAAAAAAACGTTTTT****TGGAGGCCCTAAAAAAAAAAAAAAAAAAgaggccaatgtt
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : aaccgttttttaagcccaaaaaaaaaaaaaaaaaaaaaacccaaatttgttctaattttg
MLN01_0097_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : taaatgcccacacatccccataaatttcagaacgggaactcgactctctccatcaacaaa
UTR01_0007_E11.b :
SMG01_0070_G02.b : tgggggccttaanaaatttaaaataaaaaaaaaggccattgtgtccaactgagtgccgcc
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b : ttaaataaaaatcttttttgtttgcccttaacacctttatcatatttagggtcccccttg
PTG01_0061_A02.b : tttaagccttaaaaaaaaaaaaaaaaaaaaaaaaaggccctttggttcaactgaggtccc
ITT01_0081_A11.b :
TCH01_0102_G12.b : cttgttgaggcctgaaangnnnnnnnnnnnnnanannnnnaaaaaaggccattggcttca
ITT01_0031_E12.b :
MLN01_0044_B03.b : agtttaaccagttttttggaaaaaggggtccataaaggagtngattattagtaggagtgg
SMG01_0091_B05.b :
MLN01_0092_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b : ggcgnggcccccgcccccccncgnccagggggccngccggcnnccggccnngccgccgcg
LNG01_0073_H05.b : aattataattttaaanatntatataaaatataaatataaatttaanaaaattatnatatt
UTR01_0103_D03.b : tttttatagcgctaaaaaaaaaaaaaaaaaaaggaattggggtttagaagtaggttgggg
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : aaaaaccgtttttcaggccctgannaaaaaaaaaataactaaaaaatncnaggggcaatt
MLN01_0085_D11.b : aaaaaatccttctttaacttcatataaaaatataaaaggcttcctgttgtctcaaatctt
ITT01_0068_F07.b : aaccgttgtccagcgctgaaaaaaaaaaaaaaagggccctgggtcaacctcaggccgggc
ITT01_0101_A08.b : AAAAAAAACcgttttccggccgctggaaaaaaaaaaataaaaaaaaaaagggccaatgtg
ITT01_0058_H01.b : AAAAAAAGCCGTGTTG****AGGCCGCTAAAAAAAAAAAAAAAAAgcccctgtgctccac
ITT01_0035_E04.b : AGAAAAAACCTTTGTT****AAGCGCCaaaaaaaaaaaaaaaaaaaaagggcccttgtgc
ITT01_0001_C08.b : AGAAAAAAGCGTTGTT****GAAGCGCTGaaaaaaaaaaaaaaaaaaaaaagggcaxxxx
UTR01_0043_G12.b : AAAAAAAAGCCGTTTTTTGAAGGCCCCTTaaaaaaaaaaaaaaaaaaaaaaaaaagggcc
UTR01_0083_C07.b : gnnngggaaaaaaaaaaaaaaaagggaaagggggnagagggtgagggaggggnngaanaa
OVRM1_0206_B01.b :
ITT01_0089_E04.b : gggttgtttttgggttgttgtttgtttttttgttgttgtgtgtgttttggttgtgtggtt
ITT01_0072_A05.b : AGAAAAAAgcgttgttgaagcgctgaaaannaaaaaannnnnnnnnnnnnnnnggccact
CLNT1_0010_B01.b : AAAAAAAAACGTTGTT****AAGCGCTGAAAAAAAAAAAAAAAAAAAgggcccctgggct
SPL01_0053_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0085_H05.b : aaaaaaactattttcttgctttttcaaatttcaatctaacattcctcctgatacctaaaa
ITT01_0005_F12.b :
ITT01_0058_F02.b : ttgtttagccaaaaaaaaaaaaaaaaaaggcacctgtccccagcttcggcgggcccccct
ITT01_0006_G06.b : AGAAAAAAgcgttgttcaggcgctggannanaanaaaaaannaaaaaaaaaaaagccxxx
UTR01_0051_H11.b : AAAAAAAAAACGTTTTTTGAAGGCCCTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
SKNB1_0020_C01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0018_E09.b : aaaatccttttttccgccctgaaaaaacacaacaaatgataatataccatccaccttatt
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : gttgttgaggccctgaaaaaaaaaaaaaaanaaaaanaaaaaaaaanaaaggccccttgg
SKNB1_0023_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0050_H11.b :
KDN01_0047_E01.b : cggtgtttagtccctgatataaaatataaatatgtttttgattttcactttctgttccgc
MLN01_0014_F07.b : AGAAAAAAGCGTTGTT****CAGGCGCTGaaaaaaaaaaaaaaaaaaaaaaaaaaaggcc
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b : aggtgctcctaacctctactg
UTR01_0034_C04.b :
LNG01_0106_E01.b : tccaactgcggtcccgcccctctaaaatcctccgagggccaaactaccctacccgctttc
SPLT1_0022_F01.b : cgaaatggtgtgtgcgtaagcgtacggtatataatgggatgcacgtcgccgtgagaggga
BMWN1_0005_B01.b : atacaatttcttaatcttatatcttccttcaccgattcccttctcttaaccataaatata
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : ccccgtgtctcccggtcgcgcccccttttgcgttctccccggggggcccccgtcttcccg
ITT01_0092_C09.b : cggcccccaaaaaatcctcagggggccagttaacgaaaccatttctgaaaaagggcccct
MLN01_0024_A05.b : ccctctaaaattccctcgagggcccaaccttaacgtacccgctttctgtaaaaatggtcc
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : aaattcccccaggggccaggtttccggaaccgcttcttgtacaagggtcccatatgatct
MLN01_0049_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b : ttggggttgggtggttttaaatattcttgaaggggtcaagtttagggtttaaattttttg
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : tttatagtaaagaaaaaagagaaattgaatgaaagaataaggaaatatgataaataagat
MLN01_0049_G04.b : gttccaagtgactgcttggcaaacttacctaacacctttggaaaaaagatactacggatt
CLNT1_0047_A01.b : gctccaccttcagtcccgggccctaaataatctaagaaaaaactccaaccctcccctgac
ITT01_0069_C11.b : cctcgaaccttcaggtcgccgcccctttttaaatactccttgagggggccaaagctaacc
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : gagccccccccctttaaaaaaacccccgaaggcccaatttaatagaccaccttttttttt
MLN01_0097_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : gtgggtcgccgattagcgcacgcctttggcgcacataccttctcttcatacttaaaaaaa
UTR01_0007_E11.b :
SMG01_0070_G02.b : cccctaaaattccctgggggccaaatttccggaccccttttttgtgaaaggggccctaag
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b : ttccctcaacttgctatgggttgggtcccctctctaataaaatccccttgtgagggcctc
PTG01_0061_A02.b : gcccccctaaatatcctctgagggccaagtttacggtccccattttttgtgaaaagggcc
ITT01_0081_A11.b :
TCH01_0102_G12.b : actgcgggcccggcccttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0031_E12.b :
MLN01_0044_B03.b : gggtgtttttaaattntgaaggggaaaatgtagttgggattttgaaagaacaatattcgg
SMG01_0091_B05.b :
MLN01_0092_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b : gcgggcgcgccccccccccgggggtccccccgggggggcgggcgggggccgggggccccc
LNG01_0073_H05.b : ttttannataatatttaaaaaaaaaaattttttaaaaatatatatataaaaaattttttt
UTR01_0103_D03.b : gggttttaaaaatttccctaggggggcaaagtttanggtaacaatttttttgaaaagggg
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : gtcttcaactggcaggtgccgccgcctctaaataccctcaagggcccaagttaacggtac
MLN01_0085_D11.b : atgttccagatgctccttagatattcccctctttggggcctcactttacctcttctcccc
ITT01_0068_F07.b : cctctaaattccctcaagggccaagctaccctacccactttttgtaaaagggccctaagt
ITT01_0101_A08.b : ctccaacttgagtcccggccccttaaaatatccctcggggggccagattaaccaacccag
ITT01_0058_H01.b : ctgcggtcccggcccccctaagtatcctccagggggccagcttaccgtacccgcttcttt
ITT01_0035_E04.b : tcatctgcaggttccggccgcttaaattttccttcagagggccaagcttaccctacccac
ITT01_0001_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_G12.b : acattgtgcctccaaccttccagggtcccccggccc
UTR01_0083_C07.b : aagaaaannnggaggggnnaaagattaanggaaaaa
OVRM1_0206_B01.b :
ITT01_0089_E04.b : tgggtttggtgtgggtttgttttgtttttgttggggggtgttttttttgtttgtggtgtt
ITT01_0072_A05.b : gtgctcaagctgcaaggtccgccgctctaaagtatcctcaggggcccagcttaccctacc
CLNT1_0010_B01.b : caattgcagttcgggcccctaaactatctataaaaaaacctccccccccccccttgaccg
SPL01_0053_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0085_H05.b : aatgccattttcttcttactcttctgtttccacccacctctgtttactcgccggggacct
ITT01_0005_F12.b :
ITT01_0058_F02.b : aaactaccctccgggggcaaacttaccctaccacccttcttggaaaggggccccacgggg
ITT01_0006_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_H11.b : ggccacctttgtgctcaaaccttccagggccccggcccgcctttaaaaattttcccctcg
SKNB1_0020_C01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BMWN1_0018_E09.b : tttattctgcgggcccgcgaatctcccttaaggaggtttttcgcctcccacatcaaacat
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : tttcaacttcaggtcgggcccctataaattctaaaaaaacctccccccctcccctgaacc
SKNB1_0023_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0050_H11.b :
KDN01_0047_E01.b : ttgcttaccaatctaaattaaaagcttcctaatctgtcccttgatcgtaagctaaatgta
MLN01_0014_F07.b : actgttcttgaactgcaggtccggccccctctaaatattcctccaggggcccaacctaac
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : tttaaatggtcctaaatggactcatttacctagcctggcgtcttttaactcctgcaggaa
SPLT1_0022_F01.b : gaggaggctgaaacattgagacaaggggatgatgtcgggggcgaggtgtggagggaacgg
BMWN1_0005_B01.b : tttccagtcattgctatattatctcacacctctttctcaatacctaataacctttcatat
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : gtccccctcttttcgtccnggcgggccccctttgggggccctctttttccgcgggcctgg
ITT01_0092_C09.b : aagtgatcgaattaaacaaggccggccctttttaaacctccgaaggaaaatgctacctgg
MLN01_0024_A05.b : caaaggagacgattataaccaggcccgggcccgccttttaagctcgtgatggaaaactgt
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : attaagctagcctgccccttttcacccctgagggaaccgtcactggatctttgaaaactt
MLN01_0049_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b : taaaaggggtctttagggggttgtataaaattggggtg
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : aatgatagagangaataantatgatggtttgatngnataataagtaggtaaaaangatta
MLN01_0049_G04.b : gaggctgttggactgccctaatcaaactttgagagaaaccgcctagacctggtaaaacag
CLNT1_0047_A01.b : ctgaaaattaaaggaggcatgttggtgttacttgttttggccctaaatgttccaaaaagc
ITT01_0069_C11.b : ctaaccggtttttttgtaaaagtggccccctaagggaattcttaattaaaccaaggcccg
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : aaaaaagaggccccacatgaggataaaaaaagaaagagcccccggcctctttttataacc
MLN01_0097_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : cacggtttcgtcctatgtccgccccaacaaatatcatcgcccccactaagagttcccccc
UTR01_0007_E11.b :
SMG01_0070_G02.b : gggccttttaaacaggcgggggcgcctttttaaacccggggggaaaaactctcttggttt
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b : tactttttcttacttcctccacatttctcttgtttata
PTG01_0061_A02.b : catatggagttaatttaaaccgagcccgggcctctttaaacaccggaaggaaaaatctgt
ITT01_0081_A11.b :
TCH01_0102_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0031_E12.b :
MLN01_0044_B03.b : ggggggaatattggaaaatanntaggaatttagttnaaggaaaaaaaattttaggtaagg
SMG01_0091_B05.b :
MLN01_0092_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b : ggggggncaaagggccccgggggcgngaaaaaaaaaaaaggccacggggccccancnnaa
LNG01_0073_H05.b : aaaattttnataaatnaaaanttttttaatctttatanataaaattattttaaaattttt
UTR01_0103_D03.b : ggtccaatagggggcttattaatacttggccctgcgccgttttataaatt
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : ccgttttttggaaaaggggccccaaaggaagccaataaaactaggcctgcgcccgttttc
MLN01_0085_D11.b : tttttttggtacaataggcgcctctatttaccaccttttatatatcctttcccctgtcct
ITT01_0068_F07.b : gagtcaatataacctggcctgccggcctttcacgcctgcaggaaaacggcaattggattc
ITT01_0101_A08.b : ttttttgaaaaaggggcccctaagggagccgtaataaaccaagcgcgtgcgcttttttta
ITT01_0058_H01.b : gaaaaggggtcccctaaggagcctattaaaactagcccggccgctctttaaacccctggc
ITT01_0035_E04.b : ttttttggaaagtggccccaatagaggccctattaaacctagcttggccgtcttttaaac
ITT01_0001_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : gtggtttgggtttgtgggttgttgttgtggtttttntggtttttttttggtgggggtgga
ITT01_0072_A05.b : cgccttcttgtacaagggtccctaaaggagtcgtataaagctaggcctggccttctttta
CLNT1_0010_B01.b : aaaataaaagaaggcaatgttgttgttactttttttgcaccttaagggttcaaaaagcaa
SPL01_0053_G08.b :
ITT01_0085_H05.b : gttctcccgaatacatcctttttttatacaattgacgctccctatgagtcatctataaag
ITT01_0005_F12.b :
ITT01_0058_F02.b : tctattaaacctagccgggcctctttcacctctgaagggaaacaggcactggatcttgtg
ITT01_0006_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_H11.b : ggggggccccaaaatttataccctttcccccaccttttttttt
SKNB1_0020_C01.b : n
BMWN1_0018_E09.b : acattgattgttctgtacaacaccctatttatggcctgtaaaactcctctccttcccata
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : cgaaaaaaaagaaggcatttttgttgttattgttttttgaccttataggggacaaaaagc
SKNB1_0023_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0050_H11.b :
KDN01_0047_E01.b : tggacttcgtgcgttacttttttcttgactttgatgggttacaataaccttccctccttt
MLN01_0014_F07.b : cgtacccactttcttgtcaaagtggccctaagtgagtctatttagccaggcctggccgtt
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : acgcaactggaattttgaaggacttatcggggggaatatggacatccctcaattaagctc
SPLT1_0022_F01.b : gaggacgggtgaggtaggaacgagctatggatgatggagctcggacccgtggtatgaggt
BMWN1_0005_B01.b : tacattctctttactttcctactacatatttttttatatcaacatctcttatcttgcatg
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : gcgctctttttccccgctctgcgggggcggactcgtcttcttggcctttgtggggaagca
ITT01_0092_C09.b : atctttgagaacctattcgtgggggaaaattgaaaaatcaccaaaaatagcttagagaaa
MLN01_0024_A05.b : ctcttggatttttgtaaaaacttattctgggggtggataatggacaaacctccccaagtt
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : ctctgggggaaaattggaaatacccagattagcctaggaaaaaatttaggaaagtgaaca
MLN01_0049_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : taangatgataaatgtaaattataaggtgaattngaataaggataagtgaagtatgtatt
MLN01_0049_G04.b : cttggaacccaatggttccagggtccaggcccgggccgagaaattattcaaatcagggac
CLNT1_0047_A01.b : aaccctccaatttccaaaaaccttttttccgattcaagtgggttgccaaacccaaggttt
ITT01_0069_C11.b : ggcctccttttatacactctcggcatgggaaaaactgtttctttggattctttggaagaa
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : gcgcgggaaaaaaacttttttgttgattttttgaagaccctctttcttggtgggtaattg
MLN01_0097_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0075_A04.b : ccctaaagatccctaaagacagtccagcccgaggcgacctctactcccatggacacatct
UTR01_0007_E11.b :
SMG01_0070_G02.b : ttttgagaacccttcttggggggcgattttggaccccccccaaatattcccccgggagaa
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b : tgggattttgaaagacctcttttgggtgaaatttggcacctccccaaatttaaccgggaa
ITT01_0081_A11.b :
TCH01_0102_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0031_E12.b :
MLN01_0044_B03.b : tttaaaaangcatgtttggggtggaatttgttnnnggnngatttaaaattannggagaag
SMG01_0091_B05.b :
MLN01_0092_D02.b : nnn
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b : nnnnnnnnnnnnnnnnnnnn
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b : ggcccggcccccgaaaaacccca
LNG01_0073_H05.b : atattaataaataatttaaaaaatattttttaaaattaataataannttttttaatttta
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : aaactcggacggggaaaacgctactggggatttgggaagaaattaatttttgggggtgca
MLN01_0085_D11.b : taccattacttcactcataagttgtgtaaacatctcctctttgacttctctcgtaacaga
ITT01_0068_F07.b : ttgtaagaacttattctggggtggacaattggcaaccctccaaatttaagccaggaaata
ITT01_0101_A08.b : ccacttctgacgtggaaacatgcttcttgggatttttgtgaaaaacctatttctttgggt
ITT01_0058_H01.b : cgggaaacgctacctgggatttttgaaggacccttattcgggggggacaattggacaccc
ITT01_0035_E04.b : tcggacggaaaactgctcctggaatttttgagaaccttctttgggtggcaaattggcaaa
ITT01_0001_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctggaattttttaaagagactaattctgg
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : agtgtttttgggtgtttggtggggttgtgtgtgggggtggttggttttnttggtgtgttg
ITT01_0072_A05.b : aactcctgactggaaacgctaccttggatttttggaaggacctccttcgggggtgacata
CLNT1_0010_B01.b : tccccccaatttccaaaaaactttttttcgcgcctcagtgggttgtgccaaacccagggt
SPL01_0053_G08.b :
ITT01_0085_H05.b : tatacagtaagctcgcatatctctcattcctgagtggcaacatccacctcttgttttgtt
ITT01_0005_F12.b :
ITT01_0058_F02.b : agcacctctctgggtccaatttggcactcctccaaatatcctcaggaaaaaattttagta
ITT01_0006_G06.b : xxxxxxxxxxxxxxxxxxxxxaaactgcanctgggattcttgaaaggacctacttcgggg
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b : ttgtgggccgcatcgtttttttttatctttcaccgccactcatcttttacacccacatgt
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : atacctcccaatttccaataactttttttcccgctccttggggggtgacacccccaatgt
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b : tttcagataagcattttttcttgtacggtttgggtttttcaaccttcagtgctttatttt
MLN01_0014_F07.b : cttttcaactcttgacgggaaaatgcacttggaactttggaaaaccttctttggtgtgtg
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : aggaataaatttaagtaaaggtaaaaccctacttgcctgaattcctcgtttttgaaaatt
SPLT1_0022_F01.b : tatgagggcggcgtattgagcgcactgttacacttgcctatagccgcttggcactacatg
BMWN1_0005_B01.b : ctattatcaatgtcatacactcacccaatcttattaccattcactcctcctctctcattc
MLN01_0093_C04.b : nnnnnnnnnnnnnnnnnnnnn
SPLT1_0046_F09.b :
ITT01_0016_C11.b : ctttcttcgtgcgggggacatttgcgcaacaccccccacaaatattaggcctccaggcaa
ITT01_0092_C09.b : aaattttatttaaaggaaacaccccacattttgctgaattgctccagtaatttaaattac
MLN01_0024_A05.b : taagcctcggggaaataaatctttaagttaaattttaaacctcccaacttgcgcgtagat
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : cgcttgcgcggtgaattctccgatatataaaatacggccggtttttttgtttaataccgg
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : atatgttggatgtaagggcattantaaaaattggtgaagattataagggttaaatgttta
MLN01_0049_G04.b : agccctcttgttcccctcccaatt
CLNT1_0047_A01.b : tatggtggacccgggacccaccaatattccttccctccccccaaaaccgcgccggggttg
ITT01_0069_C11.b : acctttttttcggtgggggcacaaatgggccaacttccctcaaaaatttcaaatctctgg
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : ggaacgcccccacactattttctaccgaaagaaaaaaatttatttaagggagttacaccc
MLN01_0097_A12.b :
LNG01_0075_A04.b : ccattttgggaacatttctgttcctaacccaccaccgattactttgtatccccacaaaaa
UTR01_0007_E11.b :
SMG01_0070_G02.b : aatttttttttgtggggttgaacacccgctcgtcgcggggatgttttctctaaatttaaa
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b : aaaaaaatttaattaagggtaaacacccaccctggcctaaatttctttcgatatttaaaa
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b : ttttaatttggtttttaannnnnaggntttaggnntntnnnnggttgataaaaanaattg
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b : nnnnnnnnnnnnnnnnnnnnnnn
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b : ataatatnaaaaaatataaataaaaattaaataaaataatnattattnnaaaatattaaa
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : acttggcaaatcaatcacaaattaaacccccggaaaaaaatatttaggtataggtggaaa
MLN01_0085_D11.b : ccctatctttcttctgggacataattttg
ITT01_0068_F07.b : aattttatggaaagggtaaaacccctagtcggccttgaattgtcttggtattttgaaata
ITT01_0101_A08.b : ggccattgtgaaaaaccctcctcaagatttggcctcggagaaaaaaattttttatggtaa
ITT01_0058_H01.b : cccccagatttaagctccaggaaaaaaattcaagtggaagggtaaaccccccaagccgcc
ITT01_0035_E04.b : attctccaaattaactccggggaaaaaaattttaggcaaggtataaacacctatcttgtc
ITT01_0001_C08.b : gtgggacaaattggacacctccctcaaaaattaagccctagggaaaaaaaatttttaagg
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : ttttgtgttntgtttttgtggtgttgttagntgtgttnttggtttagtgtttgtgtttgt
ITT01_0072_A05.b : tggccaactccccaaaaattaggcccagggaaattaaattttagaggaaaggggtacaac
CLNT1_0010_B01.b : tcttttatttgggacccggaaccactcaatatttctctcccctccc
SPL01_0053_G08.b :
ITT01_0085_H05.b : ttcaagaataaattcttgtgtggatgattcttgcaactcccacttacattcatttctcga
ITT01_0005_F12.b :
ITT01_0058_F02.b : aagggaaccctccattctccggaattttctgcaattctaatatccccgccggttcctttt
ITT01_0006_G06.b : gtggcatattgacaaatcctccgagttaaggcccaggaaaaaaaattttaaggaaaggtt
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b : gcttcttttatatcccccccatgcggcgtgggttgtttttctcaacacgaacaatatcac
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : tttatgtgggacccgggaacaaccaattatccctcctttcctcaaataaacggcctgttt
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b : tggttccctgtctcgttacgtatattctttgcttatagagagaatcttcgctaaattcgc
MLN01_0014_F07.b : ctattgggaaacccccaaaagattaagcccagggaattaaatttagggtagtggtaacac
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : ccgggcggttcttttggtttttcccccgctttgcccccccccttttttaccccccttaag
SPLT1_0022_F01.b : ttatttgcgacgcaagaatgtctccggccgcggcccggccggtgattacgctaagcgcgn
BMWN1_0005_B01.b : tacctttattacacaactattcattagtgtacctatttaacgacgatagtatgacacata
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b : aataaacttctccgtaccaggggcccc
ITT01_0092_C09.b : cgggagcgattttttttgtttaatcagcagataatatgcctctcctgtgataaatccaac
MLN01_0024_A05.b : tttcttctgaattattaaaattttccgggcggggtttatgtttgttttttatctcccgcg
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : gtttggccccccctttgaacccctttggtttttaacccccccaaaagattggtgttattg
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b : taatttaaatttttacttcggggtcgttt
MLN01_0049_G04.b :
CLNT1_0047_A01.b : ggggggggtttctcccgggggtattttcccaacgggaaccgaaaattttaacca
ITT01_0069_C11.b : ggaaaattaaatttttaagaggataaggttgtaaacacccctctagacgtgtcttttaaa
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : ccccgcctaccccggaaattgtcgtcacaagtaaaagaaaaaccaacaccccctgtgttg
MLN01_0097_A12.b :
LNG01_0075_A04.b : atatgtacactccttgcttttgagaaaaacaaaaaacgatgtntttttatccgtgtcccc
UTR01_0007_E11.b :
SMG01_0070_G02.b : aaaaaccaccggggttttttttgttttttattcccccccct
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b : ttccccgggggttttttttgttttaatccaccaggttttgccccccaccttttttaaata
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b : tggttttttaaancccccccgcaat
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b : taattaataatatataantatattnaattaaatttaatttttataccatttatataaaac
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b : aaccctcagccgtgcgtgaaattttcttacaaaaaa
MLN01_0085_D11.b :
ITT01_0068_F07.b : tcccgggcggttttttttgtttttttaacccagtttgcgcccccccggtttataaaccaa
ITT01_0101_A08.b : tggtgaacacccctcctcctggtgcccgaattttttctgcgatattataaaaaaatcccg
ITT01_0058_H01.b : ctgaaatttctctccggataattgaaaattcacagggcggggtttcctttgtgttttata
ITT01_0035_E04.b : ttaaattcttccgcttttctaaaatcacccgcgtgtgttttttttgtttaattaaccagg
ITT01_0001_C08.b : gtaaaggtgtaacacccccaagctgggcgctagaatttgtttcagaatgaattaaaaa
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : tgttattgtgntgttggtttgtatttttatatatatgaatgtatgttattataatgttaa
ITT01_0072_A05.b : gccatgcctggcctggaatttcttccggattattttaaaatttcccgggcctgttttttg
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b : tacatatccgattcctacgacatgtgtactcacatccatttctctactgttctcttttct
ITT01_0005_F12.b :
ITT01_0058_F02.b : gattaaagtcggtttggcccccccccgttgtaatccccttgaattttttaccccctacaa
ITT01_0006_G06.b : aacaacgccaacctcgcctaaaatttcttcggtgaatttgaaatttccggggcggttttt
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b : ccttctcttcctatcttttgatgatngatctataatcttaaccactcctgcctccttact
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : tgggggggggttacctcccaggggtaattttcccacagggaacatgaaaatgttaagggc
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b : gcgctgtgtactcttctcgtcgtagattgtactcttctgagatatgcatataattggtac
MLN01_0014_F07.b : cccaacctggcttagatttgtttactgttttgaaatttccgggcctggttattttggttt
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : ttttttacccccccccaaaaaaatgtgttttttttgaaaaacaaaaatttcttggccaat
SPLT1_0022_F01.b : gtcctgtttgggcacgg
BMWN1_0005_B01.b : tatatacctactctacagtcgctcactcatacactgaacaacttactttcttatatataa
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b : ttagattcttttacacccccccgacaaacagctgtttttttccatgcaacactctatc
MLN01_0024_A05.b : ttttgcgccttacctacttttttataaaacct
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : aaaacataaattctgttacattggttannnnntnnncccggactgctctctctaaaagaa
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b : attttttcacgaaaaataatataa
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : tttttgttttaataaacaaagtgttgtgcccccctctctggttgtataaacgacaattga
MLN01_0097_A12.b :
LNG01_0075_A04.b : atctgaaacactgatgtnnngcggnnnnntnnatcnacacnnaaaaannnaaaataacat
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b : aaccactttgttttttgttcaccccccccccaaaaaaaagttgttattttctatgtaaaa
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b : attatattatttatataaaanatatattatccaccatttt
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b : ttaggtttgttaaccccccccccaaaaaaagtgtttttatttgaaaaaacaaaaatatct
ITT01_0101_A08.b : agccggcttttttgttggttt
ITT01_0058_H01.b : taccccgggtttttgccccctcccaggtgtaaaaccccc
ITT01_0035_E04.b : ctttgccctctctcagctataaacacacccttggattttctaaacccctcccgaa
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : aaagtaatgaatgaaatttattatagataaaataattttatgtagtattataaatatatg
ITT01_0072_A05.b : ttgtggttatataaagccgggcttttggccctcnccccgggtgtttaaaaacaccacctt
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b : gactacactgtcaagtcactatcgccatcactgctcgttaatctg
ITT01_0005_F12.b :
ITT01_0058_F02.b : aagtgtttttngttgcaancttaaatttttttcctccggaaagggctaccccccgccgct
ITT01_0006_G06.b : tgttggtttaaatacccgggttttgcccctctcct
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b : cttgtagcctccatccgcgacatcatcccaacct
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b : aagggaataagacggttgtttttccccccctaca
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b : tctatggtagtgagagagctgtgtctcttgttccctgatacatgaacttcaaggtaccct
MLN01_0014_F07.b : tttcatccaggtttggcctaccccactttgttatacccacatttggtttgtatacccccc
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : ttgctaaanggggtgnnnnnnnnnnnctcttaccctctttgtatcactaannnnnggaag
SPLT1_0022_F01.b :
BMWN1_0005_B01.b : cttctatataattccatctctactgcactcgctgcttgttatatactatcacctttatac
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : aagnnnnnnnnnnnnnnnnnnnnnnnnnngaaaaatatttcgcacatgatgtgnnnnnnn
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b : gttagtttttaacaccccccccccgaaat
MLN01_0097_A12.b :
LNG01_0075_A04.b : actcacctctcttctacnataccac
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b : aaaaaaaaaaatttcttgtggagacaaggaggacgt
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b : tttgacactagggga
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b : ttttattattattatattatttagaattttagattaagtatttctcttctgtt
ITT01_0072_A05.b : ggatgttttca
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b : cccc
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b : gttacagctcccctacccctg
MLN01_0014_F07.b : cccgcaaaaaagttgtttttttttagtaaaaacaaaaaatttcttggtccaaatttgaat
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b : nnnnnnnng
SPLT1_0022_F01.b :
BMWN1_0005_B01.b : tcaccactcn
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b : aaacagcgggggacacctctnaacctggtaccctttctcttatattctntacancnnntn
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b :
SPLT1_0022_F01.b :
BMWN1_0005_B01.b :
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b : nnnnnnnnnnnnnnnn
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b : aannnnnnnnnnnntattagaacgccttcntantttnntnnnnnnctnctcatnnantct
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b :
SPLT1_0022_F01.b :
BMWN1_0005_B01.b :
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b :
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b : atcaatatcataataccatatactccctataatttcattactatatattattcnacttta
20110601C-000985 : ............................................................
---------+---------+---------+---------+---------+---------+ 1129
OVR01_0088_D09.b :
UTR01_0034_C04.b :
LNG01_0106_E01.b :
SPLT1_0022_F01.b :
BMWN1_0005_B01.b :
MLN01_0093_C04.b :
SPLT1_0046_F09.b :
ITT01_0016_C11.b :
ITT01_0092_C09.b :
MLN01_0024_A05.b :
UTR01_0040_F10.b :
SPLT1_0066_A07.b :
MLN01_0012_H06.b :
MLN01_0049_D09.b :
UTR01_0095_C04.b :
SPLT1_0038_D11.b :
BMWN1_0034_G06.b :
MLN01_0049_G04.b :
CLNT1_0047_A01.b :
ITT01_0069_C11.b :
LVRM1_0194_D04.b :
OVRM1_0213_G03.b :
PTG01_0066_C04.b :
MLN01_0097_A12.b :
LNG01_0075_A04.b :
UTR01_0007_E11.b :
SMG01_0070_G02.b :
ITT01_0006_E06.b :
UTR01_0006_C09.b :
ITT01_0062_A11.b :
UTR01_0106_F10.b :
PTG01_0061_A02.b :
ITT01_0081_A11.b :
TCH01_0102_G12.b :
ITT01_0031_E12.b :
MLN01_0044_B03.b :
SMG01_0091_B05.b :
MLN01_0092_D02.b :
MLN01_0031_B10.b :
MLN01_0090_H01.b :
UTR01_0005_C09.b :
MLN01_0020_B03.b :
UTR01_0040_F05.b :
MLN01_0057_A01.b :
LNG01_0073_H05.b :
UTR01_0103_D03.b :
UTR01_0004_F06.b :
UTR01_0017_E10.b :
ITT01_0088_F11.b :
MLN01_0085_D11.b :
ITT01_0068_F07.b :
ITT01_0101_A08.b :
ITT01_0058_H01.b :
ITT01_0035_E04.b :
ITT01_0001_C08.b :
UTR01_0043_G12.b :
UTR01_0083_C07.b :
OVRM1_0206_B01.b :
ITT01_0089_E04.b :
ITT01_0072_A05.b :
CLNT1_0010_B01.b :
SPL01_0053_G08.b :
ITT01_0085_H05.b :
ITT01_0005_F12.b :
ITT01_0058_F02.b :
ITT01_0006_G06.b :
UTR01_0051_H11.b :
SKNB1_0020_C01.b :
BMWN1_0018_E09.b :
ITT01_0103_A02.b :
UTR01_0004_C06.b :
UTR01_0022_D02.b :
CLNT1_0098_B03.b :
SKNB1_0023_H08.b :
CBLT1_0050_H11.b :
KDN01_0047_E01.b :
MLN01_0014_F07.b : tgataaagtgtt